Overview Tropical Diseases 15 I Tae

An Overview of Tropical Diseases
Edited by Amidou Samie

Edited by Amidou Samie
Stole src from http://avxhome.se/blogs/exLib/

Published by AvE4EvA
Copyright 2015
All chapters are Open Access distributed under the Creative Commons Attribution 3.0
license, which allows users to download, copy and build upon published articles even for
commercial purposes, as long as the author and publisher are properly credited, which
ensures maximum dissemination and a wider impact of our publications. After this work
has been published, authors have the right to republish it, in whole or part, in
any publication of which they are the author, and to make other personal use of the
work. Any republication, referencing or personal use of the work must explicitly identify
the original source.
As for readers, this license allows users to download, copy and build upon published
chapters even for commercial purposes, as long as the author and publisher are properly
credited, which ensures maximum dissemination and a wider impact of our publications.
Notice
Statements and opinions expressed in the chapters are these of the individual contributors
and not necessarily those of the editors or publisher. No responsibility is accepted for the
accuracy of information contained in the published chapters. The publisher assumes no
responsibility for any damage or injury to persons or property arising out of the use of any
materials, instructions, methods or ideas contained in the book.
Publishing Process Manager
Technical Editor
AvE4EvA MuViMix Records
Cover Designer
Published December 12, 2015

ISBN-10 : 953-51-2224-X
ISBN-13: 978-953-51-2224-1
ExLib: avxhome.se/blogs/exLib
Contents
Preface
Chapter 1 Emerging Public Health Issues in Drug-Resistant

Tuberculosis
by Adeola Orogade
Chapter 2 Mitochondria of Malaria Parasites as a Drug Target
by Kenji Hikosaka, Keisuke Komatsuya, Shigeo Suzuki and
Kiyoshi Kita
Chapter 3 Recent Advances in Antimalarial Drug Discovery
Challenges and Opportunities
by Chiranjeev Sharma and Satish Kumar Awasthi
Chapter 4 Advances on Dientamoeba fragilis Infections
by Ali ElBakri, Ahmed Al-Qahtani and Amidou Samie
Chapter 5 Speciation in the Leishmania guyanensis Vector Lutzomyia
umbratilis (Diptera: Psychodidae) from Northern Brazil Implications
for Epidemiology and Vector Control
by Vera Margarete Scarpassa and Ronildo Baiatone Alencar
Chapter 6 Dirofilariosis and Leishmaniasis in the Northern Region of
Serbia
by Sara Savic, Branka Vidic, Zivoslav Grgic, Tamas Petrovic,
Alekasandar Potkonjak, Aleksandra Cupina, Slavica Vaselek and
Dusan Petric
Chapter 7 Schistosomiasis Updating Technologies and Diagnostic
Approaches in Surveillance Strategies and Clinical Management
by Marta Guimares Cavalcanti and Jos Mauro Peralta
VI
Contents
Chapter 8 Praziquantel and Arachidonic Acid Combination An

Innovative Approach to the Treatment of Schistosomiasis
by Hatem Tallima, Kevin Hadley and Rashika El Ridi
Chapter 9 The Role of Chiggers as Human Pathogens
by Paula Santibez, Ana M. Palomar, Arnzazu Portillo, Sonia
Santibez and Jos A. Oteo
Preface
Tropical diseases affect millions of people throughout the world
and particularly in the developing countries. The millennium
development goals had specifically targeted HIV/AIDS and
Malaria for substantial reduction as well as Tuberculosis while
many other tropical diseases have been neglected. The new
sustainable development goals have not made such distinction
and have targeted all diseases for elimination for the
improvement of the quality of life of human beings on earth.
The present book was developed to provide an update on issues
relevant to the treatment of selected tropical diseases such as
tuberculosis, malaria, leishmaniasis, schistosomiasis and
ectoparasites such as chiggers which are widely distributed
throughout the world.
The control of these infections has been hampered by the
development of drug resistance and the lack of the development
of new and more effective drugs. The understanding of the
biochemical processes underlying drug activity is therefore
essential for the potential elimination of these infections.
Chapter 1
Emerging Public Health Issues in Drug-Resistant

Tuberculosis
Adeola Orogade
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/61269
Abstract
Drug Resistance is a major challenge in the control of Tuberculosis which itself re
mains a global public health problem. Resistance is commonly encountered as MDR
TB but a subset, XDR TB which has about a comparatively fivefold increase in mortal
ity is now identified in 84 countries worldwide and increasing rates are currently re
ported from 65 countries. The actual burden of MDR TB is unknown though estimates
have been made based on notification of cases which are usually underreported. More
so there is under diagnosis in non HIV immune suppressed adults and pediatric pop
ulations largely due to lack of readily accessible diagnostic tools. In some case series,
MDR TB has been found occurring mostly in newly diagnosed patients or relapse cas
es after previous cure and completion of treatment rather than in patients with im
properly treated disease. Clinical and laboratory monitoring once therapy has been
instituted have also been a daunting task both from institutional and patient points of
view. The impact of these factors are highlighted and discussed as the world moves
towards attainment of the 2015 global target to halve TB prevalence and death rates
within the context of Millennium Development Goals (MDGs).
Keywords: Tuberculosis, Drug Resistant, Public Health
1. Introduction
The man who moves a mountain begins by carrying away small stones Confucius.
Drug resistance is a major challenge in the control of Tuberculosis (TB), which itself remains
a global public health problem. Resistance is commonly encountered as Multidrug-Resistant
Tuberculosis (MDR TB), but a subset, Extensively Drug-Resistant Tuberculosis (XDR TB),
which has about a comparatively fivefold increase in mortality, is now identified in 84
countries worldwide and increasing rates are currently reported from 65 countries. The World
Percentage
of cases
0-2.9
3-5.9
6-11.9
12-17.9
18
No data
Not applicable
Subnational data only
Figures
are based on the most recent year for which data have been reported, which variesamong countries.
Figuresarebasedonthemostrecentyearforwhichdatahavebeenreported,whichvaries
amongcountries.
Figure 1 Percentage of new TB cases with MDR-TB (Adapted from WHO Global TB Report, 2014)
Figure 1. Percentage of new TB cases with MDR-TB (Adapted from WHO Global TB Report, 2014)
Health Organization (WHO) has designated 22 countries of the world as high-burden countries
for Tuberculosis (HBCTB) and 27 as high-burden countries for multidrug-resistant Tubercu
losis (HBC MDR TB), making a total of 36 countries in either of these categories [1]. The latter
are countries where at least 4,000 cases of MDR TB are identified per year and/or at least 10%
of newly registered TB cases are MDR TB.
MDR TB and XDR TB epidemics are largely driven by transmission and are mainly found in
new cases and patients with TB relapse [2]. Since 1994, WHO has been receiving and analyzing
data on anti-TB drug resistance from countries via its Drug Resistance Surveillance Project,
which depends on continuous data based on rapid molecular diagnostics and drug sensitivity
testing (DST). However, neither is widely or routinely available due to prohibitive costs
involved, especially in low- and middle-income economiesPercentage
that
are also high-burden countries.
of cases
0-2.9of MDR TB are identified
In these low- and middle-income high TB burden countries, cases
3-5.9
mainly through special surveys rather than continuous surveillance
6-11.9 reporting. In 2013, only
12-17.9
11 of the 36 HBCTB/HBC MDRTB had up-to-date data through these
18 drug-resistance surveys.
data
From these surveys it is clearly understood that the MDR TBNoburdens
attributed to these
Notin
applicable
countries are only estimates based on notification of cases which
most countries is incom
plete and as such may only be the tip of the iceberg (Figures 1 & 2).
.
Percentages of previously treated TB cases with MDR-TB in Bahrain,
Despite
theseIsrael,
shortfalls
the determination
exact
incidences,
Bonaire,
SaintinEustatius
and Saba,ofand
Sao
Tom andespecially
Principe where TB burden
refer to there
only ahave
smallbeen
number
of notified
1-8 notified
is highest,
recent
global cases
efforts(range:
to bridge
the gappreviously
between diagnosis and
treated TB cases).
appropriate therapy with second- and third-line drugs. Treatment after diagnosis of MDR TB
2. Percentage
of previously
treated TB
cases with
(Adapted
WHO
Global TB
andFigure
follow-up
of confirmed
cases is however
bedeviled
withMDR-TB
unavailability
of from
human
resour
Report,
2014)
ces, accessibility to second-line drugs in high MDR TB areas, and logistics. Global treatment
Not applicable
Figures are based on the most recent year for which data have been reported, which varies
among countries.
Emerging Public Health Issues in Drug-Resistant Tuberculosis 3
Figure 1 Percentage of new TB cases with MDR-TB (Adapted from
WHO Global TB Report, 2014)
http://dx.doi.org/10.5772/61269
Percentage
of cases
0-2.9
3-5.9
6-11.9
12-17.9
18
No data
Not applicable
Percentages of previously treated TB cases with MDRTB in Bahrain, Bonaire, Israel, Saint Eustatius and Saba, and Sao
PercentagesofpreviouslytreatedTBcaseswithMDRTBinBahrain,
Tom
and Principe refer to only a small number of notified cases (range: 18 notified previously treated TB cases).
Bonaire,Israel,SaintEustatiusandSaba,andSaoTomandPrinciperefer
toonlyasmallnumberofnotifiedcases(range:18notifiedpreviously
treatedTBcases).
Figure 2. Percentage of previously treated TB cases with MDR-TB (Adapted from WHO Global TB Report, 2014)
Figure
2. Percentage
ofbut
previously
TB cases
MDR-TB
(Adapted
from
WHO Global TB
targets
have
not been met.
there aretreated
concerted
effortswith
to achieve
them
through
restructuring
Report, 2014)
of programs
and Programmatic Management of Drug-Resistant TB (PMDT).
The key to overcoming MDR TB and XDR TB will eventually lie in the balance between prompt
diagnosis and treatment of cases on one hand and prevention of transmission of drug-resistant
bacilli to vulnerable populations with whom they are in contact on the other. Particular
attention needs to be given to unrecognized groups: the pediatric patients in whom a high
degree of clinical skill must be displayed to ensure prompt laboratory diagnosis and the health
care workers whose infection can be prevented through deliberate control methods.
2. Epidemiology of MDR TB
It is estimated that more than 90% of new TB cases and death occur in the high TB burden
developing countries [3]. Multidrug anti-tuberculous therapy had been found effective when
using the Directly Observed Therapy Short Course (DOTS) strategy to improve compliance to
treatment of TB. With the emergence of MDR TB, the DOTS strategy was expanded to
accommodate second-line drugs in the Directly Observed Therapy short course with MDR
diagnosis, management, and treatment (DOTS PLUS) strategy. Treatment failure, however,
can still occur leading to relapse and development of drug-resistant TB strains to second-line
drugs which is the XDR TB [4].
Multidrug-resistant Tuberculosis (MDR TB) is defined as resistance to at least both Isoniazid
and Rifampicin with or without resistance to other first-line drugs. [5]. A subset of this is
Extensively Drug-Resistant Tuberculosis (XDR TB) where there is also resistance to fluoro
quinolones and at least one injectable second-line drug (such as Amikacin, Kanamycin, or
Capreomycin) in addition [6]. XDR TB was first noted in the late 1980s and 1990s and reported
by WHO and Center for Disease Control (CDC), USA, in 2004.
In a survey of some of their National Reference laboratories, it was observed that 20% of
resistant strains tested were MDR TB, while 10% were XDR TB. Asia and Eastern Europe had
the highest rates [7]. From recent reports, about 60% of the global burden of Multidrug-resistant
TB is in China, India and Russia occurring in 3.7% of new TB cases (CI: 2.1-5.2%) and 20% of
previously treated TB cases (CI:13-26%). In countries where there are data available, 9% of
MDRTB cases have XDR (CI: 6.7-11.2%) and 14.5% have fluoroquinolone resistance (CI:
11.6-17.4%) [8].
According to the WHO, Eastern Europes rates of MDR TB are the highest and MDR TB makes
up to 20% of all new TB cases, while in The Union State, it accounts for 28% of new TB cases.
In Africa, reports of MDR TB based on continuous surveillance as in South Africa [9] show
progressively increasing MDR rates despite overall decreasing numbers of TB cases. This is
attributed to improved notification through laboratory surveillance. In developing countries
with limited access to TB drug sensitivity tests, prevalence of MDR TB is dependent on special
national surveys [1] and hospital-based clinical researches as in Nigeria [10-18]. Most of the
hospital-based reports in Nigeria indicate that there is some level of MDR TB, which though
not documented on a regular basis show progressive increase over time. This case scenario
plays out in other developing countries where continuous surveillance or monitoring of MDR
TB is not available. In Nigeria, as well as in other high-burden countries such as South Africa
and India, it has been noted that the increasing TB prevalence may be driven by HIV coinfection
[19]. Most of these reports are, however, based on testing of adult populations.
Pediatric MDR TB has been majorly underreported in continuous surveillance and special
surveys. However, in some countries like South Africa, some modest efforts have been made
to document and monitor progress of disease in these populations. A recent meta-analysis [20]
of WHO data between 1994 and 2011, testing associations between MDR TB and age groups
<15 years, and those >15 years, revealed that MDR TB was positively associated with age
<15years in Germany, Namibia, South Africa, UK, and USA. The data also revealed that similar
proportions of children and adults were diagnosed with MDR TB in many settings. HIV
coinfection was found to be in close association with pediatric MDR TB in South Africa
invariably due to the high prevalence of HIV in this area.
2.1. Genesis of MDR TB
Drug-resistant TB has microbial, clinical, and programmatic causes [21]. It manifests when
there is a selective growth of resistant mutants among the actively multiplying bacillary
population in the presence of drugs, thus making the drug ineffective against mutant bacilli.
Microbiologically, the emergence of drug resistance depends upon the frequency of drugresistant mutants in the susceptible bacillary population, the size of the actively multiplying
bacillary population in the lesions, and the antimicrobial quality of the drugs used [22]. The
Emerging Public Health Issues in Drug-Resistant Tuberculosis

http://dx.doi.org/10.5772/61269
frequency of spontaneous mutations that can be developed to each drug are believed to be of
the following magnitude: Streptomycin 1 in 106, Isoniazid 1 in 106, Rifampicin 1 in 108,
Ethambutol 1 in 107, Pyrazinamide 1 in 106, Fluoroquinolones 1 in 106-8 [23]. When these drugresistant mutants occur in large bacterial population, they have a tendency to further multiply
depending on the corresponding clinical treatment regimen the patient receives. This varies
from one program to the other and will depend on what drugs are available to a treatment
program and the ease of access the patients have to these drugs.
Administered therapy may be inadequate in the following instances: monotherapy, poor
adherence to treatment protocols, erratic or even interrupted treatment, or low drug quality.
When there is inadequate treatment, resistance develops because bacilli with drug-resistant
mutation proliferate and become the dominant strain in the infected individual. Inadequate
treatment of susceptible TB can lead to drug resistance to first-line drugs (MDR TB), which is
a marker of a failing susceptible TB treatment program. Likewise, inadequate treatment of
MDR TB will lead to drug resistance to second-line drugs (XDR TB), which is a marker of failing
MDR TB treatment programs.
Drug resistance of the Mycobacterium tuberculosis isolated from patients may be categorized
based on length of previous anti-TB drug therapy they had received prior to the diagnosis of
resistance. Acquired drug resistance is described in those who have been inadequately treated
for 1 month or more; Relapse in cases previously completed treatment and reported cured;
while that of patients who have never been treated previously or treated for less than 1 month
is called Primary drug resistance or resistance in new case. The patients grouped as relapse or
as new infections which are found to be drug resistant are grouped together as transmission
cases; 82% of MDR TB are reported to be transmission cases. The other 18% are acquired cases,
which are mostly adult populations. The acquired cases provoke and sustain MDR TB
epidemics in both developed and undeveloped countries [24].
2.2. Epidemics of MDR TB
During the late 1980s and early 1990s, epidemics of MDR TB occurred in North America and
Europe killing about 80% of those who were infected. Today, the greatest number of cases is
in India and China [25-26], although smaller epidemics have been described due to migrations
[27]. The convergence of the following were believed to precipitate MDR TB epidemics
especially that of XDR TB: High TB burden, high HIV prevalence, suboptimal TB control
practices, and introduction of second-line TB drugs into low- and middle-income countries
[28-29]. Among the pediatric age group, there is global paucity of data on MDR TB epidemics.
Most data obtained have been reported from South Africa [30]. Some of the identical issues
that were identified in all these epidemics were that there was delayed diagnosis of MDR TB
cases for over 6 weeks to 6 months due in turn to delayed turnaround time for mycobacterial
culture and DST. This invariably led to very high mortality rates which first called attention
to the need for DST. In the XDR TB epidemic reported in South Africa [29], there was promi
nence of associated HIV coinfection in most patients who were transmission cases. Another
feature was poor observance of infection control precautions such as: inadequate patient
isolation and airflow regulation within wards, which made the wards conducive for trans
mission between patients in contact with MDR TB cases. There was also notable direct
transmission from patients to health care workers, which was evident by Tuberculin Skin Test
(TST) conversion as well as later linkage mappings that correlated the strains in the patients
samples with those of the health workers [29].
2.3. Implications of transmission versus acquired cases
In the high-burden countries, there are reportedly 20-35.2% of new cases and 54-62% of relapse
cases that develop MDR TB, accounting for 82% of all incidences of MDR TB [1]. Thus, high
burdens of MDRTB and XDR TB are eventually perpetuated from direct transmission within
communities. In cases where TBHIV coinfections are also prevalent, this significantly favors
direct transmissibility [31]. Direct transmission is therefore the most common way drugresistant TB is spread and this must be stemmed to arrest the imminent global health threat
from TB.
3. MDR TB diagnosis: Clinical versus laboratory methods

Bacteriological confirmation of TB and Drug sensitivity Testing (DST) of patients presenting
with clinical features of Tuberculosis is targeted as universal standard for patient care in TB
[1]. When this is incorporated into routine clinical care package and results are available for
periodic analysis, it forms a strong database for information about drug resistance in that area.
3.1. Clinical criteria
WHO global TB report [1] revealed that only 2.8 million (58%) of the 4.9 million incident
pulmonary TB patients notified in 2013 were bacteriologically confirmed (smear- or culturepositive according to a WHO-recommended rapid diagnostic such as Xpert MTB/RIF). The
remaining 42% notifications were diagnosed clinically (symptoms, signs, chest X-ray abnor
malities, or suggestive histology). Notifications of new cases are mainly from the high-burden
countries, majority of which are low- and middle-income economies. Their capacity for
confirmatory testing and DST is limited. Although almost half of notified global TB diagnosis
is by clinical methods, this form of diagnosis is attended by poor specificity and false-positive
diagnosis. Low laboratory rates, on the other hand, may suggest underdiagnosis of true TB
cases and contribute to the gap noticed between notified and estimated incident TB cases [1].
The need for skilled health care workers who can make presumptive diagnosis to improve
notification while laboratory methods are being scaled-up, especially in the high-burden
countries cannot be overemphasized.
However, the drawback of clinical criteria alone to make a diagnosis in MDR TB is obvious.
Detection of TB without investigating drug sensitivity potentially can lead to inadequate
treatment and this could lead to spread of MDR TB.

http://dx.doi.org/10.5772/61269
3.2. Laboratory diagnosis Screening and confirmatory tools

The field of TB diagnosis has been dynamic, changing constantly with the new challenges
posed by the bacilli: from being fully susceptible to multidrug therapy to the appearance of
MDR TB and now XDR TB. Whereas the need to have accurate bacteriological diagnosis and
appropriate drug sensitivity has not changed, the tools to achieve these have continued to
evolve as newer and hopefully equally or more effective diagnostic technologies are devel
oped. Diagnosis of MDR TB requires culture to confirm TB and drug susceptibility testing or
molecular testing. The challenges faced in achieving these include:
Laboratory challenges with technical capacity, biosafety, cost, slow growth
Patient challenges in access to adequately testing facilities communication, transportation
of specimen, and reporting remain critical to success
Policy challenges in who should be tested and when to test given limited public health
resources
Increasingly, molecular technologies are being incorporated into drug resistance surveys to
simplify logistics. By 2009, the EXPAND TB (Expanding Access to New Diagnostics for TB)
was launched to accelerate access of MDR TB high-risk populations in high TB burden
countries to sophisticated but rapid diagnostic molecular techniques and provide laboratory
services. The 27 high MDR TB burden countries were equipped with 97 new or refurbished
laboratories and line probe assays (DNA strip test that allows simultaneous molecular
identification of TB and the most common genetic mutations causing resistance to Rifampicin
and Isoniazid) in reference laboratories which can diagnose MDR TB in two days. By December
2010, the WHO issued a policy on the use of another molecular diagnostic test Xpert MTB/RIF
as an initial diagnostic test for cases at risk of MDR TB with negative sputum. The Xpert test,
a cartridge-based automated diagnostic test that can identify Mycobacterium tuberculosis
DNA and resistance to Rifampicin by nucleic acid amplification technique was a sputum only
test for pulmonary TB [32].
A review of WHO policy followed in 2013 that Xpert MTB/RIF should be used rather than
conventional microscopy, culture, and DST as the initial diagnostic test in adults and children
suspected of having MDR TB or HIV associated TB. It may be used for diagnosis of drugsusceptible TB, smear-negative individuals and cases of extra-pulmonary TB testing using
non-respiratory specimens such as lymph nodes. By the end of June 2014, 108 countries had
benefitted from procurement of Gene Xpert machines. GenoType MTBDRplus (Hain
Lifescience, Germany) was used in the national survey completed in 2012 in Nigeria and is
currently being used in the national survey in Sudan. In Pakistan, Xpert MTB/RIF (Cepheid
USA) identified additional cases missed by culture in the national survey completed in 2014.
In ongoing surveys in Papua New Guinea and Senegal, Xpert MTB/RIF is being used to screen
specimens for rifampicin resistance and identify those requiring further testing at national or
supranational TB reference laboratories. Surveys planned in 20142015 in Cte dIvoire, the
Democratic Republic of the Congo, Indonesia, and Zimbabwe will adopt the same testing
algorithm [1].
This approach greatly reduces the workload for laboratories and decreases the cost of national
surveys. It may also result in the detection of cases that would otherwise have been missed by
culture and conventional DST, particularly in settings with delays in transporting sputum
samples to laboratories for testing. Although not a complete surrogate for MDR-TB, particu
larly in settings where levels of drug resistance are low, rifampicin resistance is the most
important indicator of MDR-TB and has serious clinical implications for affected patients.
It is noteworthy that the supply of these technologically advanced diagnostics though now in
more countries cannot serve the total at-risk populations, because these machines are kept
strategically in reference laboratories. There is a critical need to develop within each country
a framework that would address the accessibility to reference centers. In the Western Pacific
and Eastern Mediterranean regions, it is reported that there was less than one reference center
per 100,000 population. In Nigeria, a high TB burden country and the fourth highest African
country with MDR TB, there are only 9 reference centers which are inadequate for the whole
at-risk population of 170 million.
There is therefore need in the high TB burden areas to still supplement the recent high-tech
diagnostic tools with sputum smear microscopy as an initial screening tool and as such be
placed in such a way that these can be accessible to all. Improvements in microscopy using
fluorescent light emitting diode microscopy, which is more sensitive than light microscopy,
has been proposed and adopted in South Africa, and less so in Mozambique, Bangladesh, and
Nigeria [1].
The other aspect that needs careful attention in laboratory diagnosis is the need for regular
quality assurance of the machines. Likewise, regular capacity training for laboratory personnel
to ensure optimal standards of diagnosis and DST Xpert MT/RIF Newer areas of research for
improved diagnostics is the research for correlates of protective immunity and host biomarkers
of TB that could help determine the potential for susceptibility or protection [33].
4. Unrecognised MDR TB populations

4.1. Pediatric MDR TB
Pediatric TB diagnosis has also been largely based on clinical criteria due to the pauci bacillary
nature of their disease [3, 34-36]. In the cases of TB HIV coinfection, the diagnosis of TB disease
is usually more difficult because the symptom specificity is reduced due to similarity with
chronic HIV-related symptoms, and chest radiograph interpretation is complicated by HIVrelated comorbidity and atypical disease presentation. In this case, diagnosis involves linking
the child with an adult with confirmed pulmonary TB [37]. However, older children producing
sputum can have bacteriological confirmation and where facilities are accessible DST is
performed [8]. To date, there is still widespread under-diagnosis of MDR TB in younger
children. Children are less likely than adults to acquire MDR TB during treatment due to the
lower bacillary load and less-frequent cavity formation [38]. Acquisition of strains of MDR TB
through primary transmission has been shown to be same for children as for adults [39].

http://dx.doi.org/10.5772/61269
The implication of this is that with increasing adult MDR TB in populations, there would be
increasing incidences of pediatric MDR TB. Once a diagnosis of TB is made, MDR TB should
be carefully considered by review of household source cases for drug-resistant disease [40].
Child contacts of adults with coinfection of TB HIV should particularly be screened for MDR
TB. The recent efforts to improve on MDR diagnostic tests using non-respiratory specimens
should be harnessed for the pediatric age populations so that rapid diagnostic tests become
the first-line diagnostic tool for pediatric MDR TB. Outcomes of MDR TB in children depend
on prompt diagnosis and initiation of appropriate therapy for drug-resistant strain [41].
5. Challenges in MDR TB therapy

The Global target of MDR TB treatment is to achieve 75% treatment success by 2015. To achieve
success in treatment programs, WHO has published a document which contains the guide to
Programmatic Management of Drug-resistant TB (PMDT) which covers all key policies in
MDR TB care and control. The numbers of cases treated are usually reported in cohorts that
commence therapy within a certain year. In this way it is hoped that treatment outcomes would
be clearly understood and modifications where necessary would be implemented. WHO [1]
reports increasing numbers of cases enrolled into treatment programs for MDR TB and XDR
TB of 47% from 2010 to 2013. In specific terms, however, this increase has been achieved mainly
in low TB burden countries. The issue of inadequate notification from weak reporting systems
in most high-burden countries is also thought to contribute to only a modest increase despite
all efforts made at increasing treatment coverage. Notification still plays a crucial part in the
monitoring of treatment outcomes. This depends on systematic record collection, storage, and
retrieval by electronic means. All these processes are not uniformly accessible in all parts of
the same country and also differ significantly from country to country. Adequately trained
personnel to manage this process is crucial and a vital gap.
The treatment target of 75% success outcome has only been reached by 29 out of 126 countries
that have reported outcome. Only five of the 27 MDR TB high-burden countries have reached
70% treatment successes (Figure 3). The success recorded in high-burden countries is closely
related to the implementation of EXPAND TB project and the scale-up of PMDT in these
countries. The identified gaps to achieving treatment include unavailability of second-line TB
drugs whose costs are prohibitive in many high-burden countries. This requires substantial
financial and health care resources [42]. To ameliorate this, the Global Fund facility which
procures TB drugs for the public sector of many countries has increased supply and dropped
prices of some MDR TB drugs by 2009 [43].
5.1. Clinical and laboratory monitoring
Drugs used in the treatment of MDR TB are less effective, more toxic (90% experience side
effects), used for longer duration (usually more than 2 years duration), and are more costly
than drugs used in susceptible TB (10-100 times more costly) [44]. In the 27 high-burden
countries, the expenditure for MDR-TB treatment has increased cost of TB care from an
10
Africa
The Americas
2007
200
2008
2008
2009
2009
2010
2010
2011
2011
Eastern Mediterranean
Europe
2007
2007
2008
2008
2009
2009
2010
2010
2011
2011
SouthEast Asia
Western Pacific
2007
2007
2008
2008
2009
2009
2010
2010
2011
2011
Global
2007
20
40
60
80
100
Percentage of cohort (%)
2008
2009
2010
Treatment success
Failure
Lost to follow up
Not evaluated
Died
2011
0
20
Percentage of cohort (%)
40
60
80
100
(Adapted from WHO Global TB Report, 2014)

Figure 3. Treatment outcomes for patients diagnosed with MDR TB by WHO region, 2007-2011 cohorts.
estimated 1.3 billion USD in 2010 to 4.4 billion USD by 2015 [45]. Some of the common adverse
effects might also require monitoring such as ototoxicity and renal failure. There is also the
need to document improvement by follow-up of bacteriologic cultures. In addition to these,
cases need to be monitored because some MDR TB cases are in advanced stages of disease with
other end-stage organ failures. MDR TB therapy is often characterized by low treatment
completion rates due to death (15%), default (14-23%), and treatment failure (8-9%) [46]. To

http://dx.doi.org/10.5772/61269
achieve increased access, compliance, effective therapy, and retention in care, there is a need
for close monitoring. This is traditionally done by hospital-based care at MDR TB referral
centers for the initial therapy through health care providers. The model of care involves an
initial hospitalization until sputum culture conversion followed by ambulatory phase of
treatment in the nearest DOTS facility. However, hospital-based care may serve as an obstacle
to access. Ambulatory-based care and community-based care have been proposed in manage
ment of MDR TB cases [47]. There have been some successful experiences in some countries
using these methods [1]. There would be need for collaboration between these models of care
especially when dealing with patients with advanced disease who may benefit for some
periods from hospital-based care but would need community- or home-based care for terminal
stages. Community and Ambulatory care also serve to ensure adequate contact tracing for
cases of MDR and XDR TB, which is of great importance given the role of transmission of
disease in spreading the MDR TB epidemic.
When contacts are traced, there is need for DST to identify appropriate second-line drugs.
Currently, the diagnostic tools recommended are molecular-based testings: Line probe Assays
and Xpert MTB/RIF. There is need, however, to establish quality control measures for these
tests to avoid false positives and false negatives. Such tools as would ensure international
standards for reference laboratories and other peripheral centers have been developed in some
countries. Laboratory monitoring also includes structured assessment tools for TB microscopy,
which is shared among laboratory networks.
6. Prevention of MDR TB
To achieve success in the control of MDR TB, there would be a need to strengthen existing TB
DOTS programs. To achieve this, some areas that should be focused on are the creation of
infection control policies both within and outside institutions. Health education of how
transmission of disease occurs from cases to vulnerable groups should be emphasized in
communities. Community-based care should be strengthened with recruitment of staff for
contact tracing of MDR cases, screening of the contacts, treatment administration, and
identification of those who are defaulting on treatment or require institutionalized care. There
should be expansion in the teams with involvement of all relevant health care partners to
strengthen PublicPrivate Mix initiatives for TB care and control [48-52].
6.1. Infection control
This aims to prevent transmission from cases to other patients or health care workers. The
following means could help to ensure the protection of health care staff: Use of N95 mask by
all staff on medical and TB isolation wards and in the HIV clinics [53]; HIV testing of all staff
with reallocation of those testing positive to lower-risk positions; Annual Chest Xray screening
for TB for all staff [24,54].
Within health care institutions, TB control officers should be hired as well as cough officer in
waiting areas who would identify those that are in hospital for other reasons but who may
11
12
require TB screening. The duration of hospital admission and stay should be reduced. There
should be environmental airflow control to ensure maximal ventilation (natural mechanical
ventilation within the ward and the use of outdoor waiting areas for outpatients). MDR TB
isolation wards should be created with attention paid to laminar airflow [55].
Infection control programs should be created with plans for intervention should transmission
be proved.
7. Conclusions
Underdiagnoses of MDR TB and XDR TB cases pose significant challenge for TB control. The
current available means for tracking and monitoring are inadequate since they are reliant on
reported data which are usually incomplete. These data overlook transmission to unrecog
nized populations which sustain MDR TB epidemics. There is also a need to make diagnostic
tools more available and accessible for cases and contacts and more reference laboratories
provided. These laboratories should be monitored to assure they maintain international
standards and produce reliable results. Once diagnosis has been made promptly and accu
rately, adequate therapy for MDR TB should be instituted. This would require clinical
monitoring of cases through collaboration of hospital, community, and ambulatory care
services. Control programs should also target health care givers to prevent transmission of
MDR TB to them from cases. In essence, routine TB DOTS programs should be strengthened
in collaboration with publicprivate mix initiatives to enhance MDR TB control.
Author details
Adeola Orogade
Address all correspondence to: orogade@yahoo.com
Department of Paediatrics, Ahmadu Bello University Teaching Hospital, Shika Zaria,
Nigeria
References
[1] World Health Organization. Global Tuberculosis Report, 2014. 54-73
[2] Donald PR, van Helden PD. The global burden of tuberculosis combating drug re
sistance in difficult times. N Engl J Med 2009; 2393-2395
[3] Tuberculosis Fact Sheet, 2012: Published by the US Embassy in Nigeria, retrieved
from http://nigeria.usembassy.gov.1-3

http://dx.doi.org/10.5772/61269
[4] World Health Organization. (2005) WHO Global Task Force outlines measures to
combat XDR-TB worldwide. Geneva, Switzerland. 3-5
[5] Holtz TH, Lancaster J, Laserson KF. Risk factors associated with default from multi
drug-resistant tuberculosis treatment, South Africa. Int J Tuberc Lung Dis 2006; 10
649-655
[6] WHO, Global Plan to stop TB 2006-2015: Progress Report 2006-2008. 25-28
[7] CDC, 2006 Centers for Disease Control and Prevention. Emergence of Mycobacteri
um tuberculosis with extensive resistance to second line drugsworldwide, 2000
2004. MMWR; 55; 301305.
[8] World Health Organization Global Tuberculosis Report 2012. Geneva, WHO Press,
2012. 41-51
[9] Ndjeka, N. Multi-Drug Resistant Tuberculosis. Strategic Overview on MDR TB care
in SouthAfrica.2014.www.health-e.org.za/2014/03.../presentation-drug-resistant-tbsouth-afri..3-25
[10] Fawcett IW, Watkins BJ. Initial resistance of Mycobacterium tuberculosis in Northern
Nigeria. Tubercle 1976; 57, 71-73
[11] Kolo I. Bacteriological and drug sensitivity studies on Mycobacteria isolated from tu
berculosis patients and their close contacts in ABUTH, Zaria, Nigeria. PhD Thesis.
Ahmadu Bello University Zaria; 1991
[12] Abdullahi AA. Studies on immunological status of HIV infected patients with Tuber
culosis in Kano State, Nigeria. PhD Thesis. Ahmadu Bello University, Zaria, Nigeria;
2006.
[13] Akanbi MO, Ukoli CO. Are weak health systems a brewing ground for multidrug re
sistant tuberculosis? Afr J Respir Med 2009; 21-22
[14] Lawson L, Habib AG, Okobi MI. Pilot study on multidrug resistant Tuberculosis in
Nigeria. Ann Afr Med 2010; 9 184-187
[15] Lawson L, Yassin MA, Abdurrahman ST, Parry CM, Dacombe R et al. Resistance to
first-line Tuberculosis drugs in three cities in Nigeria. Tropic Med Int Health. 2011;
16(8) 974-980
[16] Dim CC, Dim NR. Trends of Tuberculosis prevalence and treatment in an under-re
sourced setting: the case of Enugu State, South East Nigeria. Nigeria Med J 2013; 54(6)
392-397
[17] Olusoji D, Eltayeb O, Olanrewaju O, Olapade GD. Pre-Extensive Drug Resistant Tu
berculosis (Pre-XDR-TB) among MDR-TB patients. Global Adv Res J Microbiol 2013
(ISSN: 2315-5116) 2(2) 22-25
13
14
[18] Nwokeukwu HI, Okafor PN, Okorie O, Ukpabi K. Paediatric Multidrug resistant Tu
berculosis with HIV Co infection: a case report. Case Reports in Medicine 2013; Article
ID 756152 1-4.
[19] Adegboyega TT, Thomas BT, Agu GC, Abiodun AT. Can Nigeria sustain the fight
against Drug resistant Mycobacterium Tuberculosis? J Microbiol Res 2014; 4(2) 72-77
[20] Zignol M, Sismanidis C, Falzon D, Glaziou P, Dara M, et al. Multidrug resistant Tu
berculosis in children: evidence from global surveillance. Eur Respir J 2012; 343 (3)
701-707
[21] Central TB Division, Directorate General of Health Services, Ministry of Health &
Family Welfare. DOTS-Plus Guidelines 2006. Nirman Bhavan, New Delhi: Revised
National Tuberculosis Control Programme; 146.
[22] Toman K. Tuberculosis, case finding and chemotherapy. World Health Organization.
1979. 207-211
[23] David HL. Probability distribution of drug-resistant mutants in unselected popula
tions of Mycobacterium tuberculosis. Appl Microbiol. 1970; 20 810814
[24] Broekmans JF. Advanced Issues in Global TB Control: Achieving Impact. Epi/Biostat
Summer Institute Lectures, Johns Hopkins Bloomberg School of Public Health.
2014.1-6
[25] Udawadia ZF, Amale RA, Ajbani KK, Rodrigues C. Totally drug resistant Tuberculo
sis in India. Clin Infect Dis 2011. 579-581.DOI: 10.1093/cid/cir889
[26] Global Alliance for TB Drug Development. 2015. 1-3
[27] De Vries G, van Altena R, van Soolingen D, Broekmans JF, van Hest NA. An out
break of multiresistant tuberculosis from Eastern Europe in the Netherlands. Ned
Tijdschr Geneeskd. 2005; 149(35) 1921-1924
[28] Schecter G. Multidrug resistant Tuberculosis. Francis J Curry National Tuberculosis
Center, 2008.35-42
[29] Gandhi N, Moll A, Sturm AW, Pawinski R, Govender T et al. Extensively drug-resist
ant tuberculosis (XDR TB) as a cause of death among TB/HIV co-infected patients in
a rural area in South Africa. Lancet 2006; 368, 15751580
[30] Seddon JA, Hesseling AC, Marais BBJ, Jordaan A, Victor T, Schaaf HS. The evolving
epidemic of drug resistant tuberculosis among children in Cape Town, South Africa.
Int J Tuberc Lung Dis 2012. 16(7) 928-933. http://dx.doi.org/10.5588/ijtld. 11.0679
[31] Kwan CK, Ernst JD. HIV and Tuberculosis: a deadly human syndemic. Clin Microbiol
Rev 2011; 24(2) 351-376
[32] [32]Xpert MTB/RIF implementation manual. Technical and operational how-to
practical considerations.http://www.who.int/tb/labratory/en

http://dx.doi.org/10.5772/61269
[33] Olson S, Lebovitz y, Claiborne. The Emerging Threat of Drug Resistant Tuberculosis
in Southern Africa. Global and Local Challenges and Solutions. Summary of a joint
workshop. Institute of Medicine and Academy of Science of South Africa. 2011.42
[34] [34]Orogade AA, Ahmed P, Onazi S, Abubakar U. Isa H. BCG Status in children with
Tuberculosis A multicentre study in Northern Nigeria. J Med Tropic 2013;
15(2)126-130
[35] Orogade AA., Ogala WN, Onalo R. Congenital Tuberculosis: a case report. Nigerian J
Paediatri 2011; 38(2) 100-103
[36] Salazer GE, Schmitz TL, Cama R, Working group on TB in Peru. Pulmonary tubercu
losis in children in a developing country. Paediatrics 2001; 108(2) 448-453
[37] Ugochukwu EF. HIV/TB Co infection in Nigerian Children. Nigerian Med J 2010; 51(3)
120-124
[38] Swanson DS, Starke JR. Drug resistant tuberculosis in paediatrics. Paediatr Clin N Am
1995; 42, 553-581
[39] Schaaf HS, Gie RP, Beyers N et al. Primary drug resistant tuberculosis in children. Int
J Tuberc Lung Dis 2000; 4, 1149-1155
[40] Mukherjee J, Schaaf HS. Multidrug resistant tuberculosis in children. In: Schaaf HS,
Zumla AI (eds.) Tuberculosis. A Comprehensive Clinical Reference: Elsevier; 2009.
532-537
[41] Ettehad D, Schaaf HS, Seddon JA. Treatment outcomes for children with multidrug
resistant tuberculosis: a systemic review and meta-analysis. Lancet Infect Dis 2012; 12,
449-456.
[42] Pooran A, Pieterson E, Davids M, Theron G, Dheda K. What is the cost of diagnosis
and management of drug resistant tuberculosis in South Africa? PLoS One 2013; 8(1)
[43] GDF; www.stoptb.org/gdf)
[44] The Economic Burden. Aeras. 2015. www.aeras.org/pages/beyond-a-health-crisis. 1
[45] World Health Organization. Multidrug and Extensively Drug-resistant TB (M/XDRTB) 2010 Global Report on Surveillance and Response. 21-29
[46] Ahuja SD, Askin D, Avendano M, Banerjee R, Bauer M et al. Multidrug resistant pul
monary tuberculosis treatment regimens and patient outcomes: an individual patient
data meta-analysis of 9,153 patients. PloS 2012; 9(9)
[47] Bassilli A, Fitzpatrick C, Qadeer E, Fatima R, Floyd K, Jaramillo E. A systematic re
view of the effectiveness of hospital and ambulatory based management of multi
drug resistant tuberculosis. Am J Tropic Med Hygiene 2013; 89(2) 271-280
15
16
[48] Gidado M, Ejembi CL. Tuberculosis case management and treatment outcome: as
sessment of the effectiveness of public-private mix of tuberculosis programme in Ka
duna state, Nigeria. Ann Afr Med 2009; 8(1):25-31
[49] Ahmed J, Ahmed M, Laghari A, Lohana W, Ali S, Fatmi Z. Public private mix model
in enhancing tuberculosis case detection in District Thatta, Sindh, Pakistan. J Pak Med
Assoc 2009; 59(2):82-86.
[50] Kumar MK, Dewan PK, Nair PK, Frieden TR, Sahu S, Wares F, Laserson K, Wells C,
Granich R, Chauhan LS. Improved tuberculosis case detection through public-pri
vate partnership and laboratory-based surveillance, Kannur District, Kerala, India,
2001-2002. Int J Tuberc Lung Dis 2005; 9: 870-6
[51] Newell JN, Pande SB, Baral SC, Bam DS, Malla P. Leadership, management and tech
nical lessons learnt from a successful public-private partnership for TB control in
Nepal. Int J Tuberc Lung Dis 2005; 9; 1013-17
[52] Mahendradhata Y, Utarini A,Lazuardi U, Boelaert M, Stuyft P. Private practitioners
and tuberculosis case detection in Jogjakarta, Indonesia: actual role and potential.
Tropic Med Int Health 2007; 12(10)1218-1224
[53] Matlow A, Robb M Goldman C. Infection control and paediatric tuberculosis: A prac
tical guide for the practicing paediatrician. Paediatr Child Health 2003; 8(10) 624-626
[54] Institute of Medicine (US) Forum on Drug Discovery, Development, and Translation;
Academy of Science of South Africa. The Emerging Threat of Drug-Resistant Tuber
culosis in Southern Africa: Global and Local Challenges and Solutions: Summary of a
Joint Workshop. Washington (DC): National Academies Press (US); 2011. 4, Trans
mission and Infection Control. Available from: http://www.ncbi.nlm.nih.gov/books/
NBK55584/
[55] Preventing Transmission of Tuberculosis in Healthcare facilities: An Engineering ap
proach.www.safelab.com/DOWNLOAD/TBPaper.pdf; 10-20
Chapter 2
Mitochondria of Malaria Parasites as a Drug Target

Kenji Hikosaka, Keisuke Komatsuya, Shigeo Suzuki and Kiyoshi Kita
http://dx.doi.org/10.5772/61283
Abstract
Mitochondria are organelle, which is found in most eukaryotic cells, and play an im
portant roll in production of many biosynthetic intermediates as well as energy trans
duction. Recently, it has been reported that mitochondria contribute to cellular stress
responses such as apoptosis and autophagy. These functions of mitochondria are
known to be essential for survival and maintenance of homeostasis. The mitochondria
of malaria parasites are quite different from those of their vertebrate hosts. Because
these differences markedly contribute to drug selectivity, we have focused on the Plas
modium mitochondrion to develop antimalarial drugs. Here we summarize recent ad
vances in our knowledge of the mitochondria of malaria parasites and discuss future
prospective antimalarial drugs targeting the parasite mitochondrion.
Keywords: malaria, Plasmodium, mitochondria, antimalarial drugs, atovaquone, 5aminolevulinic acid
1. Introduction
Malaria is a major global health problem, shortening over 500,000 human lives annually,
mainly children in tropical and subtropical regions [1]. Due to difficulties in developing
antimalarial vaccine, chemotherapy is important for controlling malaria. Parasites causing
malaria, however, can rapidly develop resistance against the available chemotherapies [2].
Thus, new drugs with different modes of action are urgently needed. Malaria parasites are
disseminated by female Anopheles mosquitoes and belong to the Plasmodium genus. Plasmodi
um has a complicated life cycle, comprising two major cycles: asexual multiplication in humans
and sexual multiplication in mosquitoes (Figure 1) [3]. The parasites invade the hepatocytes
of their host and mature into merozoites. After release, the merozoites infect red blood cells
(RBCs). In the RBCs, the parasites differentiate into the following stages: ring, trophozoite, and
schizont. Subsequently, the infected RBCs burst and release merozoites, which invade
18
uninfected RBCs. These stages are called the erythrocytic stages, where the parasites multiply
asexually. Following the establishment of infection, some parasites differentiate to gameto
cytes [4]. The gametocyte stage is essential for subsequent transmission because this is the only
stage where the organism undergoes sexual development in the mosquito vector. Therefore,
Plasmodium has a complex life cycle, which seems to be an adaptation to its host environment
[5]. In addition to the complex life cycle, the malaria parasites have evolved sophisticated
pathways of energy transduction to adapt to their hosts.
Figure 1. Life cycle of the human malaria parasite Plasmodium falciparum.
Mitochondria, an organelle arising from alpha-proteobacterium engulfed by a eukaryotic

progenitor [6], play a key role in energy transduction of eukaryotic cells. In vertebrates, that
can become a host for malaria parasites, mitochondria have been reported to contribute to
cellular responses such as autophagy, apoptosis, and ATP production [7]. The vertebrate
mitochondrion comprises two separate and functionally distinct outer and inner membranes
that form cristae, and it also contains its own circular genome, the mitochondrial genome
(mtDNA). With few exceptions, vertebrate mtDNA is approximately 16 kb in size, encoding

http://dx.doi.org/10.5772/61283
37 genes: two for ribosomal RNAs (rRNAs), 13 for proteins, and 22 for tRNAs [8]. In contrast
to the vertebrate mitochondrion, the Plasmodium mitochondrion is a single tubular organelle
structure [9] that possesses a 6-kb mtDNA, encoding only three genes for proteins and highly
fragmented rRNA genes [10], and it is the smallest eukaryotic mtDNA. Furthermore, the
erythrocytic stages of the parasite have been considered to mainly rely on glycolysis, with
secretion of end products such as lactate and pyruvate [11, 12]. The mitochondria of malaria
parasites are thus quite different from those of their vertebrate hosts. Because these differences
markedly contribute to drug selectivity, we have focused on the Plasmodium mitochondrion
to develop antimalarial drugs. Here we summarize recent advances in our knowledge of the
mitochondria of malaria parasites and discuss future prospective antimalarial drugs targeting
the parasite mitochondrion.
2. Biochemical functions of malaria parasite mitochondria

2.1. ATP production in canonical eukaryotes
Conventionally, a mitochondrion is the cells powerhouse, in which energy stored in chemical
bonds is turned into ATP via oxidative phosphorylation. ATP production can be divided into
three pathways: glycolysis, mitochondrial tricarboxylic acid (TCA) cycle, and mitochondrial
electron transport chain (mtETC). Glycolysis breaks down one molecule of glucose into two
molecules of pyruvate, generating two molecules of ATP. Pyruvate then moves into the
mitochondrion where it is converted to acetyl-CoA and carbon dioxide by pyruvate dehydro
genase complex (PDH). Subsequently, acetyl-CoA enters the TCA cycle. The mtETC involves
the passage of electrons from TCA-cycle NADH or from succinate via mtETC complexes to
oxygen, with concomitant translocation of protons into the mitochondrial intermembrane
space. Generally, the mtETC comprises four integral membrane enzyme complexes in the
mitochondrial inner membrane: NADH-ubiquinone oxidoreductase (complex I), succinateubiquinone oxidoreductase (SQR, complex II), ubiquinol-cytochrome c oxidoreductase
(complex III or cytochrome bc1), and cytochrome c oxidase (complex IV). Ubiquinone (Q) and
cytochrome c (complex IV) function as electron carriers and the complexes I, III, and IV function
as sites generating potential. The resultant potential across the mitochondrial inner membrane
is used to drive ATP synthesis.
2.2. ATP production in malaria parasites
Similar to canonical eukaryotes, in the mosquito stages of malaria parasites, the organisms
produce ATP in their mitochondria [13]. In the erythrocytic stages, however, the mitochondrial
energy transduction system for oxidative phosphorylation is downregulated to adapt to host
environments and produce ATP mainly via glycolysis using blood glucose [14, 15]. As a
consequence, in malaria parasite-infected patients, plasma lactate levels tend to be high and
highly variable, ranging from 2 to 26.7 mM [16, 17], compared with plasma lactate levels (0.3-1.3
mM) in normal individuals. Apart from the minor flux of carbon backbone derived from
glucose, TCA metabolism of Plasmodium was believed to involve a branched architecture
19
20
bifurcating from 2-oxoglutarate until recently [18]; however, this report was subsequently
retracted [19]. More recently, the malaria parasites have been reported to use the canonical
oxidative mitochondrial TCA cycle to catabolize host glucose and glutamate (Figure 2) [20],
even during asexual multiplication. The TCA cycle begins with malate generated by anapler
otic reactions and 2-oxoglutarate produced from glutamine as well as conversion of acetylCoA to citrate by citrate synthase [20-22]. In general, pyruvate, the end product of glycolysis,
is transported via the monocarboxylate transporter (MCT) family [23]. Plasmodium possesses
two MCT genes (PF3D7_0210300 and PF3D7_0926400) identified in its genome (PlasmoDB
version 11.0, website: http://plasmadb.org/plasma/). Although further evidence is required,
these MCTs are considered to be associated with the transport of pyruvate across the mito
chondrial membrane [24]. To convert pyruvate into acetyl-CoA, Plasmodium retains branched
chain ketoacid dehydrogenase (BCKDH), the only enzyme implicated in branched chain
amino acid degradation [22]. PDH complex, linking cytoplasmic glycolysis to the TCA cycle
in canonical eukaryotes, is not localized to the mitochondrion but to a plastid, apicoplast, in
Plasmodium [25]. The function of the Plasmodium PDH complex seems to include the provision
of acetyl-CoA for de novo fatty acid synthesis within the apicoplast.
Figure 2. TCA cycle and oxidative phosphorylation of malaria parasites. The TCA cycle of malaria parasites begins
with malate, 2-oxoglutarate, and citrate [20-22].

http://dx.doi.org/10.5772/61283
In the Plasmodium TCA cycle, succinate and malate are oxidized by SQR and malate-ubiqui
none oxidoreductase (MQO), respectively, with transporting electrons to the matrix [26]
(Figure 2). Similar to SQR of most eukaryotes, the Plasmodium SQR comprises four polypep
tides: a flavoprotein (Fp) subunit, iron-sulfur (Ip) subunit [27], and two cytochrome b (cytb)
subunits (CybL and CybS) [28]. Fp and Ip form the catalytic portion of the complex. This
portion acts as a succinate dehydrogenase (SDH), catalyzing the oxidation of succinate by
water-soluble electron acceptors such as phenazine methosulfate in SQR, and is bound to the
matrix side of the mitochondrial inner membrane via the membrane-anchoring proteins CybL
and CybS. Because the mitochondria of erythrocytic stage parasites show both SQR and SDH
activities [27, 29, 30], complex II has been considered to have some role in parasite survival.
These activities, however, are very low, compared with those of the other eukaryotes (Table
1) [31-35]. Furthermore, our previous studies have demonstrated that disruption of the Fp
subunit genes pfsdha and Pbsdha does not affect growth in the erythrocytic stages in vitro [36]
and in vivo [37], respectively. These findings reveal that complex II is not essential for survival
of the erythrocytic stage parasites, and this appears to be associated with relatively low
activities of SQR and SDH in these developmental stages.
*Activity values of P. falciparum, T. cruzi, A. suum, rat liver, bovine heart, and human cell are obtained from references [29,
31, 32, 33, 34], and [35], respectively.
Table 1. Specific activities of succinate-ubiquinone oxidoreductase of various organisms
MQO is an FAD-dependent membrane-associated protein that catalyzes the oxidation of

malate to oxaloacetate [38]. The electrons are donated to quinones of the mtETC, and NAD is
accepted as an electron donor. The MQO has been not observed in mammals but has been
found in Plasmodium [39] and some bacteria [40]. This implies that the Plasmodium MQO could
be a target for drug design. In addition to SQR and MQO in the TCA cycle, Plasmodium
possesses three oxidoreductases in its mitochondrial inner membrane: type II NADH:ubiqui
none oxidoreductase (NDH2) [41], dihydroorotate dehydrogenase (DHODH) [42, 43], and
glyceraldehyde-3-phosphate dehydrogenase (G3PDH) [44, 45], all of which can reduce
ubiquinone (Figure 2). Unlike the large multisubunit complex I in most mitochondria, the
Plasmodium NDH2 is a single subunit enzyme, not involved in the direct pumping of protons
across the membrane [46]. The absence of NDH2 in mammalian mitochondria shows that this
enzyme would be a promising target of a novel antimalarial drug. Some antimalarial activities
of NDH2 inhibitors, such as HQNO [47] and 1-hydroxy-2-dodecyl-4(1H) quinolone [48], have
21
22
been reported. However, a recent in vivo study on Plasmodium berghei revealed that the
Plasmodium NDH2 could be deleted by targeted gene disruption, indicating that it is dispen
sable in the erythrocytic stages [49]. This disproves that NDH2 is a candidate drug target. Thus,
the potential of targeting NDH2 as an antimalarial drug remains controversial.
The other dehydrogenases (DHODH and G3PDH) transfer electrons from reduced com
pounds in the cytosol (Figure 2). In the erythrocytic stages of the parasite, DHODH plays two
rolesa generator of reduced ubiquinone and the fourth enzyme in the pyrimidine biosyn
thetic pathway. Since Plasmodium cannot salvage pyrimidine [50], DHODH is essential for its
survival [42]. Therefore, in the erythrocytic stages, the mtETC appears to be essential for the
pyrimidine biosynthetic pathway rather than for contributing to the ATP pool [11].
As presented above, in Plasmodium mitochondria, five mitochondrial dehydrogenases (SQR,
MQO, NDH2, DHODH, and G3PDH) can generate reduced ubiquinone, which in turn is
reoxidized by cytochrome bc1 complex (complex III). Complex III is inhibited by atovaquone
[51], which collapses the mitochondrial membrane potential [52]. As an antimalarial, atova
quone is very effective; however, atovaquone-resistant parasites develop easily. Mechanisms
of atovaquone resistance are described in Section 4. Similar to canonical eukaryotes, Plasmo
dium utilizes cytochrome c (cytc) as electron carriers and complexes III and IV as sites gener
ating potential. The resultant potential across the mitochondrial inner membrane is used to
drive ATP synthesis. Plasmodium ATP synthase is markedly different from that of its host [53]
it is assembled as a large dimeric complex in the erythrocytic stages. In the ciliates Tetrahy
mena thermophila and Paramecium, the structure and arrangement of dimeric ATP synthase have
been suggested to determine the tubular morphology of the mitochondrial cristae [54, 55]. This
could explain how the tubular cristae found in the mitochondria of erythrocytic stages are
generated.
2.3. Mitochondrial energy metabolism: a target of antimalarial drugs
Recently, in addition to the genetic disruptions of SDH and NDH2 described above, it has been
reported that six TCA cycle enzymes can be genetically disrupted in the erythrocytic stage or
sexual development stage [45]. These reports suggest that the TCA cycle would not be essential
for survival in these developmental stages. Hence, to develop an antimalarial drug, promising
mitochondrial targets would be DHODH, which is associated with the pyrimidine biosynthe
sis pathway and mtETC, and the mitochondrial complexes III, IV, and V that generate electron
gradients on the mitochondrial inner membrane.
On the other hand, it has been recently demonstrated that parasites derived directly from
infected patients show three distinct gene expression states. One of these states demonstrates
that the expression levels of the TCA cycle- or mtETC-related genes are increased [56].
Furthermore, mice infected with P. berghei or Plasmodium yoelii perform active oxidative
phosphorylation [57], suggesting that, in some physiological conditions, malaria parasites may
produce ATP via the mitochondrial TCA cycle and mtETC. Thus, we cannot exclude the
possibility that all the mitochondrial enzymes are potential targets for antimalarial drugs.

http://dx.doi.org/10.5772/61283
3. The mitochondrial genome of malaria parasites

Malaria parasites possess a mitochondrial genome in the form of circular and/or tandemly
repeated linear elements of 6 kb, the smallest in size among eukaryotic cells [58]. Copy numbers
for this element are approximately 20-fold and 150-fold of the nuclear genomes in the human
malaria parasite Plasmodium falciparum [58] and the rodent malaria parasite P. yoelii [59],
respectively. These differences in the copy number may reflect differences in oxidative
phosphorylation activities as noted previously (see Section 2.3). The 6-kb element contains
only three mitochondrial protein-coding genes in addition to the large subunit (LSU) and small
subunit (SSU) rRNA genes [60, 61, 62] (Figure 3). The three protein-coding genes are cytc
oxidase subunit 1 (cox1) and subunit 3 (cox3), members of the cytc oxidase complex (complex
IV), and cytb (cob), a member of cytochrome bc1 complex. In all eukaryotic cells possessing
mitochondria, cox1 and cob are encoded by the mitochondrial genome. Because the organisms
possessing mitochondrion-like organelles without its own DNA (e.g., hydrogenosome and
mitosome) do not have cox1 and cob, these two genes appear to be essential for maintenance
of the mtETC.
Figure 3. Mitochondrial (mt) genome structure of malaria parasites. Mt-genome organization is perfectly conserved
among 23 Plasmodium species [63]. Elements within the mt genome of Plasmodium are tandemly repeated, so the desig
nation of both termini is arbitrary. Light green and light magenta boxes indicate fragments of LSU and SSU rRNA
genes, respectively.
The two rRNA genes of the Plasmodium mitochondrial genome are highly fragmented [63],
and the fragmentation is the most extreme example of any described rRNA fragmentation.
Recently, transcription of almost all intergenic regions of the Plasmodium mitochondrial
genome has been demonstrated [63]. The results show that 27 small rRNA fragments (12 SSU
rRNAs and 15 LSU rRNAs), ranging from 23 to 190 nt, are present in its mitochondrial genome
(Figure 4). All the rRNAs are predicted to pair with at least one of the other rRNA, creating
interactions that would help maintain the appropriate location and orientation of each rRNA.
Notably, among the Plasmodium genera, the nucleotide sequences of noncoding regions, as
well as fragmented rRNA gene regions, are more conserved when compared with those of the
protein-coding gene regions [10]. It thus appears that these highly conserved sequence regions
code for functional RNAs, including additional fragmented rRNAs.
In addition to the highly fragmented rRNAs, the mitochondria of malaria parasites have a
unique propertytransfer RNA (tRNA) is absent; therefore, protein translation in the
23
24
Figure 4. Fragmentation of the mitochondrial LSU and SSU rRNA genes of Plasmodium falciparum. Red line indicates
rRNA regions. Purple lines indicate recently identified additional fragmented rRNA candidates[63].
mitochondrion was to date considered as being impossible. However, recently, extramito

chondrial phenylalanyl-tRNA synthesis has been found in mitochondria of the erythrocytic
stages, suggesting that the parasite mitochondrion can import tRNAs from the cytoplasmic
tRNA pool [64]. These findings referring to the parasite rRNAs and tRNAs would make the
parasite mitochondrial protein translation a desirable organelle to target as an antimalarial
drug.
In malaria parasites, mtDNA is replicated via rolling circle replication to generate the linear
concatemers, similar to the replication mechanism used by some bacteriophages and plasmids
[58]. This replication manner is remarkably different from that of the vertebrate mtDNA, which
is replicated by a theta mechanism. Furthermore, mitochondrial DNA polymerase, which has
been characterized as a -like DNA polymerase, is strongly resistant to 2,3-dideoxythymi
dine-5-triphosphate and, in this aspect, differs from its vertebrate homolog [65], suggesting
structural differences between the Plasmodium and vertebrate DNA polymerase. Further
research on translation and replication mechanisms of the parasite mtDNA may help identify
potential targets for drug candidates.
4. Atovaquone resistance in malaria parasites

4.1. Predicted mode of action for atovaquone
Atovaquone (a hydroxy-1,4-naphthoquinone derivative) is a broad-spectrum antiparasitic
agent active against malaria, Pneumocystis carinii pneumonia, toxoplasmosis, and babesiosis
[66]. The mode of action for atovaquone involves selective inhibition of parasite mtETC

http://dx.doi.org/10.5772/61283
without affecting the host mitochondrial functions at effective doses, making it the first
member of an entirely new class of antimalarial agents [52]. This drug shares structural
similarity with ubiquinone, a coenzyme involved in mtETC and serves as a point of contact
between energy metabolism and pyrimidine metabolism. Therefore, a potential molecular
target of atovaquone can be the ubiquinol oxidation pocket, Qo site, of the cytochrome bc1
complex [51, 67] because it may have a specific inhibitory effect on the parasite cytochrome bc1
complex. Generally, the cytochrome bc1 complex is a structural and functional homodimer.
The catalytic core comprises three redox active subunits, cyt b with two b-type hemes,
cytochrome c1 (cytc1) with a c-type heme, and Rieske protein with a [2Fe-2S] cluster [68].
Cytb catalyzes the transfer of electron from ubiquinol to cytc1, coupled to the transmembrane
proton translocation across the mitochondrial membrane [69]. There are two distinct catalytic
sites on the cytb protein, which are involved in the proton motive Q cycle and are proposed to
account for the electron transfer and proton translocating activity through the cytochrome bc1
complex: center o (also designated as Qo or center P) on the cytoplasmic site of the mitochon
drial inner membrane, where ubiquinol (QH2) oxidation occurs, and center i (Qi or center N)
on the matrix site, where ubiquinone (Q) reduction occurs. Because of its structural similarity
with ubiquinone, atovaquone appears to inhibit the cytochrome bc1 complex by competitive
binding with coenzyme Q for one of these sites.
4.2. Emergence of atovaquone-resistant malaria parasites
Atovaquone is majorly used for treatment and chemoprophylaxis of falciparum malaria for
international travelers [70], but the major problem is rapidity of emergence of drug resistance
when it is used as a single agent. Thus far, proguanil, which inhibits the parasite dihydrofolate
reductase, is combined with atovaquone to prevent the emergence. The combination drug,
registered as Malarone (GlaxoSmithKline group of companies), is approved for treating
malaria in more than 30 countries and is used for chemoprophylaxis for international travelers.
However, atovaquone-resistant parasites isolated from malaria patients have also been highly
reported [71-73]. These studies demonstrate that atovaquone resistance is associated with point
mutations of the amino acid residue at codon 268 of cytb (Pfcob) constructing the cytochrome
bc1 complex. The mutations Y268S, Y268N, and Y268C have been found in atovaquoneresistant parasites.
To mimic the situation of emergence of atovaquone-resistant parasites in a clinical setting, we
chose a mouse malaria model using BALB/c mice and the P. berghei ANKA strain. In the first
trial, we administered atovaquone intraperitoneally on seven consecutive days at doses
ranging from 0.4 g/kg/day to 4.8 mg/kg/day and obtained P. berghei isolates with four genetic
resistance variations in cytb [74] (Table 2). We did not observe the mutation of the amino acid
residue at codon 268, which is observed in P. falciparum. The two mutations, M133I and L144S,
are located in Qo1, and these code amino acids are critical for inhibitor resistance in yeast and
mice [75, 76]. Moreover, in Plasmodium, the M133I and L144S amino acid changes appear to be
structurally significant, altering the conformational structure of the ubiquinone-binding site
and thus lowering the affinity of atovaquone to the Qo1 site. The mutation V284F is located in
the sixth transmembrane domain adjacent to the Qo2 site, and the amino acid change by itself
25
26
confers only an approximately 10-fold resistance to atovaquone. Notably, the mutation V284F
has been found in all atovaquone-resistant clones [74].
Table 2. Mutations in the cytochrome b of Plasmodium berghei with atovaquone resistance
To obtain a better model for the biochemical and genetic studies of mutations found in P.
falciparum, we performed further experiments to obtain P. berghei strains, resistant to atova
quone, with mutations in the Qo2 region conferring high degrees of resistance [77]. The
parasite-infected mice were treated intraperitoneally for 3 consecutive days at a dose of 14.4
mg/kg/day, a higher dose than in the previous experiment. The results showed three variations
of the atovaquone-resistant mutation, including mutations at codon 268 (Y268N, Y268C, and
L271/K272R; Table 2). All the mutations were located in the Qo2 region, and these resistance
levels were more than 500 times higher than those of the wild type, although the resistance
levels of the previous isolates were more than 50 times higher. Administered doses of atova
quone affected the site of mutation in cytb and the level of drug resistance.
As described above, our group has reported various mutations in the quinone-binding sites
of the cytb gene of P. berghei, such as M133I, L144S, L271V, K272R, Y268C, Y268S, Y268N, and
V284F, using the mouse model with continuous atovaquone pressure. However, no direct
evidence of a relationship between the mutations and resistance has been observed using intact
mitochondria isolated from the malarial parasite, although biochemical analysis of the mutant
has been reported using cell-free extract [78]. To address this point, we have further investi
gated the activity of dihydroorotate-cytc reductase (regarding this mitochondrial pathway, see
Section 2) in both atovaquone-resistant and atovaquone-sensitive P. berghei isolates [79]. The
results showed that mutations in the quinone-binding site of the cytb gene resulted in variable
sensitivity to atovaquone and provided direct evidence for the atovaquone inhibitory mech
anism in the parasite cytochrome bc1 complex.
4.3. Cytochrome bc1 complex as an antimalarial drug target
Recently, the X-ray crystallographic structure of the mitochondrial cytochrome bc1 complex
from Saccharomyces cerevisiae with atovaquone has been resolved, and it demonstrates atova
quone bound in the Qo site [80]. It can therefore explain the molecular basis for the broad
spectrum of the antimalarial drug as well as for the species-specific differences in its effects.
This would allow us to develop a drug targeting cytochrome bc1 that would control the
emergence of resistant parasites. Furthermore, the other group has reported cocrystallization

http://dx.doi.org/10.5772/61283
of a bovine cytochrome bc1 complex with the 4(1H)-pyridone class of inhibitors [81], which are
potent antimalarial agents in vivo [82, 83]. The X-ray structure demonstrates that these
inhibitors do not bind at the Qo site but rather at the Qi site. Differences in the inhibitor-binding
site to cytochrome bc1 complex would aid the rational drug designing for reducing the
emergence of inhibitor-resistant parasites and increasing selectivity against malaria parasites
toward novel treatments. In the future, in addition to binding site analysis using modalities
such as X-ray crystallography, we need to elucidate the molecular mechanisms explaining how
atovaquone resistance mutation is generated in the parasite mt genome.
5. 5-Aminolevulinic Acid (ALA): A new antimalarial candidate targeting

the mitochondrion
ALA is a precursor used in the biosynthesis of tetrapyrroles such as chlorophyll and heme.
The heme is an iron-containing complex macrocycle that plays a fundamental role in several
cellular processes, including oxygen transport and storage, mitochondrial respiratory chain,
and detoxification [84]. Generally, in mammalian cells, heme biosynthesis begins with ALA
formation by ALA synthase in the mitochondria from glycine and succinyl-CoA [85]. The next
four steps and three final steps occur in the cytosol and mitochondria, respectively. In cancer
cells, the uptake of a high concentration of ALA results in elevated levels of its metabolites,
particularly protoporphyrin IX (PPIX), due to insufficient activity of ferrochelatase [86]. The
PPIX accumulates in the mitochondria and consequently acts as a photosensitizer releasing
singlet oxygen and other reactive oxygen species (ROS), resulting in induction of cell death in
cancer. ALA therefore has been applied to the development of photodynamic diagnosis and
photodynamic therapy (PDT) of various cancers [87, 88].
Recently, all the enzymes of de novo heme-biosynthetic pathway have been characterized in
the human malaria parasite, P. falciparum [89-91]. In contrast to the mammalian enzymes of
heme biosynthesis, the parasite enzymes have unique localizations (Figure 5). The first
enzyme, ALA synthase, and the final two enzymes, protoporphyrinogen IX oxidase and
ferrochelatase (FC), localize to the mitochondrion. The enzymes that catalyze the intermediate
three stepsALA dehydratase, porphobilinogen deaminase, and uroporphyrinogen decar
boxylase (UROD)localize to the apicoplast, a nonphotosynthetic plastid. The next enzyme,
coproporphyrinogen III oxidase, is cytosolic. In addition, the catalytic efficiency of these
enzymes of the erythrocytic stages differs from that of mammalian enzymes: the enzymes
localizing to the apicoplast have very low catalytic efficacy [92]. Altogether, the properties of
the heme-biosynthetic pathway are remarkably different between malaria parasites and their
hosts. Hence, the heme-biosynthetic pathway has been recognized as a novel chemotherapeu
tic target in Plasmodium. Smith and Kain attempted PDT for human malaria parasites by adding
ALA to an in vitro culture [93]. The growth of Plasmodium was completely inhibited by 0.2 mM
ALA, followed by exposure to white light or by a higher concentration (2 mM) of ALA alone
without light exposure. This use of PDT is, unfortunately, clinically unrealistic because white
light cannot illuminate the inside of a malaria-infected patients body and the concentration
of 2 mM is extremely high to apply clinically.
27
28
Figure 5. Heme biosynthesis of malaria parasites. The enzymes in the pathway are localized in the mitochondrion, api
coplast, and cytosol [89-91].
Our recent study resolved this issue: in the presence of ferrous ion, ALA efficiently inhibited
the in vitro growth of Plasmodium even without light exposure [94]. Because there was a
previous report on protection from malaria by elevated zinc protoporphyrin, which binds to
heme crystals to inhibit further crystallization to form hemozoin [95], we first investigated
effects of metal ions on growth inhibition by ALA using an in vitro culture system of P.
falciparum. Our results showed that treatment with 10 M sodium ferrous citrate (SFC) and 0.2
mM ALA increased the growth inhibition to more than 50% when compared with that of 0.2
mM ALA alone. Notably, no other metal ions (e.g., zinc, lead, and copper) had such a syner
gistic effect, indicating that only ferrous compounds are synergistic with ALA.
Next, to determine heme intermediate, we analyzed the cell extract of the parasite using HPLC.
The extract contained three major intermediates: coproporphyrin I, coproporphyrin III (CPIII),
and PPIX. Unlike in cancer cells, CPIII was majorly accumulated in the apicoplast. Although

http://dx.doi.org/10.5772/61283
its contribution to the parasite growth inhibition remains unknown, we believe that these
differences are due to the complicated heme-biosynthetic pathway (Figure 5) and life cycle of
Plasmodium (Figure 1). Moreover, PPIX, as is the case with cancer cells, accumulated mainly in
the mitochondrion. In PDT of cancer cells, PPIX acts as a photosensitizer releasing ROS,
resulting in extensive cellular damage and cell death [96]. This suggests that PPIX accumulated
in the parasite mitochondria is a factor contributing to the inhibition of parasite growth. Thus,
the parasite heme-biosynthetic pathway in the mitochondrion and apicoplast may be a
potential target of an antimalarial drug.
Recently, to confirm the efficacy of the combination of ALA and SFC (ALA/SFC) in treating
malaria using an animal model, we performed a preclinical drug evaluation of orally admin
istered ALA/SFC for the treatment of mice infected with the malaria parasite. ALA/SFC cured
50% of the Py17XL-infected mice, and the cured mice showed long-lasting humoral immune
responses to the same parasite strain and protection from homologous malarial infections [97].
ALA can be safe compound because a phase I clinical study has been successfully completed.
Considering the safety and mild antimalarial activities of ALA/SFC, a combination with an
available antimalarial drug, such as artemisinin or chloroquine, would be applicable for the
treatment of malaria.
6. Concluding remarks
The energy metabolism of malaria parasites has been considerably elucidated with accumu
lating data from several omics analyses. These data suggest that enzymes of the mitochon
drial TCA cycle and mtETC could be attractive targets for development of antimalarial drugs.
However, activity of these energy transduction pathways in the mitochondrion is considered
to be very low in the erythrocytic stages of the parasite. To address these possibilities, bio
chemical assay data are required. However, rigorous biochemical analysis of the parasite
mitochondrion, in which the TCA cycle and mtETC are present, is highly difficult because
intact and pure mitochondria cannot be obtained from the parasites thus far. As a consequence,
the malaria parasite mitochondrion needs to be purified to perform these future biochemical
studies. Biochemical data regarding the Plasmodium mitochondrion would shed light on the
details of mitochondrial enzyme behavior and help in the management of malaria.
Acknowledgements
We would like to thank Y. Koyama for the helpful discussion.This work was supported by a
Grant-in-aid for Scientific Research (no. 26253025) from the Japanese Society for the Promotion
of Science. We also acknowledge the support of the Science and Technology Research Promo
tion Program for Agriculture, Forestry, Fisheries and Food Industry and JST/ JICA, SATREPS
(Science and Technology Research Partnership for Sustainable Development) (no. 10000284).
29
30
Author details
Kenji Hikosaka1,2, Keisuke Komatsuya3, Shigeo Suzuki3,4 and Kiyoshi Kita3,5*
*Address all correspondence to: kitak@m.u-tokyo.ac.jp
1 Department of Infection and Host Defense, Graduate School of Medicine, Chiba University,
Chiba, Japan
2 Department of Microbiology and Immunology, Teikyo University School of Medicine,
Tokyo, Japan
3 Department of Biomedical Chemistry, Graduate School of Medicine, The University of
Tokyo, Tokyo, Japan
4 SBI Pharmaceuticals Co, LTD, Izumi Garden Tower 20F, 1-6-1, Roppongi, Minato-ku, Tokyo,
Japan
5 Nagasaki University, School of Tropical Medicine and Global Health, Nagasaki, Japan
References
[1] World Health Organization (WHO). World Malaria Report 2014. Available at: http://
wwwwhoint/malaria/publications/world_malaria_report_2014/en/. 2014 (Accessed
January 2015).
[2] Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J, Lwin KM, Ariey F, Hanpi
thakpong W, Lee SJ. et al. Artemisinin resistance in Plasmodium falciparum malaria.
New England Journal of Medicine. 2009;361(5):455-67.
[3] Cowman AF, Crabb BS. Invasion of red blood cells by malaria parasites. Cell.
2006;124(4):755-66.
[4] Dixon MW, Thompson J, Gardiner DL, Trenholme KR. Sex in Plasmodium: a sign of
commitment. Trends in Parasitology. 2008;24(4):168-75.
[5] Seeber F, Limenitakis J, Soldati-Favre D. Apicomplexan mitochondrial metabolism: a
story of gains, losses and retentions. Trends in Parasitology. 2008;24(10):468-78.
[6] Lane N, Martin W. The energetics of genome complexity. Nature. 2010;467(7318):
929-34.
[7] Nunnari J, and Suomalainen A. Mitochondria: in sickness and in health. Cell.
2012;148(6):1145-59.

http://dx.doi.org/10.5772/61283
[8] Boore JL. Animal mitochondrial genomes. Nucleic Acids Research. 1999;27(8):
1767-80.
[9] Das A, Syin C, Fujioka H, Zheng H, Goldman N, Aikawa M, Kumar N. Molecular
characterization and ultrastructural localization of Plasmodium falciparum Hsp 60.
Molecular and Biochemical Parasitology. 1997;88(1-2):95-104.
[10] Hikosaka K, Watanabe Y, Kobayashi F, Waki S, Kita K, Tanabe K. Highly conserved
gene arrangement of the mitochondrial genomes of 23 Plasmodium species. Parasitol
ogy International. 2011;60(2):175-80.
[11] Painter HJ, Morrisey JM, Mather MW, Vaidya AB. Specific role of mitochondrial elec
tron transport in blood-stage Plasmodium falciparum. Nature. 2007;446(7131):88-91.
[12] Jensen MD, Conley M, Helstowski LD. Culture of Plasmodium falciparum: the role of
pH, glucose, and lactate. Journal of Parasitology. 1983;69(6):1060-7.
[13] Hall N, Karras M, Raine JD, Carlton JM, Kooij TW, Berriman M, Florens L, Janssen
CS, Pain A, Christophides GK, et al. A comprehensive survey of the Plasmodium life
cycle by genomic, transcriptomic, and proteomic analyses. Science. 2005;307(5706):
82-6.
[14] Fry M, Beesley JE. Mitochondria of mammalian Plasmodium spp. Parasitology.
1991;102(Pt 1):17-26.
[15] van Dooren GG, Stimmler LM, McFadden GI. Metabolic maps and functions of the
Plasmodium mitochondrion. FEMS Microbiology Reviews. 2006;30(4):596-630.
[16] Agbenyega T, Angus BJ, Bedu-Addo G, Baffoe-Bonnie B, Guyton T, Stacpoole PW,
and Krishna S. Glucose and lactate kinetics in children with severe malaria. Journal
of Clinical Endocrinology and Metabolism. 2000;85(4):1569-76.
[17] Krishna S, Waller DW, ter Kuile F, Kwiatkowski D, Crawley J, Craddock CF, Nosten
F, Chapman D, Brewster D, Holloway PA, et al. Lactic acidosis and hypoglycaemia
in children with severe malaria: pathophysiological and prognostic significance.
Transactions of the Royal Society of Tropical Medicine and Hygiene. 1994;88(1):
67-73.
[18] Olszewski KL, Mather MW, Morrisey JM, Garcia BA, Vaidya AB, Rabinowitz JD, Lli
nas M. Branched tricarboxylic acid metabolism in Plasmodium falciparum. Nature.
2010;466(7307):774-8.
[19] Olszewski KL, Mather MW, Morrisey JM, Garcia BA, Vaidya AB, Rabinowitz JD, Lli
nas M. Retraction: Branched tricarboxylic acid metabolism in Plasmodium falciparum.
Nature. 2013;497(7451):652.
[20] MacRae JI, Dixon MW, Dearnley MK, Chua HH, Chambers JM, Kenny S, Bottova I,
Tilley L, McConville MJ. Mitochondrial metabolism of sexual and asexual blood
stages of the malaria parasite Plasmodium falciparum. BMC Biology. 2013;11:67.
31
32
[21] Cobbold SA, Vaughan AM, Lewis IA, Painter HJ, Camargo N, Perlman DH, Fish
baugher M, Healer J, Cowman AF, Kappe SH, et al. Kinetic flux profiling elucidates
two independent acetyl-CoA biosynthetic pathways in Plasmodium falciparum. Jour
nal of Biological Chemistry. 2013;288(51):36338-50.
[22] Oppenheim RD, Creek DJ, Macrae JI, Modrzynska KK, Pino P, Limenitakis J, Polo
nais V, Seeber F, Barrett MP, Billker O, et al. BCKDH: the missing link in apicomplex
an mitochondrial metabolism is required for full virulence of Toxoplasma gondii and
Plasmodium berghei. PLoS Pathogens. 2014;10(7):e1004263.
[23] Halestrap AP. The monocarboxylate transporter familystructure and functional
characterization. IUBMB Life. 2012;64(1):1-9.
[24] Hikosaka K, Hirai M, Komatsuya K, Ono Y, Kita K. Lactate retards the development
of erythrocytic stages of the human malaria parasite Plasmodium falciparum. Parasitol
ogy International. 2015;64(3):301-3.
[25] Foth BJ, Stimmler LM, Handman E, Crabb BS, Hodder AN, McFadden GI. The ma
laria parasite Plasmodium falciparum has only one pyruvate dehydrogenase com
plex, which is located in the apicoplast. Molecular Microbiology. 2005;55(1):39-53.
[26] Mogi T, Kita K. Diversity in mitochondrial metabolic pathways in parasitic protists
Plasmodium and Cryptosporidium. Parasitology International. 2010;59(3):305-12.
[27] Takeo S, Kokaze A, Ng CS, Mizuchi D, Watanabe JI, Tanabe K, Kojima S, Kita K. Suc
cinate dehydrogenase in Plasmodium falciparum mitochondria: molecular characteri
zation of the SDHA and SDHB genes for the catalytic subunits, the flavoprotein (Fp)
and iron-sulfur (Ip) subunits. Molecular and Biochemical Parasitology. 2000;107(2):
191-205.
[28] Kawahara K, Mogi T, Tanaka TQ, Hata M, Miyoshi H, Kita K. Mitochondrial dehy
drogenases in the aerobic respiratory chain of the rodent malaria parasite Plasmodium
yoelii yoelii. Journal of Biochemistry. 2009;145(2):229-37.
[29] Takashima E, Takamiya S, Takeo S, Mi-ichi F, Amino H, Kita K. Isolation of mito
chondria from Plasmodium falciparum showing dihydroorotate dependent respiration.
Parasitology International. 2001;50(4):273-8.
[30] Suraveratum N, Krungkrai SR, Leangaramgul P, Prapunwattana P, Krungkrai J. Pu
rification and characterization of Plasmodium falciparum succinate dehydrogenase.
Molecular and Biochemical Parasitology. 2000;105(2):215-22.
[31] Morales J, Mogi T, Mineki S, Takashima E, Mineki R, Hirawake H, Sakamoto K,
Omura S, Kita K. Novel mitochondrial complex II isolated from Trypanosoma cruzi is
composed of 12 peptides including a heterodimeric Ip subunit. Journal of Biological
Chemistry. 2009;284:7255-63.

http://dx.doi.org/10.5772/61283
[32] Kita K, Takamiya S, Furushima R, Ma YC, Suzuki H, Ozawa T, Oya H. Electrontransfer complexes of Ascaris suum muscle mitochondria. III. Composition and fuma
rate reductase activity of complex II. Biochimical et Biophysica Acta. 1988;935:130-40.
[33] Mi-Ichi F, Miyadera H, Kobayashi T, Takamiya S, Waki S, Iwata S, Shibata S, Kita K.
Parasite mitochondria as a target of chemotherapy: inhibitory effect of licochalcone A
on the Plasmodium falciparum respiratory chain. Annals of the New York Academy of
Science. 2005;1056:46-54.
[34] Miyadera H, Shiomi K, Ui H, Yamaguchi Y, Masuma R, Tomoda H, Miyoshi H, Osa
nai A, Kita K, Omura S. Atpenins, potent and specific inhibitors of mitochondrial
complex II (succinate-ubiquinone oxidoreductase). Proceedings of the National
Academy of Sciences of the United States of America. 2003;100:473-7.
[35] Sakai C, Tomitsuka E, Miyagishi M, Harada S, Kita K. Type II Fp of human mito
chondrial respiratory complex II and its role in adaptation to hypoxia and nutritiondeprived conditions. Mitochondrion. 2013;13:602-9.
[36] Tanaka TQ, Hirai M, Watanabe Y, Kita K. Toward understanding the role of mito
chondrial complex II in the intraerythrocytic stages of Plasmodium falciparum: gene
targeting of the Fp subunit. Parasitology International. 2012;61(4):726-8.
[37] Hino A, Hirai M, Tanaka TQ, Watanabe Y, Matsuoka H, Kita K. Critical roles of the
mitochondrial complex II in oocyst formation of rodent malaria parasite Plasmodium
berghei. Journal of Biochemistry. 2012;152(3):259-68.
[38] Molenaar D, van der Rest ME, Petrovic S. Biochemical and genetic characterization of
the membrane-associated malate dehydrogenase (acceptor) from Corynebacterium
glutamicum. European Journal of Biochemistry/FEBS. 1998;254(2):395-403.
[39] Uyemura SA, Luo S, Vieira M, Moreno SN, Docampo R. Oxidative phosphorylation
and rotenone-insensitive malate- and NADH-quinone oxidoreductases in Plasmodi
um yoelii yoelii mitochondria in situ. Journal of Biological Chemistry. 2004;279(1):
385-93.
[40] van der Rest ME, Frank C, Molenaar D. Functions of the membrane-associated and
cytoplasmic malate dehydrogenases in the citric acid cycle of Escherichia coli. Journal
of Bacteriology. 2000;182(24):6892-9.
[41] Fisher N, Bray PG, Ward SA, Biagini GA. The malaria parasite type II NADH:qui
none oxidoreductase: an alternative enzyme for an alternative lifestyle. Trends in
Parasitology. 2007;23(7):305-10.
[42] Krungkrai J. Purification, characterization and localization of mitochondrial dihy
droorotate dehydrogenase in Plasmodium falciparum, human malaria parasite. Biochi
mica et Biophysica Acta. 1995;1243(3):351-60.
[43] LeBlanc SB, Wilson CM. The dihydroorotate dehydrogenase gene homologue of Plas
modium falciparum. Molecular and Biochemical Parasitology. 1993;60(2):349-51.
33
34
[44] Danne JC, Gornik SG, Macrae JI, McConville MJ, and Waller RF. Alveolate mitochon
drial metabolic evolution: dinoflagellates force reassessment of the role of parasitism
as a driver of change in apicomplexans. Molecular Biology and Evolution. 2013;30(1):
123-39.
[45] Sheiner L, Vaidya AB, McFadden GI. The metabolic roles of the endosymbiotic or
ganelles of Toxoplasma and Plasmodium spp. Current Opinion in Microbiology.
2013;16(4):452-8.
[46] Melo AM, Bandeiras TM, Teixeira M. New insights into type II NAD(P)H:quinone
oxidoreductases. Microbiology and Molecular Biology Reviews. 2004;68(4):603-16.
[47] Fry M, Webb E, Pudney M. Effect of mitochondrial inhibitors on adenosinetriphos
phate levels in Plasmodium falciparum. Comparative Biochemistry and Physiology. B,
Comparative Biochemistry. 1990;96(4):775-82.
[48] Saleh A, Friesen J, Baumeister S, Gross U, Bohne W. Growth inhibition of Toxoplasma
gondii and Plasmodium falciparum by nanomolar concentrations of 1-hydroxy-2-dodec
yl-4(1H)quinolone, a high-affinity inhibitor of alternative (type II) NADH dehydro
genases. Antimicrobial Agents and Chemotherapy. 2007;51(4):1217-22.
[49] Boysen KE, Matuschewski K. Arrested oocyst maturation in Plasmodium parasites
lacking type II NADH:ubiquinone dehydrogenase. Journal of Biological Chemistry.
2011;286(37):32661-71.
[50] Gutteridge WE, Dave D, Richards WH. Conversion of dihydroorotate to orotate in
parasitic protozoa. Biochimica et Biophysica Acta. 1979;582(3):390-401.
[51] Fry M, Pudney M. Site of action of the antimalarial hydroxynaphthoquinone, 2[trans-4-(4-chlorophenyl) cyclohexyl]-3-hydroxy-1,4-naphthoquinone (566C80). Bio
chemical Pharmacology. 1992;43(7):1545-53.
[52] Srivastava IK, Rottenberg H, Vaidya AB. Atovaquone, a broad spectrum antiparasitic
drug, collapses mitochondrial membrane potential in a malarial parasite. Journal of
Biological Chemistry. 1997;272(7):3961-6.
[53] Balabaskaran Nina P, Morrisey JM, Ganesan SM, Ke H, Pershing AM, Mather MW,
Vaidya AB. ATP synthase complex of Plasmodium falciparum: dimeric assembly in mi
tochondrial membranes and resistance to genetic disruption. Journal of Biological
Chemistry. 2011;286(48):41312-22.
[54] Balabaskaran Nina P, Dudkina NV, Kane LA, van Eyk JE, Boekema EJ, Mather MW,
Vaidya AB. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena
thermophila. PLoS Biology. 2010;8(7):e1000418.
[55] Allen RD, Schroeder CC, Fok AK. An investigation of mitochondrial inner mem
branes by rapid-freeze deep-etch techniques. Journal of Cell Biology. 1989;108(6):
2233-40.

http://dx.doi.org/10.5772/61283
[56] Daily JP, Scanfeld D, Pochet N, Le Roch K, Plouffe D, Kamal M, Sarr O, Mboup S,
Ndir O, Wypij D, et al. Distinct physiological states of Plasmodium falciparum in ma
laria-infected patients. Nature. 2007;450(7172):1091-5.
[57] Uyemura SA, Luo S, Moreno SN, Docampo R. Oxidative phosphorylation, Ca(2+)
transport, and fatty acid-induced uncoupling in malaria parasites mitochondria.
Journal of Biological Chemistry. 2000;275(13):9709-15.
[58] Preiser PR, Wilson RJ, Moore PW, McCready S, Hajibagheri MA, Blight KJ, Strath M,
and Williamson DH. Recombination associated with replication of malarial mito
chondrial DNA. EMBO Journal. 1996;15(3):684-93.
[59] Vaidya AB, Arasu P. Tandemly arranged gene clusters of malarial parasites that are
highly conserved and transcribed. Molecular and Biochemical Parasitology.
1987;22(2-3):249-57.
[60] Feagin JE, Gardner MJ, Williamson DH, Wilson RJ. The putative mitochondrial ge
nome of Plasmodium falciparum. Journal of Protozoology. 1991;38(3):243-5.
[61] Feagin JE, Werner E, Gardner MJ, Williamson DH, Wilson RJ. Homologies between
the contiguous and fragmented rRNAs of the two Plasmodium falciparum extrachro
mosomal DNAs are limited to core sequences. Nucleic Acids Research. 1992;20(4):
879-87.
[62] Feagin JE, Mericle BL, Werner E, Morris M. Identification of additional rRNA frag
ments encoded by the Plasmodium falciparum 6 kb element. Nucleic Acids Research.
1997;25(2):438-46.
[63] Feagin JE, Harrell MI, Lee JC, Coe KJ, Sands BH, Cannone JJ, Tami G, Schnare MN,
Gutell RR. The fragmented mitochondrial ribosomal RNAs of Plasmodium falciparum.
PloS One. 2012;7(6):e38320.
[64] Sharma A, Sharma A. Plasmodium falciparum mitochondria import tRNAs along
with an active phenylalanyl-tRNA synthetase. Biochemical Journal. 2015;465(3):
459-69.
[65] Chavalitshewinkoon-Petmitr P, Chawprom S, Naesens L, Balzarini J, Wilairat P. Par
tial purification and characterization of mitochondrial DNA polymerase from Plas
modium falciparum. Parasitology International. 2000;49(4):279-88.
[66] Vaidya AB, Mather MW. Atovaquone resistance in malaria parasites. Drug Resist
ance Updates. 2000;3(5):283-7.
[67] Vaidya AB, Lashgari MS, Pologe LG, Morrisey J. Structural features of Plasmodium
cytochrome b that may underlie susceptibility to 8-aminoquinolines and hydroxy
naphthoquinones. Molecular and Biochemical Parasitology. 1993;58(1):33-42.
35
36
[68] Nyola A, Hunte C. A structural analysis of the transient interaction between the cyto
chrome bc1 complex and its substrate cytochrome c. Biochemical Society Transac
tions. 2008;36(Pt 5):981-5.
[69] Trumpower BL, Gennis RB. Energy transduction by cytochrome complexes in mito
chondrial and bacterial respiration: the enzymology of coupling electron transfer re
actions to transmembrane proton translocation. Annual Review of Biochemistry.
1994;63:675-716.
[70] Sutherland CJ, Laundy M, Price N, Burke M, Fivelman QL, Pasvol G, Klein JL, Chio
dini PL. Mutations in the Plasmodium falciparum cytochrome b gene are associated
with delayed parasite recrudescence in malaria patients treated with atovaquoneproguanil. Malaria Journal. 2008;7(240).
[71] Fivelman QL, Butcher GA, Adagu IS, Warhurst DC, Pasvol G. Malarone treatment
failure and in vitro confirmation of resistance of Plasmodium falciparum isolate from
Lagos, Nigeria. Malaria Journal. 2002;1(1).
[72] Schwartz E, Bujanover S, Kain KC. Genetic confirmation of atovaquone-proguanil-re
sistant Plasmodium falciparum malaria acquired by a nonimmune traveler to East Afri
ca. Clinical Infectious Diseases. 2003;37(3):450-1.
[73] Wichmann O, Muehlberger N, Jelinek T, Alifrangis M, Peyerl-Hoffmann G, Muhlen
M, Grobusch MP, Gascon J, Matteelli A, Laferl H, et al. Screening for mutations relat
ed to atovaquone/proguanil resistance in treatment failures and other imported iso
lates of Plasmodium falciparum in Europe. Journal of Infectious Diseases. 2004;190(9):
1541-6.
[74] Syafruddin D, Siregar JE, Marzuki S. Mutations in the cytochrome b gene of Plasmo
dium berghei conferring resistance to atovaquone. Molecular and Biochemical Parasi
tology. 1999;104(2):185-94.
[75] di Rago JP, Coppee JY, Colson AM. Molecular basis for resistance to myxothiazol,
mucidin (strobilurin A), and stigmatellin. Cytochrome b inhibitors acting at the cen
ter o of the mitochondrial ubiquinol-cytochrome c reductase in Saccharomyces cerevi
siae. Journal of Biological Chemistry. 1989;264(24):14543-8.
[76] Howell N, Gilbert K. Mutational analysis of the mouse mitochondrial cytochrome b
gene. Journal of Molecular Biology. 1988;203(3):607-18.
[77] Siregar JE, Syafruddin D, Matsuoka H, Kita K, Marzuki S. Mutation underlying re
sistance of Plasmodium berghei to atovaquone in the quinone binding domain 2
(Qo(2)) of the cytochrome b gene. Parasitology International. 2008;57(2):229-32.
[78] Fisher N, Abd Majid R, Antoine T, Al-Helal M, Warman AJ, Johnson DJ, Lawrenson
AS, Ranson H, O'Neill PM, Ward SA, et al. Cytochrome b mutation Y268S conferring
atovaquone resistance phenotype in malaria parasite results in reduced parasite bc1

http://dx.doi.org/10.5772/61283
catalytic turnover and protein expression. Journal of Biological Chemistry.

2012;287(13):9731-41.
[79] Siregar JE, Kurisu G, Kobayashi T, Matsuzaki M, Sakamoto K, Mi-Ichi F, Watanabe
YI, Hirai M, Matsuoka H, Syafruddin D, et al. Direct evidence for the atovaquone ac
tion on the Plasmodium cytochrome bc complex. Parasitology International. 2014. pii:
S1383-5769(14)00133-0. doi: 10.1016/j.parint.2014.09.011.
[80] Birth D, Kao WC, Hunte C. Structural analysis of atovaquone-inhibited cytochrome
bc1 complex reveals the molecular basis of antimalarial drug action. Nature Commu
nications. 2014;5(4029).
[81] Capper MJ, O'Neill PM, Fisher N, Strange RW, Moss D, Ward SA, Berry NG, Law
renson AS, Hasnain SS, Biagini GA, et al. Antimalarial 4(1H)-pyridones bind to the
Qi site of cytochrome bc1. Proceedings of the National Academy of Sciences of the
United States of America. 2015;112(3):755-60.
[82] Xiang H, McSurdy-Freed J, Moorthy GS, Hugger E, Bambal R, Han C, Ferrer S, Gar
gallo D, Davis CB. Preclinical drug metabolism and pharmacokinetic evaluation of
GW844520, a novel anti-malarial mitochondrial electron transport inhibitor. Journal
of Pharmaceutical Sciences. 2006;95(12):2657-72.
[83] Jimenez-Diaz MB, Mulet T, Viera S, Gomez V, Garuti H, Ibanez J, Alvarez-Doval A,
Shultz LD, Martinez A, Gargallo-Viola D, et al. Improved murine model of malaria
using Plasmodium falciparum competent strains and non-myelodepleted NOD-scid
IL2Rgammanull mice engrafted with human erythrocytes. Antimicrobial Agents and
Chemotherapy. 2009;53(10):4533-6.
[84] Heinemann IU, Jahn M, Jahn D. The biochemistry of heme biosynthesis. Archives of
Biochemistry and Biophysics. 2008;474(2):238-51.
[85] Shemin D, Russell CS, and Abramsky T. The succinate-glycine cycle. I. The mecha
nism of pyrrole synthesis. Journal of Biological Chemistry. 1955;215(2):613-26.
[86] Ohgari Y, Nakayasu Y, Kitajima S, Sawamoto M, Mori H, Shimokawa O, Matsui H,
Taketani S. Mechanisms involved in delta-aminolevulinic acid (ALA)-induced photo
sensitivity of tumor cells: relation of ferrochelatase and uptake of ALA to the accu
mulation of protoporphyrin. Biochemical Pharmacology. 2005;71(1-2):42-9.
[87] Barr H, Dix AJ, Kendall C, and Stone N. Review article: the potential role for photo
dynamic therapy in the management of upper gastrointestinal disease. Alimentary
Pharmacology and Therapeutics. 2001;15(3):311-21.
[88] Ishizuka M, Abe F, Sano Y, Takahashi K, Inoue K, Nakajima M, Kohda T, Komatsu
N, Ogura S, Tanaka T. Novel development of 5-aminolevurinic acid (ALA) in cancer
diagnoses and therapy. International Immunopharmacology. 2011;11(3):358-65.
[89] Varadharajan S, Dhanasekaran S, Bonday ZQ, Rangarajan PN, Padmanaban G. In
volvement of delta-aminolaevulinate synthase encoded by the parasite gene in de no
37
38
vo haem synthesis by Plasmodium falciparum. Biochemical Journal. 2002;367(Pt 2):

321-7.
[90] Sato S, Clough B, Coates L, Wilson RJ. Enzymes for heme biosynthesis are found in
both the mitochondrion and plastid of the malaria parasite Plasmodium falciparum.
Protist. 2004;155(1):117-25.
[91] Nagaraj VA, Sundaram B, Varadarajan NM, Subramani PA, Kalappa DM, Ghosh SK,
Padmanaban G. Malaria parasite-synthesized heme is essential in the mosquito and
liver stages and complements host heme in the blood stages of infection. PLoS Patho
gens. 2013;9(8):e1003522.
[92] Padmanaban G, Nagaraj VA, Rangarajan PN. An alternative model for heme biosyn
thesis in the malarial parasite. Trends in Biochemical Sciences. 2007;32(10):443-9.
[93] Smith TG, Kain KC. Inactivation of Plasmodium falciparum by photodynamic excita
tion of heme-cycle intermediates derived from delta-aminolevulinic acid. Journal of
Infectious Diseases. 2004;190(1):184-91.
[94] Komatsuya K, Hata M, Balogun EO, Hikosaka K, Suzuki S, Takahashi K, Tanaka T,
Nakajima M, Ogura S, Sato S, et al. Synergy of ferrous ion on 5-aminolevulinic acidmediated growth inhibition of Plasmodium falciparum. Journal of Biochemistry.
2013;154(6):501-4.
[95] Iyer JK, Shi L, Shankar AH, Sullivan DJ, Jr. Zinc protoporphyrin IX binds heme crys
tals to inhibit the process of crystallization in Plasmodium falciparum. Molecular Medi
cine. 2003;9(5-8):175-82.
[96] Dougherty TJ, Gomer CJ, Henderson BW, Jori G, Kessel D, Korbelik M, Moan J, Peng
Q. Photodynamic therapy. Journal of the National Cancer Institute. 1998;90(12):
889-905.
[97] Suzuki S, Hikosaka K, Balogun EO, Komatsuya K, Niikura M, Kobayashi F, Takaha
shi K, Tanaka T, Nakajima M, Kita K. In vivo curative and protective potential of oral
ly administrated 5-aminolevulinic acid plus ferrous ion against malaria.
Antimicrobial Agents and Chemotherapy. 2015. pii: AAC.01910-15.doi: 10.1128/AAC.
01910-15.
Chapter 3
Recent Advances in Antimalarial Drug Discovery

Challenges and Opportunities
Chiranjeev Sharma and Satish Kumar Awasthi
http://dx.doi.org/10.5772/61191
Abstract
Malaria drug discovery is a challenging and difficult task due to the unavailability
of the vaccine and lack of newer drugs. The most potent artemisinin and its deriva
tives, widely used in combination therapies for curing malaria worldwide are also
now falling to resistance in some parts of the world. Thus, to combat malaria, new
drugs possessing high therapeutic value, minimal toxicity, rapid efficacy and low
cost are urgently needed. In this chapter, we will provide an integrated overview on
the challenges and opportunities in malaria drug discovery with more emphasis on
synthesis of peroxidic antimalarials.
Keywords: Natural Products, Quinine, Chloroquine, Artemisinin, Trioxane, Tet
raoxane, Malaria, Antimalarials
1. Introduction
1.1. History
The chronicle of malaria predating humanity is as ancient as mankind.[1] Malaria continues
to be a persistent menace wreaking havoc especially in tropical and subtropical regions despite
tremendous efforts toward its control and eradication. The unavailability of the vaccine and
the emergence of resistance in the parasite against nearly all existing antimalarial drugs have
attracted attention of researchers to modify the existing antimalarial drugs with improved
efficacy over older therapies and identify new compounds as appropriate clinical candidate.
Mortality from malaria is increasing at an alarming rate despite various renewed efforts and
40
eradication campaigns[2] because the parasites (Plasmodium strains) responsible for the
majority of fatal infections have become resistant to the existing drugs. Malaria is also the cause
of poverty and a major hindrance to economic development, especially in sub-Saharan
countries.[3] Mostly, malaria is spread due to local transmission through female anopheles
mosquitoes. Occasionally, it can also be transmitted by exposure to infected blood products
(transfusion malaria) and also through congenital transmission. The major species of Plasmo
dium strains that infect humans are P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi.
Among these, P. falciparum causes the most severe form of infection, which could be fatal.
The original picture of the parasitic existence and passage of malaria through historic times
remains blurred. It is uncertain whether the human population settlements preceded the
arrival of malaria within them.[3] The versions may vary from tentative to widely accepted or
even controversial based on the general scientific evidence. However, the effect of malaria
wreaking havoc to the human species is prominent, clear, and unmistakable. There was no
specific treatment for malaria until the 17th century.[4] The discovery of quinine from the bark
of Cinchona calisaya began effective treatment of malaria. Further, the synthesis of chloroquine
by Hans Andersag in 1934 introduced a cheap antimalarial drug and a substitute for quinine.
[5] Until the widespread resistance in 1960, quinoline-related antimalarial drugs played an
important role in the treatment of malaria. Fortunately, in 1972, the Chinese discovered
artemisinin from sweet wormwood plant Artemisia annua.[6] Artemisinin along with its
derivatives artemether, arteether (artemotil), and artesunate are the main treatment for malaria
that is resistant to conventional therapies.
Recent advances in the molecular genetics and biochemical technologies available for the
investigation of malaria parasites within the last half century have enabled us to gain a unique
perspective on the human health and health services in relation to malaria.[7]
1.2. Life cycle of malaria parasite
The life cycle of malaria parasites is very complex. It is completed inside two hosts, including
the humans (asexual) and the mosquitoes (sexual) (Figure 1).[8, 9] Malaria infection begins
when an infected female anopheles mosquito feeding on human blood bites and injects
sporozoites into the bloodstream. The parasites then quickly reach liver to form merozoites by
asexual multiplication. Subsequently, merozoites exit liver with the rupture of hepatic tissues
and enter the bloodstream where they invade and disintegrate red blood cells. Some mero
zoites transform into gametocytes, which are then circulated in the bloodstream. When the
second mosquito bites an infected human, it gets infected and intakes gametocytes. The sexual
transformation of gametocytes into ookinetes and ookinetes into oocyst takes place inside the
midgut of mosquito. Finally, sporozoites are developed from oocysts, which eventually burst,
releasing sporozoites into the salivary gland. Continued infection in humans and mosquitoes
alternatively propagates and spreads malaria.
A comparative study with human and rodent parasites revealed the activities of current
antimalarial drugs on the life cycle stages of plasmodium.[10] 8-Aminoquinolones are known
to be active for liver stage. The most currently available antimalarial drugs primarily target
the human blood cell stage. In addition to the asexual blood stage, some drugs (viz., pyronar
Recent Advances in Antimalarial Drug Discovery Challenges and Opportunities

http://dx.doi.org/10.5772/61191
Figure 1. Life cycle of malaria parasite.[9]
idine and atovaquone) can also target both liver and sexual stage. Further, new stable synthetic
endoperoxides can inhibit gamete formation and gametocyte maturation.[10] Furthermore, it
is important to profile the currently available drugs for specific stage in parasites life cycle to
combat malaria by eradication and circumventing resistance.
1.3. Status quo
WHO has recommended artemisinin combination therapy (ACT) for the treatment of malaria.
[11] Since 2006, artemisinin-based combination therapies remain as the first-line treatment for
P. falciparum malaria replacing chloroquine and sulfadoxine/pyrimethamine. Combined with
other drugs, its derivatives, such as artesunate and artemether, can clear symptoms of malaria
in three days. However, a rise in demand has led to a shortage of artemisinin. Artemisininbased drugs are also more expensive than conventional treatments, in part because large doses
are required. Further, with recent reports on the emergence of resistance to artemisinin,[12] it
can be foreseen that in the near future, new armamentarium will be required to fight against
malaria. Thus, to overcome this problem, there is an urgent need to identify new chemotypes
or reexamining old molecules to transform them into an appropriate clinical candidate.
2. Drug resistance
The greatest challenge to malaria control and eradication is the emergence of malaria parasites
that are resistant to antimalarial drugs.[13] The reemergence of malaria from the areas where
41
42
it was eradicated and spread of malaria to new areas is a major threat. The World Health
Organization defined antimalarial drug resistance as the ability of a parasite strain to survive
and/or multiply despite the administration and absorption of a drug given in doses equal to
or higher than those usually recommended but within tolerance of the subject.[14] It was
modified later to specify that the drug in question must gain access to the parasite or the
infected red blood cell for the duration of the time necessary for its normal action.[15]
Antimalarial drug resistance occurs through spontaneous mutations that reduces the sensi
tivity to a given class of drug(s).[16] Only a single point mutation is sufficient to confer
resistance to some drugs, while multiple mutations appear to be required for others.
Sl. no
Drug class
Drug
Resistance
Chloroquine
Since 1945
Amodiaquine
Yes
Piperaquine
Since 1980s
Primaquine
Quinine
Yes
Mefloquine
Since 1985
7.
Lumefantrine
No
8.
Pyrimethamine
Since 1967
Trimethoprim
Yes
Proguanil
Since 2000
Sulfonamides
Yes
Atovaquone
Since 2000
1.
2.
4-Aminoquinoline
3.
4.
8-Aminoquinoline
5.
6.
9.
10.
Aryl-amino alcohol
Antifolates
11.
12.
13.
14.
Napthoquinone
Antibiotic
15.
16.
17.
Artemisinin
Doxycycline
Clindamycin
No
Artesunate
Yes
Artemether
Since 2001
Mechanism of action
Inhibition of hemozoin
formation
Unknown
Unknown
Inhibition of DHFR
Inhibition cytochrome
Inhibition of protein
synthesis and apicoplast
Free radical mechanism

Heme alkylation
Dihydroartemisinin
Table 1. Status of resistance in antimalarial drugs.
The malaria parasite has developed some level of resistance against nearly all previous
generation antimalarial drugs (Table 1). Recent research has confirmed evidence of artemisinin
resistance.[10] Although it is under investigation, immediate actions are needed to restrict
resistance to artemisinin from spreading to new areas. It is high time that we should fight this

http://dx.doi.org/10.5772/61191
overwhelming menace with improved tools to aim at controlling the mosquito vector and
develop new armaments; otherwise, the future looks bleak and grim.
3. Mechanism of action
The mechanism of action of antimalarial drugs is based on the extensive studies of selected
drugs. Most drugs available for the treatment were discovered based on the serendipitous
identification of active compounds (natural, synthetic, and semisynthetic).[17] The progress
in the understanding of the biochemistry of malarial parasite has shed light on the mechanism
of action of new as well as older drugs.
It is believed that artemisinin and related drugs are transported to the food vacuole of the
parasite, where they generate free radicals upon interaction with Fe(II)-heme. These free
radicals interaction with heme generates oxidative stress and kills the parasite.[18] The
mechanism of action of quinoline and related drugs is also well established.[19] It is shown
that the drugs enter the RBC and inhabit the digestive vacuole of parasite by simple diffusion.
The subsequent inhibition of hemozoin biocrystallization leads to the aggregation and
accumulation of cytotoxic heme in food vacuoles resulting in parasites death. The commer
cially available quinolone antimalarials target the gyrase and inhibit DNA replication. It results
in the delayed death of treated parasites by formation of abnormal apicoplasts.[20]
Based on the mechanism of action, different groups of antimalarials can be classified as follows:
Artemisinin: binds heme iron and generates oxygen radicals
Antifolate: inhibits DNA synthesis
Atovaquone: collapses mitrochondrial membrane potential
Quinoline: inhibits heme crystallization
Antibacterial: ribosome and DNA gyrase inhibition
4. Toxicity of the antimalarial drugs

The most important determinant of drug use and its effectiveness is the patient compliance.
The toxicity of the drug must be balanced with the efficacy of the drug and the risk from
malaria, i.e., the drug should cause less harm than the disease itself. The doses given to the
patients should be taken into account in determining the treatment of malaria. The assessment
of the tolerability of many antimalarial drugs is ongoing, but evaluating adverse drug
reactions, events, side effects, and drug-related toxicity is difficult due to the unavailability of
good techniques to measure the side effects.[21]
The most promising naturally occurring sesquiterpene lactone drug and its derivatives
(artemether, arteether, and sodium artesunate) did not show any serious side effects. However,
43
44
insufficient clinical trials to detect the toxicity stopped us from declaring artemisinin 100%
safe. However, they have excellent safety profile and remarkable efficacy. The current
knowledge obtained from the laboratory and clinical study is that the long-term availability
of artemisinins may cause toxicity (rarely produce neurotoxicity and allergic reactions).[22]
The short-term peak concentrations followed by rapid elimination of artemisinins after oral
intake is relatively safe compared to administration by intramuscular injection. Evidently, the
majority of animal experiments showed considerable toxicities in contrast to human studies.
Chloroquine, considered being a safe drug even at higher doses, also causes mild side effects
such as reversible effect on optical accommodation, which can potentially affect eyesight. It
also binds irreversibly to melanin. Hence, the patients with rheumatoid arthritis treated with
the long-term use of high dose chloroquine suffer from accumulation of chloroquine in retinal
melanin. Some reports also suggest that chloroquine administered to patients with light
intolerant disease can aggravate psoriasis.[22] Proguanil is also assumed to be safe at a dose
of 200 mg a day. However, for doses higher than 200 mg, there are reports of reversible alopecia
and aphthous ulceration, nausea, and gastric irritation.[23] These side effects are common with
other antimalarial agents as well. The combination of chloroquine with proguanil has good
tolerability. However, gastrointestinal upset and mouth ulcers are still observed. Sulfadoxine/
pyrimethamine is also well tolerated, but it is no longer used because it causes StevensJohnson
syndrome and toxic epidermal necrolysis. Mefloquine is another valuable drug for the
treatment of malaria. Despite good tolerability to most patients, dose-related serious neuro
psychiatric toxicity can occur. Cardiovascular or CNS toxicity is rare for quinine but hypogly
cemia may occur. Further, due to its potential for cardiotoxicity, halofantrine is unsuitable for
widespread use. Mepacrine, sulfonamides, dapsone, and amodiaquine are also withdrawn
from the use because of the high frequency of adverse side effects.[24]
5. Malaria vaccine
Malaria vaccine development is a challenging and difficult task because of the antigenic
complexity and the complex life cycle of malaria parasite. Research on the development of
malaria vaccine is of prime importance because such a discovery can prevent millions of deaths
worldwide. The currently available tools are insufficient for malaria eradication. Malaria
vaccine could be a transformative tool to help in reduced transmission and future eradication.
Extensive research has been carried out in the last two decades, and several vaccines have
reached clinical trials, but there is none in the clinical practice due to insufficient immunoge
nicity. Although parasite vaccines are in development, there is no FDA-approved vaccine for
organisms more complex than viruses and bacteria.[25]
5.1. Scientific challenges
The significant hurdle in the development of malaria vaccine is insufficient knowledge about
the malaria parasite. Understanding the structure and antigenic variation of parasite popula

http://dx.doi.org/10.5772/61191
tion requires lengthy, tedious, and difficult lab and field studies. Antigenic variation and
parasite polymorphism also create a major scientific barrier. Unfortunately, in nature, there
are not many good examples of immunity to malaria, and many vaccine development
programs are based only on naturally acquired immunity. Since the mechanism of immune
protection is still unknown, it is difficult to comprehend why certain people are protected while
others are not. Inadequate animal models and lack of clarity in the definition of desired
outcomes create confusion in choosing the best approach to develop a malaria vaccine. Even
in particular animal model systems with defined outcomes, there is always uncertainty in
translating the success of protection in the model systems with success in humans.[26]
The malaria vaccine development includes recombinant proteins, gene-based (DNA or viral
vector) vaccines, attenuated whole organisms, peptides, and prime-boost strategy, which
involves a combination of different antigen delivery systems encoding the same epitopes or
antigen using various adjuvants. Reports dating back to 1960s[26] demonstrated speciesspecific and strain cross-reactive protection on immunization with radiation-attenuated
sporozoites in primate and experimental rodent models. Studies showed optimistic levels of
protective immunity. However, the volunteers immunized against multiple strains of P.
falciparum malaria were not protected against P. vivax. The target antigens were identified from
the sera cells of experimental hosts immunized with attenuated sporozoite vaccine and
protected volunteers. Circumsporozoite protein, the first cloned and sequenced malaria
parasite in P. knowlesi and P. falciparum, is also the first antigen identified by serological
screening. It plays an important role in protection. When the sporozoite was irradiated in the
rodent models, antibody and cells showed different roles in malaria species and different
strains. Although multifaceted cellular responses are observed, the basic mechanism of
immunity is believed to target the intracellular hepatic exoerythrocytic forms by the produc
tion of interferon. The antibody eliminates most of the infectious sporozoite inoculum, when
the vaccines prove a multipronged approach. The cellular responses target the rest of the
intracellular exoerythrocytic forms by direct cytotoxicity or inhibitory cytokines.
The understanding of the research related to vaccine development is greatly benefitted by the
lessons learned from discontinued and inactive projects. Recent findings allow us to be
optimistic about the possibility of an effective malaria vaccine. Several malaria vaccine
candidates have entered field trials. It is now possible to impact the hostparasite relationship
using different platforms through vaccine-induced immune responses to multiple antigenic
targets. The field has grown rapidly over the last two decades from the first clinical trials to
the successful conduct of large-scale field studies, and substantial progress has been made in
evaluating many antigens. Despite the daunting task, researchers have produced surprising
progress in several areas. The malaria vaccination program has progressed to an assessment
and clinical evaluation of RTS,S/AS01E in phase 3 trial.[27] The first malaria vaccine may be
considered for licensure in the coming years. Further, there is a possibility of developing more
efficacious second-generation vaccines. Researchers are now better equipped to establish clear
product profiles. The lessons learned in terms of safety, immunogenicity, efficacy, and trial
methodology from malaria vaccine research is summarized in Table 2.
45
46
Parameters
Remarks
It is often lower in semi-immune populations living in endemic areas than in nave
Safety
populations
Reactogenicity in young children has not been worse than in adult populations
Immunogenicity
DNA alone is poorly immunogenic

Little clinically significant interference is observed between vaccine antigens and the
malarial antigen
Efficacy
Only RTS,S-based vaccines proved to be effective to reduce morbidity in endemic areas

Highly polymorphic blood-stage antigens have tended to lead to allele-specific efficacy, but
poor efficacy against the population of circulating strains
Methodology
In vitro studies and animal studies does not correlate well

For testing of new malaria vaccines, ethical and methodological issues may arise
There is a need to make formal trial design for phase trials and sample size calculations.
Epidemiological studies are required to assess the effectiveness of mosquito antigen vaccines
in sexual stage
Table 2. Lessons from two decades of malaria vaccine development research.
6. Antimalarial drugs
Malaria, existing in over 100 countries, is one of the deadliest infectious diseases and major
health problem worldwide. Antimalarial drugs are designed to cure malaria, many of which
are in market.[28] From the 17th century onward quinine had been the drug of choice for the
treatment of malaria. Later on, medication therapies heavily relied on chloroquine, prima
quine, mefloquine, etc.4 These drugs especially chloroquine have saved more lives than any
other drugs in history. Recently, artemisinin and its derivatives have emerged as a new
generation of antimalarials (Figure 2).
There is a critical need to develop newer synthetic and more effective drugs that could address
the issues associated with the existing and traditional drug therapies. The availability of
artemisinin also causes supply constraints because artemisinin and its derivatives constitute
an active ingredient of many combination therapy dugs. For example, Coartem contains a fixed
combination of artemether and lumefantrine. In 2012, Ranbaxy also launched a new synthetic
peroxide antimalarial drug SynriamTM in the market in line with the recommendations of the
WHO. It is a fixed dose combination of arterolane maleate and piperaquine phosphate. The
chemical structures are shown below.

http://dx.doi.org/10.5772/61191
Research groups across the world are united in the efforts to discover new chemicals for the treatment
of malaria. Attempts to modify the established drugs are also ongoing. Long-term hopes are resting
on the modification of the synthetic artemisinin-based drugs containing endoperoxide rings. The
following sections will mainly focus on the development of peroxidic antimalarial agents.
6.1 Natural products
Natural products continue to make an immense contribution to malaria chemotherapy. The discovery
of quinine and artemisinin proves that nature is a rich source of lead compounds that can provide cure
and medicine for malaria. Nature has been extremely generous when it comes to search of new
molecular scaffolds for good malarial activity. These scaffolds later serve as template for the
development of structurally diverse analogues with more potent activity.29 For example, quinine a
bitter-tasting alkaloid, is one of the earliest natural compounds that helped man in the fight against
malaria. It was isolated from the Cinchona bark. Later, it also served as a template for the synthesis of
more potent and structurally simpler analogues such as chloroquine, primaquine, mepacrine, and
mefloquine (Figure 2). Artemisinin extracted from Artemesia annua is another example whose
diverse pharmacological potential has attracted the researchers worldwide. Artemisinin also gave rise
to the development of dihydroxyartemisinin, artemether, arteether and artesunate. Thus, natural
products such as quinine and artemisinin have demonstrated the enormous potential of nature in
providing lead compounds, which can be further manipulated structurally for the development of
more effective antimalarial agents. Many more natural products possessing various chemical
structures, such as alkaloids, steroids, chalcones, terpenes, flavonoids, peptides, quinones, xanthones,
coumarines, naphthopyrones, polyketides, phenols, lignans, chromenes, etc., have been tested as
antimalarial drugs.3033
Figure 2. Antimalarial drugs.
47
48
Research groups across the world are united in the efforts to discover new chemicals for the
treatment of malaria. Attempts to modify the established drugs are also ongoing. Long-term
hopes are resting on the modification of the synthetic artemisinin-based drugs containing
endoperoxide rings. The following sections will mainly focus on the development of peroxidic
antimalarial agents.
6.1. Natural products
Natural products continue to make an immense contribution to malaria chemotherapy. The
discovery of quinine and artemisinin proves that nature is a rich source of lead compounds
that can provide cure and medicine for malaria. Nature has been extremely generous when it
comes to search of new molecular scaffolds for good malarial activity. These scaffolds later
serve as template for the development of structurally diverse analogues with more potent
activity.[29] For example, quinine a bitter-tasting alkaloid, is one of the earliest natural
compounds that helped man in the fight against malaria. It was isolated from the Cinchona
bark. Later, it also served as a template for the synthesis of more potent and structurally simpler
analogues such as chloroquine, primaquine, mepacrine, and mefloquine (Figure 2). Artemisi
nin extracted from Artemesia annua is another example whose diverse pharmacological
potential has attracted the researchers worldwide. Artemisinin also gave rise to the develop
ment of dihydroxyartemisinin, artemether, arteether and artesunate. Thus, natural products
such as quinine and artemisinin have demonstrated the enormous potential of nature in
providing lead compounds, which can be further manipulated structurally for the develop
ment of more effective antimalarial agents. Many more natural products possessing various
chemical structures, such as alkaloids, steroids, chalcones, terpenes, flavonoids, peptides,
quinones, xanthones, coumarines, naphthopyrones, polyketides, phenols, lignans, chromenes,
etc., have been tested as antimalarial drugs.[30, 33]
6.2. Semisynthetic drugs
The success of the most potent antimalarial drugs, quinine and artemisinin, has brought some
optimism. Due to the widespread emergence of drug-resistant chloroquine, primaquine,
mepacrine, and mefloquine (Figure 2) were developed. Despite the remarkable antimalarial
activity, artemisinin suffers from limited availability, low solubility, high cost, metabolic
stability, short half-life, poor bioavailability, and chemical stability. Thus, there is a need for
new compounds more active than the parent artemisinin. To circumvent some of these
problems, semisynthetic analogs were prepared. The reduction of artemisinin yields dihy
droartemisinin, and the lactol group can be further converted to its ether (artemether, arteether,
and artelinic acid) and ester (sodium artesunate) derivatives.[34]
6.3. Synthetic drugs
Artemisinin, a sesquiterpene endoperoxide, has established the role of peroxide ring for
potential antimalarial activity. However, the naturally isolated artemisinin is available in short
supply and expensive to synthesize. As a consequence, extensive research directed towards
the discovery of peroxidic antimalarials inspired researchers to explore structurally simple

http://dx.doi.org/10.5772/61191
peroxides. Trioxanes, tetraoxanes, and their hybrids were consequently identified as promis
ing candidates for the development of next generation antimalarial drugs.
6.3.1. Various synthetic procedures for the synthesis of trioxanes
Trioxanes can be synthesized from inexpensive starting materials, and their scale-up prepa
rations are feasible. Most methods reported for the synthesis of trioxanes starts with the
reaction of singlet oxygen with carbonyls in the presence of Lewis acids. Then acid-catalyzed
cyclization of hydroxyperoxides with olefins and reaction of -peroxy aldehydes with
carbonyl compound yields trioxanes in good yields. Many synthetic strategies were developed
for the synthesis 1,2,4-trioxanes, which are described below.
6.3.1.1. Photooxygenation method
Starting from commercially available cyclohexanediones, tricyclic 1,2,4-trioxanes can be
synthesized by following simple method. Briefly, photooxygenation of the electron-rich allylic
alcohols 1 using singlet oxygen gives -hydroxyperoxide 2. Further, -hydroxyperoxide 2 was
condensed with 1,4-cyclohexadiene followed by Lewis acid-mediated cyclization to give ketotrioxane 3. Amino functionalized trioxanes 4 were also synthesized on reductive amination
with various amines in the presence of sodium triacetoxy borohydride (Scheme 1).[35]
Sheme 1. Photooxygenation method for trioxane synthesis.
In another synthetic procedure, the geranyl acetate was transformed into aldehyde acetate 5,
which is converted into allylic alcohol 6. Photooxygenation of 6 followed by subsequent acid
catalyzed condensation of -hydroxyhydroperoxides 7 with various ketones resulted in the
formation of new 1,2,4-trioxanes 8 (Scheme 2).[36] The hydroxyl functionalized side chains can
be further manipulated for the synthesize of a diverse library of compounds.
49
50
Sheme 2. Synthesis of Geraniol derived 1,2,4-trioxanes.
6.3.1.2. Epoxidation method

The epoxidation of N-Boc piperidone 9 gives N-Boc spirooxirane 10. Dispiro N-Boc-protected
1,2,4-trioxane can then be synthesized by MoO2(acac)2 catalyzed perhydrolysis of N-Boc
spirooxirane 10, as shown in Scheme 3.[37] Subsequent condensation of the resulting hydroperoxy alcohol 11 with 2-adamantanone gives N-Boc 1,2,4-trioxane 12, which can be
converted into the amine 1,2,4-trioxane hydrochloride salt 13. Further, alkylation may result
in a diversified sulfonamide trioxane derivatives 14.
Sheme 3. Trioxane synthesis using epoxidation method.

http://dx.doi.org/10.5772/61191
6.3.1.3. Catalytic enantioselective synthesis

Trioxanes can also be synthesized by catalytic enantioselective synthesis. Para-cresol 15 is
converted into p-peroxyquinols 16. The desymmetrization of p-peroxyquinols 16 occurs via an
acetalization/oxa-Michael cascade reaction (Scheme 4).[38] The reaction proceeds via a
dynamic kinetic resolution of a peroxyhemiacetal intermediate. Various derivatized trioxanes
17 can be easily obtained by this method. The use of chiral Brnsted acid catalyst TRIP 18 gave
a single diastereomer trioxane 17 in 86% ee, while using bis-(2,4,6-triisopropylphenyl)spiro
biindane phosphoric acid 19 gave 96% ee. The use of thiourea 20 as cocatalyst helped to restore
the reactivity even at lower catalyst loading.
Sheme 4. Enantioselective synthesis of trioxanes.
6.3.1.4. Solid phase synthesis

The solid support synthesis of 1,2,4-trioxanes also needs light mediated oxygenation on
polystyrene polymer support. Wang and Rink amide resins can be used as linkers. The reaction
of resin-bound p-carboxybenzaldehydes 21 with excess of ionone derivatives 22 gave immo
bilized dienones 23 in the presence of LiOH in DME (Scheme 5).[39] Resin-bound trioxane 24
was obtained upon irradiation of compound 23 with UV light (354 nm) in toluene yielded.
After cleavage from the solid support, the formation of 25 was confirmed by 13C NMR. Peaks
at 82.4 and 94.4 ppm corresponded to the peroxy-bearing carbon and peroxyketal carbon of
the trioxane ring system.
6.3.2. Various synthetic procedures for the synthesis of tetraoxanes
The chemical modification of artemisinin retaining the crucial endoperoxide ring has resulted
in yet another simplified structure known as 1,2,4,5-tetraoxane. Tetraoxanes show significantly
higher stability and exhibit even higher activity than natural peroxidic drugs for curing malaria
51
52
Sheme 5. Solid phase trioxane synthesis.
infections. In 1899, Baeyer and Villiger reported the synthesis of the first dimeric acetone
peroxide upon treatment of acetone and Caros acid in ether. Since then, the field has moved
ahead significantly and newer synthetic routes and efficient methodologies were developed.
The synthesis can be carried out by several methods as described below.
6.3.2.1. Peroxidation method
The most commonly and widely used method for tetraoxane synthesis is known as peroxida
tion method. In this method, acid-catalyzed cyclocondensation of ketones or aldehydes gives
the gem-dihydroperoxide as an important active intermediate. Generally, the acid-catalyzed
addition of hydrogen peroxide to carbonyl compound 26 produce gem-dihydroperoxide 27,
which on subsequent cyclocondensation in the presence of strong acid such as sulfuric acid,
perchloric acid, or methanesulfuric acid yield more stable symmetrical tetraoxane 28 along
with side product hexaoxane 29, as shown in Scheme 6. It is also known that the trimeric cyclic
peroxide by-product hexaoxonane is formed in the presence of excess hydrogen peroxide.
Dimethyl sulfide and potassium iodide can be used for the removal of hydroperoxide-related
impurities. Hexaoxonanes could be removed by washing the reaction mixture with cold
methanol. [40]
In our lab, we also attempted the synthesis of a new series of tetraoxane by incorporating
nitrogen within the cyclohexyl ring. [41] Methyl 2-(4-oxopiperidin-1-yl)acetate 30 on reaction
with gem-dihydroperoxide 27 may give very small amount of tetraoxane 31 and trimer 29, as
shown in Scheme 7. We characterized hexaoxonane 29 as a main side product by spectroscopy
and x-ray crystallography.

http://dx.doi.org/10.5772/61191
Sheme 6. Acid catalyzed synthesis of tetraoxanes and hexaoxonanes.
Sheme 7. Synthesis of piperidinetetraoxane
6.3.2.2. One pot synthesis

Iskara et al.[42] developed the first one-pot synthesis of tetraoxane. Simple carbonyl com
pounds 32 in the presence of 30% H2O2, 0.1% MTO, and fluorous alcohols (TFE and HFIP)
selectively gives tetraoxanes 33 (Scheme 8). Fluorous solvents TFE and HFIP activate both
H2O2 and MTO for oxidation reactions. The one-pot synthesis of mixed tetraoxanes begins with
the oxidation of the most reactive carbonyl compound, and then less oxidizable carbonyl
compound is added in the presence of acid. In this reaction, no trimeric product is formed.
Sheme 8. One pot tetraoxane synthesis.
53
54
6.3.2.3. Ozonolysis method

The most prolific strategy for the synthesis of tetraoxanes is the ozonolysis of suitable olefins
and oximes. This method has dual advantage over others: (1) the absence of hexaoxonane (a
usual by-product), which is very common in acid catalyzed reactions, and (2) it is useful for
the synthesis of aromatic tetraoxanes, which could not be obtained by other methods. In the
1970s, Keul et al. reported the synthesis of dimeric adamantine peroxide 35 by ozonization of
methyleneadamantane 34 in pentane at 78C. The ozonolysis of valerophenone oxime omethyl ether 36 produces carbonyl oxide 38 via an intermediate ozonoid 37 to give the
crystalline dimeric valerophenone peroxides 39 in the absence of carbonyl compounds or
protic solvents.[43]
Sheme 9. Tetraoxane synthesis by ozonolysis method.
7. Prodrug and combination therapies

The search of newer drugs and the enhancement of antimalarial activity of the existing ones
have led to the development of prodrug and combination therapy approaches. It presents a
good platform for the usage of readily available drugs in combination with other effective
drugs. The potential of drug hybrids, prodrugs, and combination therapy as new approaches
are immense.[44]
Tetraoxaquine 40 contain two covalently linked pharmacophores, i.e., a tetraoxane (a radical
donor) and an aminoquinoline (interferes with hematin polymerization).[45] Moreover,
trioxaquine 41 contains covalently attached trioxane to a 4-aminoquinoline moiety.[46] The
chimeric drug penetrates (enabled by aminoquinoline) into infected erythrocyte and targets
the free heme. The hemoglobin digestion of the schizonts within infected red blood cells
liberates free heme, which is alkylated by the peroxidic part. Trioxaferroquine 42 consists of a
trioxane, a substituted quinoline, and an iron (II) species within a single structure.[47]

http://dx.doi.org/10.5772/61191
These new chimeric molecules containing two covalently attached moieties can be expected
to possess synergistic therapeutic value, reduce resistance, and toxicity. These strategies offer
a rational drug design approach for the development of next generation drug candidates.
Notwithstanding few selected examples, which are discussed in this section, it explains the
concept and potential applications.
O O
O O
HN
HN
N
H
NH
40
Cl
Cl
41
O
N
O O
Fe
Cl
42
8. Conclusion and future prospect

The development of new drugs for malaria presents a challenging situation. Lack of alterna
tives and increasing ineffectiveness of the existing drugs are the main reasons for increased
mortality. Traditional medicines have provided few drugs, but to combat malaria, new drugs
are urgently needed. These new drugs must ideally possess minimal toxicity, rapid efficacy,
and low cost. However, there is consensus among scientific community that drug combina
tions may create optimal control of malaria because the combination therapies are believed to
be additive in potency, provide synergistic activity, and is more advantageous than mono
therapies. Unfortunately, these requirements are not met by any combination at the current
window of time. Besides all the challenges, failures, and setbacks, the global importance of
fighting malaria is recognized. Dedicated efforts and academic engagement to discover,
develop, and deliver new, effective, and affordable antimalarials have thus increased dramat
ically. Natural products, semisynthetic drugs, and synthetic compounds offer vast opportunity
for the drug development process. Further, assessment and clinical evaluation of RTS,S/AS01E
for malaria vaccination offers hope that we may soon expect some good news. Malaria drug
discovery is undoubtedly challenging, but scientists are optimistic as they also have got various
opportunities too. The status quo seems balanced. However, we believe that we have to provoke
the status quo to gain the upper hand in the battle against this tropical scourge.
55
56
Acknowledgements
CS is thankful to UGC, New Delhi, for SRF. SKA acknowledges the financial support from the
University of Delhi, Delhi-110007, India.
Author details
Chiranjeev Sharma and Satish Kumar Awasthi*
*Address all correspondence to: skawasthi@chemistry.du.ac.in
Chemical Biology Laboratory, Department of Chemistry, University of Delhi, Delhi, India
References
[1] Poinar G. Plasmodium dominicana n. sp. (Plasmodiidae: Haemospororida) from Ter
tiary Dominican amber. Systematic Parasitology 2005; 61(1), 4752
[2] World Malaria Report 2014, http://www.who.int/malaria/publications/world_malar
ia_report_2014/en/ (accessed 21.03.2015).
[3] Eve WE, Basu S, Hanson K. Is malaria a disease of poverty? A review of the litera
ture. Tropical Medicine and International Health 2005; 10(10), 10471059.
[4] Greenwood D. Conflicts of interest: the genesis of synthetic antimalarial agents in
peace and war. Journal of Antimicrobial Chemotherapy 1995; 36(5), 857872.
[5] Krafts K, Hempelmann E, Skorska-Stania A. From methylene blue to chloroquine: a
brief review of the development of an antimalarial therapy. Parasitology Research
2012; 111(1), 16.
[6] Kayman DL. Qinghaosu (artemisinin): an antimalarial drug from China. Science 1985;
228(4703), 10491055.
[7] Neafsey DE, et al. Highly evolvable malaria vectors: the genomes of 16 Anopheles
mosquitoes. Science 2015; 347(6217), 1258522.
[8] Chang HH, Hartl DL. Recurrent bottlenecks in the malaria life cycle obscure signals
of positive selection. Parasitology 2015; 142(S1): S98S107.
[9] Neupane CS, Awasthi SK. In: Synthetic Quinolones: Emerging Antimalarial Agents.
A. Pandey (eds.), Antibacterial activity in natural and synthetic compounds.
2013,443-459.
[10] Delves M, Plouffe D, Scheurer C, Meister S, Wittlin S, Winzeler EA, Sinden RE, Leroy
D. The activities of current antimalarial drugs on the life cycle stages of plasmodium:

http://dx.doi.org/10.5772/61191
a comparative study with human and rodent parasites. PLOS Medicine 2012; 9(2):
e1001169/1e1001169/14.
[11] World Health Organization. Guidelines for the Treatment of Malaria. Second edition.
March 2010.
[12] Carter TE, Boulter A, Existe A, Romain JR, St. Victor JY, Mulligan CJ, Okech BA. Ar
temisinin resistance-associated polymorphisms at the K13-propeller locus are absent
in Plasmodium falciparum isolates from Haiti. American Journal of Tropical Medicine and
Hygiene 2015; 92(3), 552554.
[13] Hyde JE. Drug-resistant malariaan insight. FEBS Journal 2007; 274(18), 46884698.
[14] Peters W. History and current status of drug resistance. In: Peters W, Richards WHG.
(eds.), Antimalarial Drugs. Handbook of Experimental Pharmacology. 1984, pp. 423
445.
[15] World Health Organization. Guidelines for the Treatment of Malaria. 2006.
[16] White NJ. Antimalarial drug resistance. Journal of Clinical Investigation 2004; 113(8),
10841092.
[17] Schlesinger PH, Krogstad DJ, Herwaldt BL. Antimalarial agents: mechanism of ac
tion. Antimicrobial Agents and Chemotherapy 1988; 32(6), 793798.
[18] Meshnick SR. Artemisinin: mechanisms of action, resistance and toxicity. Internation
al Journal for Parasitology 2002; 32(13), 16551660.
[19] Bray PG, Ward SA, ONeill PM. Quinolines and artemisinin: chemistry, biology and
history. Current Topics in Microbiology and Immunology 2005; 295, 338.
[20] Biagini GA, et al. Generation of quinolone antimalarials targeting the Plasmodium fal
ciparum mitochondrial respiratory chain for the treatment and prophylaxis of malar
ia. Proceedings of the National Academy of Sciences of the United States of America 2012;
109(21), 82988303.
[21] Peto TE. Toxicity of antimalarial drugs. Journal of the Royal Society of Medicine 1989;
82(17), 3033.
[22] Wesche Dl, DeCoster MA, Tortella FC, Brewer TG. Neurotoxicity of artemisinin ana
logs in vitro. Antimicrobial Agents and Chemotherapy 1994; 38(8), 18131819.
[23] Davidson NM. Mouth ulceration associated with proguanil. Lancet 1986; 327(8477),
384.
[24] Taylor WBJ, White NJ. Antimalarial drug toxicity: a review. Drug Safety 2004; 27(1),
2561.
[25] Schwartz L, Brown GV, Genton B, Moorthy VS. A review of malaria vaccine clinical
projects based on the WHO rainbow table. Malaria Journal 2012; 11, 11.
57
58
[26] Graves PM, Levine MM. Battling Malaria: Strengthening the U.S. Military Malaria
Vaccine Program. 2006, pp. 2633.
[27] Olotu A, et al. Four-year efficacy of RTS,S/AS01E and its interaction with malaria ex
posure. New England Journal of Medicine 2013; 368(12), 11111120.
[28] Crowther GJ, et al. Identification of inhibitors for putative malaria drug targets
among novel antimalarial compounds. Molecular and Biochemical Parasitology 2011;
175(1), 2129.
[29] Guantai E, Chibale K. How can natural products serve as a viable source of lead com
pounds for the development of new/novel anti-malarials? Malaria Journal 2011,
10(Suppl 1):S2.
[30] Department of International Development. Medicines For Malaria Venture (MMV)
20052010. MMV in natural products: harnessing the power of nature in malaria
drug discovery. 2009, http://r4d.dfid.gov.uk/PDF/Outputs/MMV/MMV_in_Natu
ral_Products.pdf (accessed 21.03.2015)
[31] Nogueira CR, Lopes LMX. Antiplasmodial natural products. Molecules 2011; 16,
21462190.
[32] Agarwal D, Sharma M, Dixit SK, Dutta RK, Singh AK, Gupta RD, Awasthi SK. In vi
tro synergistic effect of fluoroquinolone analogs in combination with artemisinin
against Plasmodium falciparum; their antiplasmodial action in rodent malaria model.
Malaria Journal 2015; 14(1), 48.
[33] Dixit SK, Yadav N, Kumar S, Good L, Awasthi SK. Synthesis and antibacterial activi
ty of fluoroquinoone analogs. Medicinal Chemistry Research 2014; 23(12), 52375249.
[34] Yadav N, Sharma C, Awasthi SK. Diversifications in the synthesis of antimalarial tri
oxane and tetraxoane analogs. RSC Advances 2014; 4, 54695498.
[35] Singh C, Malik H, Puri SK. Orally active 1,2,4-trioxanes: synthesis and antimalarial
assessment of a new series of 9-functionalized 3-(1-arylvinyl)-1,2,5-trioxas
piro[5.5]undecanes against multi-drug-resistant Plasmodium yoelii nigeriensis in mice.
Journal of Medicinal Chemistry 2006; 49(9), 27942803.
[36] Singh C, Gupta N, Puri SK. Geraniol-derived 1,2,4-trioxanes with potent in-vivo anti
malarial activity. Bioorganic and Medicinal Chemistry Letters 2003; 13(20), 34473450.
[37] Sabbani S, Stocks PA, Ellis GL, Davies J, Hedenstrom E, Ward SA, ONeill PM. Piper
idine dispiro-1,2,4-trioxane analogues. Bioorganic and Medicinal Chemistry Letters 2008;
18(21), 58045808.
[38] Rubush DM, Morges MA, Rose BJ, Thamm DH, Rovis T. An asymmetric synthesis of
1,2,4-trioxane anticancer agents via desymmetrization of peroxyquinols through a
Brnsted acid catalysis cascade. Journal of American Chemical Society 2012; 134(33),
1355413557.

http://dx.doi.org/10.5772/61191
[39] La-Venia A, Mata EG, Mischne MP. Photoinduced oxygen capture on immobilized
dienone systems. First solid-phase synthesis of trioxane scaffolds. Journal of Combina
torial Chemistry 2008; 10(4), 504506.
[40] Kumar N, Singh R, Rawat DS. Tetraoxanes: synthetic and medicinal chemistry per
spective. Medicinal Research Reviews 2012; 32(3), 581610.
[41] Neupane CS, Awasthi SK. Unique trifurcated hydrogen bonding in a pseudopoly
morph of tricyclohexane triperoxide (TCTP) and its thermal studies. Tetrahedron let
ters 2012; 53(45), 60676070.
[42] Iskra J, Bonnet-Delpon D, Begue, JP. One-pot synthesis of non-symmetric tetraoxanes
with the H2O2/MTO/fluorous alcohol system. Tetrahedron Letters 2003; 44(33), 6309
6312.
[43] Ito Y, Konishi M, Matsuura T. Thermal and photosensitized decomposition of dimer
ic valerophenone peroxide formed by ozonation of valerophenone oxime ether. Pho
tochemistry and Photobiology 1979; 30(1), 5357.
[44] Gutema GB, Hailu GS, Kidanemariam ZA, Hishe HZ. Combination therapy and its
implication on clinical efficacy of artemisininsreview. International Journal of Phar
maceutical Sciences and Research 2011; 2(8), 19141921.
[45] Opsenica I, Opsenica D, Lanteri CA, Anova L, Milhous WK, Smith KS, Solaja BA.
New chimeric antimalarials with 4-aminoquinoline moiety linked to a tetraoxane
skeleton. Journal of Medicinal Chemistry 2008; 51(19), 62166219.
[46] Odile DC, Francoise BV, Anne R, Bernard M. Preparation and antimalarial activities
of trioxaquines, new modular molecules with a trioxane skeleton linked to a 4-ami
noquinoline. ChemBioChem 2000; 1(4), 281283.
[47] Francois B, Frederic C, Laure V, Jacques B, Bernard M, Anne R. Trioxaferroquines as
new hybrid antimalarial drugs. Journal of Medicinal Chemistry 2010; 53(10), 4103
4109.
59
Chapter 4
Advances on Dientamoeba fragilis Infections

Ali ElBakri, Ahmed Al-Qahtani and Amidou Samie
http://dx.doi.org/10.5772/61809
Abstract
Dientamoeba fragilis is an enteric protozoan parasite that remains neglected, probably due
to the misconception that it is uncommon and non-pathogenic. As more information be
came available and antimicrobial agents were developed with activity against this para
site, it became clear that D. fragilis is responsible of an active infection, associated with
symptoms such as abdominal pain and diarrhea. The clinical presentation of dientamoe
biasis varies from asymptomatic carriage to symptoms ranging from altered bowel mo
tions, abdominal discomfort, nausea and diarrhea with associated eosinophilia reported
in up to 50% of paediatric and 10% of adult patients. Moreover, controversy exists over
the protective role of the parasite in priming the immune system in a beneficial way such
as in selecting beneficial bacteria, keeping potential harmful microbial intruders at bay or
producing metabolites beneficial to the host. Thus, a number of ambiguities and obscuri
ties surrounding D. fragilis infections exist. Moreover, the means by which this parasite is
transmitted has not been fully defined. The diagnostic recognition of this parasite in fecal
examinations requires specific processing and expertise; thus, it is possible that many in
fections with D. fragilis may go undiagnosed. A number of studies conducted on small
numbers of case reports have demonstrated parasite clearance, as well as resolution of
clinical symptoms following treatment with various antiparasitic compounds such as pa
romomycin, hydroxyquinolines and the 5-nitroimidazoles, including metronidazole and
tinidazole. In addition there is very little in vitro susceptibility data available for the or
ganism making some current treatment options questionable. This chapter reviews the
scientific literature relating to Dientamoeba's life cycle, prevalence, diagnosis and patho
genicity.
Keywords: Dientamoeba fragilis, epidemiology, diagnosis, treatment, tropical infections
1. Introduction
Dientamoeba fragilis is an enteric protozoan parasite that remains obscure and neglected. While
many infections remain asymptomatic, it is now generally accepted that D. fragilis is account
62
able for an active infection, concomitant with abdominal symptoms, nausea, and diarrhea.
Moreover, controversy exists over the protective role of the parasite in priming the immune
system in a beneficial way such as in selecting beneficial bacteria, keeping potential harmful
microbial intruders at bay or producing metabolites beneficial to the host. Furthermore, the
parasites transmission mode remains a mystery. The microscopic identification and diagnoses
of D. fragilis in stool requires skill and expertise; consequently, it is likely that many infections
may go unidentified. Numerous studies have reported the effectiveness of treatment regimens
using compounds such as paromomycin, hydroxyquinolines, and 5-nitroimidazoles, includ
ing metronidazole and tinidazole in the parasite eradication and the resolution of clinical
symptoms. In addition, there is very little in vitro susceptibility data available for this parasite,
making some current treatment options questionable. This chapter reviews the scientific
literature relating to Dientamoebas life cycle, prevalence, diagnosis, and pathogenicity.
2. Recognition D. fragilis as a pathogen

D. fragilis is a ubiquitous protozoan parasite found in the gastrointestinal tract of humans.
Electron microscopy [1] and molecular phylogenetic studies of the SSU rRNA gene [2,3] have
recently confirmed the relationship of this parasite to trichomonads (lacking flagella). Al
though its pathogenic potential is still controversial, Jepps and Dobell in1918 were the first to
report its pathogenicity when it was found to be the only agent detected in three patients with
gastrointestinal clinical symptoms [5].
Figure 1. Trophozoite of D. fragilis stained by iron hematoxylin stain (Photo by Adnan Al-Hindi, 2005). Photo extracted
from Al-Hindi and Abu Shammala, 2013 [4].
Since then, many investigators have shown that patients infected with D. fragilis generally
presented with bowel disorders with symptoms such as diarrhea, loose stools, and epigastric
abdominal pains [612]. Furthermore, mounting evidence is accumulating reinforcing the
pathogenic potential of D. fragilis [1320]. Lately, irritable bowel syndrome (IBS) has been linked
to D. fragilis infections as a possible cause [21, 22], further underscoring its role in the causa
tion of disease. A great deal of controversy exists on the mode of transmission of D. fragilis, and
while Enterobius vermicularis nematode has been accepted to play a role in its transmission, more
recently a report described the discovery of a new cyst stage in its life cycle [23].

http://dx.doi.org/10.5772/61809
Globally, the prevalence rates of D. fragilis infections vary depending on the identification tool
used [6, 24, 25, 26]. Using the traditional light microscope, the rates of infections oscillate
between 0.4% and 52% [26]. Nevertheless, using indirect immunoflourescent assay, Chan et
al. (1996) reported a prevalence rate of 91% [27]. The application of more sensitive identification
tools such as PCR and culture has the extra advantage of providing accurate prevalence data
[28]. Considered as a pathogen by several researchers, numerous reports have revealed that
D. fragilis elimination with parasitic drugs normally relieves the clinical symptoms in the
absence of other pathogens. However, there is currently no consensus as to the ideal treatment
regimen [20, 29, 30]. The aim of this chapter is to review the recent developments and advances
made on this frequently overlooked parasite and the disease dientamoebiasis.
3. Biology and life cycle of D. fragilis

Ranging in size from 5 to 15 m in diameter, D. fragilis is a single-celled pleiomorphic troph
ozoite containing up to four nuclei [32, 20]. A large proportion of D. fragilis trophozoites are
typically binucleated with a large, fragmented, central karyosome without peripheral chro
matin differentiated clearly in stained fecal smears [32,10]. Banik et al. (2012) have recently
extensively described the surface structures and ultrasrtuctural details of D. fragilis popula
tions grown in xenic culture [31]. Using the scanning electron microscope, the group reported
the existence of two different trophozoite populationssmooth and ruffled cells. Whether this
represents a significant difference biologically or even in terms of the parasites pathogenicity
remains to be elucidated. Using the transmission electron microscope, neither mitochondria
nor peroxisomes were reported [33, 34]. Nevertheless, a conspicuous organelle detected was
the hydrogenosomes. Like many other organisms living in oxygen-deprived or anaerobic
environments, these hydrogenosomes most probably represent the site of anaerobic respira
tion and energy production [3539]. Different activities such as amoeboid movement, phago
cytosis, and bacterial adhesion to trophozoite surfaces were also reported by Banik and others
(2012) [31]. Like many other parasitic protozoa such as Trichomonas vaginalis [40, 41, 33], Giardia
[42], and Leishmania [43], virus-like particles (VLPs) have also been reported to be seen in D.
fragilis trophozoites. Many groups have reported an association between the presence of VLPs
within T. vaginalis and variations in protozoa phenotypes, virulence factors, and disease
pathogenesis [4446]. More details of the ultrastructure of D. fragilis are available in a review
authored by Banik et al. (2012) [31].
The complete life cycle and the mode of transmission of D. fragilis remain ambiguous and
equivocal. The only known stage thus far is the trophozoite (Fig. 2). Dobell (1940) was the first
to predict E. vermicularis egg to act as a vector for the transmission of D. fragilis [47]. Recently,
Roser et al. (2013) have detected D. fragilis DNA inside E. vermicularis eggs agreeing with the
prediction of Dobell in 1940 [48]. While many reports of a higher than anticipated rate of coinfection between D. fragilis and E. vermicularis led researchers to postulate E. vermicularis as
the probable vector responsible for its transmission [48, 49], other groups have proved no coinfections with D. fragilis and other worms, suggesting fecal-oral transmission as the possible
mechanism of transmission of D. fragilis [9, 10]. A new study by Munasinghe et al. (2013) using
63
64
Figure 2. Life cycle of D. fragilis. Reproduced from: Centers for Disease Control and Prevention. DPDx: Dientamoeba
fragilis infection. Available at: http://www.cdc.gov/dpdx/dientamoeba/index.html.
rodents and mice infected with human isolates reported the discovery of a new cyst stage in
the life cycle of D. fragilis strongly suggesting oralfecal transmission as the possible route of
infection [23]. Moreover, Stark et al. (2014) have recently reported a cyst form of D. fragilis from
human clinical samples, further supporting that cysts are likely to be the transmission forms
[50]. The role of animals and zoonotic transmission of the parasite is still ambiguous despite
a recent study reporting pigs and sheep as natural hosts of dientamoebiasis [51]. The reader is
invited to read an excellent review on the topic written by Clark et al. (2014) [52].
4. Epidemiology of dientamoebiasis and its occurrence

Since its hypothetical association with IBS and other bowel disorders, probable pathogenicity,
and the existence of gaps in its life cycle and mode of transmission, many investigators have
become increasingly aware of the importance of D. fragilis. This has led to the development of
more sensitive diagnostic techniques for its proper identification and determination of its
accurate prevalence. It is now recognized as being more prevalent than Giardia [7, 11, 25, 27,
29, 5365]. Table 1 shows the prevalence rates of D. fragilis ranging between 0.3% and 90% in
many countries worldwide. With the exception of few studies, light microscopy was the tool
used in those studies. The use of more sensitive techniques such as PCR or cultivation may
result in different and more accurate prevalence rates [10, 28, 66]. Unlike many parasitic

http://dx.doi.org/10.5772/61809
infections, D. fragilis has been shown to have high infection rates in developed countries than
in underprivileged countries [25, 67].
Prevalence
Sample source and type
Number of
Country/region
Reference
patients
36.25%
Mental asylum residents; feces
80
Holland
[68]
2.4
Patients; feces
14203
USA
[69]
20.1%
Gastrointestinal tract patients; feces
1114
Israel
[70]
Not disclosed Ascaris lumbricoides patients; feces
N/A
Thailand
[71]
About 4.2%
43029
Canada
[16]
125
Mexico City, Mexico
[72]
Fecal specimens submitted for parasitological

examination
9.6%
Fecal specimens infected with Entamoeba

histolytica/dispar
1.1%
School children; feces
94
Durban, South Africa [73]
52%
Adults; feces
81
Los Angeles, USA
[53]
21.1%
Children attending clinics; feces
104
Los Angeles, USA
[74]
8.6%
Children in day care centers; feces
900
Toronto, Canada
[65]
Adults in day care centers; feces
146
Toronto, Canada
[65]
1.3%
Homosexual men; feces
150
San Francisco, USA
[75]
16.8%
Intestinal tract patients; feces
125
Frenchs Forest,
[62]
Sydney, Australia
1.1%
Homosexual men; diarrhea
274
Chicago, USA
[76]
21%
Indigenous individuals; feces
242
Irian Jaya, Indonesia
[77]
3%
Patients with bowel disorder; feces
1350
Christchurch, New
[78]
Zealand
82.9%
Children infected with other gut protozoa; feces123
Germany
[64]
3%
Children living in rural areas; feces
266
Honduras
[79]
2%
Fecal specimens with light to moderate
100
Dominican Republic
[80]
dehydration and diarrhea

1.5%
Patients with diarrhea
260
Brisbane, Australia
[81]
25.6%
HIV-positive patients with no diarrhea; feces
82
Buenos Aires,
[82]
Argentina
2.3%
Children refugees; feces
87
USA
[83]
91%
Healthy children; sera
189
Canada
[27]
Around 8%
Patients with bowel symptoms
N/A
Netherlands
[84]
65
66
Prevalence
Number of
Country/region
Reference
San Pedro Sula,
[85]
patients
2.1%
HIV negative patients; feces
48
Honduras
5.1%
Routine testing; feces
857
Oman
[59]
5.5%
Fecal specimens submitted to a university
27053
Sfax, Tunisia
[86]
hospital in Tunisia
3%
HIV-positive patients; feces
34
North Brazil
[87]
11.3%
151
Italy
[61]
8.8%
Admitted patients; feces
400
Turkey, Celal Bayar
[29]
University
0.9%
Diarrhea patients; feces
6750
Sydney, Australia
[9]
0.82%
Sanitary employees; feces
241
Malatya, Turkey
[88]
6.3%
Patients infected with a gut parasite; feces
448
Brussels, Belgium
[6]
3.7%
3139
Italy
[58]
3.4%
1141
Italy
[57]
4.1%
1989
Italy
[53]
2%
Children and neonates patients; feces
350
Surt, Libya
[89]
2.7%
Aborigines; feces
112
Salta, Argentina
[90]
2.7%
Feces
770
Turkey
[91]
8.9%
Patients infected with gut parasites; feces
168
Egypt
[24]
29.8%
Patients infected with gut parasites; feces
168
Egypt
[24]
0.8%
HIV negative MSM ; feces
628
Sydney, Australia
[92]
0.3%
HIV-positive MSM; feces
618
Sydney, Australia
1.1%
Non-MSM patients; feces
622
Sydney, Australia
11.7%
Patients suspected of infection with gut
103
Denmark
[25]
397
Zwolle, The
[93]
parasites; feces
32%
Bowel complaints patients; feces
Netherlands
14.6%; 16.9%
Individuals attending complimentary health
3719; 2491
British Isles
[67]
care practices (20022004 and 20052007); feces

0.2%
School children; feces
2975
Van Province, Turkey [94]
5.2%
Bowel complaints; feces
750
Sydney, Australia
[11]
1.6%
Digestive disorder patients; feces
8313
Catalonia, Spain
[95]

http://dx.doi.org/10.5772/61809
Prevalence
Number of
Country/region
Reference
491
Parma, Italy
[96]
171
Karachi,
[97]
patients
21.4%
Patients suspected of infection with gut

parasites; feces
3.5%
Irritable bowel syndrome patients with

diarrhea; feces
4%
Pakistan
171
Karachi, Pakistan
171
Karachi, Pakistan
Fecal samples submitted to the Department of 472
Sydney, Australia
diarrhea; feces
4%

diarrhea; feces
5.5%
[98]
Microbiology at St Vincents Hospital, Sydney

8.8%
Patients with clinical symptoms, like diarrhea
319
and abdominal pain; feces
Al-Nuseirate Refugee [4]

Camp Clinic, Gaza
Strip
0%
Fecal samples from different laboratories
1000
Tabriz, Iran
[]
2.1%b
2.4%
Table adapted from Barratt et al. 2011. With kind permission from Dr. Damien Stark.
MSM denotes men who have sex with men.
In this Tabriz, Iran, study (Sarafraz et al., 2013), 26 samples were reported as suspicious cases in trichrome-stained smears.
Table 1. Global prevalence of D. fragilis infections in stool samples from various sources
Conflicting reports exist regarding the age-group distribution of D. fragilis infections. Two
studies, Danish and Canadian, reported a high infection rate in subjects aged between 16 and
20 years, respectively [25, 60]. On the other hand, despite being statistically insignificant, Rayan
et al. (2007) reported a higher infection rate in individuals aged between 30 and 40 years [24].
In contrast, other investigators reported a higher incidence rate in children and in less than 20
years old [8, 16, 27, 29, 63, 74, 95, 100]. In a recent study by Al-Hindi and Abu Shammala (2013)
in the Gaza strip regarding age, children less than 5 years of age were reported to have a
prevalence of 11.3%, while the age-group 2026 years had 15.4% [4]. This is in contrast to findings
by Girginkardesler et al. (2003), who reported that D. fragilis infection was higher among children
than adult [29]. No plausible explanation to these variations in age distribution of D. fragilis
incidences is proposed. Nevertheless, hygiene and modest sanitation have been suggested as
likely to prejudice groups to infections with D. fragilis and other intestinal protozoa irrespec
tive of age making the fecal oral route as the probable route of transmission [12, 24, 53, 101].
With respect to the association between gender and D. fragilis infections, numerous studies
report dissimilar trends. While several investigators report more infection incidences in females
than males [16, 24, 55, 57, 86, 95], other studies describe a drift towards males in certain age-
67
68
groups [4, 8, 60]. For more details on the subject, the reader is advised to consult the review by
Barratt et al. (2011) [12].
5. Pathogenicity and clinical symptoms of dientamoebiasis

Originally proposed as a pathogen in 1936 by Hakansson, there still remains some reluctance
by many investigators accepting D. fragilis as a pathogen [102, 103]. For example, in a recent
retrospective case-control study in the Netherlands elucidating the clinical importance of D.
fragilis in children with chronic abdominal pain, De Jong et al. (2014) detected D. fragilis in
43.2% of patients with chronic abdominal pain and in 50.6% in the controls (without gastro
intestinal symptoms) (p = 0.255) [104]. Thus, there are no significant differences in symptoms
comparing children with and without D. fragilis infection. Furthermore, no relation was found
between clinical and microbiological response after treatment for D. fragilis in the same study,
suggesting that there is no association between chronic abdominal pain D. fragilis infection.
Nevertheless, many current studies have acknowledged and confirmed the pathogenic
potential of D. fragilis. It is often detected in the feces of patients suffering from gastrointestinal
tract disorders and presenting symptoms such as loose stools, diarrhea, urgency to defecate,
vomiting, nausea, anorexia, weight loss, abdominal pain, and fever [69, 11, 21, 29, 105, 106].
Many investigators have reported the tendency for this parasite to cause persistent diarrhea
[9, 55]. An example of a study confirming the pathogenic role of D. fragilis is an Italian study
in 2007, where Crotti and DAnnibale found that between 3.4% and 4.1% of patients with
various bowel complaints carried Dientamoeba [55, 57]. Another report corroborating the
pathogenic potential of the organism is an Australian study in which 5.4% (35/650) of patients
with bowel disorders were reported to have Dientamoeba in their stools, with 83.3% of them
suffering from diarrhea [10]. Furthermore, Dientamoeba has been linked it with irritable bowel
syndrome (IBS) [22, 97, 105]. Patients carrying Dientamoeba may also experience eosinophilia
[10, 63, 64, 103, 106, 107].
6. Treatment of D. fragilis infections

While still not recognized as a pathogen, the ability to resolve associated symptoms by
eradicating D. fragilis using different drugs provides some proof for its possible pathogenic
nature [6, 16, 20, 69, 102, 103, 108110]. There is still no agreement as to the best regimen for
the complete elimination of the organism. Stark et al. (2010b) and Preiss et al. (1990) reported
a treatment ineffectiveness and/or relapse of dientamoebiasis following the use of metronida
zole only [11, 64]. In a recent Danish randomized trial, 96 children in Denmark with D.
fragilis infection and chronic gastrointestinal symptoms were treated with a 10-day course of
metronidazole or placebo [111]. Change in gastrointestinal symptoms following treatment did
not differ significantly between the groups. Eradication of D. fragilis was significantly greater
in the metronidazole group as assessed by PCR 2 weeks after completion of therapy, although
PCR positivity rebounded by 8 weeks after completion of therapy to levels comparable with

http://dx.doi.org/10.5772/61809
those seen in placebo recipients. The eradication of D. fragilis was significantly greater in the
metronidazole group, although it declined rapidly from 62.5% 2 weeks after end of treatment
to 24.9% 8 weeks after end of treatment. The findings of the study did not provide evidence to
support routine metronidazole treatment of D. fragilis-positive children with chronic gastro
intestinal symptoms. However, the complete resolution of symptoms and elimination of the
organism were noted following the administration of either iodoquinol, paromomycin, or a
combination of the two [11, 107]. Most recently, Halkjr et al. (2015) described a case history
of a 16-year-old Danish patient who had suffered severe abdominal discomfort and flatulence
through his lifetime following infection with D. fragilis. The patient was treated initially with
a high dose of metronidazole, which eradicated the parasite and kept him without symptoms
for 1 year [112]. However, recurrence of the symptoms and recurrence of the D. fragilis infection
were thereafter treated successfully with paromomycin [112]. Other drugs that are also
reported to effectively eradicate the parasite leading to clinical cure included oxytetracycline,
doxycycline, tinidazole, secnidazole, ornidazole, and erythromycin [29, 30, 64, 102, 113].
Despite the lack of randomized controlled trial data, the literature suggests paromomycin is a
more efficacious agent than metronidazole [6, 11, 114]. New potential therapeutic compounds
are constantly being screened for by investigators. More recently, Stark et al. (2014) have shown
that there is no therapeutic response against dientamoebiasis with benzimidazoles (such as
albendazole and mebendazole) [115].
7. Role of genetic characteristics of the infecting strains in the pathogenesis

of dientamoebiasis
The outcome of an infection may depend on several factors, among which the genetic charac
teristics of the specific pathogen have been identified as an important one. The virulence and
disease outcome has been linked to the genotypes of few parasites such as Entamoeba histoly
tica and Giardia lamblia [116124]. Despite its inability to ascertain correlation between geno
type and disease outcome, evidence emerged using the ssu rRNA gene of at least two
genetically distinct variants (genotypes 1 and 2) of D. fragilis are in existence [6, 9, 20, 125,
126]. Thus, in the case of D. fragilis infections, the ssu rRNA gene demonstrated inferiority as
a tool for molecular epidemiological studies [127]. Accordingly, new molecular tools were
employed to demonstrate the association between variants and clinical disease outcome. One
such tool is the use of C-profiling in which the cysteine nucleotide pattern is compared between
samples for evidence of genetic variation on the internal transcribed spacer regions (ITS1 and
ITS2) of the ribosomal gene [128]. These regions are noncoding sequences reported to be
suitable for molecular characterization of phylogenetically related organisms [129]. Bart et al.
(2008) and Stark and his group (2009) documented the occurrence in variations of ITS1 in D.
fragilis isolates [21, 130]. Furthermore, a correlation between certain ITS1 variants and disease
outcome was reported [130]. Recently, Barratt et al. (2010) found that the growth of Dienta
moeba in certain media formulations varied between different isolates, and while all Dienta
moeba isolates described by Barratt and colleagues were from patients with gastrointestinal
complaints, this work indicates that phenotypic diversity exists in Dientamoeba and that the
variation noted is likely to have a genetic basis. Nevertheless, it is still unclear whether the two
genotypes differ in their pathogenicity [131].
69
70
8. Diagnosis of dientamoebiasis
While it is difficult to identify the trophozoites of D. fragilis morphologically, the only diag
nostic tool used to detect D. fraglis is microscopy using permanent stained smears. A large
variety of stains have been used for the microscopic examination of E. fragilis. However, the
most commonly used that also give much clearer images of the parasites are the trichrome and
the iron-hematoxylin stains. The sample should be fixed immediately after staining to avoid
degeneration of the trophozoites and staining should also occur sooner [107]. Trophozoites
range in size from 5 to 15 m in length, from 9 to 12 m in width, normally with 12 fragmented
nuclei with visible holes seen through the nucleus center. Smears may also contain tropho
zoites with the typical four nucleated form. No cyst stage has been recovered yet from humans
despite being observed in mice [23]. Even under ideal conditions, with prompt preservation
of stool and evaluation of permanent stained smears by experienced microscopists, Stark et al.
(2010a and 2011) reported a sensitivity of 34% and 38%, respectively, compared to PCR (realtime and multiplex tandemPCR) [10, 132]. Despite numerous studies reporting common
occurrence of D. fragilis infection, no clinical antigen-based, molecular, or serologic diagnostics
have been commercially developed to aid with laboratory identification to date, although
current molecular based methods are used for research [133]. The culture of D. fragilis has been
reported and is done in similar conditions as that of E. histolytica. Liquid or diphasic media is
used that can be in xenic or axenic conditions [10]. Another diphasic medium based on the
Loefflers slope has also been demonstrated, and Earles balanced salt solution (EBSS) has been
successfully used for the growth of D. fragilis [23].
Molecular diagnostic methods have been very instrumental for the improvement of our
understanding of different infections. There has been a significant gain in the development of
molecular methods for the detection of D. fragilis, although compared to other organisms, this
improvement has been much slower [32]. Several PCR protocols have been developed for the
detection of this organism mainly for research laboratories. These protocols vary from
conventional PCR to real-time PCR with increased sensitivity and specificity. Primers based
on the small ribosomal RNA gene have been developed for this purpose [9]. Verweij and
colleagues have developed a real-time PCR protocol using the 5.8S ribosomal RNA gene and
they showed that this method was both specific and sensitive [28]. A variation of PCR based
on the amplification of the internal transcribed spacer 1 region of D. fragilis has also been used
for the molecular characterization of the parasite [130]. The actin gene has also been used as a
target for the molecular characterization of this parasite [128]. Generally, the detection and/or
the molecular characterization of the parasite begin with DNA purification, which is a very
important and critical step in the amplification of the organism. Following DNA purification,
the PCR master mixed is prepared depending on the procedure to be used. In the case of
detection, the PCR protocol is generally sufficient. However, the molecular characterization
often requires a sequencing step with or without the purification of the PCR amplicons. Other
methods that have been used so far for the molecular characterization of D. fragilis include
high-resolution melt curve analysis (HRM) and restriction fragment length polymorphism
after amplification by PCR [9, 22].
Using HRM, Hussein and colleagues found 4 genetic profiles of which the first and most
common profile and the last profile (Profile 4) were more associated with diarrhea compared

http://dx.doi.org/10.5772/61809
to the two middle profiles [22]. However, the ITS showed two major genotypes although there
were subgenotypes among those main categories. In another study, the ITS-1-5.8S rRNA geneITS-2 region of D. fragilis was found to be highly variable and pyrosequencing method
identified 11 different alleles of the ITS-1 sequence showing the limitation of this gene in the
molecular characterization of the parasite [130]. Briefly, the use of molecular methods has
increased our knowledge on these organisms; much still remains to be discovered for the better
understanding of issues related to pathogenicity, diagnosis, and prognosis.
9. Conclusion
Known for almost a hundred years now, D. fragilis still remains a mysterious organism
although much has been learned. The use of molecular biology has clarified its classification
not as an amoeba but as a trichomonad. However, its pathogenicity as well as its genetic
diversity still remains to be clarified. Diagnosis particularly in developing areas of the world
where it could be common remains difficult because microscopy is not sensitive. This is made
to be even more difficult because of the uncertainty of the existence of a cyst stage, which so
far has only been demonstrated in very limited studies. Real-time PCR has been proven to be
more sensitive compared to all the other diagnostic methods, including conventional PCR,
microscopy, and culture. Further studies are needed, and collaboration between developing
and developed countries will help boost the research capacity on this infection and improve
our understanding of its distribution, pathogenicity, and immunology.
Acknowledgements
We thank Dr. Wiam Elshami from the University of Sharjah, UAE, for her help in the prepa
ration and referencing of the chapter.
Author details
Ali ElBakri1, Ahmed Al-Qahtani2 and Amidou Samie3
*Address all correspondence to: samieamidou@yahoo.com
1 Medical Laboratory Sciences Department, University of Sharjah, Sharjah, UAE
2 Health Sciences Department, Al Khawarizmi International College, AbuDhabi, UAE
3 Molecular parasitology and opportunistic infections program, Department of Microbiology,
University of Venda, Thohoyandou, South Africa
71
72
References
[1] Camp RR, Mattern CF, Honigberg BM. Study of Dientamoeba fragilis Jepps & Dobell I.
Electronmicroscopic observations of the binucleate stages. II. Taxonomic position
and revision of the genus. J Protozool. 1974; 21:6982.
[2] Delgado-Viscogliosi P, Viscogliosi E, Gerbod D, Kulda J, Sogin ML, Edgcomb VP.
Molecular phylogeny of parabasalids based on small subunit rRNA sequences, with
emphasis on the Trichomonadinae subfamily. J Eukaryot Microbiol. 2000; 47:705.
[3] Gerbod D, Edgcomb VP, Noel C, Zenner L, Wintjens R, Delgado-Viscogliosi P, et al.
Phylogenetic position of the trichomonad parasite of turkeys, Histomonas meleagridis
(Smith) Tyzzer, inferred from small subunit rRNA sequence. J Eukaryot Microbiol.
2001; 48: 498504.
[4] Al-Hindi AI, Abu-Shammala BM. Dientamoeba fragilis in Gaza Strip: a neglected pro
tozoan parasite. Iran J Parasitol. 2013; 8: 24955.
[5] Jepps MW, Dobell C. Dientamoeba fragilis n.g., n. sp.: a new intestinal amoeba from
man. Parasitology 1918; 10:35267.
[6] Vandenberg O, Peek R, Souayah H, Dediste A, Buset M, Scheen R, et al. Clinical and
microbiological features of dientamoebiasis in patients suspected of suffering from a
parasitic gastrointestinal illness: a comparison of Dientamoeba fragilis and Giardia lam
blia infections. Int J Infect Dis. 2006; 10:25561.
[7] Crotti D, DAnnibale ML, Fonzo G, Lalle M, Caccio SM, Pozio E. Dientamoeba fragilis
is more prevalent than Giardia duodenalis in children and adults attending a day
care centre in Central Italy. Parasite. 2005; 12:16570.
[8] Norberg A, Nord CE, Evengard B. Dientamoeba fragilisa protozoal infection which
may cause severe bowel distress. Clin Microbiol Infect. 2003; 9:658.
[9] Stark D, Beebe N, Marriott D, Ellis J, Harkness J. Prospective study of the prevalence,
genotyping and clinical relevance of Dientamoeba fragilis infections in an Australian
population. J Clin Microbiol. 2005; 43:271823.
[10] Stark D, Barratt J, Roberts T, Marriot D, Harkness J, Ellis J. Comparison of microsco
py, two xenic culture techniques, conventional and real-time PCR for the detection of
Dientamoeba fragilis in clinical stool samples. Eur J Clin Microbiol Infect Dis. 2010a;
29:4116.
[11] Stark D, Barratt J, Roberts T, Marriott D, Harkness J, Ellis J. A review of the clinical
presentation of dientamoebiasis. Am J Trop Med Hyg. 2010b; 82:6149.
[12] Barratt JLN, Harkness J, Marriott D, Ellis JT, Stark D. A review of Dientamoeba fragilis
carriage in humans: several reasons why this organism should be considered in the
diagnosis of gastrointestinal illness. Gut Microb. 2011; 2: 312.

http://dx.doi.org/10.5772/61809
[13] Hakansson EG. Dientamoeba fragilis, a cause of illness: report of a case. Am J Trop
Med Hyg 1936; 16:1758.
[14] Ottilio MJ, Luiz de Pinho A, Silva S, Rodrigues Gomes FJ. Parasitic aspects of Dienta
moeba fragilis. Pathogenic action and therapy. Bull Soc Pathol Exot Filiales. 1968;
61:305.
[15] Addadi K, Le Corroller Y, Guy Y, Tabet-Derraz A. Possible pathogenicity of Dienta
moeba fragilis. Bull Soc Pathol Exot Filiales. 1972; 65:2745.
[16] Yang J, Scholten T. Dientamoeba fragilis: a review with notes on its epidemiology,
pathogenicity, mode of transmission and diagnosis. Am J Trop Med Hyg. 1977;
26:1622.
[17] Ockert G, Schulz U. Pathogenetic role of Dientamoeba fragilis. Dtsch Gesundheitsw.
1972; 27:11568.
[18] Desser SS, Yang YJ. Letter: Dientamoeba fragilis in idiopathic gastrointestinal disor
ders. Can Med Assoc J. 1976; 114:2903.
[19] Shein R, Gelb A. Colitis due to Dientamoeba fragilis. Am J Gastroenterol. 1983; 78:634
6.
[20] Stark DJ, Beebe N, Marriott D, Ellis JT, Harkness J. Dientamoebiasis: clinical impor
tance and recent advances. Trends Parasitol. 2006; 22:926.
[21] Windsor JJ, Macfarlane L. Irritable bowel syndrome: the need to exclude Dientamoeba
fragilis. Am J Trop Med Hyg. 2005; 72:5012.
[22] Hussein EM, Al-Mohammed HI, Hussein AM. Genetic diversity of Dientamoeba fragi
lis isolates of irritable bowel syndrome patients by high-resolution melting-curve
(HRM) analysis. Parasitol Res. 2009; 105:105360.
[23] Munasinghe VS, Vella NGF, Ellis JT, Windosr P, Stark D. Cyst formation and faecal
oral transmission of Dientamoeba fragilis the missing link in the life cycle of an
emerging pathogen. Int J Parasitol. 2013; 43: 879883.
[24] Rayan HZ, Ismail OA, El Gayar EK. Prevalence and clinical features of Dientamoeba
fragilis infections in patients suspected to have intestinal parasitic infection. J Egypt
Soc Parasitol. 2007; 37:599608.
[25] Stensvold CR, Arendrup MC, Molbak K, Nielsen HV. The prevalence of Dientamoeba
fragilis in patients with suspected enteroparasitic disease in a metropolitan area in
Denmark. Clin Microbiol Infect. 2007; 13:83942.
[26] Barratt J, Harkness J, Marriott D, Ellis J, Stark D. The ambiguous life of Dientamoeba
fragilis: the need to investigate current hypotheses on transmission. Parasitology.
2011a; 138: 557572.
73
74
[27] Chan F, Stewart N, Guan M, Robb I, Fuite L, Chan I, et al. Prevalence of Dientamoeba
fragilis antibodies in children and recognition of a 39 kDa immunodominant protein
antigen of the organism. Eur J Clin Microbiol Infect Dis. 1996; 15:9504.
[28] Verweij JJ, Mulder B, Poell B, van Middelkoop D, Brienen EA, van Lieshout L. Realtime PCR for the detection of Dientamoeba fragilis in fecal samples. Mol Cell Probes.
2007; 21:4004.
[29] Girginkardesler N, Coskun S, Cuneyt Balcioglu I, Ertan P, Ok UZ. Dientamoeba fragi
lis, a neglected cause of diarrhea, successfully treated with secnidazole. Clin Micro
biol Infect. 2003; 9:1103.
[30] Kurt O, Girginkardesler N, Balcioglu IC, Ozbilgin A, Ok UZ. A comparison of metro
nidazole and singledose ornidazole for the treatment of dientamoebiasis. Clin Micro
biol Infect. 2008; 14:6014.
[31] Banik et al. A microscopic description and ultrastructural characterisation of Dienta
moeba fragilis: an emerging cause of human enteric disease. International Journal for
Parasitology. 2012; 42: 13953.
[32] Johnson EH, Windsor JJ, Clark CG. Emerging from obscurity: biological, clinical and
diagnostic aspects of Dientamoeba fragilis. Clin Microbiol Rev. 2004; 17:55370.
[33] Benchimol M. Trichomonads under microscopy. Microsc Microanal. 2004a; 10: 528
550.
[34] Carlton JM, Hirt RP, Silva JC, Delcher AL, Schatz M, Zhao Q, Wortman JR, Bidwell
SL, Alsmark UCM, Besteiro SB, Sicheritz-Ponten T, Noel CJ, Dacks JB, Foster PG et
al. Draft genome sequence of the sexually transmitted pathogen Trichomonas vagina
lis. Science. 2007; 315: 207212.
[35] Benchimol M, Kachar B, de Souza W. The structural organization of the pathogenic
protozoan Tritrichomonas foetus as seen in replicas of quick frozen, freeze-fractured
and deep etched cells. Biol Cell. 1993; 77: 289295.
[36] Benchimol M, Engelke F. Hydrogenosome behavior during the cell cycle in Tritricho
monas foetus. Biol Cell. 2003; 95: 283293.
[37] Benchimol M. Hydrogenosomes under microscopy. Tissue Cell. 2009; 41: 151168.
[38] Shiflett AM, Johnson PJ. Mitochondrion-related organelles in eukaryotic protists. An
nu Rev Microbiol. 2010; 64:409429.
[39] Stairs CW, Roger AJ, Hampl V. Eukaryotic pyruvate formate lyase and its activating
enzyme were acquired laterally from a firmicute. Mol Biol Evol. 2011; 28: 20872099.
[40] Wang AL, Wang CC. A linear double-stranded RNA in Trichomonas vaginalis. J Biol
Chem. 1985; 260: 36973702.

http://dx.doi.org/10.5772/61809
[41] Wang AL, Wang CC. The double-stranded RNA in Trichomonas vaginalis may origi
nate from virus-like particles. Proc Natl Acad Sci USA. 1986a; 83: 79567960.
[42] Wang AL, Wang CC. Discovery of a specific double-stranded RNA virus in Giardia
lamblia. Mol Biochem Parasitol. 1986b; 21: 269276.
[43] Tarr PI, Aline Jr. RF, Smiley BL, Scholler J, Keithly J, Stuart K. LR1: a candidate RNA
virus of Leishmania. Proc Natl Acad Sci USA. 1988; 85: 95729575.
[44] Gerhold RW, Allison AB, Sellers H, Linnemann E, Chang TH, Alderete JF. Examina
tion for double-stranded RNA viruses in Trichomonas gallinae and identification of a
novel sequence of a Trichomonas vaginalis virus. Parasitol Res. 2009; 105: 775779.
[45] Fraga J, Rojas L, Sariego I, Fernndez-Calienes A. Double-stranded RNA viral infec
tion of Trichomonas vaginalis and correlation with genetic polymorphism of isolates.
Exp Parasitol. 2011; 127: 593599.
[46] Malla N, Kaul P, Sehgal R, Gupta I. The presence of dsRNA virus in Trichomonas vag
inalis isolates from symptomatic and asymptomatic Indian women and its correlation
with in vitro metronidazole sensitivity. Indian J Med Microbiol. 2011; 29: 152157.
[47] Dobell C. Researches on intestinal protozoa in monkeys and man. X. The life history
of Dientamoeba fragilis: observations, experiments and speculations. Parasitology.
1940; 32:41761.
[48] Roser D, Nejsum P, Carlsgart AJ, Nielsen HV, Stensvold CR. DNA of Dientamoeba fra
gilis detected within surface-sterilized eggs of Enterobius vermicularis. Exp Parasitol.
2013; 133: 5761.
[49] Girginkardesler N, Kurt O, Kilimcioglu AA, Ok UZ. Transmission of Dientamoeba fra
gilis: evaluation of the role of Enterobius vermicularis. Parasitol Int. 2008; 57: 7275.
[50] Stark D, Garcia LS, Barratt JLN, Phillips O, Roberts T, Marriott D, harkness D, Ellis
JT. Description of Dientamoeba fragilis cyst and precystic forms from human samples.
J Clin Microbiol. 2014; 52: 26803.
[51] Caccio SM, Sannella AR, Manuali E, Tosini F, Sensi M, Crotti D, Pozio E. Pigs as nat
ural hosts of Dientamoeba fragilis genotypes found in humans. Emerg Infect Dis. 2012;
18: 838841.
[52] Clark CG, Rser D, Stensvold CR. Transmission of Dientamoeba fragilis: pinworm or
cysts? Trends Parasitol. 2014; 30: 13640.
[53] Millet V, Spencer MJ, Chapin M, Stewart M, Yatabe JA, Brewer T, et al. Dientamoeba
fragilis, a protozoan parasite in adult members of a semicommunal group. Dig Dis
Sci. 1983; 28:3359.
[54] Spencer E, Araya M, Sandino AM, Pacheco I, Brunser O. Faecal excretion of rotavirus
and other enteropathogens in newborns of the high and low socio-economic stratum
in Santiago, Chile. Epidemiol Infect. 1988; 101:42536.
75
76
[55] Crotti D, DAnnibale ML. Intestinal infections caused by Dientamoeba fragilis and
Giardia duodenalis in our experience. Recenti Prog Med. 2007a; 98:3616.
[56] Hamze M, Naja M, Mallat H. Biological analysis of workers in the food sector in
north Lebanon. East Mediterr Health J. 2008; 14:142534.
[57] Crotti D, DAnnibale ML. Role of Dientamoeba fragilis in human bowel infections. In
fez Med. 2007b; 15:309.
[58] Crotti D, DAnnibale ML. Human intestinal parasitosis: role of Dientamoeba fragilis in
human infections. Ann Ig. 2007c; 19:2734.
[59] Windsor JJ, Rafay AM, Shenoy AK, Johnson EH. Incidence of Dientamoeba fragilis in
faecal samples submitted for routine microbiological analysis. Br J Biomed Sci. 1998;
55:1725.
[60] Lagace-Wiens PR, VanCaeseele PG, Koschik C. Dientamoeba fragilis: an emerging role
in intestinal disease. CMAJ. 2006; 175:4689.
[61] Crotti D, DAnnibale ML. Dientamoeba fragilis and dientamoebiasis: aspects of clinical
parasitology and laboratory diagnosis. Parassitologia. 2001; 43:1358.
[62] Walker JC, Bahr G, Ehl AS. Gastrointestinal parasites in Sydney. Med J Aust. 1985;
143:480.
[63] Preiss U, Ockert G, Broemme S, Otto A. On the clinical importance of Dientamoeba
fragilis infections in childhood. J Hyg Epidemiol Microbiol Immunol. 1991; 35:2734.
[64] Preiss U, Ockert G, Bromme S, Otto A. Dientamoeba fragilis infection, a cause of gas
trointestinal symptoms in childhood. Klin Padiatr. 1990; 202:1203.
[65] Keystone JS, Yang J, Grisdale D, Harrington M, Pillon L, Andreychuk R. Intestinal
parasites in metropolitan Toronto day-care centres. Can Med Assoc J. 1984; 131:733
5.
[66] Windsor JJ, Macfarlane L, Hughes-Thapa G, Jones SK, Whiteside TM. Detection of
Dientamoeba fragilis by culture. Br J Biomed Sci. 2003; 60: 7983.
[67] Schuster H, Jackson RS. Prevalence of Dientamoeba fragilis among patients consulting
complementary medicine practitioners in the British Isles. J Clin Pathol. 2008; 62:182
4.
[68] Brug SL. Observations on Dientamoeba fragilis. Ann Trop Med Parasitol. 1938; 30:441
52.
[69] Kean BH, Malloch CL. The neglected ameba: Dientamoeba fragilis. A report of 100
pure infections. Am J Dig Dis. 1966; 11:73546.
[70] Steinitz H, Talis B, Stein B. Entamoeba histolytica and Dientamoeba fragilis and the syn
drome of chronic recurrent intestinal amoebiasis in Israel. Digestion. 1970; 3:14653.

http://dx.doi.org/10.5772/61809
[71] Sukanahakeru S. The presence of Dientamoeba fragilis in the Ascaris lumbricoides ova:
the first report from Thailand. J Med Assoc Thai. 1977; 60:2568.
[72] Sargeaunt PG, Williams JE, Kumate J, Jimenez E. The epidemiology of Entamoeba his
tolytica in Mexico City. A pilot survey I. Trans R Soc Trop Med Hyg. 1980; 74:6536.
[73] Sargeaunt PG, Williams JE, Jackson TF, Simjee AE. A zymodeme study of Entamoeba
histolytica in a group of South African schoolchildren. Trans R Soc Trop Med Hyg.
1982; 76:4012.
[74] Spencer MJ, Millet VE, Garcia LS, Rhee L, Masterson L. Parasitic infections in a pe
diatric population. Pediatr Infect Dis. 1983; 2:1103.
[75] Ortega HB, Borchardt KA, Hamilton R, Ortega P, Mahood J. Enteric pathogenic pro
tozoa in homosexual men from San Francisco. Sex Transm Dis. 1984; 11:5963.
[76] Peters CS, Sable R, Janda WM, Chittom AL, Kocka FE. Prevalence of enteric parasites
in homosexual patients attending an outpatient clinic. J Clin Microbiol. 1986; 24:684
5.
[77] Muller R, Lillywhite J, Bending JJ, Catford JC. Human cysticercosis and intestinal
parasitism amongst the Ekari people of Irian Jaya. J Trop Med Hyg. 1987; 90:2916.
[78] Oxner RB, Paltridge GP, Chapman BA, Cook HB, Sheppard PF. Dientamoeba fragilis: a
bowel pathogen? N Z Med J. 1987; 100:645.
[79] Kaminsky RG. Parasitism and diarrhoea in children from two rural communities and
marginal barrio in Honduras. Trans R Soc Trop Med Hyg. 1991; 85:703.
[80] Tavarez LA, Pena F, Placencia F, Mendoza HR, Polanco D. Prevalence of protozoans
in children with acute diarrheal disease. Arch Domin Pediatr. 1991; 27:437.
[81] Sawangjaroen N, Luke R, Prociv P. Diagnosis by faecal culture of Dientamoeba fragilis
infections in Australian patients with diarrhoea. Trans R Soc Trop Med Hyg. 1993;
87:1635.
[82] Mendez OC, Szmulewicz G, Menghi C, Torres S, Gonzalez G, Gatta C. Comparison
of intestinal parasite infestation indexes among HIV positive and negative popula
tions. Medicina (B Aires). 1994; 54:30710.
[83] Meropol SB. Health status of pediatric refugees in Buffalo NY. Arch Pediatr Adolesc
Med. 1995; 149:88792.
[84] van Gool T, Dankert J. 3 emerging protozoal infections in the Netherlands: Cyclo
spora, Dientamoeba and Microspora infections. Ned Tijdschr Geneeskd. 1996;
140:15560.
[85] Lindo JF, Dubon JM, Ager AL, De Gourville EM, Solo-Gabriele H, Klaskala WI, et al.
Intestinal parasitic infections in human immunodeficiency virus (HIV)-positive and
77
78
HIV-negative individuals in San Pedro Sula, Honduras. Am J Trop Med Hyg. 1998;
58:4315.
[86] Ayadi A, Bahri I. Dientamoeba fragilis: pathogenic flagellate? Bulletin de la Societe de
Pathologie Exotique. 1999; 92:299301.
[87] Lainson R, da Silva BA. Intestinal parasites of some diarrhoeic HIV-seropositive indi
viduals in North Brazil, with particular reference to Isospora belli Wenyon, 1923 and
Dientamoeba fragilis Jepps & Dobell 1918. Mem Inst Oswaldo Cruz. 1999; 94:6113.
[88] Karaman U, Atambay M, Aycan O, Yologlu S, Daldal N. Incidence of intestinal para
sites in municipal sanitary workers in Malatya. Turkiye Parazitol Derg. 2006; 30:181
3.
[89] Kassem HH, Zaed HA, Sadaga GA. Intestinal parasitic infection among children and
neonatus admitted to Ibn-Sina Hospital, Sirt, Libya. J Egypt Soc Parasitol. 2007;
37:37180.
[90] Menghi CI, Iuvaro FR, Dellacasa MA, Gatta CL. Survey of intestinal parasites among
an aboriginal community in Salta. Medicina (B Aires). 2007; 67:7058.
[91] Ozcakir O, Gureser S, Erguven S, Yilmaz YA, Topaloglu R, Hascelik G. Characteris
tics of Blastocystis hominis infection in a Turkish university hospital. Turkiye Parazitol
Derg. 2007; 31:27782.
[92] Stark D, Fotedar R, van Hal S, Beebe N, Marriott D, Ellis JT, et al. Prevalence of enter
ic protozoa in human immunodeficiency virus (HIV)-positive and HIV-negative men
who have sex with men from Sydney, Australia. Am J Trop Med Hyg. 2007; 76:549
52.
[93] Bruijnesteijn van Coppenraet LE, Wallinga JA, Ruijs GJ, Bruins MJ, Verweij JJ. Parasi
tological diagnosis combining an internally controlled real-time PCR assay for the
detection of four protozoa in stool samples with a testing algorithm for microscopy.
Clin Microbiol Infect. 2009; 15:86974.
[94] Cengiz ZT, Akbayram S, Cicek M, Yilmaz H. Intestinal parasitoses detected in pri
mary schoolchildren in the Van province. Turkiye Parazitol Derg. 2009; 33:28993.
[95] Gonzalez-Moreno O, Domingo L, Teixidor J, Gracenea M. Prevalence and associated
factors of intestinal parasitisation: a cross-sectional study among outpatients with
gastrointestinal symptoms in Catalonia, Spain. Parasitol Res. 2011; 108: 8793.
[96] Calderaro A, Gorrini C, Montecchini S, Peruzzi S, Piccolo G, Rossi S, et al. Evaluation
of a real-time polymerase chain reaction assay for the detection of Dientamoeba fragi
lis. Diagn Microbiol Infect Dis. 2010; 67:23945.
[97] Yakoob J, Jafri W, Beg MA, Abbas Z, Naz S, Islam M, et al. Blastocystis hominis and
Dientamoeba fragilis in patients fulfilling irritable bowel syndrome criteria. Parasitol
Res. 2010; 107:67984.

http://dx.doi.org/10.5772/61809
[98] Stark D, Al-Qassab SE, Barratt JL, Stanley K, Roberts T, Marriott D, et al. An evalua
tion of a multiplex tandem real-time PCR for the detection of Cryptosporidium spp,
Dientamoeba fragilis, Entamoeba histolytica and Giardia intestinalis from clinical stool
samples. J Clin Microbiol. 2010c; 49:25762.
[99] Sarafraz S, Farajnia S, Jamali J, Khodabakhsh F, Khanipour F. Detection of Dientamoe
ba fragilis among diarrheal patients referred to Tabriz health care centers by nested
PCR. Tropical Biomedicine. 2013; 30: 113118.
[100] de Wit MA, Koopmans MP, Kortbeek LM, van Leeuwen NJ, Vinje J, van Duynhoven
YT. Etiology of gastroenteritis in sentinel general practices in the Netherlands. Clin
Infect Dis. 2001; 33:2808.
[101] El-Taweel GE, Shaban AM. Microbiological quality of drinking water at eight water
treatment plants. Int J Environ Health Res. 2001; 11:28590.
[102] Bosman DK, Benninga MA, van de Berg P, Kooijman GC, van Gool T. Dientamoeba
fragilis: possibly an important cause of persistent abdominal pain in children. Ned
Tijdschr Geneeskd. 2004; 148:5759.
[103] Spencer MJ, Garcia LS, Chapin MR. Dientamoeba fragilis. An intestinal pathogen in
children? Am J Dis Child. 1979; 133:3903.
[104] De Jong MJ, Korterink JJ, Benninga Ma, Hilbink M, Widdershoven J, Deckers-Kocken
JM. Dientamoeba fragilis and chronic abdominal pain in children: a case-control study.
Arch Dis Child. 2014; 99: 110913. doi: 10.1136/archdischild-2014-305942.
[105] Stark D, Barratt J, Ellis J, Harkness J, Marriott D. Repeated Dientamoeba fragilis infec
tions: a case report of two families from Sydney, Australia. Infect Dis Rep. 2009; 1:7
9.
[106] Cuffari C, Oligny L, Seidman EG. Dientamoeba fragilis masquerading as allergic coli
tis. J Pediatr Gastroenterol Nutr. 1998; 26:1620.
[107] Windsor JJ, Johnson EH. Dientamoeba fragilis: the unflagellated human flagellate. Br J
Biomed Sci. 1999; 56:293306.
[108] Borody TJ, Warren EF, Wettstein A, Robertson G, Recabarren P, Fontela A, et al.
Eradication of Dientamoeba fragilis can resolve IBS-like symptoms. J Gastroenterol
Hepatol. 2002; 17:103.
[109] Chan FT, Guan MX, Mackenzie AM, Diaz-Mitoma F. Susceptibility testing of Dienta
moeba fragilis ATCC 30948 with iodoquinol, paromomycin, tetracycline and metroni
dazole. Antimicrob Agents Chemother. 1994; 38:115760.
[110] Spencer MJ, Chapin MR, Garcia LS. Dientamoeba fragilis: a gastrointestinal protozoan
infection in adults. Am J Gastroenterol. 1982; 77:5659.
[111] Rser D, Simonsen J, Stensvold CR, Olsen KE, Bytzer P, Nielsen HV, Mlbak K. Met
ronidazole therapy for treating dientamoebiasis in children is not associated with
79
80
better clinical outcomes: a randomized, double-blinded and placebo-controlled clini

cal trial. Clin Infect Dis. 2014; 58: 16929. DOI: 10.1093/cid/ciu188.
[112] Halkjr S, Stensvold CR, Petersen AM. Dientamoeba fragilis infection as cause of se
vere abdominal discomfort and flatulence. Ugeskr Laeger. 2015; 177:2A.
[113] Butler WP. Dientamoeba fragilis. An unusual intestinal pathogen. Dig Dis Sci. 1996;
41:18113.
[114] van Hellemond JJ, Molhoek N, Koelewijn R, Wismans PJ, van Genderen PJ. Is paro
momycin the drug of choice for eradication of Dientamoeba fragilis in adults? Int J Par
asitol Drugs Drug Resist. 2012; 14:1625. doi: 10.1016/j.ijpddr.2012.03.002.
[115] Stark D, Barratt JL, Roberts T, Marriott D, Harkness JT, Ellis J. Activity of benzimida
zoles against Dientamoeba fragilis (Trichomonadida, Monocercomonadidae) in vitro
and correlation of beta-tubulin sequences as an indicator of resistance. Parasite.
2014;21:41. doi: 10.1051/parasite/2014043. Epub 2014 Aug 25.
[116] Ali IKM, Mondal U, Roy S, Haque R, Petri WA, Jr, Clark CG. Evidence for a link be
tween parasite genotype and outcome of infection with Entamoeba histolytica. J Clin
Microbiol. 2007; 45: 285289.
[117] Paul J, Srivastava S, Bhattacharya S. Molecular methods for diagnosis of Entamoeba
histolytica in a clinical setting: an overview. Exp Parasitol. 2007; 116: 3543.
[118] 118. Clark CG. Methods for the investigation of diversity in Entamoeba histolytica.
Arch Med Res. 2006; 37:258262.
[119] Aydin AF, Besibellioglu BA, Avci IY et al. Classification of Giardia duodenalis para
sites in Turkey into groups A and B using restriction fragment length polymorphism.
Diagn Microbiol Infect Dis. 2004;50:14751.
[120] Haque R, Roy S, Kabir M et al. Giardia assemblage A infection and diarrhea in Ban
gladesh. J Infect Dis. 2005;192:21713.
[121] Homan WL, Mank TG. Human giardiasis: genotype linked differences in clinical
symptomatology. Int J Parasitol. 2001;31:8226.
[122] Paintlia AS, Mahajan RC, Chakraborti A et al. Characterization of Giardia lamblia
groups A and B from North India by isoenzyme and random amplified polymorphic
DNA analysis. Parasitol Res. 1999;85:5102.
[123] Mohammed Mahdy AK, Surin J, Wan KL et al. Giardia intestinalis genotypes: risk fac
tors and correlation with clinical symptoms. Acta Trop. 2009;112:6770.
[124] Al-Mohammed HI. Genotypes of Giardia intestinalis clinical isolates of gastrointesti
nal symptomatic and asymptomatic Saudi children. Parasitol Res. 2011;108:137581.
doi: 10.1007/s00436-010-2033-5.

http://dx.doi.org/10.5772/61809
[125] Johnson JA, Clark CG. Cryptic genetic diversity in Dientamoeba fragilis. J Clin Micro
biol. 2000; 38:46534.
[126] Clark CG. Cryptic genetic variation in parasitic protozoa. J Med Microbiol. 2000;
49:48991.
[127] Peek R, Reedeker FR, van Gool T. Direct amplification and genotyping of Dientamoe
ba fragilis from human stool specimens. J Clin Microbiol. 2004; 42: 6315.
[128] Stensvold CR, Clark CG, Roser D. Limited intra-genetic diversity in Dientamoeba fra
gilis housekeeping genes. Infect Genet Evol. 2013; 18: 2846. doi:10.1016/j.meegid.
2013.05.003
[129] Hillis, D. M., and M. T. Dixon. Ribosomal DNA: molecular evolution and phyloge
netic inference. Quar Rev Bio. 1991; 66:41153.
[130] Bart A, van der Heijden HM, Greve S, Speijer D, Landman WJ, van Gool T. Intrage
nomic variation in the internal transcribed spacer 1 region of Dientamoeba fragilis as a
molecular epidemiological marker. J Clin Microbiol. 2008; 46:32705.
[131] Barratt JL, Banik GR, Harkness J, Marriott D, Ellis JT, Stark D. Newly defined condi
tions for the in vitro cultivation and cryopreservation of Dientamoeba fragilis: new
techniques set to fast track molecular studies on this organism. Parasitology. 2010;
137:186778.
[132] Stark D, Al-Qassab SE, Barratt JL, Stanley K, Roberts T, Marriott D, Harkness J, Ellis
JT. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium
spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool
samples. J Clin Microbiol. 2011; 49:25762.
[133] McHardy IH, Wu M, Shimizu-Cohen R, Couturier MR, Humphries RM. Detection of
intestinal protozoa in the clinical laboratory. J Clin Microbiol. 2014; 52: 71220.
81
Chapter 5
Speciation in the Leishmania guyanensis Vector

Lutzomyia umbratilis (Diptera: Psychodidae) from
Northern Brazil Implications for Epidemiology and
Vector Control
Vera Margarete Scarpassa and
Ronildo Baiatone Alencar
http://dx.doi.org/10.5772/60921
Abstract
This chapter starts with a brief mention of the Leishmania species and sandflies vectors
that occur in the Neotropical region, especially in the Brazilian Amazon. The main
focus of this chapter is a review of the taxonomic, biologic and epidemiologic studies
conducted in Lutzomyia umbratilis, the main vector of Leishmania guyanensis in the
northern region of Brazil. We associated these data with the population genetics
studies carried out in this sandfly vector by our research team. The genetic studies
were made with six samples of L. umbratilis from the central region of the Brazilian
Amazon, using a large fragment (1,181 bp) of the mitochondrial DNA COI gene. Also,
another study was conducted in these samples using the DNA barcode region. The
results revealed rather high levels of genetic variability for all samples analyzed and
a pronounced genetic differentiation between samples from both banks of the Negro
and Amazon rivers. The degree of differentiation found may reflect the presence of
distinct species within L. umbratilis, suggesting that the Amazon and Negro rivers may
be acting as effective barriers, preventing gene flow between populations living on
the two sides. These findings have important implications for epidemiology,
especially regarding vector competence, which is vital information for surveillance
and vector control strategies. Furthermore, this diversification process of L. umbrati
lis represents an interesting example for speciation studies.
Keywords: Sandflies, Brazilian Amazon, Population genetics, Speciation, Cryptic species
84
1. Introduction
Phlebotomine sandflies (Diptera: Psychodidae) are insects of medical and veterinary impor
tance since they are involved in transmission of various pathogens (bacteria, virus and
protozoa) that cause diseases such as Bartonellosis, Arboviruses and Leishmaniasis. The latter
is caused by trypanosomatids of the genus Leishmania, the pathogenic agent of human
leishmaniasis. Leishmania infection is characterized by a species-specific pathology, varying
from cutaneous lesions to the potentially fatal visceral form [1-3]. The distribution of this
disease encompasses the tropical, subtropical and Mediterranean regions of the world and its
global burden has been estimated to be approximately 500,000 cases of visceral leishmaniasis
(VL) and approximately 1.1-1.5 million cases of cutaneous leishmaniasis (CL) per year (4,5].
Despite its widespread distribution, most of the leishmaniasis cases occur in only a few
countries: more than 90% of the VL cases occur in Bangladesh, Brazil, Ethiopia, India, South
Sudan and Sudan, and most of the CL cases occur in Afghanistan, Algeria, Brazil, Colombia,
Iran, Pakistan, Peru, Saudi Arabia and Syria [5].
In the Americas, CL occurs from southern USA to northern Argentina, but its main focus is
concentrated in South America, especially in Bolivia, Brazil and Peru, with approximately 90%
of the recorded cases of the muco-cutaneous type [5,6]. Yet, in spite of its importance, leish
maniasis is one of the most neglected tropical diseases in the world [5].
In Brazil, there has been an expansion of this disease since 1950 [7,8]. Currently, CL has been
reported in all Brazilian states, causing outbreaks in several regions of country [9], especially
in the Brazilian Amazon. This situation has been correlated to several factors, such as defor
estation, the construction of highways and dams, implementation of agricultural poles,
migrations of human populations, new mining ventures, the emergence of villages and cities,
the use of forest locations for military training, among other factors [6-8,10-16].
Leishmania displays two main morphological forms, the amastigote and the promastigote,
which are found in close association with vertebrate (mammals) and invertebrate (phleboto
mine sandflies) hosts, respectively, comprising the link of several transmission cycles
[13,17,18]. The vertebrate hosts include a large variety of mammals, such as rodents, xenar
thrans (armadillo, anteater and sloth), marsupials (opossum), canids and primates, including
humans [19-21].
There are approximately 30 species of Leishmania described in the World and, of these, at least
20 are pathogenic in mammals [22]. In the Neotropical region 22 species were recorded; of
these, 12 were reported in Brazil [23] and seven were found infecting humans in the Brazilian
Amazon region [24]. The studies conducted in Brazil have found a large number of dermo
tropic Leishmania species that are proved to infect humans, such as Leishmania amazonensis, Le.
braziliensis, Le. guyanensis, Le. lainsoni, Le. naiffi, Le. shawi and Le. lindenbergi. There are others
species too, but they have been found only in their natural reservoir hosts, as follows: Le.
enriettii, Le. forattinii, Le. deanei and Le. utingensis [18,20,23,25-27]. With the exception of the two
species (Le. enriettii and Le.forattinii), all those listed above were reported in the Brazilian
Amazon, including Leishmania chagasi that causes visceral leishmaniasis and whose main
Speciation in the Leishmania guyanensis Vector Lutzomyia umbratilis (Diptera: Psychodidae) from Northern Brazil
http://dx.doi.org/10.5772/60921
vector is Lutzomyia longipalpis [23]. Table 1 presents all species of Leishmania and their respective
proven and suspected sandfly vectors and reservoir hosts reported in Neotropical region.
In addition to those listed in Table 1, other species of sandflies have been observed in the
Brazilian Amazon region, harboring Leishmania spp. such as L. (Lutzomyia) spathotrichia and
L. (Psathyromyia) dendrophyla [18].
The detection and identification of the Leishmania spp. in phlebotomine species are important
to predict the risk of the disease spreading in and around endemic areas, once these species
are the main determinants of the clinical outcome in humans. Currently, the use of molecular
techniques such as polymerase chain reaction (PCR) has increased the sensitivity and specif
icity of parasite identification [28]. Based on this technique, L. (Evandromyia) georgii was
reported for the first time to be infected with Leishmania spp. in the Brazilian Amazon region
[29]. Similarly, L. (Trichophoromyia) ubiquitalis and L. (Psychodopygus) davisi were found for the
first time to be infected with Le. lainsoni in the state of Amazonas, Brazil [30]. These sandflies
had already been identified as vectors of Le. lainsoni [31] and Le. brazilienesis [32], respectively,
in the state of Par (Brazil).
Phlebotomine sandflies are amply distributed in all continents, except in Antarctica. Out of
the six genera belonging to the subfamily Phlebotominae, only Lutzomyia and Phlebotomus
harbor the main vectors of human leishmaniasis. The former is restricted to the Neotropical
and Neartic regions, where approximately 32 out of more than 500 species described [33] are
implicated as vectors, whereas the latter is distributed in all the other regions of the world and
comprises important vectors such as Phlebotomus papatasi in the Old World, which is the main
vector of Leishmania major [34,35]. Genus Lutzomyia includes the subgenera Nyssomyia and
Psychodopygus, which comprise the most important vectors of CL in the Neotropics, in
particular in the Brazilian Amazon region (Table 1; Figures 1 and 2).
Parasites
Leishmaniasis Sandfly vectors
Reservoir host
Species
Subgenus
in humans
Species
Leishmania
Leishmania
Visceral and
Lutzomyia longipalpisP Lutzomyia
Canids (Cerdocyon thou,
cutaneous*
Lutzomyia cruziP
Lutzomyia
Speothos venaticus, Canis
Lutzomyia evansiP
Group Verrucarum familiaris), felines
chagasiBr/A
Subgenus/Group
(Panthera onca, Felis

concolor), marsupials
(Didelphis marsupialis
and D. albiventris)
Leishmania
Leishmania
Not registered
enriettiiBr
Leishmania
mexicana
Lutzomyia monticolaS
Ungrouped
Rodents (Cavia porcellus)
Lutzomyia correalimaiS Group Rupicola

Leishmania
Cutaneous
Lutzomyia olmeca
Nyssomyia
Rodents (Ototylomys
olmecaP
Lutzomyia
phyllotis, Nyctomys
Lutzomyia diabolicaS
sumichrasti, Heteromys
desmarestianus, Sigmodon
hispidus, Neotoma
albigula)
85
86
Parasites
Species
Subgenus
in humans
Reservoir host
Species
Subgenus/Group
Leishmania pifanoi Leishmania
Cutaneous
Lutzomyia
Nyssomyia
Unknown
Lutzomyia
Nyssomyia
Rodents (Proechimys
flaviscutellataP
Nyssomyia
spp.,
Lutzomyia o. olmecaP
Nyssomyia
Oryzomys spp., Nectomys,
flaviscutellataS
Leishmania
Leishmania
Cutaneous
amazonensisBr/A
Lutzomyia reductaP
Neacomys, Dasyprocta)
Marsupials (Marmosa,
Metachirus, Didelphis,
Philander),
fox (Cerdocyon thous)
Leishmania
Leishmania
Not registered
aristidesi
Lutzomyia olmeca
Nyssomyia
bicolorS
Marsupials (Marmosa
robinsoni), rodents
(Poechmys semispinosus,
Dasyprocta punctata)
Leishmania
Leishmania
Cutaneous
Lutzomyia youngiS
Group Verrucarum Marsupials (Didelphis
Leishmania
Cutaneous
Lutzomyia olmeca
Nyssomyia
bicolorS
Ungrouped
garnhami
Leishmania
marsupialis)
venezuelensis
Domestic cat
Lutzomyia rangelianaS
Leishmania
Leishmania
Not registered
forattiniiBr
Lutzomyia ayrozaiP
Psychodopygus
Lutzomyia yuilliP
Nyssomyia
Rodents (Proechimys
inheringi), marsupials
(Didelphis marsupialis)
Leishmania hertigi Leishmania
Not registered
Unknown
Rondent(Coendou
Leishmania
Leishmania
Not registered
Unknown
Rondent (Coendou p.
Viannia
Cutaneous
Lutzomyia intermediaP Nyssomyia
Rodents (Oryzomys
Lutzomyia whitmaniP
Nyssomyia
concolor,
Lutzomyia wellcomeiP
Psychodopygus
O. capito, O. nigripes,
Lutzomyia davisiP
Psychodopygus
Akodon arviculoides,
Lutzomyia complexaS
Psychodopygus
Proechimys
rothschildi)
deaneiBr/A
Leishmania
prehensilis)
braziliensisBr/A
spp., Rattus rattus,

Rhipidomys leucodactylus,
Sigmodon hispidus,
Bolomys lasiurus),
marsupials (Didelphis
marsupialis)
Leishmania
peruviana
Viannia
Cutaneous
Lutzomyia peruensisS
Helcocyrtomyia
Lutzomyia
Group Verrucarum andinum), marsupials
verrucarumS
Rodent (Phyllotis
(Didelphis marsupialis)
and domestic dog
http://dx.doi.org/10.5772/60921
Parasites
Species
Subgenus
in humans
Species
Leishmania
Viannia
Cutaneous
Lutzomyia umbratilisP Nyssomyia
Xenarthrans (Choloepus
Lutzomyia anduzeiP
didactylus, Tamandua
guyanensisBr/A
Reservoir host
Subgenus/Group
Nyssomyia
tetradactyla), rodents and

marsupials
Leishmania
Viannia
Cutaneous
panamensis
Lutzomyia trapidoi
Nyssomyia
Lutzomyia ylephiletorP Nyssomyia
hoffmanni, Bradypus
Lutzomyia gomeziP
Lutzomyia
infuscatus and B. griseus);
Lutzomyia
Psychodopygus
racoons (Bassaricyon
panamensisP
gabbi, Nasua nasua, Poto

flavus), primates (Aotus
trivirgatus, Saguinus
geoffroyi), rodents
(Heteromys spp.)
Leishmania
Viannia
Cutaneous
lainsoniBr/A
Leishmania
Viannia
Cutaneous
naiffiBr/A
Lutzomyia ubiquitalisP Trichophoromyia

Lutzomyia velascoiS
Trichophoromyia
Lutzomyia ayrozaiP
Psychodopygus
Lutzomyia panamensisP Psychodopygus

Lutzomyia
Rodent (Agouti paca)

Xenarthrans (Dasypus
novemcinctus)
Psychodopygus
squamiventrisP
Leishmania
Viannia
Cutaneous
Lutzomyia whitmaniP
Nyssomyia
shawiBr/A
Primates (Cebuspaella,
Chiropotes satanas),
xenarthrans (Choloepus
didactylus,Bradypus
tridactylus) and racoon
(Nasua nasua)
Leishmania
Viannia
Cutaneous
colombiensis
Lutzomyia hartmanni
Helcocyrtomyia
Xenarthrans(Choloepus
Lutzomyia gomeziP
Lutzomyia
hoffmanni)
Lutzomyia panamensisP Psychodopygus

Leishmania
Viannia
Not registered
Lutzomyia hartmanniP Helcocyrtomyia
equatorensis
hoffmanni) and rodent
(Sciurus grantensis)
Leishmania
Viannia
Cutaneous
Lutzomyia antunesiS
Nyssomyia
Viannia
Not registered
Lutzomyia tuberculataP Viannamyia
Unknown
lindenbergiBr/A
Leishmania
Unknown
utingensisBr/A
Br/A=Brazil, including Amazon; Br=Brazil, except Amazon; P=proven vector; S=suspect vector. *In Costa Rica, the
infection occurs mostly as non-ulcerative skin lesions; Honduras and Nicaragua, the infection is much visceral as skin.
Information compiled from Lainson (2010) [23].
Table 1. Leishmania species with their respective proven and suspect vectors (phlebotomine sandflies) and natural
reservoirs (mammals) reported for the Neotropical region.
87
88
Figure 1. Distribution of the sandfly vectors of Leishmania amazonensis (A), Leishmania braziliensis (B) and Leishmania
guyanensis (C and D). Highlight in green color corresponding to the Brazilian Amazon region. Map modified from
Young and Duncan (1994) [2].
http://dx.doi.org/10.5772/60921
Figure 2. Distribution of the sandfly vectors of Leishmania lainsoni (A), Leishmania naiffi (B), Leishmania shawi (C) and
Leishmania chagasi (D). Highlight in green color corresponding to the Brazilian Amazon region. Map modified from
Young and Duncan (1994) [2].
89
90
Similar to other insect groups, the Brazilian Amazon hosts a large diversity of sandfly species
likely because of the great variety of ecological niches available [36] which are favorable for
survival and reproduction. For example, in a single hectare of forest 50 sandfly species were
captured [37]. This high level of diversity of insect vectors and also of reservoirs permits the
simultaneous circulation of several species of Leishmania and is particularly interesting for the
dynamic transmission studies of CL in this region [38,39].
In northern South America, in particular in the Brazilian Amazon region, the transmission of
CL is associated to Lutzomyia umbratilis Ward and Fraiha and Lutzomyia anduzei Rozeboom,
implicated as principal and secondary vectors of Le. guyanensis, respectively. The Le. guyanen
sis cycle is completed in several species of mammals, especially in xenarthrans, the two-toed
sloth (Choloepus didactylus), considered the main reservoir, and marsupials such as the
opossum (Didelphis marsupialis) (Didelphis marsupialis) [40-43].
2. Distribution, biological aspects and population genetics of Lutzomyia

umbratilis
In the last years, as genetic molecular markers became available, the number of studies on
population genetics and evolutionary genetics in sandfly species has significantly increased
[44-49], and the results have revealed large intra-population genetic variation, genetically
populations structured, genetic lineages and cryptic species complexes. In the case of vector
species, the knowledge of the genetic structure of populations and the processes responsible
for the differentiation distribution is important for the identification of the disease transmission
heterogeneity patterns. Such patterns are often produced by the presence of cryptic species,
structured populations and/or genetic lineages, which may show variation in the degrees of
anthropophily, susceptibility of females to infection by the pathogen, infection rates and
females longevity. The identification of these factors is of paramount importance for devel
oping effective management and vector control strategies.
The diversification patterns (structured populations, lineages, complete speciation) observed
in sandfly species have generally been associated to multiple factors, such as climate barriers
(or climate events in the past), geographic distances, differences in latitude or altitude, habitat
modification, landscape fragmentation caused by anthropogenic actions and others, vegeta
tion type or geographic barriers (rivers, mountains). These factors can reduce the dispersal
capacity of sandflies, leading them to become isolated populations and causing loss of genetic
diversity and increase of differentiation among the populations, as discussed by Ready et al.
[50] with regard to Lutzomyia whitmani, by Mukhopadhyay et al. [51] for Lutzomyia shannoni,
by Uribe-Soto et al. [52] for L. longipalpis and by Pech-May et al. [45] for Lutzomyia cruciata.
Additionally, the low flight capacity of this group of insects which seldom spread over more
than 1 km, and the breeding soil type are also factors that may contribute even more to the
population isolation and then favor the process of divergence and speciation events.
Lutzomyiaumbratilis, the main vector of Le. guyanensi, that causes Cutaneous Leishmaniasis
(CL), occurs in northern South America, including Bolivia, Brazil, Colombia, French Guyana,
http://dx.doi.org/10.5772/60921
Peru, Suriname and Venezuela [2,53]. In Brazil, L. umbratilis has been reported in all states of
the northern region, the states of Mato Grosso and Mato Grosso do Sul (Southwest), besides
the state of Maranho and an isolated population in the state of Pernambuco, both in the
northeastern region [2, 54,55]. Thus, populations of this species are spread over vast areas,
separated by geographic barriers such as the largest rivers, the Amazon and the Negro, in the
Brazilian Amazon region. Additionally, sandfly species have very limited dispersal capabili
ties, usually no more than 1 km [56,57], which favors geographic isolation of the populations.
Thus, considering the vast geographic area, with discontinuous distribution, along with the
low flight capacity of this insect group, L. umbratilis populations could be more susceptible to
evolve into differentiated populations, incipient species and, ultimately, reproductively
isolated species.
Lutzomyia umbratilis has been implicated in the transmission of Le. guyanensis in several
countries of northern South America, including northern Brazil, and French Guiana and
Suriname [58-60]. In the Brazilian Amazon, this species has shown to be highly anthropophilic
and has been appointed as the main Le. guyanensis vector in the states of Par [58-60], Amazonas
[42,61-63] and Amap [18] and is probably involved in the transmission in the states of Acre
[64] and Rondnia [65]. Moreover, according to the hypothesis of Arias and Freitas [40], the
susceptibility of this vector to Leishmania seems to vary in the central Brazilian Amazon region.
Lutzomyia umbratilis populations naturally infected with Le. guyanensis have been observed
east of the Negro River and north of the Amazonas River; however, there is no report of natural
infections by Leishmania in this species south of the Amazon River system. Arias and Freitas
[40] suggested that the fluvial system formed by the Amazon, Solimes and Negro Rivers may
act as a barrier to the Le. guyanensis transmission cycle, where L. umbratilis populations display
distinct degrees of vector competence between the opposite sides of these rivers, suggesting
that these populations might represent a species complex or incipient speciation event.
Despite its importance as vector and the probable existence of a cryptic species complex, only
few studies have tested the role of the rivers barrier in the genetic subdivision of L. umbratilis.
A biological study conducted with two L. umbratilis populations from Manaus and Manaca
puru (left and right banks of the Negro River, respectively) in the Brazilian Amazon region,
revealed significant differences in the life cycle, fecundity, fertility, emergence degree and adult
longevity between these populations, reflecting intrinsic biological differences [66]. Subsequent
ly, a study that combined morphology, chromosome and isozymes analyses of four L. umbrati
lis populations from this fluvial system showed significant differences in the bristle lengths of
4th instar larvae and in the number and size of the spines of the female genital atrium arma
ture [67]. The latter has been a useful marker for distinguishing closely related species of sandflies
[68]. Unfortunately, polytene chromosome analysis was not possible, but the metaphase
karyotype was 2n=6. Isozymes did not reveal any differences among the populations [67]. This
result may be due to the slow evolution rate, negative selection and the amino acid codon wobble
effect. Consequently, isozymes are not informative markers for detecting incipient or recently
diverged species. Therefore, the taxonomic status of L. umbratilis remains unclear.
Lutzomyia umbratilis was described by Ward and Fraiha [69], based on specimens captured in
the Jari River region, state of Par, Brazil. Because of the high morphological similarity between
L. umbratilis and L. anduzei, the former has been wrongly identified as L. anduzei in the past. In
91
92
fact, most of L. anduzei specimens found to be naturally infected with Leishmania before this
date (1977) could actually be L. umbratilis. After this date, it has been possible distinguish L.
umbratilis and L. anduzei morphologically, based on the internal and external genitalia of males
and females [2,70]. Currently, they can also be identified molecularly by using DNA barcode
sequences from COI of mitochondrial DNA [70]. The phylogenetic analysis of this dataset
found two strongly supported monophyletic clades, although the genetic distances between
them, based on the Kimura 2 Parameters (K2P) model, were very small (4.4%), suggesting that
these species are very closely related (sister species) [70]. These species have been found
infected naturally with Le. guyanensis in the Brazilian Amazon, although the studies revealed
much higher infection rates in L. umbratilis than in L. anduzei females, consequently, the former
has been recognized as principal vector of this parasite [18,63,71,72].
L. umbratilis adults are generally found in the rainforest (primary forest) of the Brazilian
Amazon region, with its high humidity and dim light; therefore, the species has been recog
nized as ombrophilous, as expressed in its name, L. umbratilis. This species is further recognized
as dendrobatic, because it is associated to tree trunks during the daytime. In the field, its density
may vary, depending on the location and of these characteristics, but it seems to be denser in
the central Amazon region, tending to reduce its density towards the edges of this region
(Alencar, R. B., personal information). L. umbratilis adults are captured using aspirators on the
bases of tree trunks during daytime and with CDC (Center for Disease Control) miniature light
traps at ground level and in the forest canopy at night. These methods have been employed
efficiently throughout Brazilian Amazon region [73].
In addition to the isozyme studies mentioned above, the most recent population genetics
analyses were performed on the six L. umbratilis populations from the two opposite banks of
the Amazon and Negro rivers (Table 2; Figure 3) by using a large fragment (1,181 bp) of the
COI gene (the 3 end fragment of COI) [48] and the Barcode region (663 bp) [70], both from
mitochondrial DNA. The aim of these analyses was to assess whether the populations of the
opposite banks of these rivers consist of incipient or distinct species. In the study of Scarpassa
and Alencar [48], 111 specimens were sequenced and the results revealed 52 haplotypes,
reflecting a very large genetic variability for most of the samples examined, except one (Rio
Preto da Eva). The genealogical relationships of the haplotypes were accessed using the TCS
program [74] at the 95% confidence level. This analysis showed two haplotype groups
(lineages), separated by ten mutational steps, but all connected in the network (Figure 4).
Similarly, phylogenetic analysis using Bayesian Inference (BI) and inferred under the TIM1+I
model, generated two distinct evolutionary lineages (probably clades), with probability
support from moderate to slightly high (0.64 and 0.77; Figure 5), suggesting two monophyletic
clades. These lineages can be separated by one fixed mutation at position 933 (A G) of the
dataset, and the estimated sequence divergence between them was 1%. Lineage I consisted of
four samples from the left bank of the Amazon and Negro rivers, whereas lineage II comprised
two samples from the right bank of the Negro river (Figure 3). No haplotypes were shared
between samples of the two lineages. Samples from the same clade (within-clades) exhibited
low to moderate genetic differentiation (FST = -0.0390-0.1841), whereas samples from different
clades (between clades) exhibited extremely high and significant differentiation (FST =
http://dx.doi.org/10.5772/60921
0.7100-0.8497; P < 0.0001) and fixed differences (Sf = 1 to 7) (Table 3). Curiously, the samples
from Manacapuru versus the samples from the BR-174 Highway, Rio Preto da Eva and Manaus,
which are separated by smaller geographic distances (from 59.43 to 96.01 km), displayed more
fixed differences (Sf = 6 to 7) and no shared polymorphism (Ss = 0), whereas, the samples from
Manacapuru versus the samples from Cachoeira Porteira, which are separated by a larger
geographic distance (449.22 km), exhibited less fixed differences (Sf = 3) and more shared
polymorphisms (Ss = 2). Taken together, the evidence of absence of gene flow associated with
the high levels of genetic differentiation may be an indicator of genetic discontinuity between
these lineages, so they could represent incipient or distinct species. The separation time
calculated between these lineages falls in the middle Pleistocene (0.22 Mya), coinciding with
the more recent formation of the Amazon and Negro rivers [75], appointed as the most
probable evolutionary force. This vicariant event, along with the low dispersal rate of the
sandflies, and the amenable environmental conditions for adaptation and also drift are likely
to have contributed to the great genetic differentiation between the populations of the opposite
banks.
Figure 3. Collection sites of Lutzomyia umbratilis from the Brazilian Amazon. Geographic distribution inferred of line
age I (in red color); Geographic distribution inferred of lineage II (in blue color). Map modified from Scarpassa and
Alencar (2013) [70].
93
94
Species
Localities, State
Co-ordinates
L. umbratilis
Cachoeira Porteira, Oriximin, Par
1 28 S; 56 22 W
18
BR-174 Highway, Amazonas
2 36 S; 60 02 W
15
Rio Preto da Eva, Amazonas
2 43 S; 59 47 W
15
Manaus, Amazonas
3 04 S; 59 57 W
Manacapuru, Amazonas
3 14 S; 60 31 W
24
Novo Airo, Amazonas
2 47 S; 60 55 W
35
Latitude; Longitude
N: sample size. Source: Scarpassa and Alencar (2012) [48]

Table 2. Collection sites and sample sizes of Lutzomyia umbratilis from the Brazilian Amazon.
Figure 4. Parsimony haplotypes network of the 52 haplotypes observed in Lutzomyia umbratilis. H1 to H52, haplotypes.
The haplotype circle sizes are proportional to number of individuals observed in each haplotype. Clade I is in red col
or. Clade II is in blue color. Empty smaller circles represent mutational events. Source: Scarpassa and Alencar (2012)
[48].
http://dx.doi.org/10.5772/60921
Figure 5. Bayesian Inference (BI) topology tree of the 52 haplotypes of Lutzomyia umbratilis inferred under the TIM1+I
evolutionary model. Numbers above branch represent posterior probabilities obtained in the BI. Lutzomyia anduzei was
used as outgroup. Source: Scarpassa and Alencar (2012) [48].
95
96
Samples
FST (Km)
Dxy
Da
Ss
Sf
Cachoeira Porteira x BR-174 Highway
0.0522 (368.40)
3.52
0.00297
0.00017
Cachoeira Porteira x Rio Preto da Eva
0.0569*** (353.67)
2.99
0.00248
0.00017
Cachoeira Porteira x Manaus
0.0230 (394.02)
3.92
0.00332
0.00025
BR-174 Highway x Rio Preto da Eva
0.0189 (30.46)
1.48
0.00125
0.00002
BR-174 Highway x Manaus
-0.0390 (56.29)
2.20
0.00187
-0.00012
Rio Preto da Eva x Manaus
0.1841 (45.35)
1.87
0.00158
0.00008
Manacapuru x Novo Airo
0.0548 (58.74)
1.81
0.00153
0.00008
Cachoeira Porteira x Manacapuru
0.7100*** (449.22)
10.19
0.00863
0.00599
BR-174 Highway x Manacapuru
0.8157*** (87.11)
9.78
0.00833
0.00673
Rio Preto da Eva x Manacapuru
0.8497*** (96.01)
8.98
0.00765
0.00653
Manaus x Manacapuru
0.8249*** (59.43)
10.42
0.00887
0.00699
Cachoeira Porteira x Novo Airo
0.7337 *** (477.49)
10.55
0.00899
0.00625
BR-174 Highway x Novo Airo
0.8197*** (107.97)
10.21
0.00869
0.00705
Rio Preto da Eva x Novo Airo
0.8439 *** (130.14)
9.43
0.00803
0.00687
Manaus x Novo Airo
0.8269*** (108.76)
10.84
0.00924
0.00731
Clade I x Clade II
0.7776***
9.99
0.00850
0.00660
FST: pair-wise genetic differentiation; K: average number of nucleotide differences between populations; Dxy: average
number of nucleotide substitutions per site between populations; Da: number of net nucleotide substitutions per site
between populations; Ss: number of shared polymorphisms between pairs of populations; Sf: number of fixed differences
between pairs of populations. The geographic distance (in km) between localities is represented inside the parentheses.
***P = 0.00000 0.0000, after the Bonferroni correction. Source: Scarpassa and Alencar (2012) [48].
Table 3. Genetic differentiation among samples and haplotype clade of Lutzomyia umbratilis.
Another study was conducted subsequently on these L. umbratilis populations, using the
Barcode region (663bp) [70]. In the 72 specimens sequenced, 32 haplotypes were observed. In
line with the results of the previous study [48], no haplotype was shared between lineages I
and II. The genetic distance between the lineages, based on the K2P model, was rather small
(0.009 to 0.010); however, they could be identified by one fixed mutation (T C transition at
position 21).
The genetic differentiation observed in these studies supports the biological and morpholog
ical differences reported by Justiniano [67] and Justiniano et al. [66]. These results strongly
http://dx.doi.org/10.5772/60921
indicate that L. umbratilis represents a species complex with recent evolutionary history. Taken
together, these findings might explain possible differences in the vector competence of these
sandflies, a hypothesis raised by Arias and Freitas [40]. On the other hand, these results do not
support the isozyme data, which showed genetic homogeneity among populations. These
inconsistencies between markers could be attributed to incomplete lineage sorting, due to
recent divergence between L. umbratilis lineages (or distinct species) and/or distinct evolution
rates of the markers used; for instance, isozymes evolve at a slower rate than mitochondrial
DNA and are not informative markers for detecting incipient or recently diverged species.
Little is known about the natural breeding sites of L. umbratilis and, consequently, about its
biology. This knowledge is important for application in any attempt to create and maintain
colonies in laboratory conditions. The maintenance of L. umbratilis colonies could be the key
to testing the mechanisms of reproductive isolation [66,76,77], as well as the assortative mating
features between populations separated by the Negro and Amazon rivers, hypothesized as
distinct species. It is particularly important because species that have diverged very recently
are expected to share ancestral variation at high proportions, a situation that may confound
their phylogenetic reconstruction. In addition, it is likely that in young species, with a recent
divergence process, there are fixed differences only in genes involved in the speciation process.
The maintenance of L. umbratilis colonies in the laboratory would also be important to assess
the level of vector competence, based on tests of experimental infection between populations
from the opposite river banks.
Another interesting approach could be genomic population studies using multilocus analysis,
especially using loci which are involved in the different biologic aspects of L. umbratilis. This
approach will permit distinguishing the effects of natural selection from those of genetic drift.
The importance of this approach resides in the fact that genomic analyses provide more reliable
information on historic and demographic events. The effect of a specific locus (outlier locus)
helps identifying signs of natural selection in genes involved in the most variable adaptability
process, such as those related to vector competence and (or) vector capacity, thus allowing a
better understanding of vector status in distinct areas from the Brazilian Amazon.
3. Conclusion
The two genetic lineages of L. umbratilis found in these studies may represent an advanced
speciation process, indicating incipient or distinct species. This suggests that the Amazon and
Negro rivers may be acting as effective barriers, as observed in L. cruciata [45], preventing gene
flow between populations of opposite banks. Such findings have important implications for
epidemiology, especially those related to vector competence, which are vital information for
surveillance and vector control strategies in northern Brazil. Furthermore, this information
may also provide a better knowledge of the evolutionary history of this species complex, as
well as L. umbratilis represents an interesting example for speciation studies.
Finally, further studies of these populations using other molecular genetic markers, as well as
additional sampling along the river banks and within interfluves in the Brazilian Amazon, are
97
98
clearly needed to allow a more precise estimate of the differentiation, number of clades or
distinct species. Studies of this kind are currently under way in our laboratory.
Acknowledgements
The results of the articles our team cited here were funded by MCTI/INPA, Brazil, and by
grants from the Amazonas Research Foundation (FAPEAM-Universal-Amazonas, process
number 3111/2012), Brazil, from the INCT-CENBAM/CNPq/FAPEAM/INPA, Brazil, and from
the PRO-EQUIPAMENT/CAPES, Brazil.
Author details
Vera Margarete Scarpassa1 and Ronildo Baiatone Alencar2
*Address all correspondence to: vera@inpa.gov.br
1 Laboratrio de Gentica de Populaes e Evoluo de Vetores de Malria e Dengue. Insti
tuto Nacional de Pesquisas da Amaznia (INPA), Manaus, Amazonas, Brazil
2 Universidade do Estado do Amazonas (UEA), Manaus, Amazonas, Brazil
References
[1] Lane RP. Sandflies. In Medical insects and arachnids. Edited by Lane RP, Crosskey
RW. London: Chapman and Hall 1993; 78-119.
[2] Young DG, Duncan NA. Guide to the identification and geographic distribution of
Lutzomyia sandflyies in Mexico, the West Indies, Central and South America (Dip
tera: Psychodidae). Memoirs of the American Entomological Institute (Gainesville)
1994; 54 1-881.
[3] WORLD HEALTH ORGANIZATION - WHO. Control of the leishmaniasis. Report
of a meeting of the WHO Expert Committee on the Control of Leishmaniasis, 22-26
March, Geneva 2010; 5-88.
[4] Reithnger R. Leishmaniases burden of disease: ways forward for getting from specu
lation to reality. PLoS Neglected Tropical Diseases 2008; 2 e285. doi:10.1371/ jour
nal.pntd.0000285.
http://dx.doi.org/10.5772/60921
[5] WORLD HEALTH ORGANIZATION - WHO. Leishmaniasis. 2015. Available in:

http://www.who.int/tdr/publications/publications/pdf/prl/pr17/leishmaniasis.pdf.
Accessed at February 15, 2015.
[6] Gontijo B, Carvalho MLR. Leishmaniose tegumentar americana. Revista Brasileira de
Medicina Tropical. 2003; 36(1) 71-80.
[7] Vale ECS, Furtado T. Leishmaniose tegumentar americana: reviso histrica da ori
gem, expanso e etiologia. Anais Brasileiro de Dermatologia 2005; 80(4) 421-428.
[8] Guerra JAO, Ribeiro JAS, Coelho LIARC, Barbosa MGV, Paes MG. Epidemiologia da
leishmaniose tegumentar na Comunidade So Joo, Manaus, Amazonas, Brasil. Ca
derno de Sade Pblica 2006; 22 2319-2327.
[9] MS/SVS - Ministrio da Sade/Secretaria de Vigilncia em Sade. Manual de Vigiln
cia da Leishmaniose Tegumentar Americana 2010. 2 ed. Braslia: Editora do Minis
trio da Sade, 180 pp. (Srie A. Normas e Manuais Tcnicos).
[10] Marzochi MC. As Leishmanioses no Brasil: as leishmanioses tegumentares. Jornal
Brasileiro de Medicina 1992; 63 82-104.
[11] Ministrio da Sade MS/Fundao Nacional de Sade FUNASA. Manual de Con
trole da Leishmaniose Tegumentar Americana 2000. 5 ed., Braslia, 62pp.
[12] Basano SA, Camargo LMA. Leishmaniose Tegumentar Americana: histrico, epide
miologia e perspectiva de controle. Revista Brasileira de Epidemiologia 2004; 7(3)
328-337.
[13] Lainson R. The American Leishmaniasis: some observations on their ecology and epi
demiology. Transactions of the Royal Society of Tropical Medicine and Hygiene
1983; 77 569-596.
[14] Barrett TV, Senra MS. Leishmaniasis in Manaus, Brazil. Parasitology Today 1989; 5(8)
255-257.
[15] S SMA, S EV, Diniz AM. Sade e Qualidade de Vida na Amaznia. In: Furtado,
L.G. (Org.). Amaznia, Desenvolvimento, Sociodiversidade e Qualidade de Vida, UFPA, Be
lm 1997; 135-145.
[16] Guerra JAO, Talhari S, Paes MG, Garrido M, Talhari JM. Aspectos clnicos e diagns
ticos da leishmaniose tegumentar americana em militares simultaneamente expostos
infeco na Amaznia. Revista da Sociedade Brasileira de Medicina Tropical 2003;
36 587-590.
[17] Lainson R, Shaw JJ. Leishmaniasis in Brazil. I. Observations on enzootic rodent leish
maniasis incrimination of Lutzomyia flaviscutellata (Mangabeira) as the vector in the
lower Amazonian basin. Transactions of the Royal Society of Tropical Medicine and
Hygiene 1968; 62 385-395.
[18] Freitas RA, Naiff RD, Barrett TV. Species Diversity and Flagellate Infections in the
Sand Fly Fauna near Porto Grande, State of Amap, Brazil (Diptera: Psychodidae. Ki
99
100
netosplatida: Trypanosomatidae). Memrias do Instituto Oswaldo Cruz 2002; 97(1)

53-59.
[19] Lainson R, Shaw JJ. Leishmaniasis in Brazil: III. Cutaneous leishmaniasis in an opos
sum, Marmo samurina (Marsupialia, Didelphidae) from the lower Amazon region.
Transactions of the Royal Society of Tropical Medicine and Hygiene1969; 63(6)
738-740.
[20] Lainson, R, Shaw JJ. Leishmaniasis in Brazil: V. Studies on the epidemiology of cuta
neous leishmaniasis in Mato Grosso State, and observations on two distinct strains of
Leishmania isolated from man and forest animals. Transactions of the Royal Society of
Tropical Medicine and Hygiene 1970; 64(5) 654-667.
[21] Naiff RD, Talhari S, Barrett TV. Isolation of Leishmania guyanensis of the nasal muco
sa. Memrias do Instituto Oswaldo Cruz 1988; 83(4) 529-530.
[22] Center for Food Security and Public Health (CFSPH). Leishmaniasis (cutaneous and
visceral). Iowa State of University, College of Veterinary Medicine, Iowa 2009; 1-10.
[23] Lainson, R. Espcies neotropicais de Leishmania: uma breve reviso histrica sobre
sua descoberta, ecologia e taxonomia. Revista Pan-Amaznica de Sade 2010; 1
13-32.
[24] Rotureau B. Ecology of the Leishmania species in the Guianan eco-region complex.
American Journal of Tropical Medicine and Hygiene 2006; 74 81-96.
[25] Silveira FT, Ishikawa EA, De Souza AAA, Lainson R. An outbreak of cutaneous leish
maniasis among soldiers in Belm, Par State, Brazil, caused by Leishmania (Viannia)
lindenbergi n. sp. A new leishmaniasis parasite of man in the Amazon region. Parasite
2002; 9 43-50.
[26] Genaro O, Marques MJ, Reis AB, Silva AFF, Michalik MSM, Costa CA, Mayrinc W,
Dias M. Leishmaniose Tegumentar Americana. In: Neves DP, Melo AL, Genaro O,
Linardi PM. Parasitologia Humana 2003; 36-53. ATHENEU, So Paulo-SP.
[27] Rangel EF, Lainson R. Flebotomneos do Brasil, Fiocruz, Rio de Janeiro 2003; 367 pp.
[28] Cabrera OL, Munstermann LE, Cardenas R, Gutierrez R, Ferro C. Definition of ap
propriate temperature and storage conditions in the detection of Leishmania DNA
with PCR in phlebotomine flies. Biomdica (Bogot) 2002; 22 296-302.
[29] Albuquerque MIC. Fauna de flebotomneos (Diptera: Psychodidae) e taxa de infeco
natural por Leishmania spp. (Kinetoplastida: Trypanosomatidae) da Reserva Biolgica
de Campina INPA da BR 174, Manaus, Amazonas, Brasil. Masters Thesis 2009; 74
pp.
[30] Pereira Jnior AA. Fauna de flebotomneos (Diptera: Psychodidae) e taxa de infeco
natural por Leishmania Ross (Kinetoplastida: Trypanosomatidae) em ambientes de
http://dx.doi.org/10.5772/60921
vrzea e de terra firme do municpio de Tef, Amazonas, Brasil. Master Thesis 2014;
81 pp.
[31] Silveira FT, Souza AAA, Lainson R, Shaw JJ, Braga RR, Ishikawa EAY. Cutaneous
leishmaniasis in the Amazon Region: natural infection of the sandfly Lutzomyia ubiq
uitalis (Psychodidae: Phlebotominidae) by Leishmania lainsoni in Par State, Brazil.
Memrias do Instituto Oswaldo Cruz 1991; 86(1) 127-30.
[32] Souza AAA, Silveira FT, Lainson R, Barata IR, Silva MGS, Lima JAN, Pinheiro MSB,
Silva FMM, Vasconcelos, LS, Campos, MB, Ishikawa, EAY. Fauna flebotomnica da
Serrados Carajs, Estado do Par, Brasil, e sua possvel implicao na transmisso da
leishmania tegumentar americana. Revista Pan-Amaznica de Sade 2010; 1(1) 45-51.
[33] Shimabukuro PHF, Galati, EAB. Checklist dos Phlebotominae (Diptera: Psychodidae)
do Estado de So Paulo, Brasil, com comentrios sobre sua distribuio greogrfica.
Biota Neotropical 2011; 11 1-20. http://www. biotaneotropica.org.br/v11n1a/pt/
abstract?inventory +bn0361101a2011.
[34] Dantas-Torres F. The role of dogs as reservoirs of Leishmania parasites, with emphasis
on Leishmania (Leishmania) infantum and Leishmania (Viannia) braziliensis. Veterinary
Parasitology 2007; 149 139-146.
[35] Kakarsulemankhel JK. Leishmaniasis in Pak-Afghan region: a review. International
Journal of Agriculture and Biology 2011; 13 611-620.
[36] Aguiar GM, Medeiros WM. Distribuio regional de habitats das espcies de fleboto
mneos do Brasil. In: Rangel EF, Lainson R (eds). Flebotomneos do Brasil 2003;
207-256.
[37] Young DG, Arias JR. Flebotomneos vectores de leishmaniasis en las Americas. Or
ganizao Pan-Americana da Sade. Caderno Tcnico 1992; (3).
[38] Grimaldi G Jr, Tesh RB, McMahon-Pratt D. A review of the geographic distribution
and epidemiology of leishmaniasis in the New World. American Journal of Tropical
Medicine and Hygiene 1989; 41 687-725.
[39] Lainson R, Shaw JJ, Silveira FT, Sousa AAA, Braga RR, Ishikawa EAY. The dermal
leishmaniasis of Brazil, with special reference to the eco-epidemiology of the disease
in Amazonian. Memrias do Instituto Oswaldo Cruz 1994; 89 435-443.
[40] Arias JR, Freitas RA. Sobre os vetores de leishmaniose cutnea na Amaznia central
do Brasil. 2: incidncia de flagelados em flebtomos selvticos. Acta Amaznica 1978;
8 387-396.
[41] Arias JR, Freitas RA. On the vectors of cutaneous leishmaniasis in the Central Ama
zon of Brazil. 4. Sand fly emergence from a terra firme forest floor. Acta Amazni
ca 1982; 12 609-611.
101
102
[42] Arias JR, Naiff RD. The principal reservoir host of cutaneous leishmaniasis in the ur
ban area of Manaus, Central Amazon of Brazil. Memrias do Instituto Oswaldo Cruz
1981; 76 279-286.
[43] Arias JR, Miles MA, Naiffi RD, Pvoa MM, Freitas RA, Biancardi CB, Castelln EG.
Flagellates infections of Brazilian sandflies (Diptera: Psychodidae): Isolation in vitro
and biochemical identification of Endotrypanum and Leishmania. American Journal of
Tropical Medicine and Hygiene 1985; 34 1098-1108.
[44] Zapata S, Meja L, Le Pont F, Len R, Pesson B, Ravel C, Bichaud L, Charrel R,
Cruaud C, Trueba G, Depaquit J. A study of a population of Nyssomyia trapidoi (Dip
tera: Psychodidae) caught on the Pacific coast of Equator. Parasites & Vectors 2012; 5
144.
[45] Pech-May A, Marina CF, Vzquez-Domnguez E, Berzunza-Cruz M, Rebollar-Tlles
EA, Narvez-Zapata JA, Moo-LIanes D, Ibnez-Bernal S, Ramsey JM, Becker I. Genet
ic structure and divergence in populations of Lutzomyia cruciata, a phlebotomine sand
fly (Diptera: Psychodidae) vector of Leishmania mexicana in southeastern Mexico. In
fection, Genetics and Evolution 2013; 16 254-262.
[46] Yamamoto K, Cceres AG, Gomez EA, Mimori T, Iwata H, Korenaga M, Sakurai T,
Katakura K, Hashiguchi Y, Kato H. Genetic diversity of the mitochondrial cyto
chrome b gene in Lutzomyia spp., with special reference to Lutzomyia peruensis, a main
vector of Leishmania (Viannia) peruviana in the Peruvian Andes. Acta Tropica 2013;
126 156-163.
[47] Valderrama A, Tavares MG, Andrade-Filho JD. Phylogeography of the Lutzomyia go
mezi (Diptera: Phlebotominae) on the Panama Isthmus. Parasites & Vectors 7: 9.
[48] Scarpassa VM, Alencar RB. Lutzomyia umbratilis, the main vector of Leishmaniaguya
nensis, represents a novel species complex? PLoS ONE 2012; 7(5) e37341.
[49] Scarpassa VM, Figueiredo AS, Alencar RB. Genetic diversity and population struc
ture in the Leishmania guyanensis vector Lutzomyia anduzei (Diptera, Psychodidae)
from the Brazilian Amazon. Infection, Genetics and Evolution 2015; 31 312-320.
[50] Ready PD, De Souza AA, Rebelo JC, Day J, Silveira FT, Campbell-Lendrum D, Da
vies CR, Costa JML. Phylogenetic species and domesticity of Lutzomyia whitmani at
the southeast boundary of Amazonian Brazil. Transaction of the Royal Society Tropi
cal Medicine and Hygiene 1998; 92 159160.
[51] Mukhopadhyay J, Ghosh K, Ferro C, Munstermann LE. Distribution of phleboto
mines and by genotypes (Lutzomyia shannoni, Diptera: Psychodidae) across a highly
heterogeneous landscape. Journal of Medical Entomology 2001; 38 260267.
[52] Uribe-Soto SI, Lehmann T, Rowton ED, Vlez IDB, Porter CH. Speciation and popu
lation structure in the morphospecies Lutzomyia longipalpis (Lutz &Neiva) as derived
http://dx.doi.org/10.5772/60921
from the mitochondrial ND4 gene. Molecular Phylogenetics and Evolution 2001;
18(1) 84-93.
[53] Azevedo ACR, Lainson R, Souza AA, F NF, Feliciangeli DM, Meneses CRV, Rangel
EF. Comparative studies of populaitons of Lutzomyia umbratilis (Diptera: Psychodi
dae) in Brazil and Venezuela. Journal of Medical Entomology 2002; 39 587-600.
[54] Forattini, OP. Notas sobre Phlebotomus do Territrio do Amap, Brasil (Diptera, Psy
chodidae). Studia Entomologica1960; 11(1-2) 467-480.
[55] Balbino VQ, Marcondes CB, Alexander B, Luna LKS, Lucena MMM, Mendes AC,
Andrade PP. First report of Lutzomyia (Nyssomyia) umbratilis Ward & Frahia, 1977
outside of Amazonian region, in Recife, State of Pernambuco, Brazil (Diptera: Psy
chodidae: Phlebotominae). Memrias do Instituto Oswaldo Cruz 2001; 96 315-317.
[56] Dye C, Davies CR, Lainson R. Communication among phlebotomine sandflies: a field
study of domesticated Lutzomyia longipalpis populations in Amazonian Brazil. Ani
mal Behaviour 1991; 42 183192.
[57] Morrison AC, Ferro C, Morales A, Tesh RB, Wilson ML. Dispersal of the sandfly Lut
zomyia longipalpis (Diptera: Psychodidae) at an endemic focus of visceral leishmania
sis in Colombia. Journal of Medical Entomology 1993; 30 427435.
[58] Lainson R, Ward RD, Shaw JJ. Cutaneous Leishmaniasis in north Brazil: Lutzomyia
anduzei as a major vector. Transaction Royal Society Tropical Medicine and Hygiene
1976; 70(2) 171-172.
[59] Lainson R, Ready PD, Shaw JJ. Leishmania in phlebotomid sandflies. VII. On the taxo
nomic status of Leishmania peruviana, causative agent of Peruvian uta, as indicated
by its development in the sandfly, Lutzomyia longipalpis. Proceedings of the Royal So
ciety London Biological Science 1979; 206(1164) 307-318.
[60] Lainson R, Shaw JJ, Pvoa MM. The importance of edentates (sloths and anteaters) as
primary reservoirs of Leishmania braziliensis guyanensis, causative agent of pian-bois
in North Brazil. Transaction of the Royal Society Tropical Medicine and Hygiene
1981; 75(4) 611-612.
zon of Brazil. Acta Amaznica 1977; 7 507-527.
[62] Nery LCR, Lorosa ES, Franco AMR. Feeding preference of the sand flies Lutzomyia
umbratilis and L. spathotrichia (Diptera: Psychodidae: Phlebotominae) in an urban for
est patch in the city of Manaus, Amazonas, Brazil. Memrias do Instituto Oswaldo
Cruz 2004; 99 571-574.
[63] Pinheiro FG, Luz SLB, Franco AMR. Infeco natural por tripanosomatdeos (Kineto
plastida: Trypanosomatidae) em Lutzomyia umbratilis (Diptera: Psychodidae) em
reas de Leishmaniose Tegumentar Americana no Amazonas, Brasil. Acta Amazni
ca 2008; 38 165-172.
103
104
[64] Azevedo ACR, Costa SM, Pinto MCG, Souza JL, Cruz HC, Vidal J, Rangel EF. Studies
on the sandfly fauna (Diptera: Psychodidae: Phlebotominae) from transmission areas
of American Cutaneous Leishmaniasis in state of Acre, Brazil. Memrias do Instituto
Oswaldo Cruz 2008; 103 760-767.
[65] Gil LHS, Arajo MS, Villalobos JM, Camargo LMA, Ozaki LS, Fontes CJF, Ribolla
PEM, Katsuragawa TH, Cruz RM, Silva AA, Silva LHP. Species structure of sand fly
(Diptera: Psychodidae) fauna in the Brazilian western Amazon. Memrias do Institu
to Oswaldo Cruz 2009; 104 955-959.
[66] Justiniano SCB, Chagas AC, Pessoa FAC, Queiroz RG. Comparative biology of two
populations of Lutzomyia umbratilis (Diptera: Psychodidae) of central Amazonia, Bra
zil, under laboratory conditions. Brazilian Journal of Biology 2004; 64 227-235.
[67] Justiniano SCB. Biologia comparada de populaes de Lutzomyia umbratilis (Diptera:
Psychodidae) da Amaznia Central Brasileira. Doctoral Thesis. Instituto Nacional de
Pesquisas da Amaznia 2004; 151pp.
[68] Valenta DT, Anez N, Tang Y, Killick-Kendrick R. The genital atrium as a good taxo
nomic character to distinguish between species of phlebotomine sandflies (Diptera:
Psychodidae) from Venezuela. Annual of Tropical Medicine and Parasitology 1999;
93 389399.
[69] Ward RD, Fraiha H. Lutzomyia umbratilis, a new species of sandfly from Brazil (Dip
tera: Psychodidae). Journal of Medical Entomology 1977; 14 313317.
[70] Scarpassa VM, Alencar RB. Molecular taxonomy of the two Leishmania vectors Lutzo
myia umbratilis and Lutzomyia anduzei (Diptera: Psychodidae) from the Brazilian Am
azon. Parasites & Vectors 2013; 6 258. http://www.parasitesandvectors.com/content/
6/1/258
zon of Brazil. Acta Amaznica 1977; 7 507-527.
[72] Silva MNT, Castelln EB. Sandflies (Diptera: Psychodidae) naturally infected by Try
panosoma (Kinetoplastida: Trypanosomatidae) in urban forest fragments in Manaus
city, Amazonas, Brazil. Revista Colombiana de Ciencia Animal 2012; 4(1) 121-129.
[73] Ready PD, Lainson R, Shaw JJ, Ward R. The ecology of Lutzomyia umbratilis Ward &
Fraiha (Diptera: Psychodidae) the major vector to man of Leishmania braziliensis guya
nensis in north-eastern Amazonian Brazil. Bulletin of Entomology Resources 1986; 76
21-40.
[74] Clement M, Posada D, Crandall KA. TCS: a computer program to estimate gene ge
nealogies. Molecular Ecology 2000; 9 1657-1660.
[75] Figueiredo J, Hoorn C, Van der Ven P, Soares E. Late Miocene onset of the Amazon
River and the Amazon deep-sea fan: Evidence from the Foz do Amazonas Basin. Ge
ology 2009; 37 619622.
http://dx.doi.org/10.5772/60921
[76] Alencar RB. Emergncia de flebotomneos (Diptera: Psychodidae) em cho de flores

ta de terra firme na Amaznia Central do Brasil: Uso de um modelo modificado de
armadilha de emergncia. Acta Amaznica 2008; 37(2) 287-292.
[77] Alencar RB, Queiroz RG, Barrett TV. Breeding sites of phlebotomine sand flies (Dip
tera: Psychodidae) and efficiency of extraction techniques for immature stages in ter
ra-firme forest in Amazonas State, Brazil. Acta Tropica 2011; 118(3) 204-208.
105
Chapter 6
Dirofilariosis and Leishmaniasis in the Northern Region

of Serbia
Sara Savic, Branka Vidic, Zivoslav Grgic, Tamas Petrovic,
Alekasandar Potkonjak, Aleksandra Cupina, Slavica Vaselek and
Dusan Petric
http://dx.doi.org/10.5772/61761
Abstract
Research in the field of vector borne diseases and zoonozes became a topic of interest
in Serbia, during the last decade. Climate changes in the country (and the region) are
evident. Also, significantly is higher frequency of human and animal movement and
travel, especially of dogs, within the European countries, but with overseas countries
as well. The presence of vectors has already been confirmed in the country and all the
surrounding countries. Current research in the domain of infectious diseases in dogs
mostly includes diseases which drastically endanger health and population of dogs.
Some of those infectious diseases, like dirofilariosis and leishmaniasis, which are
found more or less often in dogs, cause clinical symptoms which are not obvious and
therefore they represent a danger for public health with dogs acting as reservoirs of
the infection.
Vectors necessary for the transmission of dirofilariosis are mosquitoes and for
leishmaniasis are sand flies. Vectors of dirofilariosis are mosquitoes. Female mosqui
toes which feed on mammals can transfer microfilaria from one infected organism to
another non infected one. Dirofilaria immitis is a nematode, intravascular parasite that
lives in bloodstream of host, usually pulmonary vessels. Prepatent period is at least
6-7 months in definitive hosts. Maturation of organisms in mosquitoes is temperature
dependant and over 14oC is needed. Diagnostic methods for dirofilariosis are many,
but several serological methods can be used: ELISA modified Knott test, immunoem
zyme fast test and then molecular method (PCR), etc.
Leishmaniasis is a vector borne zoonotic disease caused by a pathogen of Leishmania
species. For the transmission of the disease, sand flies are needed as vectors from
108
Lutzomyia spp. Female sand flies are bloodsucking organisms which can transfer the
pathogen from one host to another during their feeding time. The presence of
Phlebotominae (commonly known as sand flies) has been identified in Serbia. The
most certain method for diagnostic is demonstration of the parasite from bone
marrow, splenic or lymph node aspirates, but there are other less invasive methods,
like IFAT (immunofluorescent test) and ELISA (enzyme-linked immunosorbent
assay).
Material for the research were samples from dogs and samples of vectors. In total, 292
samples of mosquitoes were collected and identified and 170 of blood samples from
dogs were examined for dirofilariosis and leishmaniasis. Methods used in the study
were modified Knott test and PCR for dirofilariosis and ELISA test for leismaniasis.
For dirofialriosis a total prevalence of the disease in dogs was found to be 15,29%,
(with different values from 3-22%) for different groups of dogs (hunting and military
dogs, dogs from asylum and pet dogs). Total seroprevalence for all 170 blood samples
was 10,59% for leishmaniasis. Overall, there is acually no difference in seroprevalnce
for leishmaniosis, between different groups of dogs (hunting and military dogs, dogs
from asylum and pet dogs). There is a reasonable doubt that leismaniasis appears as
a disease in the Northern part of Serbia, in region of Vojvodina. The presence of vectors
has been identified (Phlebotomus papatasi, Laroussius tobbi) as well as existing seropre
valence in dogs with and without clinical symptoms. All of this suggests that there is
an existence of the reservoirs of infection.
Keywords: dirofilariosis, leishmaniasis, diagnostics, dogs
1. Introduction
Research in the field of vector-borne diseases and zoonozes became a topic of interest in Serbia
during the last decade. Climate changes in the country (and the region) are evident, compared
to the weather conditions from 10 or more years ago in terms of higher temperatures during
the summer, higher humidity in summer, shorter spring and autumn periods, and shorter
period of low temperature during winter. The influence of climate change has already been
highlighted [1]. Also, the frequency of human and animal movement and travel, especially of
dogs, is significantly higher not only in European countries but also in overseas countries. The
importation of dogs is done on a pretty flexible basis with health status analysis only for rabies.
The presence of vectors has already been confirmed in the country and all the surrounding
countries. Current research in the domain of infectious diseases in dogs mostly includes
diseases that drastically endanger health and population of dogs. Some of those infectious
diseases, like dirofilariosis and leishmaniasis, which are found more or less often in dogs, cause
clinical symptoms that are not so characteristic and expressed. These diseases are zoonozes,
and therefore they represent a danger for public health with dogs acting as reservoirs of the
Dirofilariosis and Leishmaniasis in the Northern Region of Serbia

http://dx.doi.org/10.5772/61761
infection. For a transmission of vector-borne diseases among dogs and from dogs to humans,
vectors are essential because a part of the pathogens life cycle takes place in vectors.
Dirofilariosis and leishmaniasis were earlier recognized as Mediterranean vector-borne
diseases. They both have a zoonotic potential. Vectors necessary for the transmission of
dirofilariosis are mosquitoes and for leishmaniasis are sand flies. Today there is evidence of
dirofilariosis in different countries around the world and also evidence of presence of vectors
for dirofilariosis and leishmaniasis in countries other than Mediterranean [25].
Dirofilariosis is a vector-borne zoonosis mostly caused by Dirofilaria immitis and Dirofilaria
repens. Even though dirofilariosis was primary known as a disease found in Mediterranean
countries only, it has spread out to the North and West of Europe through the years, so now
clinical cases of dirofilariosis can be found in middle Europe, including Serbia [612].
The first published research on dirofilariosis in Serbia (ex, like previously known as Yugosla
via) was done during the 1990s, when the first cases were discovered in humans and dogs [13
16]. Since that time, there is a follow-up on dirofilariosis in several regions of Serbia. Diagnos
tics of dirofilariosis in Serbia has started approximately 10 years ago. Since 2004 until nowa
days, veterinary services have started a regular, routine check up in dogs for dirofilariosis.
Cases of dirofilariosis (Dirofilaria immitis and Dirofilaria repens) in Serbia have been found so
far both in humans and dogs. Several cases of dirofilariosis in humans have been represented,
and few studies have been done [1722].
The first cases of dirofilariosis in Serbia, in dogs, were discovered as a side finding during
dissections [43]. The actual first case of canine dirofilariosis in Serbia was considered to be in
a dog imported from USA. A number of studies were done on the outbreaks of dirofilariosis
in dogs and seroprevalence in different regions [2327]. In the northern part of Serbia,
Vojvodina province, several studies have been done during the previous period on seropre
valence and diagnostic methods [2832]. Some research was also done on seroprevalence to
dirofilariosis in working and military dogs and in pet dogs [33] (Figure 1).
Figure 1. Dirofilaria immitis found in heart at dissection of a dog.
109
110
Vectors of dirofilariosis are mosquitoes. Female mosquitoes that feed on mammals can
transfer microfilaria from one infected organism to another noninfected one. Female
mosquitoes are vectors that can be found in high numbers in Serbia during the warm period
of the year, from May to October. Over 70 mosquito species can be vectors of dirofilario
sis out of 3000 mosquito species worldwide. Three of those species can be found in Serbia
Aedes, Anopheles, and Culex [34].
Dirofilariosis can appear with different severity, from asymptomatic to mild, or it can also
progress to fatal. Definitive hosts of the parasite can be domestic dogs and wild candies, such
as wolfs, coyotes, and foxes. Reservoirs of dirofilariosis in wildlife are raccoons, wolverines,
coyotes, dears, and bears. Dirofilariosis has a zoonotic potential. Humans are not definitive
hosts for Dirofilaria, but occasionally the disease can occur, most usually under the skin or in
the eye.
Dirofilaria immitis is a nematode, intravascular parasite that lives in bloodstream of host,
usually pulmonary vessels. Prepatent period is at least 67 months in definitive hosts. The
maturation of organisms in mosquitoes is temperature dependant, and over 14C is needed.
When mosquitoes feed on the blood of an infected dog, they ingest first-stage (L1) larvae
(microfilariae), which are produced over many years by the mature heartworm in the dog.
Within the mosquito, larvae mature from stage 1 to stage 3. Most of their development takes
place in the malphigian tubes of the mosquito. Once developed to the infective (L3) larval
stage, they migrate through the body to the head cavities of the mosquito, where they wait to
infect another host by leaving the mosquito during the blood meal. The prepatent period
between initial infection of the dog and the maturation of the worms into adults living in the
heart takes 6 to 7 months in dogs. The (L3) larvae of heartworms deposited by the mosquito
into dogs skin grow for a week or two and then molt to the next larval stage (L4) under the
skin at the site of the mosquito bite. Then they migrate to the muscles of the chest and abdomen,
and 45 to 60 days after infection, they molt to the next larval stage (L5). Between 75 and 120
days after infection, these immature heartworms then enter the bloodstream and are carried
through the heart to reside in the pulmonary artery. Over the next 3 to 4 months, they increase
in size. Seven months after infection, the adult worms have mated, which has a consequence
of the appearance of microfilariae in the blood stream of the host. Microfilariae may circulate
in the bloodstream for up to 2 years, waiting for a bloodsucking mosquito. The extrinsic
incubation period required to reach the stage when microfilariae become transmittable to
another host can vary from 2 to 6 weeks, depending on the temperature. It is possible that there
are no evident clinical symptoms in a host for even a year after infection. In humans, Dirofilaria
immitis never reaches the adult stage, and they can never be found in the heart of humans
because humans are accidental hosts [34] (Figure 2).
Dirofilariosis in dogs is most frequently located in the right side of the heart, pulmonal arteries,
and rarely in the lungs. Clinical symptoms in dogs are unspecific: lethargy, weakness, fatigue,
exercise intolerance, dyspnea, cough, anorexia, weight loss, vomiting, diarrhea, collapse,
seizures, and sudden death.

http://dx.doi.org/10.5772/61761
Figure 2. Dirofilaria immitis taken out from the heart of a dog.
Diagnostic methods for dirofilariosis are many, but several serological methods can be used:
ELISA modified Knott test, immunoenzyme fast test, and then molecular method (PCR).
Antibodies formed against the antigens of Dirofilaria sp. can be detected by ELISA method.
ELISA is a very sensitive and specific test, easy to perform, but it has to be done in a laboratory.
There can be a false-positive reaction if there is a cross reaction with another antigen. Also,
there can be a false-negative finding, if the analysis is performed too early after the infection
and the dog still does not have a level of antibodies high enough (Figure 3).
Figure 3. ELISA method for diagnosticspositive and negative control and positive and negative samples.
111
112
Antibodies formed against Dirofilria sp. can also be detected by an immunoenzyme test,
usually called fast or snap tests. It is a user-friendly one- or two-step test that can be
performed anywhere. No laboratory conditions are needed for the performance of the test, so
it can be done at veterinary practice or even in the field. The results of the tests are ready to be
read within 1015 minutes, and the sensitivity and specificity of fast tests is good compared
to the other available tests (Figure 4).
Figure 4. Immunoenzyme fast testpositive (two dots) and negative (one dot) findings.
The most popular and most used diagnostic test for dirofilariosis among veterinarians is the
modified Knott test. With this test, circulating microfilaria from the blood stream can be found,
colored, and seen with a microscope. The procedure is not complex but requires some
laboratory equipment; time and skills are also needed, with a good knowledge of microfilarial
morphology. This method is highly specific and sensitive in dogs, and microfilariae belonging
to different species can be determined [35].
PCR is a molecular method with which DNA of Dirofilaria immitis is detected. This is a sensitive
and accurate method to discriminate microfilariae from other different filarial worms in dogs.
It is a good conformation test and a research tool. If dirofilariosis is detected by snap tests,
ELISA, or modified Knott test, the presence of the DNA of pathogen can be confirmed by PCR
method [36].
Leishmaniasis is a vector-borne zoonotic disease caused by a pathogen of Leishmania species.
For the transmission of the disease, sand flies are needed as vectors from Lutzomyia spp. Female
sand flies are bloodsucking organisms that can transfer the pathogen from one host to another
during their feeding time. In the overview of human leishmaniasis from 2009, in Europe there
are cases described in Greece, Cyprus, France, Italy, Malta, Portugal, Spain, FYROM, and
Albania [5]. Later on, there are data published on cases of leishmaniasis in humans in Bulgaria
[37], in dogs in Romania [38], and in dogs in Hungary [39].
In Serbia, leishmaniasis is considered, so far, an imported disease, and there is no official data
that the disease exists as an autochthonous infection in humans or in animals. There are cases
of humans with leishmaniasis in Serbia, but all of them were imported from Montenegro,
FYOM (Former Yugoslavia Republic of Macedonia), or Greece during holiday season [40].

http://dx.doi.org/10.5772/61761
There were some notifications about leishmaniasis in dogs during the last several years. Three
separate cases of dogs were found with clinical symptoms that could indicate leishmaniasis,
and they were found seropositive to leishmaniasis. After therapy, their condition has improved
[41, 42].
The presence of Phlebotominae (commonly known as sand flies) has been identified in the
southern part of Serbia a long time ago, and these vectors are known in Mediterranean
countries as vectors of leishmaniasis. During the late 1950s and early 1960s, studies were done
on the presence of Phlebotominae in the southern part of Serbia, but after that period, nothing
else was published [43]. During a previous period, several dogs were found in the region, as
clinical cases suspicious to leishmaniasis (epistaxis, cachexia, pale mucosa, skin problems,
blindness, and lethargy), with seropositive findings for this disease [42].
Figure 5. Bitch with skin lesions, positive serological finding for leishmaniasis.
Figure 6. Dog with skin lesions, positive serological finding for leishmaniasis.
113
114
The first clinical cases of leishmaniasis in humans and dogs in Serbia were infections coming
from abroad (Montenegro, Greece, Former Yugoslavia Republic of Macedonia, and Croatia),
mostly after summer holidays. Within the last 3 years, positive findings were identified in dogs
that have never left their homes in Serbia (Figures 5 and 6) [41, 42].
Domestic and wild canines are the main host species for leishmaniasis, but the domestic dog
is the only epidemiologically important reservoir. Causative organisms are protozoa Leishma
nia donovani (in Asia, Middle East, and Africa) and Leishmania infantum (in Asia, Middle East,
Europe, and South America). The transmission of the disease occurs via sand fly bites, and
dogs are the reservoir hosts. Humans are accidental hosts. Transmission of the disease between
dogs and humans directly is not possible.
Clinical symptoms of leishmaniasis in dogs are nonspecific. They can be as fever, weakness,
lethargy, weight loss, muscle wasting, lymphadenopathy, pallor, anemia, thrombocytopenia,
conjunctivitis and eye problems, skin lesions and alopecia, etc.
Diagnostic procedures for leishmaniasis are several. The most certain method is the demon
stration of the parasite from bone marrow, splenic, or lymph node aspirates, but there are other
less invasive methods too. Serologic tests are most commonly immunofluorescent test (IFAT)
and enzyme-linked immunosorbent assay (ELISA) [44].
2. Materials and methods

Materials for the research were samples from dogs and samples of vectors. The research was
planed as serological examination of dog blood samples for dirofilariosis and leishmaniasis.
The vectors (mosquitoes) were collected, identified, and analyzed for the presence of causative
agents of dirofilariosis in the northern part of Serbia.
During spring and summer of 2014 (MaySeptember), 292 samples of mosquitoes were
collected and identified. Collecting was done with lamps with dry ice. The identification of
mosquitoes (for gender and species) was done at Faculty of Agriculture, University of Novi
Sad. Vector identification was done with microscopic observation. The analysis of vectors for
the presence of causative agent for dirofilariosis was done by a molecular method (PCR). PCR
analysis were performed at the Scientific Veterinary Institute of Novi Sad. The samples were
pooled as 20 mosquitoes into one pool. In collected mosquitoes, a molecular method of PCR
was performed. DNA extraction was done with commercial kits from Quiagen (QIAmp),
during a 2-day protocol. PCR was done according to the prescription of Rishniw et al. [36].
Primers used for PCR analysis were primers 53, forward: DIDR-F1_for AGTGCGAATTG
CAGACGCATTGAG and reverse: DIDR-R1_rev AGCGGGTAATCACGACTGAGTTGA.
Determination was done based on 542 bp for D. immitis.
In total, 170 of blood samples from dogs were examined for dirofilariosis and leishmaniasis.
Serological analysis for dirofilariosis and leishmaniasis were done from blood samples of dogs
obtained by venous punctation. The blood samples were divided into three groups, according
to the way of life of the dogs:
Group of hunting and military dogs (79 samples)in this group, samples were analyzed
from dogs that are actively used for hunting. They had their owners, and they mostly did

http://dx.doi.org/10.5772/61761
not receive any preventive treatment against parasites. Not one of these dogs has ever left
Serbia.
Group of dogs from asylum for homeless dogs (64 samples)in this group were dogs kept
in the asylum, but for a long time, and they have all received preventive treatment against
parasites annually. Not one of these dogs has ever left Serbia since they were in asylum, but
for many of them, the history of their previous life and origin is unknown.
Group of pet dogs (27 samples)in this group were dogs that came to veterinary practice
for numerous reasons, with nonspecific clinical symptoms, or no clinical symptoms at all.
Not one of the owners thought that their dog has dirofilariosis or leishmaniasis. Some of the
dogs have received antiparasitic prevention and some did not. Even the ones which did
receive preventive treatment did not receive it annually, only during spring and summer.
Not one of these dogs has ever left Serbia.
Methods used in the study were the following: modified Knott test and PCR for dirofilariosis
and ELISA test for leishmaniasis.
Analysis for dirofilariosis was done with the modified Knott test for the detection of microfi
laria in circulation. Analysis for all the samples was done on the same day of sampling or the
next day. Samples were taken with anticoagulant. The procedure of the modified Knott test
was performed according to the instructions of Genchi et al. [35]. The modified Knott test was
done in all the samplesfrom dogs with clinical symptoms as well as from dogs without any
clinical symptoms for dirofilariosis. Positive samples found by the modified Knott test were
then selected for molecular analysis to be done by PCR. DNA extraction was done with QIAmp
commercial kits for DNA extraction (Quiagen, by the instructions of the producer). After that,
a PCR was performed according to the protocol from Rishniw et al. [36]. The same primers
were used in the protocol of Dirofilaria DNA detection in blood samples as in mosquito samples
(primers 53):
Forward: DIDR-F1_for AGTGCGAATTGCAGACGCATTGAG and
Reverse: DIDR-R1_rev AGCGGGTAATCACGACTGAGTTGA.
Determination was done based on 542 bp for Dirofilaria immitis.
For diagnostics of leishmaniasis, same blood samples were used taken from the same dogs.
Analysis for leishmaniasis was done by ELISA method (commercial kit by Ingenaza, done by
the prescription of the producer). From blood samples, sera samples were obtained by
centrifugation. After that, blood sera samples were kept on 20C until ELISA was performed.
3. Results and discussion

3.1. Dirofilariosis
Analysis of vectors for dirofilariosis: In total, 292 samples of mosquitoes were collected. After
determination, it was found that they belong to Culex (Culex pipiens and Culex culex) and Aedes
species. The samples were collected as random samples from different locations of the northern
115
116
part of Serbia. In 292 mosquitoes randomly collected, the presence of DNA of causative agent
for dirofilariosis (Dirofilaria immitis) was not found. Mosquitoes were collected randomly, and
weather conditions during the collection of samples were not favorable. Weather conditions
were bad for the lamps and the collection process because there was a lot of wind and often
rain during the time of collection. Also, the outside temperature was lower than usual for that
the time of the year. The results found after the analysis of mosquito samples indicate that
sampling was perhaps not done in the best way. The samples should have been collected at
the residence of positive dogs and not from several randomly chosen locations. Also, the
weather conditions may have influenced the development of L3 larval stage of microfilariae
in the mosquito because the temperature for many days was not too much above 14C. All of
these may have influenced the absence of Dirofilaria sp. DNA in mosquito samples.
The results of analysis of blood samples from three groups of dogs (170 samples in total) to
dirofilariosis by the modified Knott test are shown in Table 1.
Group of dogs
Hunting and military dogs
Total number of examined

dogs
Number of positive dogs
Percentage of positive
dogs
79
18
22.78
64
3.12
Pet dogs
27
22
Total
170
26
15.29
Dogs from asylum for

homeless dogs
Table 1. Results of the analysis of blood samples from three groups of dogs to dirofilariosis
In the group of hunting and military dogs, a seroprevalence for dirofilariosis was found to be
22.78%. In the group of dogs from asylum, a lower seroprevalence for dirofilariosis was found
3.12% and in the group of pet dogs, and seroprevalence for dirofilariosis was found to be
22%. In the case of dirofilariosis, the seroprevalence of the disease in different groups was
different. It depended on the received prevention treatment against parasites and the lifestyle
of dogs. Seroprevalence was the lowest (3.12%) in dogs living in asylum with regular preven
tion care. These dogs received preventive treatment monthly during the whole period when
mosquitoes can be found (March/AprilOctober). It is important to highlight that even two
positive dogs found in asylum were new dogs that came from another place, less than 1 month
previously to the sampling. The highest seroprevalence (22.78%) was found in hunting dogs
with no prevention treatment in most of the cases. Seroprevalence found in pet dogs was not
much different than the one found in hunting dogs. This would refer to the fact that not many
pet dogs are under preventive treatment, or even if they are, it is not being repeated enough
times. Most of the pet owners are not aware enough of the existence of dirofilariosis as a disease
in dogs, and so they believe that it is enough if they give the preventive treatment to their pet
dogs once or rarely twice during the whole period of the year when mosquitoes are present
(March/AprilSeptember). Also, the fact that there are no clinical symptoms in dogs usually
for a long time after infection makes the owners believe that their dog is healthy.

http://dx.doi.org/10.5772/61761
During a 2-year period, 170 dog blood samples were analyzed. Most of the dogs did not have
any clinical symptoms. Only several dogs had clinical symptoms such as cough, lethargy,
tiredness, and heart failure symptoms. The modified Knott test gives us a direct overview into
the existence of larvae of Dirofilaria (microfilaria) in dogs circulation. A total average sero
prevalence for the whole three groups of dogs was found to be 15.29%, but the highest
seroprevalence was found to be in hunting and military dogs, followed very closely by pet
dogs. Hunting and military dogs live in most cases outside in backyards and are in constant
contact with vectors. They have a long time of outside activities in the regions where vectors
can be found. Also, quite a lot of dogs from this group is not protected constantly with
preventive ectoantiparasitic treatment.
The modified Knott test is a fast and reliable diagnostic tool recognized in the world as a
method for the detection of microfilaria in circulation of dogs. In veterinary practices, fast tests
can be used for routine checkup of patients. However, in the case of positive finding or if there
are recognizable clinical symptoms in a dog, a confirmation of diagnosis has to be done with
the modified Knott test. With this test, an identification of Dirofilaria can be done with
distinction between Dirofilaria immitis and Dirofilaria repens [35] (Figure 7).
Figure 7. Diagnostics of dirofilariosis by the modified Knott test.
After positive samples were found by the modified Knott test, a PCR analysis was done for
the conformation of Dirofilaria immitis. PCR analysis was done from blood samples of dogs in
which microfilariae were found (26 samples). The isolation of Dirofilarias DNA from 200 l of
blood samples was done with QIAmp set kit (Quiagen). PCR procedure was done as described
by Rishniw et al. [36]. PCR is a very sensitive, specific, and accurate method with which
determination of Dirofilaria species is possible. It is more a research tool than a diagnostic tool
because it is a demanding procedure in equipment and skills. From 26 blood samples from
dogs in which Dirofilaria was found by the modified Knott test, a positive result was found by
the PCR method in 24 samples (92.3%) (Figure 8).
117
118
Figure 8. PCR reaction for Dirofilaria immitis in blood samples of dogs positive to dirofilariosis by the modified Knott
test, determination based on 542 bp.
These data can be compared to the data collected during the last several years in the same
region by the same authors, shown in Table 2. The first official acknowledgment of dirofilar
iosis in Serbia was published by Dimitrijevic in 1999 [43]. After that time, several authors have
been following the development of this disease in dogs in different regions of Serbia. For the
northern part of Serbia, data have been collected for more than 10 years now.
Year
Percentage of positive dog samples
20032004
5.97
20062007, dogs with no clinical symptoms
1011
20062007, dogs with clinical symptoms
80
2010
14
2010, only pet dogs
11
20112013
5 human cases
20132014 hunting and military dogs, dogs from asylum

and pet dogs
15.29
Table 2. An overview of data collection during a 10-year period on the seroprevalence of dirofilariosis in dogs in
northern Serbia
By comparing the data during the last decade, it can be stated that there is a constant increase
of seroprevalence for dirofilariosis in dogs in Serbia over the years. After these findings were
published, diagnostic methods for dirofilariosis were introduced into the routine checkup of
dogs in veterinary practicesmodified Knott test, fast test, and ELISA test. Also, fast tests
became available to the practitioners and became the mostly used diagnostic tool in veterinary
practices. Preventive treatment is present and offered to the owners, but the awareness of the
owners is not quite high enough. Further research on the presence of causative pathogen
(Dirofilaria immitis) must be done in vectors so that a risk estimation can be made. Definitely,

http://dx.doi.org/10.5772/61761
dirofilariosis is present in the northern part of Serbia in the percentage that justifies the fact
that this disease should always be considered when looking at a patient in veterinary practice.
Also, there are already human cases in the region, so attention should be paid to this disease
in the meaning of One Health point of view.
Clinical cases of canine dirofilariosis in Serbia are still often found after dissections, and still
mostly as a side finding (Figure 9).
Figure 9. Dirofilariosis in one of the military dogs from the survey.
It appears that dirofilariosis is a disease more and more frequent in dogs, so there is more
demand for control of health status for dirofilariosis within a routine checkup in dogs. The
owners are not enough aware that disease can occur without any clinical symptoms for a
certain period of time. During the period of our study, seropositive findings for dirofilariosis
were present all the time in dogs, which makes therapy and prevention necessary in the region.
The awareness of the fact that dirofilariosis is a zoonotic disease is higher over the time, and
this makes the disease a danger for public health. Cases of human dirofilariosis are also present
in the northern part of Serbia but are still neglected within diagnostic procedure. Medical
doctors are still not completely aware of the diagnostics of dirofilariosis in humans, and there
are still no reliable, noninvasive diagnostic methods on the market [21].
Apart from the modified Knott test done from the blood samples of dogs, an identification of
the pathogen has been confirmed by PCR method too. Positive finding were gained by PCR
method, at the matching rate of 92.3% with the modified Knott test.
3.2. Leishmaniasis
During the same period of study, 170 blood samples were examined for leishmaniasis from
dogs that did or did not have clinical symptoms of the disease. After serological testing of the
samples, positive findings for leishmaniasis were gained. Blood samples were analyzed for
119
120
the presence of specific antibodies against Leishmania sp. with the ELISA method (Ingezim
Leishmania, Ingenasa, 1.5.LSH.K.1). From total number of samples, in 10.59% of samples, the
presence of specific antibodies against Leishmania infantum was found. It is important to
highlight that not one of the examined dogs has ever left their dwelling place. In 18 dogs,
positive serological findings for leishmaniasis were obtained. Three of the examined dogs had
skin lesions that would not heal and bad skin condition in general.
The findings after the analysis of blood samples from three groups of dogs (170 samples in
total) for leishmaniasis with ELISA test are shown in Table 3.
Group of dogs
Hunting and military dogs
Dogs from asylum for
homeless dogs
Total number of examined

dogs
Number of positive dogs
Percentage of positive
dogs
79
10.12
64
10.33
Pet dogs
27
11.11
Total
170
18
10.59
Table 3. Results of the analysis of blood samples from three groups of dogs for leishmaniasis
In the group of hunting and military dogs, a seroprevalence for leishmaniasis was found to be
10.12%. In the group of dogs from asylum, seroprevalence was found to be 10.33%, and in the
group of pet dogs, seroprevalence for leishmaniasis was 11.11%. The total seroprevalence for
all 170 blood samples was 10.59% for leishmaniasis. Overall, there is actually no difference in
seroprevalence for leishmaniasis between different groups of dogs. There is a similar seropre
valence in all three groups of dogs, unlike the seroprevalence to dirofilariosis. There is a
constant presence of causative pathogen among the dog population in the northern part of
Serbia. There is a reasonable doubt that leishmaniasis appears as a disease in the northern part
of Serbia, in Vojvodina. The presence of vectors has been identified (Phlebotomus papatasi and
Laroussius tobbi) (Vaselek, unpublished data), as well as the existing seroprevalence in dogs
with and without clinical symptoms. All of this suggests that there is an existence of the
reservoirs of infection. Leishmaniasis in humans has been identified so far only in people who
have traveled to Mediterranean countries and not as an autochthonous infection. Due to
climate changes, summer temperatures and conditions in the northern part of Serbia are more
and more in favor of the life cycle of vectorssand flies.
In our history, there is evidence of leishmaniasis in humans and in dogs in Serbia, but over 60
years ago. The first autochthonous cases of visceral leishmaniasis were found in the southern
part of Serbia (region around city of Nis) back in 1945. During the period of 19461949, there
were 350 registered cases of human visceral leishmaniasis in Serbia, and some cases were even
registered around city of Belgrade [45]. At that same time, about 2% of dogs in the region
around city of Nis were found to have asymptomatic leishmaniasis, and dogs were identified
as main reservoir of infection [45]. During the period from 1968 to 1969, rare cases of autoch
thonous visceral leishmaniasis were reported in the southern part of Serbia. At that time, the

http://dx.doi.org/10.5772/61761
vectors of leishmaniasis were detected: P. major, P. simici, and P. perfiliewi [46]. In the northern
part of Serbia, the disease or vectors have never been identified before. After this period of
studies and interest of public into leishmaniasis, no more data were found, and no research
has been done until now. No vectors have been identified any more, or they were just not
looked for until 50 years later. There is a question on the existence of leishmaniasis in Serbia,
but at the moment, there is evidence of the existence of vectors and clinical disease in dogs,
with serological conformation of the disease and successful therapy. Today, Serbia is sur
rounded with several countries that have leishmaniasis for sure (Croatia, Montenegro, and
FYROM), countries where vectors are identified so far (Hungary), and countries in which there
is also a reasonable doubt that leishmaniasis exists in dogs (Romania). More research has to
be done, especially on vectors and reservoirs of the infection, with a precise identification of
the pathogen.
Acknowledgements
This study was supported by the Ministry of Education, Science and Technological Develop
ment of the Republic of Serbia (grant TR31084).
Author details
Sara Savic1, Branka Vidic1, Zivoslav Grgic1, Tamas Petrovic1, Alekasandar Potkonjak2,
Aleksandra Cupina3, Slavica Vaselek3 and Dusan Petric3
1 Department of Immunology, Serology and Biochemistry, Scientific Veterinary Institute
Novi Sad, Novi Sad, Serbia
2 Department for veterinary medicine, Agricultural Faculty, University of Novi Sad, Serbia
3 Laboratory for Medical and Veterinary Entomology, Agricultural Faculty, University of
Novi Sad, Serbia
References
[1] Ready PD (2008) Leishmaniasis emergence and climate change. In: S de la Roque, ed
itor. Climate change: the impact on the epidemiology and control of animal diseases.
Rev Sci Tech Off Int Epiz. 27(2):399412.
[2] Jacs O, Kiss G, Krassvri D, Kiss HJ, Gyurkovszky M, Fok E. (2014) Epidemiologi
cal view about dirofilarioses in dogs of Hungary. Fourth European Dirofilaria and
Angiostrongylus Days (FEDAD), 24 July, 2014, Budapest, Hungary. Edited by Eva
121
122
Fok, Istvan Kucsera, Final Program and Abstracts, Budapest, European Society of
Dirofilaria and Angiostrongylus.
[3] Miterpkov M, Igldyov A, Antolov D, Hurnkov Z. (2014) Canine dirofilariosis
in Slovakiathe results of 8-year epidemiological research. Fourth European Dirofi
laria and Angiostrongylus Days (FEDAD), 24 July, 2014, Budapest, Hungary. Edited
by Eva Fok, Istvan Kucsera, Final Program and Abstracts, Budapest, European Soci
ety of Dirofilaria and Angiostrongylus.
[4] Farkas R1, Tnczos B, Bongiorno G, Maroli M, Dereure J, Ready PD. (2011) First sur
veys to investigate the presence of canine leishmaniasis and its phlebotomine vectors
in Hungary. Vector Borne Zoonotic Dis. 11(7):82334. doi: 10.1089/vbz.2010.0186. Jan
22.
[5] Ready PD. (2010) Leishmaniasis emergence in Europe. Euro
15(10):pii=19505. Available online: http://www.eurosurveillance.org
Surveill.
[6] Draghici S, Jarca A. (2012) Dirofilariasis-case file. European Multicolloquium of Para

sitology (EMOP XI). Program and Abstract book, Romania, p. 386.
[7] Hamel D, Silaghi C, Mihalkov A, Maurer U, Pfister K. (2012) Vector-borne infections
in imported dogsa serological and molecular survey. European Multicolloquium
of Parasitology (EMOP XI). Program and Abstract book, Romania, p. 300.
[8] Simon F, Gonzles-Miguel J, Morchon R, Mellado I, Del Mar Siles-Luca M. (2012) Pro
teomic analyses of Dirofilaria species. European Multicolloquium of Parasitology
(EMOP XI). Program and Abstract book, Romania, p. 234.
[9] Otasevic S, Tasic A, Gabrielli S, Trenkic Bozinovic M, Cancrini G. (2014) Canine and
human Dirofilaria infections: what is new in the Balkan Peninsula. Fourth European
Dirofilaria and Angiostrongylus Days (FEDAD), 24 July, 2014, Budapest, Hungary.
Edited by Eva Fok, Istvan Kucsera. Final Program and Abstracts, Budapest, Europe
an Society of Dirofilaria and Angiostrongylus.
[10] Diakou A, Kapantaidakis E. (2014) Epidemiology of dirofilariosis in dogs in Greece:
previous and last information. Fourth European Dirofilaria and Angiostrongylus
Days (FEDAD), 24 July, 2014, Budapest, Hungary. Edited by Eva Fok, Istvan Kuc
sera. Final Program and Abstracts, Budapest, European Society of Dirofilaria and
Angiostrongylus.
[11] Margarida Alho A, Gomes L, Pereira da Fonseca I, Meireles J, Madeira de Carvalho
L. (2014) Canine dirofilariosis in Lisbon, Portugal, over a 14-year period: prevalence,
diagnosis, and routine laboratory approaches. Fourth European Dirofilaria and An
giostrongylus Days (FEDAD), 24 July, 2014, Budapest, Hungary. Edited by Eva Fok,
Istvan Kucsera. Final Program and Abstracts, Budapest, European Society of Dirofi
laria and Angiostrongylus.
[12] Fuehrer H-P, Auer H, Silbermayr K, Duscher GG. (2014) Dirofilaria repens and Diro
filaria immitis in Austria. Fourth European Dirofilaria and Angiostrongylus Days

http://dx.doi.org/10.5772/61761
(FEDAD), 24 July, 2014, Budapest, Hungary. Edited by Eva Fok, Istvan Kucsera. Fi
nal Program and Abstracts, Budapest, European Society of Dirofilaria and Angios
trongylus.
[13] Kulii Z, Kranji-Zec I, Mitrovi S, Radojii B. (1989) New case of human dirofilar
iosis in Jugoslavia (serb), 6. Kongres mikrobiologa Jugoslavije Maribor, Proceedings.
[14] Kulii Z, Milosavljevi P. (1994) Modern techniques in diagnostic of dirofilariosis in
dogs (serb). Veterinarski Glasnik. 48, 9: 7459.
[15] Kulii Z, Mii Z, Milosavljevi P, Popovi N. (1995) Dirofilariosis in dogs in Yugo
slavia (serb), 8. Symposium of Veterinarians in Serbia, Zlatibor, Proceedings.
[16] Dimitrijevi S. (1999) Dirofilarioza ante portas, Clinica Veterinaria 1, Proceedings, p.
58.
[17] Laloevi D. (2004) Dirofilaria spp parasite like in mesenterium removed by surgery
from mesenterium (serb). Medicinski Pregled, 56: 3078.
[18] Tasi A, Tasi S, Miladinovi-Tasi N, Zdravkovi D, orevi. (2007) Dirofilaria re
penspotential risk for public health. Acta Medica Medianae; 46(3): 536.
[19] Dami AM, olovi IV, Arsi-Arsenijevi VS, Stepanovi S, Borii I, Dami Z, Mi
trovi SM, Rai DM, Stefanovi I, Latkovi Z, Kranji-Zec IF. (2009) Human Dirofi
laria repens infection in Serbia. J Helminthol; 83: 12937.
[20] Tasi S, Stojiljkovi N, Miladinovi-Tasi N, Tasi A, Mihailovi D, orevi J. (2009)
Human subcutaneous dirofilariosis in South Serbiacase report. u: Dirofilaria days
(II), Salamanca, Spain, P-12.
[21] orevi J, Tasi S, Miladinovi-Tasi N, Tasi A. (2010) Diagnosis and clinical value
of human dirofilariosis (serb). Acta Facultatis Medicae Naissensis; 27(2): 814.
[22] Tasi-Otaevi S, Gabrielli S, Tasi A, Miladinovi Tasi N, Kosti J, Ignjatovi A, Po
povi Dragonji L, Miloevi Z, Cancrini G. (2014). Seroreactivity to Dirofilaria anti
gens in people from different areas of Serbia. BMC Infect. Dis; 14: 68.
[23] Tasi A, Kati-Radivojevi S, Klun I, Mii Z, Ili T, Dimitrijevi S. (2003) Prevalence
of canine filariasis in some parts of Vojvodina. Veterinary Symposium of Serbia (15),
Zlatibor, 0913. 09., Proceedings.
[24] Tasi A, Tasi S, Miladinovi-Tasi N, Zdravkovi D, orevi J. (2007) Prevalence of
Dirofilariae repens as causative agent of zoonozes in dogs. Acta Facultatis Medicae
Naissensis; 24(2): 714.
[25] Tasic A, Rossi L, Tasic SA, Miladinovic-Tasic N, Ilic TD, Dimitrijevic SM. (2008) Sur
vey of canine dirofilariasis in Vojvodina, Serbia.
[26] Spasojevi-Kosi L, Laloevi V, Laloevi D, Nagli A. (2011) Heart worm disease
a case study. Veterinarski Glasnik; 65(34): 25767.
123
124
[27] Spasojevi-Kosi L, Laloevi V, Laloevi D, Simin S, Vasi I, Kuruca L. (2012) Prev

alence of dirofilariosis in pet dogs in Novi Sad. Saremena Poljoprivreda; 61(34):
24754.
[28] Savi-Jeveni S, Vidi B, Grgi , Milovanovi A. (2004) Fast diagnostic of dirofilar
iosis in Novi Sad region (serb). Veterinarski Glasnik; 58(56): 693698. ISSN
0350-2457.
[29] Savi-Jeveni S, Milovanovi A, Grgi , Koji S. (2006) Outspread of dirofilariosis
in Novi Sad region-six years later (serb), Proceedings, VIII epizootiological days,
Banja Vrdnik, p. 60.
[30] Savi-Jeveni S, Vidi B, Grgi , Loli Z. (2007) The appearances of dirofilariosis in
Serbia - Vojvodina. First European Dirofilaria Days, Zagreb, Croatia, Proceedings, p.
202.
[31] Savi S, Grgi Z, Vujkov B, Fenjac I, Pajkovi D, eki M. (2009) Determination of ca
nine dirofilariasis by ELISA method and modified Knotts test. Arhiv Veterinarske
Medicine; 2(2): 71-77. ISSN 1820-9955.
[32] Savi S, Vidi B, Pajkovi D, Spasojevi-Kosi L, Medi S, Potkonjak A, Otaevi S.
(2014) Overview of dirofilariosis in Serbia during the last ten years 20042014 and
current status of the disease. Fourth European Dirofilaria and Angiostrongylus Days
(FEDAD), 24 July, 2014, Budapest, Hungary. Edited by Eva Fok, Istvan Kucsera, Fi
nal Program and Abstracts, str. 46, Budapest, European Society of Dirofilaria and
Angiostrongylus.
[33] Pajkovi D, Savi S, Veljkovi P, Grgi Z. (2010) Study on dirofilariosis in working
dogs servicing the Army of Serbia. Arhiv Veterinarske Medicine; 3(2): 5358.
[34] Newcomb EC, Moorhead A. (2013) Dirofilaria immitis, American Association of Zoo
Veterinarians Infectious Disease Committee Manual, 2013 Infectious Disease Manual
2013, 2nd Edition.
[35] Genchi C, Venco L, Genchi M. (2007) Guideline for the laboratory diagnosis of canine
and feline Dirofilaria infections, Dirofilaria immitis, and D. repens in dog and cat and
human infections. Edited by Genchi C, Rinaldi L, Cringoli Giuseppe. Mappe parasi
tologiche 8, ISBN 88-89132-14-0, pp. 139144.
[36] Rishniw M, Barr SC, Simpsom KW, Frongillo MF, Franz M, Dominguez-Alpizar JL.
(2006) Discrimination between six species of canine microfilariae by single polymer
ase chain reaction. Veterinary Parasitology 135, pp. 303314.
[37] Harizanov R, Rainova I, Tzvetkova N, Kaftandjiev I, Bikov I, Mikov O. (2013) Geo
graphical distribution and epidemiological characteristics of visceral leishmaniasis in
Bulgaria, 1988 to 2012, Eurosurveillance, Volume 18, Issue 29, 18 July 2013, Surveil
lance and outbreak reports.

http://dx.doi.org/10.5772/61761
[38] Mircean V, Dumitrache MO, Mircean M, Bolfa P, Gyrke A, Mihalca AD. (2014) Au
tochthonous canine leishmaniasis in Romania: neglected or (re)emerging? Parasit
Vectors. 7: 135. http://www.parasitesandvectors.com/content/7/1/135
[39] Tnczos B1, Balogh N, Kirly L, Biksi I, Szeredi L, Gyurkovsky M, Scalone A, Fioren
tino E, Gramiccia M, Farkas R. (2012 July) First record of autochthonous canine leish
maniasis in Hungary. Vector Borne Zoonotic Dis. 12(7): 58894. doi: 10.1089/vbz.
2011.0906. Epub 2012 May 18.
[40] Dakic ZD1, Pelemis MR, Stevanovic GD, Poluga JL, Lavadinovic LS, Milosevic IS, In
djic NK, Ofori-Belic IV, Pavlovic MD. (2009) Epidemiology and diagnostics of viscer
al leishmaniasis in Serbia. Clin Microbiol Infect. 15(12):11736.
[41] Savi-Jeveni S, Grgi , Vidi B, Vujkov B. (2007) Leishmaniasis in dogclinical
case, IX regional meeting in clinical pathology and therapy in animals Palic, Proceed
ings, p. 2, Belgrade, Faculty of Veterinary Medicine.
[42] Savi S, Vidi B, Fenjac I, Bekvalac R, Radievi M, Loli Z. (2010) Leishmaniasis in
dogs in Serbiaexistence or not? Symposium of Small Animal Practitioners SIVE
MAP 2010, Belgrade, Proceedings, pp. 241243.
[43] Dimitrijevi S, Dirofilarioza ante portas. Meeting on Clinical Pathology and Therapy
of Animals, Proceedings, Budva, 1999, pp. 5861.
[44] Fiorello C. (2013) Visceral leishmaniasis. American Association of Zoo Veterinarians
Infectious Disease Committee Manual, 2013 Infectious Disease Manual 2013, 2nd Ed
ition.
[45] Simi C. (1957) Protozoe paraziti oveka i domaih ivotinja. Nauna knjiga, Beo
grad.
[46] Petrovi Z. (1980) Epidemiology of kala-azar in Serbia. Belgrade: Institute for Medi
cal Research (Serbian).
125
Chapter 7
Schistosomiasis Updating Technologies and Diagnostic

Approaches in Surveillance Strategies and Clinical
Management
Marta Guimares Cavalcanti and Jos Mauro Peralta
http://dx.doi.org/10.5772/61310
Abstract
Schistosoma infection is a poverty-related parasitic infection, being the second most
important neglected tropical disease in the world after malaria. Schistosomiasis is
caused by five distinct Schistosoma species distributed in tropical and subtropical
areas. But, imported cases can also be seen in non - endemic areas. Human popula
tions acquire infection after exposure to contaminated water collections. Schistosoma
infection falls on a large spectrum of clinical manifestations that ranges from absence
of signs and symptoms to severe forms of disease. Although morbidity and mortality
have been reduced along the years after use of mass drug administration (MDA) in
endemic areas, large populations are still at risk of disability-related outcomes on dai
ly basis. Recently, a great deal of debate has been done over two main issues in schis
tosomiasis management in endemic and non-endemic areas: how to accurately
diagnosis Schistosoma infections pre and post-therapy in addition to assess morbidity
level. Adoption of promising new diagnostic tools and development of new markers
of disease progression might change the current scenario by improving schistosomia
sis clinical management in both community and institutional settings.
Keywords: schistosomiasis, diagnostic tests, markers of therapy response, morbidity,
community settings, institutional settings
1. Introduction
Schistosoma infection is a poverty-related parasitic infection, being the second most important
neglected tropical disease in the world after malaria. Schistosomiasis is a blood-fluke-induced
infection, which may present with acute and chronic disease forms. Schistosomiasis is caused
by five distinct Schistosoma species distributed in tropical and subtropical areas. However,
128
imported cases can also been seen in nonendemic areas. Human populations acquire infection
after exposure to contaminated fresh water sources like dams, rivers, canals, lakes, and
streams. Schistosoma infection falls on a large spectrum of clinical manifestations that ranges
from absence of signs and symptoms to severe forms of disease. Although morbidity and
mortality have been reduced along the years after use of mass drug administration (MDA) in
endemic areas, large populations are still at risk of disability-related outcomes on a daily basis.
A broad spectrum of clinical manifestations and also asymptomatic infections are observed [1,
2]. Three major species, Schistosoma haematobium, Schistosoma japonicum, and Schistosoma
mansoni, and another two minor species, Schistosoma mekongi and Schistosoma intercalatum, are
recognized as the mainly pathogenic Schistosoma species that infect human populations [3, 4].
Parasite transmission occurs after contamination of water collections with Schistosoma eggs
eliminated by infected individuals, which further develop in the infective form called cercariae
in freshwater snails. The release of Schistosoma cercariae from snails is followed by skin
penetration of the definitive hosts (human and nonhuman species like buffalos in the case of
S. japonicum or rodents in the case of S. mansoni infection). In the latter, Schistosoma immature
forms evolve to adults that lay eggs, which are spread in the definitive hosts and/or eliminated
in the environment through excreta, like urine in the case of S. haematobium and stool for the
other species. In some areas, nonhuman definitive hosts are also essential to maintain
Schistosoma life cycle, such as buffalos for S. japonicum and rodents for S. mansoni [5, 6].
Schistosomiasis world distribution is essentially in tropical and subtropical areas, with more
than 90% of infected individuals living in sub-Saharan Africa [7, 8]. However, imported cases
of schistosomiasis are also becoming increasingly frequent in nonendemic areas such as
Europe. Spotlights were thrown on schistosomiasis in the recent years since elimination is
believed to be a reachable goal for some endemic regions on the globe. Education, sanitation
policies, and hygiene awareness proved to promote a high impact on infection transmission
[9]. Also, field work in different transmission areas shows that chemotherapy plays an evident
role in decreasing prevalence, parasite burden, and late morbidity [10].
Recently, a great deal of debate has been done over two main issues in schistosomiasis
management in endemic and nonendemic areas: how to accurately diagnosis Schistosoma
infections before and after therapy in addition to assess morbidity level. The adoption of
promising new diagnostic tools and the development of new markers of disease progression
might change the current scenario by improving schistosomiasis clinical management in both
community and institutional settings.
The diagnosis of active Schistosoma infection is based on the demonstration of egg excretion
by parasitological methods such as Kato-Katz (K-K), which has a low cost and can be per
formed in field studies. Direct egg detection achieves 100% specificity and high sensitivities
parallel with high parasite burden. However, in individuals with less than 100 eggs per gram
(epg), parasitological method loses sensitivity. Non-egg excretors are usually underdiagnosed.
Furthermore, the assessment of cure rate is unreliable postchemotherapy use [11, 12]. More
over, the evaluation of the effectiveness of schistosomiasis control or eradication programs
after (mass) chemotherapy is distorted. New approaches have been developed and proposed
as complementary or in substitution to K-K. New approaches such as DNA detection assays
Schistosomiasis Updating Technologies and Diagnostic Approaches in Surveillance Strategies...

http://dx.doi.org/10.5772/61310
and rapid tests have evolved in the last years [13]. The accurate assessment of schistosomiasis
diagnosis, morbidity determination, and therapy response through new technologies became
suitable for use in both institutional as well as community settings. The upgrade of diagnostic
technology that encompasses the detection of active infection before chemotherapy and
monitoring of treatment response will permit advances in public health policies as well as in
individual clinical management [14, 15]. Moreover, the assessment of clinical presentation, the
disease stage, and the prognosis have been the object of progresses that go side by side with
the development of new image diagnostic apparatus. Also, biochemical, immunological, and
molecular markers have been tested for the evaluation of fibrosis, vascular damage, and even
cancer [16]. The present review aims to discuss the new surveillance strategies and their impact
on schistosomiasis clinical management.
2. New diagnostic tools in both community and institutional settings

The laboratory investigation of Schistosoma infection consists of different techniques, including
parasitological, immunological, and molecular biology methods [17-19]. Frequently, diagnos
tic approaches are also applied on the monitoring of drug response. In addition, the assessment
of morbidity levels can be achieved by using image tests and biochemical markers [20-22].
However, the diagnosis of active Schistosoma infection and the monitoring of therapy response
as well as the determination of morbidity levels are distinctively assessed at community and
institutional settings (Figure 1). Furthermore, in community settings, conventional or investi
gational tools aim to assess the efficiency of national control programs in the morbidity control
and/or elimination of transmission by measuring the prevalence and intensity of infection in
intermediary and definitive hosts [23-25]. In contrast, in institutional settings, diagnostic
approaches aim to improve clinical management of individual cases.
Traditionally, egg detection by microscopy is the major criteria for active Schistosoma infection
[24, 26]. Egg excretion can be detected by parasitological methods such as urine filtration and
centrifugation methods in the case of S. haematobium. Since S. japonicum, S. mansoni, S. mekon
gi, and S. intercalatum eggs are shed in the feces, egg patent infection is detected in fecal samples
by parasitological methods such as Kato-Katz test (K-K). The principal characteristics of K-K
are as follows: an easy-to-do technique, low cost, reliability, and accurate identification of eggs
in the case of Schistosoma species. Also, parasitological methods are quantitative. As a result,
parasite load can be estimated. Egg counts correlate with the intensity of being <100 eggs per
gram (epg), >100-399 epg, and >400 epg designated as light, moderate, and severe infection,
respectively, according to WHO guidelines. Furthermore, the assessment of morbidity levels
can also be roughly determined. Based on findings in high endemic areas, the elevated number
of eggs was associated with severe forms of disease. Both urine filtration and Kato-Katz test
have been applied for diagnosis and monitoring therapy response and used in field studies in
areas of transmission as well as in institutional settings. Although Kato-Katz are affordable
and suitable for low-income areas with individuals presenting with heavy to moderate
infections, Schistosoma infection diagnosis can be quite tricky to detect in individuals with acute
schistosomiasis or light infection living in nonendemic and low-endemic areas when based
129
130
Figure 1. Schistosomiasis flowchart for clinical management in community and institutional settings. Conventional
and new tools to diagnosis, determination of response to therapy, and morbidity assessment are indicated under com
munity and institutional settings in hierarchic order. Bellow conventional tests, new tools were depicted according to
the strength of literature evidence (red boxes). Approaches still under investigation and/or diagnostic platforms that
show debatable results are inside the gray boxes. PM: parasitological method; US: ultrasonography; PCR: polymerase
chain reaction; RDT: rapid test (POC-CCA /POC-CAA); FOB: fecal occult blood; CT: computed tomography; MRI:
magnetic resonance imaging.
solely on microscopy [27]. Lack of egg shedding, one gender-induced infection, and daily
variability are some of the causes that directly interfere with the sensitivity of microscopy, thus
compromising the detection of Schistosoma infection and resulting in the underestimation of
real prevalence [15, 28]. Moreover, the erratic elimination of Schistosoma eggs makes the
determination of therapy response uncertain. In addition, some patients may present with
severe forms of disease such as neuroschistosomiasis or genital schistosomiasis without any
egg excretion detectable [13]. Strategies to overcome the lack of sensitivity of urine filtration
and Kato-Katz test include testing replicate samples of urine or stool samples and/or aug
menting the number of Kato-Katz slides/sample [29].
Other parasitological methods such as sedimentation, centrifugation, flotation techniques, and
miracidium hatching were developed and had improved the diagnosis of light infections by
increasing sensitivity [26, 32]. In institutional settings, tissue biopsy such as rectal snips and
liver biopsy are largely used to diagnose active infection in non-egg excretors despite its
invasiveness [31]. Eventually, surgical specimens reveal previously undiagnosed schistoso

http://dx.doi.org/10.5772/61310
miasis. Except for rectal snips, histological examination is not quantitative, lack of information
on parasite burden does not preclude clinical assistance.
Albeit the availability of diverse parasitological methods and tissue biopsies as alternatives to
the reference test (Kato-Katz), nonparasitological methods were also developed to overcome
microscopy false-negative results. This is the case of immunological tests, which have become
more useful for showing active infections in recently exposed individuals, such as travelers or
chronically infected immigrants residing in nonendemic areas [32]. In areas of transmission,
immunodiagnosis is a suitable tool for surveillance in low endemic areas [29]. Several immu
nodiagnostic tests were developed, but currently the ELISA-based assays using egg antigen,
cercarial, or adult worm antigens have been extensively used [33]. In addition, recombinant
proteins and peptides have been potential targets [34-36]. Despite its infrequent use in National
Programs for Schistosomiasis Control, serology is a potent auxiliary diagnostic approach that
permits the diagnosis of non-egg excretors. However, the presence of active infection may be
undermined by persistent reactivity despite successful treatment [13, 29]. Although immu
noreactivity does not correlate with the intensity of infection, data have demonstrated that
isotypic immunoresponse may reflect morbidity levels [37, 38].
Moreover, rapid tests (RDT) for the detection of Schistosoma antigens like circulating cathodic
(CCA) and anodic (CAA) antigens and DNA detection assays have proven to be an advanced
and feasible strategy for diagnosing Schistosoma infection despite the absence of their use as
routine diagnostic approaches [13, 39]. See detailed comments in Table 1. During active
infection, gut-produced Schistosoma glycoproteins - POC-CCA and POC-CAA - are detectable
in the blood, urine, and stool. At individual level, results revealed that both CAA and CCA
ELISA-based assays can be quite sensitive to detect active infection early after exposure in
travelers even in the cases of light infections. Also, the tests allow a quantitative assessment of
antigen levels, which correlates with the intensity of infection [40]. Point-of-care platforms
(POC) have been applied to estimate infection prevalence with high accuracy in field studies
in high and moderate endemic areas [41, 42]. Although research groups claim that CCA and
CAA might be a suitable substitute for Kato-Katz test, its performance is still debatable in low
endemic areas [43, 44]. RDT for hematuria (urogenital schistosomiasis), fecal occult blood
(FOB), and calprotectin detection (entero-schistosomiasis) are also point-of-care approaches,
which have been shown to have fair association with egg-patent infections with dual use as
diagnostic tools and markers of morbidity [25, 45]. Although strong evidences support the
usage of hematuria detection by RDTs, larger studies are still necessary to establish the
usefulness of FOB and/or calprotectin detection in cases of light infection commonly found in
low endemic areas.
3. Assessment of morbidity and drug response in community and

institutional settings
Sanitation and community health education in addition to chemotherapeutic intervention are
measures that effectively contribute to the control and/or elimination of Schistosoma infection
131
132
in several endemic areas and the resolution or attenuation of progressive forms of disease at
individual level [10, 46, 47]. However, the determination of the effects of these measures, in
particular, drug intervention, still presents as a challenge (Table 1). Tests like microscopy have
low sensitivity and underestimate cure rates especially in non-egg excretors. Day-to-day
variations in egg excretion contribute to the misdiagnosis of schistosomiasis elimination after
treatment [15]. The evaluation of drug response in individuals previously diagnosed by tissue
biopsies is also troubled since the procedures might be invasive like brain or spinal cord
biopsies in neuroschistosomiasis [48]. In immunoreactive egg and non-egg excretors submitted
to PZQ treatment, it was shown that reactivity against several proteins mostly related to
parasite musculature or glycolytic metabolism is enhanced after therapy [49]. Immunoreac
tivity might persist for long periods of time despite effective drug response, although sero
conversion may occur in some individuals. Nonetheless, in low-endemic areas,
immunodiagnosis has proven to be a valuable tool for schistosomiasis surveillance [50].
Changes in immunoreactivity in controlled areas can be used as an indicator of maintained
transmission and/or active infection in community settings [51]. Therefore, the assessment of
drug response is a hot topic in the schistosomiasis and development of new tools became an
urgent matter (Table 1). Investigations have shown a potential role in drug response assess
ment with the use of rapid tests and DNA detection assays [14, 52].
Community
Traditional Tools
Investigational Tools
Tests
Tests
Characteristics / Observations
Antigen
Detection in 2nd week post-infection
Detection
(pi); secretion by live larvae; group
Characteristics/Observations
Settings
Vector control Light Exposure For determination of
Test
transmission control,
(Cercarial
elimination or erradication.
specific. Not commercially available
shedding
Inaccurate. no species
assays.
detection)
identification; Test does not

detect prepatent infections; no
assessment of early post-control
measures in snail infection rates.
DNA- based
Detection in 1st week pi; quantitation
assays
of parasite load (real -time PCR;

specie-specific identification.
Mapping foci of vector snails and
monitoring transmission. In house
assays.
Non-human
Parasitological Traditional methods which are CCA-dipsticks Detection of active infection
Hosts
Methods
simple, cheap and effective for (urine lateral
(Egg detection) Schistosoma detection.
flow test)
independent of patent egg-excretion

in primate non-humans. Only
Serology (IgG/ determination of genus but not

IgM)
species.

http://dx.doi.org/10.5772/61310
Community
Traditional Tools
Tests
Tests
Settings
Defines exposure to Schistosoma. In
chimpanzee populations serology
present high sensitivity but reactivity
may persist for years after infection
has been cleared.
Comercial available test.
Humans Hosts Questionaries Questionnaries are applied to
DNA- based
Identification and mapping of
Sanitation /
Parasitological identify high - risk populations assays1
Schistosoma endemic areas.
Education
Methods
DNA based assays are powerful
and permits assessment of
(Egg detection) Schistosoma infection
tools for detection of Schistosoma
Serology
Parasitological tests are
active infections. DNA detection
quantitative methods. Low price
show better performance even in
per test. Used for Screening
light infection (low parasite loads)
sentinel populations like school
or despite absence of egg excretion.
children.See more comments
Mostly tested in small studies.
below.
Chemotherapy Parasitological Microscopy is highly sensitive
Methods
DNA-based
and specific to detect egg-patent assays1
(Egg detection) infections. Day-to-day
DNA detection has higher

sensitivity after use of
chemotherapy. Persistent DNA
variations on egg excretion is a
amplification in both egg excretors
limitation. Absence of egg
and non-egg excretors strongly
excretion post-treatment may
suggest no response to therapy.
not represent response to
Presents good performance
therapy. Cure rates determined
compared to parasitological
in different S. mansoni and
methods to determine effect of
S.haematobium infections are
MDA. Cure rates calculated by
variable (49.2 to 98.40%) [53, 54].
different DNA - based assays in
Understimates reinfection and
distinct populations and by different
also incomplete cure.
Schistosoma species may varie from

21.1 - 30.7 to 75.6% [55, 15].
Persistence of DNA amplification
until 6 months and post- 6 months
after treatment might suggest
incomplete infection and reinfection,
respectively DNA-based assays for
Schistosoma infection detection are
not currently commercially
available.
Serology
Loss of sensitivity of
microscopy has been replaced in
Rapid Test
POC-CCA maintains higher

sensitivity than parasitological
133
134
Community
Traditional Tools
Tests
Tests
Settings
some control programs by
methods after PZQ use. However,
serology which may remain
specificity may be compromised by
reactive for extended periods
the presence of persistent low
post effective drug use. In areas
reactivity ( trace positive samples)
submitted to several rounds of
post-chemotherapy.Cure rates may
chemotherapy, low and/or
vary from 23.3 - 26.1 to 40.7- 47.8%
absence of reactivity might
[42, 54]
represent control of
infection.Long periods of
obsevation are necessary to
determine Schistosoma infection
real status. Reinfection or
incomplete cure may not be
assessed.
Institutional
Settings
Chemotherapy Parasitological Assessment of post-therapy
Methods
response by parasitological
(Egg detection) methods in clinical wards has
DNA-based
DNA-based assays are a reliable tool
assays1
to detect response to therapy in

distinct clinical specimens. Absence
similar advantages and
of DNA amplification correlates
limitations as in community
with response to therapy in
settings. In immigrants (long
individuals treated in Travel
gone from endemic areas) and
Medicine Clinics
recently exposed travelers,
[56].In case of therapy failure,
absence of egg excretion pre-
maintained DNA amplification
therapy represent an obstacle.
correlate with persistence of clinical
Ova detection is inappropriate
signs, symptoms and pathological
to determine therapy response
abnormalities associated to therapy
in these groups. See above other
failure [57]. Usefulness of DNA-
coments.
based assays to detect past infection

incomplete cure for non re-exposed
individuals has to be established
with large studies [58].
Tissue Biopsy No viable eggs in rectal snips

show good correlation with
response to therapy. However,
tissue biopsy (rectal snips, liver
biopsies) are invasive
procedures. And, lack of ova

http://dx.doi.org/10.5772/61310
Community
Traditional Tools
Tests
Tests
Settings
detection may not represent
absence of active infection [59].
Serology
Immunoreactivity persistence
for years after effective therapy
is the major limitation. Negative
seroconversion representes
response to therapy and it is
observed in some individuals
[56]. But, assessment of therapy
failure is mostly difficult [59].
Transplant
Tissue Biopsy Donnor and organ-recipients

from endemic areas with /
DNA- based
Further studies are necessary.
assays1
without transaminase
alterations can be screened by
tissue biopsy [60]. But, negative
tissue samples do not rule out
active infection.
DNA based assay - conventional PCR, real-time PCR and LAMP (Loop-mediated isothermal amplification)
Table 1. Effectiveness of interventions in surveillance programs and monitoring therapy response in clinical
management: use of traditional and investigational tools.
RDTs for antigen detection have been largely used for population studies to evaluate post
therapy response and efficacy [42, 43]. In areas of moderate and high endemicity, therapy
response represented by decrease or disappearance of antigen detection may represent cure.
However, in light infections, rapid test accuracy is reduced with maintained antigen detection
in individuals without infection. The use of antigen detection assays is a debatable matter to
measure posttherapy response. In contrast, DNA assays seem to be a suitable marker of drug
response. Cure is determined by the absence of DNA amplification postchemotherapy use,
while persistent DNA amplification correlates with nonresponse to therapy [15].
Schistosomiasis presents as a large spectrum of manifestations and disease severity during
acute and chronic phases. Usually, imaging tests and/or biological markers are required to
confirm diagnosis, to assess morbidity, and to stage disease progression [21, 22]. Image tests
such as ultrasonography became revolutionary to assess urogenital S. haematobium infection
and S. mansoni liver disease [61]. In both community and institutional settings, conventional
ultrasound (US) examination is a well-standardized test to assess bladder and liver fibrosis,
which is the hallmark of disease progression in urinary and intestinal schistosomiasis,
respectively [62-65]. US predicts disease prevalence rates and is a reliable noninvasive
indicator of morbidity levels which aloud disease staging [64, 66]. However, morbidity
measurement in a multivariate clinical manifestation infection like schistosomiasis is no easy
135
136
task. Targeting one compartment to measure schistosomiasis morbidity might not be enough
since some clinical presentations can affect a single compartment like in neuroschistosomiasis
and others. In intestinal Schistosoma infection, independent hepatosplenic forms are the most
common clinical presentation after asymptomatic S. mansoni infection. However, in contrast
to hepatic schistosomiasis, the study of disease progression by using image and/or biochemical
markers is still poorly developed [21]. Promising new approaches such as capsule endoscopy
have been introduced, but large-scale studies are still necessary to evaluate the usefulness of
the method [67]. In hepatosplenic forms, vascular gastropathy and colopathy can be indicators
of portal hypertension severity [68]. The assessment of vascular alterations in superior
gastrointestinal tract are used to determine schistosomiasis levels of morbidity through the
use of upper digestive endoscopy in association with conventional ultrasonography and
Doppler imaging [66]. In institutional settings, transient elastography, magnetic resonance,
and computerized tomography might give supplementary information regarding fibrosis
progression and vascular status, although standardization is necessary especially for disease
staging [22, 69]
4. Conclusion
In community settings, concerns have been increasing on the effectiveness of schistosomiasis
control interventions like MDA over the years. The low accuracy of the reference test to detect
active Schistosoma infection and the improper estimates of cure rates jeopardize the truthful
analysis of drug intervention, which compromises the effectiveness of surveillance systems.
In clinical settings, underdiagnosed schistosomiasis and inadequate morbidity assessment also
increase the burden on public and private health systems. In order to change this scenario,
new diagnostic tools, markers of treatment response, and morbidity assessment have been
developed over the years showing promising results. Nonetheless, efforts still have to be made
to find a single cheap and easy-to-do approach that is suitable and reliable for diagnosis,
treatment evaluation, and disease staging in community and institutional settings.
Author details
Marta Guimares Cavalcanti1,2 and Jos Mauro Peralta2*
*Address all correspondence to: peralta@micro.ufrj.br
1 Servio de Doenas Infecciosas e Parasitrias, Hospital Universitrio Clementino Fraga
Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
2 Departmento de Imunologia, Instituto de Microbiologia Paulo de Ges, Universidade
Federal do Rio de Janeiro, Rio de Janeiro, Brazil

http://dx.doi.org/10.5772/61310
References
[1] Lambertucci JR. Acute schistosomiasis mansoni: revisited and reconsidered. Mem
Inst Oswaldo Cruz. 2010; 105(4):422-435.
[2] Barsoum RS, Esmat G, El-Baz. Human schistosomiasis: clinical perspective: review. J
Adv Res. 2013; 4(5):433-444.
[3] McManus DP, Gray DJ, Li Y, Feng Z, Williams GM, Stewart D, Rey-Ladino J, Ross
AG. Schistosomiasis in the Peoples Republic of China: the era of the Three Gorges.
Clin Microbiol Rev. 2010; 23(2):442-466.
[4] Walker AJ. Insights into the functional biology of schistosomes. Parasit Vectors. 2011;
4:203.
[5] Ribeiro AC, Maldonado Jnior A, DAndrea PS, Vieira GO, Rey L. Susceptibility of
Nectomys rattus (Pelzen, 1883) to experimental infection with Schistosoma mansoni
(Sambon, 1907): a potential reservoir in Brazil. Mem Inst Oswaldo Cruz. 1998; 93
Suppl 1:295-299.
[6] McGarvey ST, Zhou XN, Willingham AL 3rd, Feng Z, Olveda R. The epidemiology
and host-parasite relationships of Schistosoma japonicum in definitive hosts. Parasitol
Today. 1999; 15(6):214-215.
[7] Hotez PJ, Kamath A. Neglected tropical diseases in sub-Saharan Africa: review of
their prevalence, distribution, and disease burden. PLoS Negl Trop Dis. 2009;
3(8):e412.
[8] WHO: Schistosomiasis. http://www.who.int/mediacentre/factsheets/fs115/en/
[9] Esrey SA, Potash JB, Roberts L, Shiff C. Esrey SA, Potash JB, Roberts L, Shiff C. Ef
fects of improved water supply and sanitation on ascariasis, diarrhoea, dracunculia
sis, hookworm infection, schistosomiasis, and trachoma. Bull World Health Organ.
1991; 69(5):609-621.
[10] Tour S, Zhang Y, Bosqu-Oliva E, Ky C, Ouedraogo A, Koukounari A, Gabrielli AF,
Bertrand S, Webster JP, Fenwick A. Two-year impact of single praziquantel treat
ment on infection in the national control programme on schistosomiasis in Burkina
Faso. Bull World Health Organ. 2008; 86(10):780-787.
[11] Rabello A, Pontes LA, Dias-Neto E. Recent advances in the diagnosis of Schistosoma
infection: the detection of parasite DNA. Mem Inst Oswaldo Cruz. 2002; 97 Suppl
1:171-172.
[12] Enk MJ, Oliveira e Silva G, Rodrigues NB. Diagnostic accuracy and applicability of a
PCR system for the detection of Schistosoma mansoni DNA in human urine samples
from an endemic area. PLoS One. 2012; 7(6):e38947.
137
138
[13] Cavalcanti MG, Silva LF, Peralta RH, Barreto MG, Peralta JM. Schistosomiasis in
areas of low endemicity: a new era in diagnosis. Trends Parasitol. 2013; 29(2):75-82.
[14] Downs JA, Kabangila R, Verweij JJ, Jaka H, Peck RN, Kalluvya SE, Changalucha JM,
Johnson WD, van Lieshout L, Fitzgerald DW. Detectable urogenital schistosome
DNA and cervical abnormalities 6 months after single-dose praziquantel in women
with Schistosoma haematobium infection. Trop Med Int Health. 2013; 18(9):1090-1096.
[15] Vinkeles Melchers NV, van Dam GJ, Shaproski D, Kahama AI, Brienen EA, Venner
vald BJ, van Lieshout L. Diagnostic performance of Schistosoma real-time PCR in
urine samples from Kenyan children infected with Schistosoma haematobium: day-today variation and follow-up after praziquantel treatment. PLoS Negl Trop Dis. 2014;
8(4):e2807.
[16] Sousa-Figueiredo JC, Basez MG, Khamis IS, Garba A, Rollinson D, Stothard JR.
Measuring morbidity associated with urinary schistosomiasis: assessing levels of ex
creted urine albumin and urinary tract pathologies. PLoS Negl Trop Dis. 2009;
3(10):e526
[17] Hoy AM, Lundie RJ, Ivens A, Quintana JF, Nausch N. Forster T, Jones F, Kabatereine
NB, Dunne DW, Mutapi F, Macdonald AS, Buck AH. Parasite-derived MicroRNAs in
host serum as novel biomarkers of helminth infection. PLoS Negl Trop Dis. 2014;
8(2):e2701.
[18] Carneiro TR, Peralta RH, Pinheiro MC, Oliveira SM, Peralta JM, Bezerra FS. A con
ventional polymerase chain reaction-based method for the diagnosis of human schis
tosomiasis in stool samples from individuals in a low-endemicity area. Mem Inst
Oswaldo Cruz. 2013; 108(8):1037-1044.
[19] Gordon CA, Acosta LP, Gray DJ, Olveda RM, Jarilla B, Gobert GN, Ross AG, McMa
nus DP. High prevalence of Schistosoma japonicum infection in carabao from Samar
Province, the Philippines: implications for transmission and control. PLoS Negl Trop
Dis. 2012; 6(9): e1778.
[20] Voieta I, de Queiroz LC, Andrade LM, Silva LC, Fontes VF, Barbosa A Jr, Resende V,
Petroianu A, Andrade Z, Antunes CM, Lambertucci JR. Imaging techniques and his
tology in the evaluation of liver fibrosis in hepatosplenic schistosomiasis mansoni in
Brazil: a comparative study. Mem Inst Oswaldo Cruz. 2010; 105(4):414-421.
[21] Domingues AL, Medeiros TB, Lopes EP. Ultrasound versus biological markers in the
evaluation of periportal fibrosis in human Schistosoma mansoni. Mem Inst Oswaldo
Cruz. 2011:106(7):802-807.
[22] Lambertucci JR. Revisiting the concept of hepatosplenic schistosomiasis and its chal
lenges using traditional and new tools. Rev Soc Bras Med Trop. 2014; 47(2):130-136.
[23] Mutapi, Improving diagnosis of urogenital schistosome infection. Expert Rev Anti
Infect Ther. 2011; 9(10):863-865.

http://dx.doi.org/10.5772/61310
[24] Colley DG, Bustinduy AL, Secor WE, King CH. Human schistosomiasis. Lancet.
2014; 383(9936):2253-2264.
[25] Stothard JR, Stanton MC, Bustinduy AL, Sousa-Figueiredo JC, Van Dam GJ, Betson
M, Waterhouse D, Ward S, Allan F, Hassan AA, Al-Helal MA, Memish ZA, Rollinson
D. Diagnostics for schistosomiasis in Africa and Arabia: a review of present options
in control and future needs for elimination. Parasitology. 2014; 141(14):1947-1961.
[26] Gray DJ, Ross AG, Li YS, McManus DP (2011). Diagnosis and management of schis
tosomiasis. BMJ. 2011; 342:d2651.
[27] Coltart CE, Chew A, Storrar N, Armstrong M, Suff N, Morris L, Chiodini PL, Whitty
CJ. Schistosomiasis presenting in travellers: a 15 year observational study at the Hos
pital for Tropical Diseases, London. Trans R Soc Trop Med Hyg. 2015; 109(3):214-220.
[28] Degarege A, Legesse M, Medhin Gm Teklehaymanot T, Erko B. Day-to-day fluctua
tion of point-of-care circulating cathodic antigen test scores and faecal egg counts in
children infected with Schistosoma mansoni in Ethiopia. BMC Infect Dis. 2014; 14:210.
[29] Gonalves MM, Barreto MG, Peralta RH, Gargioni C, Gonalves T, Igreja RP, Soares
MS, Peralta JM. Immunoassays as an auxiliary tool for the serodiagnosis of Schistoso
ma mansoni infection in individuals with low intensity of egg elimination. Acta Trop.
2006; 100(1-2):24-30.
[30] Coelho PM, Jurberg AD, Oliveira AA, Katz N. Use of a saline gradient for the diag
nosis of schistosomiasis. Mem Inst Oswaldo Cruz. 2009; 104:720-723.
[31] Olveda DU, Olveda RM, Lam AK, Chau TN, Li Y, Gisparil AD 2nd, Ross AG. Utility
of diagnostic imaging in the diagnosis and management of schistosomiasis. Clin Mi
crobiol. 2014; 3(2):142.
[32] WHO (2013). http://www.who.int/mediacentre/factsheets/fs115/en/
[33] Chand MA, Chiodini PL, Doenhoff MJ. Development of a new assay for the diagno
sis of schistosomiasis, using cercarial antigens. Trans R Soc Trop Med Hyg. 2010;
104:255-258.
[34] Zhou XH, Wu JY, Huang XQ, Kunnon SP, Zhu XQ, Chen XG. Identification and char
acterization of Schistosoma japonicum Sjp40, a potential antigen candidate for the early
diagnosis of schistosomiasis. Diagn Microbiol Infect Dis. 2010; 67:337-345.
[35] de Oliveira EJ, Kanamura HY, Takei K, Hirata RD, Valli LC, Nguyen NY, de Carval
ho Rodrigues I, de Jesus AR, Hirata MH. Synthetic peptides as an antigenic base in
an ELISA for laboratory diagnosis of schistosomiasis mansoni. Trans R Soc Trop Med
Hyg. 2008; 102:360-366.
[36] Ludolf F, Patrocnio PR, Corra-Oliveira R, Gazzinelli A, Falcone FH, Teixeira-Ferre
ira A, Perales J, Oliveira GC, Silva-Pereira RA. Serological screening of the Schistoso
ma mansoni adult worm proteome. PLoS Negl Trop Dis. 2014; 8(3):e2745.
139
140
[37] Ramrez RM, Ceballos E, Alarcn de Noya B, Noya O, Bianco N. The immunopathol
ogy of human schistosomiasis: III. Immunoglobulin isotype profiles and response to
praziquantel. Mem Inst Oswaldo Cruz. 1996; 91(5):593-599.
[38] Negro-Corra D, Fittipaldi JF, Lambertucci JR, Teixeira MM, Antunes CM, Carneiro
M. Association of Schistosoma mansoni-specific IgG and IgE antibody production and
clinical schistosomiasis status in a rural area of Minas Gerais, Brazil. PLoS One. 2014;
9(2):e88042.
[39] Nausch N, Dawson EM, Midzi N, Mduluza T, Mutapi F, Doenhoff MJ. Field evalua
tion of a new antibody-based diagnostic for Schistosoma haematobium and S. mansoni
at the point-of-care in northeast Zimbabwe. BMC Infect Dis. 2014; 14:165.
[40] van Lieshout L, Polderman AM, Deelder AM. Immunodiagnosis of schistosomiasis
by determination of the circulating antigens CAA and CCA, in particular in individ
uals with recent or light infections. Acta Trop. 2000; 77(1):69-80.
[41] Tchuem Tchuent LA, Kuet Fouodo CJ, Kamwa Ngassam RI, Sumo L, Dongmo
Noumedem C, Kenfack CM, Gipwe NF, Nana ED, Stothard JR, Rollinson D. Evalua
tion of circulating cathodic antigen (CCA) urine-tests for diagnosis of Schistosoma
mansoni infection in Cameroon. PLoS Negl Trop Dis. 2012; 6(7):e1758.
[42] Coulibaly JT, NGbesso YK, Knopp S, NGuessan NA, Silu KD, van Dam GJ, NGor
an EK, Utzinger J. Accuracy of urine circulating cathodic antigen test for the diagno
sis of Schistosoma mansoni in preschool-aged children before and after treatment.
PLoS Negl Trop Dis. 2013; 7(3):e2109.
[43] Sousa-Figueiredo JC, Betson M, Kabatereine NB, Stothard JR. The urine circulating
cathodic antigen (CCA) dipstick: a valid substitute for microscopy for mapping and
point-of-care diagnosis of intestinal schistosomiasis. PLoS Negl Trop Dis. 2013;
7(1):e2008.
[44] van Dam GJ, Xu J, Bergquist R, de Dood CJ, Utzinger J, Qin ZQ, Guan W, Feng T, Yu
XL, Zhou J, Zheng M, Zhou XN, Corstjens PL. An ultra-sensitive assay targeting the
circulating anodic antigen for the diagnosis of Schistosoma japonicum in a low-endem
ic area, Peoples Republic of China. Acta Trop. 2015; 141(Pt B):190-197.
[45] King CH, Bertsch D. Meta-analysis of urine heme dipstick diagnosis of Schistosoma
haematobium infection, including low-prevalence and previously-treated populations.
PLoS Negl Trop Dis. 2013; 7(9):e2431.
[46] Martins-Leite P, Gazzinelli G, Alves-Oliveira LF, Gazzinelli A, Malaquias LC, Cor
rea-Oliveira R, Teixeira-Carvalho A, Silveira AM. Effect of chemotherapy with prazi
quantel on the production of cytokines and morbidity associated with
schistosomiasis mansoni. Antimicrob Agents Chemother. 2008;52(8):2780-2786.
[47] Silva PC, Leal TV, Domingues AL. Treatment and education reduce the severity of
schistosomiasis periportal fibrosis. Rev Soc Bras Med Trop. 2013; 46(4):472-477.

http://dx.doi.org/10.5772/61310
[48] Lambertucci JR, Souza-Pereira SR, Carvalho TA. Simultaneous occurrence of brain
tumor and myeloradiculopathy in schistosomiasis mansoni: case report. Rev Soc Bras
Med Trop. 2009; 42(3):338-341.
[49] Mutapi F, Burchmore R, Mduluza T, Foucher A, Harcus Y, Nicoll G, Midzi N, Turner
CM, Maizels RM. Praziquantel treatment of individuals exposed to Schistosoma hae
matobium enhances serological recognition of defined parasite antigens. J Infect Dis.
2005;192(6):1108-1118.
[50] Ramrez RM, Ceballos E, Alarcn de Noya B, Noya O, Bianco N. The immunopathol
ogy of human Schistosomiasis-III. Immunoglobulin isotype profiles and response to
praziquantel. Mem Inst Oswaldo Cruz. 1996; 91(5):593-599.
[51] Wami WM, Nausch N, Bauer K, Midzi N, Gwisai R, Simmonds P, Mduluza T, Wool
house M, Mutapi F. Comparing parasitological vs serological determination of Schis
tosoma haematobium infection prevalence in preschool and primary school-aged
children: implications for control programmes. Parasitology. 2014; 141(14):1962-1970.
[52] Gomes LI, Enk MJ, Rabello A. Diagnosing schistosomiasis: where are we? Rev Soc
Bras Med Trop. 2014; 47(1):3-11.
[53] Garba A, Lamine MS, Barkir N, Djibo A, Sofo B, Gouvras AN, Labbo R, Sebangou
H, Webster JP, Fenwick A, Utzinger J. Efficacy and safety of two closely spaced doses
of praziquantel against Schistosoma haematobium and S. mansoni and re-infection pat
terns in school-aged children in Niger. Acta Trop. 2013; 128(2):334-344.
[54] Lamberton PH, Kabatereine NB, Oguttu DW, Fenwick A, Webster JP. Lamberton PH,
Kabatereine NB, Oguttu DW, Fenwick A, Webster JP. Sensitivity and specificity of
multiple Kato-Katz thick smears and a circulating cathodic antigen test for Schistoso
ma mansoni diagnosis pre- and post-repeated-praziquantel treatment. PLoS Negl
Trop Dis. 2014; 8(9):e3139.
[55] Pontes LA, Oliveira MC, Katz N, Dias-Neto E, Rabello A. Comparison of a polymer
ase chain reaction and the Kato-Katz technique for diagnosing infection with Schisto
soma mansoni. Am J Trop Med Hyg. 2003; 68(6):652-656.
[56] Wichmann D, Poppert S, Von Thien H, Clerinx J, Dieckmann S, Jensenius M, Parola
P, Richter J, Schunk M, Stich A, Zanger P, Burchard GD, Tannich E. Prospective Eu
ropean-wide multicentre study on a blood based real-time PCR for the diagnosis of
acute schistosomiasis. BMC Infect Dis. 2013; 13:55.
[57] Kato-Hayashi N, Yasuda M, Yuasa J, Isaka S, Haruki K, Ohmae H, Osada Y, Kanaza
wa T, Chigusa Y. Use of cell-free circulating schistosome DNA in serum, urine, se
men, and saliva to monitor a case of refractory imported schistosomiasis hematobia. J
Clin Microbiol. 2013 51(10):3435-3438.
141
142
[58] Wichmann D, Panning M, Quack T, Kramme S, Burchard GD, Grevelding C, Drosten

C. Diagnosing schistosomiasis by detection of cell-free parasite DNA in human plas
ma. PLoS Negl Trop Dis. 2009; 3(4):e422.
[59] Helleberg M, Thybo S. High rate of failure in treatment of imported schistosomiasis. J
Travel Med. 2010; 17(2):94-99.
[60] Mahmoud KM, Sobh MA, El-Agroudy AE, Mostafa FE, Baz ME, Shokeir AA, Gho
neim MA. Impact of schistosomiasis on patient and graft outcome after renal trans
plantation:10 years follow-up. Nephrol Dial Transplant. 2001;16(11):2214-2221.
[61] Koukounari A, Sacko M, Keita AD, Gabrielli AF, Landour A, Dembel R, Clements
AC, Whawell S, Donnelly CA, Fenwick A, Traor M, Webster JP. Assessment of ul
trasound morbidity indicators of schistosomiasis in the context of large-scale pro
grams illustrated with experiences from Malian children. Am J Trop Med Hyg. 2006;
75(6):1042-1052.
[62] Akpata R, Neumayr A, Holtfreter MC, Krantz I, Singh DD, Mota R, Walter S, Hatz C,
Richter J. The WHO ultrasonography protocol for assessing morbidity due to Schisto
soma haematobium. Acceptance and evolution over 14 years. Systematic review. Para
sitol Res. 25 February 2015 (published on line).
[63] el Scheich T, Holtfreter MC, Ekamp H, Singh DD, Mota R, Hatz C, Richter J. The
WHO ultrasonography protocol for assessing hepatic morbidity due to Schistosoma
mansoni. Acceptance and evolution over 12 years. Parasitol Res. 2014;113(11):
3915-3925.
[64] Abebe N, Erko B, Medhin G, Berhe N. Clinico-epidemiological study of Schistosomia
sis mansoni in Waja-Timuga, District of Alamata, northern Ethiopia. Parasit Vectors.
2014;7:158.
[65] Wu YM, Xu N, Hu JY, Xu XF, Wu WX, Gao SX, Zhu WJ, Wu WL, Shen XZ, Wang JY,
Wu SD. A simple noninvasive index to predict significant liver fibrosis in patients
with advanced schistosomiasis japonica. Parasitol Int. 2013;62(3):283-288.
[66] Pinto-Silva RA, Queiroz LC, Azeredo LM, Silva LC, Lambertucci JR. Ultrasound in
schistosomiasis mansoni. Mem Inst Oswaldo Cruz. 2010; 105(4):479-484.
[67] Betson M, Sousa-Figueiredo JC, Rowell C, Kabatereine NB, Stothard JR. Intestinal
schistosomiasis in mothers and young children in Uganda: investigation of field-ap
plicable markers of bowel morbidity. Am J Trop Med Hyg. 2010;83(5):1048-1055.
[68] Ganc RL, Malheiros CA, Nakakubo S, Szutan LA, Ganc AJ. Small-bowel lesions
caused by portal hypertension of schistosomal origin: a capsule endoscopy pilot
study. Small-bowel lesions caused by portal hypertension of schistosomal origin: a
capsule endoscopy pilot study. Gastrointest Endosc. 2010; 71(4):861-866.

http://dx.doi.org/10.5772/61310
[69] Esmat G, Elsharkawy A, El Akel W, Fouad A, Helal K, Mohamed MK, Attia D, Khat
tab H, Doss W, Labib S. Fibroscan of chronic HCV patients coinfected with schistoso
miasis. Arab J Gastroenterol. 2013;14(3):109-112.
143
Chapter 8
Praziquantel and Arachidonic Acid Combination An

Innovative Approach to the Treatment of
Schistosomiasis
Hatem Tallima, Kevin Hadley and Rashika El Ridi
http://dx.doi.org/10.5772/61185
Abstract
Schistosomiasis is a debilitating disease caused by trematode worms of the genus
Schistosoma. Three members Schistosoma mansoni, Schistosoma haematobium, and
Schistosoma japonicum are responsible for the great majority of human infections.
Schistosomiasis is widespread in sub-Saharan Africa, several countries of the Mid
dle East, South America, and South-East Asia. Vaccination against the infection
would be the most reliable way to combat the infection and decrease or interrupt its
transmission, but a commercial vaccine is still unavailable. Praziquantel (PZQ) is
the only drug considered for schistosomiasis treatment as it is effective against the
major human schistosomes, commercially available, cost-affordable, and elicits lim
ited side-effects. Several reports documented the highly significant PZQ efficacy in
treatment of light infections in areas of low S. mansoni and S. haematobium endemici
ty and PZQ use. Chemotherapy with PZQ alone of patients residing in regions of
high schistosome endemicity and afflicted with light, moderate, or heavy infection
is not efficacious. Accordingly, we propose implementation of cost-affordable
arachidonic acid (ARA), a polyunsaturated omega-6 fatty acid and efficacious in vi
tro and in vivo schistosomicide, for oral therapy of children with Schistosoma manso
ni and Schistosoma haematobium light infection, as adjunct to PZQ for cure of
children with moderate and heavy infections, and for counteracting schistosome re
sistance to PZQ that arises in endemic areas exposed to repeated and intense PZQ
mass treatment campaigns.
Keywords: Praziquantel, Arachidonic acid, Schistosomiasis, Chemotherapy, Com
bination chemotherapy
146
1. Introduction
Schistosomiasis is a debilitating disease caused by dioecious (having separate sex) trematode
worms of the genus Schistosoma. Three members, Schistosoma mansoni, Schistosoma haematobi
um, and Schistosoma japonicum, are responsible for the great majority of human infections.
Schistosomiasis is also called snail fever as the schistosomes' life cycle comprises asexual
reproduction in an appropriate, fresh water snail. Actually, it is the presence of the specific
snail vector that determines the prevalence of the disease, as infection is exclusively caused by
the larvae (termed cercariae) shed by infected snails. The cercariae of S. mansoni, S. haematobi
um, and S. japonicum swim in fresh water and soon die if they fail to land on the skin of humans
or other suitable mammalian hosts. The cercariae then penetrate the epidermis, linger there
for one (S. japonicum) to three (S. mansoni, S. haematobium) days or more until extensive
biochemical changes end by setting a protective, outer double-lipid bilayer armor. The larvae,
now termed schistosomula, exit to the dermis and then make their way into dermal venous
capillaries, en route to the lung and then liver. There the parasites start to feed and rapidly
grow and mature, and the male carrying the female into its ventral gynecophoric groove or
"schist" migrate to permanent residence in the inferior mesenteric (S. mansoni, S. japonicum) or
the peri-vesical (S. haematobium) venous plexus. Until then, the worms are nearly innocuous
causing very limited harm, especially in endemic regions. With the onset of female parasite
egg deposition, harm starts and progresses into overt diseases [1-5].
To continue the life cycle, the ova must egress the mammalian host vasculature to the exterior
to locate the intermediate snail host where asexual reproduction takes place. The parasite
dwelling is nearest to the outlets of the lower colon and rectum via feces and the urinary
bladder with urine. Eggs release proteolytic and other hydrolytic enzymes to transit the blood
capillaries, and thereafter the large intestine (or urinary bladder) wall into the lumen. Besides
releasing host matrix digestive enzymes, S. mansoni and S. haematobium additionally depend
on the sharp, lateral and terminal spine, respectively. The massive daily egg migration,
trapping, and calcification lead to edema, congestion, ulcers, lesions, petechial hemorrhage,
necrosis, hyperplastic and hypertrophic changes, fibrosis, and excessive nodules and polyps
formation in the intestine, symptoms collectively known as intestinal schistosomiasis [1, 2].
Continuous egg transit via the wall of the lower urinary tract to the lumen causes even more
damage to the urinary tract and bladder, the severe symptoms of urinary schistosomiasis [3].
Beside the egg-induced overt mechanical injury and lesions, the presence of parasite molecules
within the extracellular matrix signals danger and expectedly contributes to intense and
prolonged generation of inflammatory mediators [4].
The "plat de resistance" is still away, as the most severe injury does not result from the eggs
that escape to the exterior but from the eggs that fail to do so. Eggs trapped in the wall of the
intestine or urinary tract drift and eventually accumulate in tissues of other organs, namely
the liver, where they remain viable for approximately three weeks, and release soluble egg
antigens (SEA) via their microscopic pores. The host responds to these insults through vigorous
immunologic reactions. These intense immunological reactions are injurious to the host, not
the egg that remains unscathed, until its viability becomes exhausted. Lymphocytes, eosino
phils, basophils, and macrophages accumulate around the egg in attempt to prevent its
contents from seeping and disseminating, thus forming large granulomas. The granulomas
Praziquantel and Arachidonic Acid Combination An Innovative Approach to the Treatment of Schistosomiasis
http://dx.doi.org/10.5772/61185
gradually begin to encompass the entire organ, progressing to fibrosis with excessive accu
mulation of collagen and extracellular matrix proteins, obstructive vascular lesions, vascular
hypertension, neo angiogenesis, splenomegaly, esophageal varices, and signs of hepatocellular
(S. mansoni) or kidney (S. haematobium) failure [1-3, 5].
The transiting eggs-induced mechanical injury and the immunological reactions to the
entrapped eggs manifest into colitis, diarrhea, blood in stool or urine, abdominal discomfort
and pain, urodynamic abnormalities, fatigue, lower exercise and work tolerance, impaired
cognitive capacities, and retarded development. Chronic infection leads to organ dysfunction,
intense vascular complications, and additionally, predisposes to other even more severe viral
and bacterial infections, cancer development, and ultimately death [1-3, 5].
Detection of eggs in stool specimens is the gold standard for diagnosis of the infection. In
chronic infections, i.e., in adults residing in endemic areas, continuous egg deposition and
migration via the wall of the lower intestine and the urinary bladder and tracts generate fibrosis
in the submucosa and hypertrophy in the muscularis mucosa, and consequently, a barrier is
raised to the usual route of ova transit from the surrounding veins to the lumen of the gut or
urinary bladder [2, 3]. Expectedly, the gold standard method of egg detection is entirely
unreliable in chronic infections. Diagnostic methods based on serological detection of anti
bodies to the parasite antigens do not lack sensitivity, but lack specificity and additionally may
not be used to monitor the outcome of therapy or to differentiate between present and past
infection. Diagnostic methods based on antigen detection in serum, urine or stool, and saliva
lack both sensitivity and specificity and together with the methods based on molecular biology
advances are cumbersome, costly, and none has been adapted for routine screening in endemic
regions, all situated in the developing world [5 and references therein, 6]. Epidemiological
surveys are costly and require thorough scientific and political involvement, both often failing
in developing countries. Based on the above, it may be foreseen that the figures on the
prevalence of schistosomiasis, namely 252 million infected, are a gross underestimate. Yet, it
is certain that the figures of 800 million persons, namely children, residing in rural areas are
at risk of the infection, and yearly deaths as high as 200,000 are correct [6-9]. Schistosomiasis
is widespread in sub-Saharan Africa, several countries of the Middle East, South America, and
South-East Asia [6-10]. Vaccination against the infection would be the most reliable way to
combat the infection and decrease or interrupt its transmission, but a commercial vaccine is
still an unmet clinical need. Praziquantel is the only drug considered for schistosomiasis
treatment as it is effective against the major human schistosomes, commercially available, costaffordable, and elicits limited side-effects [reviewed in 5, 11, 12].
2. Chemotherapy
2.1. Praziquantel
2.1.1. Structure and schistosomicidal effects in vitro and in experimental animals
Praziquantel (PZQ), C19H24N2O2 (2-cyclohexylcarbonyl-4-oxo-1,2,3,6,7,11b-hexahydro-4Hpyrazino[2,1-a]iso-quinolin-4-one) (Figure 1) is a hydrophobic molecule of molecular weight
147
148
312.4 g/mole, for all this lengthy formula, smaller than the molecular weight of cholesterol
386.6 g/mole), which schistosomes cannot synthesize de novo and rely on absorption from the
host via the tegument [13].
Figure 1. Structure of praziquantel.
Because of its small molecular weight and hydrophobic nature, PZQ may access and interact
with the schistosome outer lipid bilayer, expectedly causing disruption, degeneration, and
disintegration. Adult S. mansoni were exposed in vitro to 1, 10, or 100 g/ml PZQ for 5, 15, 30,
or 60 minutes, and examined by light and electron microscopy. Severe body contraction and
complete cessation of movement were associated with the appearance of numerous small areas
of vacuolization and vesicle formation distributed all over the parasite surface, their number
increasing with PZQ concentration and exposure time and eliciting disruption of the apical
tegumental layer [14, 15].
Mice orally treated with 500 mg/kg PZQ seven weeks following infection with S. mansoni
showed dislodgment of the worms from the veins of the intestine to the portal circulation, and
pronounced vacuolization of the tegument as early as one hour after treatment, indicating that
in vitro and in vivo likewise, PZQ suddenly and abruptly affects the worm physiology. Soon
after, neutrophils and eosinophils attached to the bleb-like vacuoles and succeeded in infil
trating the interior of the worms leading to progressive internal lysis and eventually total
disintegration [15]. Yet, several reports indicated that 21- and 28-day worms are less sensitive
to PZQ action in vivo [16, 17].
Lung-stage schistosomula were recovered one hour after treatment of 6-day S. mansoniinfected mice with 0 or 200 mg/kg PZQ, and examined by indirect membrane immunofluor
escence using chronic infection serum. Larvae recovered from untreated mice were entirely
negative, a finding we repeatedly confirmed decades later [11, 12 and references therein].
Larvae harvested from PZQ-treated hosts revealed exposure of hitherto hidden surface
membrane molecules, likely consequent to interaction of PZQ with the lung-stage schistoso
mula apical lipid bilayer [18]. Proven PZQ-mediated exposure of larval and adult S. mansoni
surface membrane antigens to hitherto barred antibody access suggested that PZQ in vivo
action is due to the synergy between its direct effect on the worm and host-immune effectors,
principally antibody-dependent cell- and complement-mediated cytotoxicity and granulo
cytes cytolytic action [19-22].
http://dx.doi.org/10.5772/61185
Praziquantel was shown to be equally effective against S. haematobium and S. japonicum in vitro
and in vivo, inducing spastic paralysis, tegumental vacuolation and disruption, and surface
membrane exposure to host antibodies and other immune effectors [23-25].
2.1.2. Mechanism of action
The pyrazino-isoquinoline ring system of PZQ represents a completely novel structure in antihelminthic chemotherapy, and additionally, its schistosomicidal mode of action is not
intuitively clear [26]. The most immediate PZQ effect, at least in vitro, is dramatic parasite
contraction and spastic paralysis, followed by outer membrane vacuolation, blebbing, and
disruption. Thus, one hypothesis to explain PZQ mode of action is that the drug inserts itself
in the membrane, destabilizes the double lipid bilayer [27-29], and subsequently interacts with
muscle filaments. Due to its size and hydrophobic nature, PZQ likely intercalates within the
phospholipid molecules of the worm apical lipid leaflets, undergoes hop diffusion in the
plasma membrane, and permeates to access tegumental actin, myosin, and/or tropomyosin
[27-30]. Adult worms' surface spines are crystalline structures consisting of filaments of actin
that interact directly with the apical and basal membranes [31, 32]. Actin is present in the
surface membrane tubercles and in the tegument [33]. More importantly, actin molecules are
known to form a mesh or fence underneath surface plasma membranes [30, 34, 35]. Putative
interaction of PZQ with actin in spines, tubercles, and tegument would affect its polymeriza
tion status, leading to surface membrane disruption. Pre-incubation of parasites in the presence
30 mM magnesium before exposure to PZQ prevented contraction and tegumental disinte
gration in all worms [36]. This finding, coupled with the recent report showing magnesiumdependent modulation of myosin and actin functions, [37] may be construed to indicate that
PZQ directly interacts with the parasite myosin and actin.
We have taken advantage of the Claisen Condensation Reaction to irreversibly bind the
otherwise inert PZQ to cellulose acetate membrane and thus use affinity chromatography to
isolate the parasite surface membrane molecule(s) that most selectively bind to PZQ. Amino
acid microsequencing and immunogenicity studies indicated that PZQ preferably binds to
schistosome actin at the exclusion of other adult worm surface membrane antigens. We have
proposed that PZQ accesses actin of schistosomes and induces its polymerization, with
subsequent parasite contraction and tegument disruption [38, 39]. Cytochalasin B disrupts
actin polymerization by capping the fast-growing end of actin filaments. Pre-treatment of adult
S. mansoni with cytochalasin B did not entirely prevent worm contraction and immobility, yet
rendered the parasites refractory to killing by even exceedingly high PZQ concentrations. The
results may easily be construed to indicate that PZQ-mediated actin polymerization is the
major mechanism of PZQ killing [40]. Ramaswamy and colleagues expressed the cDNA library
of S. mansoni on the surface of T7 bacteriophages and screened the displayed proteins with
labeled PZQ. The results indicated PZQ binds to the N-terminal end of myosin light chain and
to actin, and further revealed that S. mansoni myosin light chain is phosphorylated in vivo
upon binding to PZQ [41].
The second major PZQ effect is abnormal calcium influx in the worm, leading to hypothesizing
that voltage-gated calcium channel(s) on the surface of the worm is the elusive target of PZQ
149
150
action [42-46]. However, Cioli and colleagues failed to detect the correlation between PZQinduced intra-worm calcium influx and parasite death [47]. In support, incubation of S.
mansoni worms in the presence of seven different calcium channel blockers gave insignificant
protection against PZQ lethal action except for nicardipine and nifedipine, which nevertheless
did not prevent the spastic paralysis observed in worms observed in schistosomes exposed to
PZQ, and allowed 50% of the worms to be killed by 3 M PZQ. In contrast, all worm survived
exposure to 36 M PZQ following pre-treatment with the actin depolymerizing agent,
cytochalasin B [40].
2.1.3. Safety and efficacy
Extensive use of PZQ for treatment and control of schistosomiasis requires a comprehensive
understanding of efficacy and safety:
a.
Of various doses for different Schistosoma species. PZQ is active against all schistosome
species that infect humans. A multicenter, randomized, controlled trial of the efficacy and
safety of single-dose PZQ at 40 mg/kg versus 60 mg/kg for treating intestinal schistoso
miasis in the Philippines (S. japonicum), Mauritania, Tanzania, and Brazil (S. mansoni)
enrolled 856 patients, aged 10-19 years and with 100 eggs per gram of feces (epg). A
total of 666 (78%) reported adverse reactions, mostly abdominal pain, at 4 hours after
administration with no highly significant differences between doses. Both doses were
highly effective, as in Day 21 cure rates were 91.7% (86.6%-98% at individual sites) with
40 mg/kg and 92.8% (88%-97%) with 60 mg/kg, suggesting there is no significant efficacy
advantage of the 60 versus standard 40 mg/kg for therapy of intestinal schistosomiasis.
Of note, there were no differences in efficacy outcomes with variations in transmission
and infection intensities across the sites [48]. A meta-analysis of comparative and noncomparative clinical trials on PZQ clinical efficacy and tolerability for intestinal and
urinary schistosomiasis, involved 19,500 patients, largely children, in 24 countries and 82
sites. Again, approximately 60% of the subjects receiving 40 mg/kg PZQ reported adverse
reactions, namely abdominal pain. The WHO-recommended dose of PZQ 40 mg/kg
achieved within 8 weeks cure rates of 94.7% (92.2-98.0) for S. japonicum, 77.1% (68.4-85.1)
for S. haematobium, 76.7% (71.9-81.2) for S. mansoni, and 63.5% (48.2-77.0) for mixed S.
haematobium/S. mansoni infections; the data revealed efficacy in some sites was signifi
cantly lower than expected [49].
b.
For low, moderate, and heavy infections. In a study performed in 2009-2010, PZQmediated cure rates in 588 school-age children of S. mansoni endemic El Rouse village in
Kafr El Sheikh at 4 weeks after a single PZQ dose of 40 mg/kg were 83%, 76%, and 54%
for light (<100 epg), moderate (100-400 epg), and heavy (>400 epg) infection, respectively,
indicating that pre-treatment intensity of infection has a great influence on PZQ efficacy
[50]. Decrease of cure rates with increasing pre-treatment egg counts was also observed
among 611 S. mansoni-infected schoolchildren from three schools in northeast Ethiopia.
Side-effects and symptoms, especially abdominal cramps, vomiting, diarrhea, and
dizziness were reported by 91% of the children and were more pronounced in those with
high pre-treatment egg excretion [51]. Among 253 S. mansoni-infected children in western
http://dx.doi.org/10.5772/61185
Cte d'Ivoire treated with 60 mg/kg PZQ, there was a significant (P<0.01) association
between cure rate and intensity of infection prior to treatment with highest cure rates
observed in light infections [reviewed in 52]. Highest cure rates against S. haematobium
infection among 675 primary schoolchildren in Zimbabwe were observed in those with
light baseline infection; yet, a wide range of observed mild and transient side effects were
not associated with egg intensity [53]. The remarkably low cure rates obtained from people
with heavy S. mansoni or S. haematobium infections led King et al. [54] to advocate the
repeat of PZQ treatment 2-8 weeks after the first dose. We have recently performed a study
involving 260 S. mansoni-infected schoolchildren in Kafr El Sheikh, Egypt. Cure rates 6
weeks after a single dose of 40 mg/kg PZQ were 60%, 42%, and 20% for light, moderate,
and heavy infections, respectively [55], fully supporting the observation that PZQ efficacy
greatly decreases with the increase of baseline infection levels.
c.
In areas of low endemicity/limited PZQ treatment versus areas of high endemicity and
massive, repeated PZQ administration. In our recent study involving 66 school-age
children in low S. mansoni endemicity villages of Menoufiya, Egypt, PZQ cure rates at 4
weeks following treatment with a single dose of 40 mg/kg PZQ, were 87% and 83% for
light and moderate infections, respectively, significantly higher than cure rates achieved
in the high S. mansoni endemicity villages of Kafr El Sheikh [55, 56]. Our findings fully
support the observations of King et al. [54] who reported that for subjects with S. manso
ni or S. haematobium infection, cure rates were higher in communities having lower initial
prevalence. Indeed, in Cameroon regions with low prevalence of schistosomiasis, and in
Senbete Town, northeast of Ethiopia, treatment of schoolchildren with a single dose of 40
mg/kg body weight resulted into cure rates of 80-95%, with the majority of children
reporting drug-related symptoms and malaise as late as 24 hours after treatment [57, 58].
Conversely, a single oral dose at 40 mg/kg body weight induced only approximately 60%
reduction in prevalence and epg in <10-14 year-old schoolchildren In Wondo Genet,
southern Ethiopia, region with school age children prevalence rate of 75%, i.e., high-risk
communities. Approximately 83% of S. mansoni-infected children complained of head
ache, nausea, abdominal pain, bloody stool, vomiting, and fever at 24 hour post-treatment.
These symptoms were associated with age (P<0.001) and pre-treatment intensity of
infection (P<0.05) [59].
A study was performed along the high endemicity shores of Lake Victoria after 12.5 years of
massive and repeated PZQ use involving 178 S. mansoni-infected men. The overall cure rate
after a single PZQ dose was 66% ranging from 36% to 82%. Of note, treatments administered
in 2006 were significantly more likely to result in cure failures than treatments administered
in 2004, the year in which PZQ efficacy was highest [60]. Similar observation was also reported
for S. mansoni-infected schoolchildren in Kafr El Sheikh, Egypt. Thus, in a study performed in
2009-2010, PZQ-mediated cure rates in school-age children of S. mansoni high endemicity El
Rouse village in Kafr El Sheikh were 83%, 76%, and 54% for light, moderate, and heavy
infection, respectively, 4 weeks after a single PZQ dose of 40 mg/kg [50]. These cure rates were
distinctly higher than those obtained in in the same areas at 6 weeks after PZQ therapy,
suggesting reduction in PZQ efficacy 3 years later, following intense and repeated PZQ
administration [55].
151
152
2.1.4. Evidence for worm resistance to PZQ

Twenty years after its introduction, PZQ remains the drug of choice despite treatment failures
and emergence of resistance being reported.
First indications on worm resistance to PZQ appeared in the Senegal River Basin, whereby 117
out of 130 selected subjects (87%) were infected with S. mansoni with overall geometric mean
epg of 478. The overall cure rate 4 weeks after treatment with single standard PZQ dose was
only 42%. However, cure rate after a second round of treatment rose to 76%, suggesting the
low cure rate observed after one treatment was probably the result of a combination of high
infection intensity and the maturation of pre-existing pre-patent S. mansoni infections [61].
Exceedingly low cure rates but similar conclusions were reached by Gryseels et al. [62],
advocating there is no convincing evidence for emergence of PZQ-resistant S. mansoni in
Senegal, and that the exceptionally low cure rates can be attributed to high initial worm loads
and intense transmission in this area. However, low PZQ cures were again reported in children
living in villages in Senegal River Basin with intense S. mansoni and S. haematobium transmis
sion. Additionally, high prevalence and high infection intensity of S. mansoni and S. haema
tobium were still evident despite multiple rounds of chemotherapy, leading to the
recommendation of new treatment regimens to control schistosomiasis in the school-age
population [63].
Evidence for some degree of S. mansoni resistance to PZQ has been obtained using parasites
taken from treated, but uncured human patients in Egypt and Senegal and in a laboratory
isolate of S. mansoni subjected to successive passages under drug pressure, raising the need
for alternative drugs to treat PZQ-resistant schistosomiasis [64-66]. Yet, there was no increase
in drug failure, despite 10 years of therapeutic pressure in some Nile Delta villages where there
had been resistant infections and worms with decreased response to PZQ [67]. In contrast to
this optimistic note, a British traveler returning from East Africa failed to be cured despite
several rounds of standard PZQ doses and no opportunity for re-infection [68]. In addition,
there are several schistosomiasis cases caused by S. haematobium infections in which repeated
standard treatment failed to clear the infection [69]. Isolates of S. mansoni obtained from
patients from Kisumu, Kenya continuously exposed to infection as a consequence of their
occupations as car washers or sand harvesters showed reduced PZQ susceptibility that was
associated with previous PZQ treatment of the patient [70]. Recently, miracidia were hatched
from eggs obtained from seven Kenyan car washers and used to infect snails. Shed cercariae
were used to establish in mice a laboratory S. mansoni strain with significantly reduced PZQ
sensitivity that was achieved within only 5 generations by administering increasing PZQ doses
to the infected mice; the parasites were eventually able to withstand a normally lethal dose [71].
2.1.5. Proposed mechanism(s) for PZQ resistance
Resistance to a drug is defined as "genetically transmitted loss of sensitivity in a parasite
population that was previously sensitive to the drug". Schistosomicidal action of oxamniquine
(OXA) and hycanthone is dependent on activation by sulfotransferase enzymatic esterification
and this ultimately results in the production of an electrophilic moiety capable of alkylating
DNA [72, 73]. Resistance of S. mansoni to OXA was attributed to loss-of-function mutations in
http://dx.doi.org/10.5772/61185
a gene on chromosome 6 that was found to be encoding the enzyme, sulfotransferase [74].
Unlike OXA and hycanthone, there is no evidence PZQ interacts with schistosome DNA,
inducing mutation(s) responsible for the drug inefficacy. It was then proposed that massive
use of the drug would select for parasites harboring "genes" that confer resistance to the drug
[75]. The presence of gene(s) that confer resistance to PZQ is not excluded, especially that a
proportion of adult worms consistently survive treatment, and the drug is ineffective against
immature worms. Yet, PZQ-resistant and susceptible worms did not show differences at 15
microsatellite genotypic markers [76].
Voltage-gated calcium channels that have been implicated in PZQ action did not show
differences in the encoding cDNA sequence or expression levels among PZQ-susceptible and
PZQ-resistant isolates [42-46, 77]. Adenosine triphosphate binding cassette (ABC) multi-drug
transporters, especially the P glycoprotein, which shows selectivity for hydrophobic mole
cules, are predominantly localized in schistosome excretory system. Evidence for association
between schistosome multi-drug transporters and PZQ resistance has been recently presented
[78-81 and references therein].
On the other hand, Botros et al. [82] reported that laboratory-maintained S. mansoni isolates
obtained from Egyptian patients resistant to PZQ cure failed to display PZQ-induced tegu
mental damage, implying changes in tegument characteristics in PZQ-unresponsive worms.
Changes in parasite tegument properties in PZQ-resistant S. mansoni isolates were associated
with decreased stability, reproductive fitness, and immunogenicity [65]. We recently proposed
that the decrease in PZQ efficacy may be explained if repeated and intensive PZQ use selects
for the worms with tighter outer lipid bilayer shield consequent to higher percentage of
cholesterol and sphingomyelin (SM) and/or less active tegument-associated neutral sphingo
myelinase (nSMase) [83]. The result would be worm progeny, able to prevent or decrease access
of even molecules of 312 Da such as PZQ [55]. Schistosomes showing PZQ insusceptibility
were documented to incur serious biological costs [65, 78], a strong support to our assumption.
2.2. Arachidonic acid
2.2.1. Structure, biological sources, and functions
Arachidonic acid (ARA) is a polyunsaturated fatty acid, i.e., the 20 carbon-chain contains more
(#4) than one double bond, the first starting at position 6 from the last = omega carbon (methyl
terminus opposite the COOH end). The formula is C20H32O2, 20:4(-6). All double bonds are
in a cis position (hydrogen atoms are on the same side of the double bonds) and, hence, ARA
is also termed all-cis-5,8,11,14-eicosatetraenoic acid (Figure 2). ARA has an average mass of
304.467 Da and adopts a dominant hairpin conformation [84].
ARA is present throughout the body and comprises the greatest % weight of total fatty acids
among long chain poly-unsaturated fatty acids (LC-PUFAs). It is present as a structural
component in animal and human cell membrane phospholipids, especially phosphatidyle
thanolamine, phosphatidylcholine, and phophatidylinositol. It is particularly abundant in
skeletal muscles, the brain, and liver. ARA nutrition appears to serve various important roles
throughout the human (and mammalian) life-cycle. Throughout pregnancy, ARA, along with
153
154
Figure 2. Structure of arachidonic acid.
other fats and nutrients, originates from the maternal diet and is supplied via the placenta to
support the development of the growing fetus.
Between the third trimester of pregnancy and second year of neonatal life, the human brain
undergoes a remarkable increase in the rate of growth. During this period, mass and volume
increase more than 10-fold, and achieve >40% of the average-sized adult brain. These changes
in size are mirrored by the accumulation of ARA in the brain [85, 86]. A major hallmark of
mammalian birth is the sudden transition, following partuition, from the placenta as the source
of prenatal nutrition, onto mother's milk as the main source from which to acquire nutrients.
On average, ARA comprises 0.470.13% of total fatty acids in human milk [87]. The concen
tration of ARA in human milk varies between individuals and populations due, at least in part,
to the presence of polymorphisms in the genes involved in the endogenous synthesis of LCPUFAs [88].
The amount of LC-PUFA intake by infants has been estimated based upon the assumptions
that the fat content in human milk is 3.8 g/dL, and that average daily intake is 780 mL/day [89].
Using these values, average daily intake of ARA can be estimated to be approximately 140 mg.
In addition, it is possible to compare the estimated average intake levels by infants to those of
post-weaned individuals, due to the availability in the U.S. of annually collected data from
dietary surveys [90].
The results from such a comparison reveal an interesting trend related to the levels of ARA
consumed as individuals advance from pre- to post-weaning stages of human development.
The average amount of dietary intake by toddler and preschool-age children (2-5 years) is
approximately 80 mg. A modest increase in the absolute level of intake of approximately 20%
occurs by school-age (6-11 years). Intake then decreases by adolescence (12-19 years), and once
again approximates the average levels obtained through nursing. These differences in the
amount of ARA consumed in the diet may initially seem to be marginal, until they are
considered on a per weight basis. A change of approximately 20-fold in body mass occurs as
humans develop from infancy to adulthood (i.e., ~3 kg to ~60 kg). Therefore, on a per weight
basis, the amount of preformed ARA consumed daily by mid-adolescence is 5% relative to
the estimated amount per kg of intake for infants.
http://dx.doi.org/10.5772/61185
Although ARA is synthesized endogenously by the desaturation and elongation of linoleic

acid (18:2n-6), results from experimental efforts consistently point to a need for ARA availa
bility through dietary sources in order to elevate ARA in plasma and other tissues. In addition,
associations between experimentally-defined endpoints and changes in the status of ARA
reported in numerous investigations support the notion of a minimum required threshold in
the concentrations of esterified and/or unesterified ARA in tissues or circulating pools [91].
The importance of preformed dietary ARA in supporting healthy immune functions has been
demonstrated by investigations comparing the effects of supplementation using refined,
microbial-derived ARA as triglycerides (TG) or unsupplemented formula and human milk on
immune ability in pre-term and term infants. In an investigation involving infants born before
37 weeks of gestation, infants were provided with a control formula, or that same formula
supplemented with 0.49% (wt/wt) of ARA, in addition to DHA [92-94]. After a period of 4
weeks, immunologic parameters were assessed from both groups and the results compared
to those obtained from human milk-fed infants. The status of ARA in phospholipids was
equivalent in the human milk-fed and LC-PUFA+formula-fed infants, and in both cases,
significantly greater compared to infants fed with the control formula. In addition, effects on
lymphocyte populations, cytokine production, and antibody maturation in formula-fed
infants supplemented with LCPUFAs were consistent with those observed for human milkfed infants.
More recently, healthy full-term, formula-fed infants supplemented with 190 mg/day ARA
for a period of at least 8 weeks, showed fewer incidence of symptoms commonly associated
with infections of the upper respiratory tract, in addition to fewer incidents of diarrhea.
Importantly, the combined results from these investigations provide a clear example of the
utility of preformed LC-PUFA in the diet to support the ability of infants to respond to immune
challenges. In each case, the availability of preformed LC-PUFAs in the diet was associated
with a preferred response to immune challenges, in contrast to results obtained from the use
of formulations that contained adequate (i.e., 16% wt/wt) 18:2n-6 [95].
Animal models have also been used to explore possible roles and functions of LC-PUFAs,
including ARA, in immune-related activities. In piglets fed with formula enriched with supraphysiological levels of ARA resulted in maximal enrichment of intestinal mucosal within 8
days of initiating treatment. In addition, enrichment showed a dose-dependent response of
intestinal mucosal phospholipid ARA concentration to dietary ARA in formula [96].
These results along with data from the human studies indicate that dietary intake of microbialderived ARA supports enrichment of ARA phospholipids in tissues. In addition, intake of
sufficient levels of dietary ARA may support mucosal immunity against pathogenic agents,
during periods of rapid growth and development in humans and other mammals. Overall,
these and other results may not be surprising considering the large number of metabolic
pathways and signaling cascades in which ARA is involved.
Arachidonic acid is essentially incorporated into cell phospholipids; in humans, approximate
ly 10% of phopholipids in liver and plasma contain ARA [97-100]. N-arachidonoyl-phospha
tidylethanol- amine leads via multiple pathways to anandamide, an endogenous cannabinoid
neurotransmitter [101]. Arachidonic acid is liberated from phospholipids by the action of
155
156
phospholipase A2, and then produces eicosanoids, prostaglandins, leukotrienes, and other
essential bioactive products via the action of three types of oxygenases, cyclooxygenase (COX),
lipoxygenase (LOX), and cytochrome P450. There is evidence that exogenous, plasma unes
terified ARA may effectively compete with endogenous ARA for these enzymes, predomi
nantly located on the nuclear and endoplasmic reticulum membrane. Some resultant
eicosanoids are pro-inflammatory and vasoconstrictive, such as prostaglandin E2, thrombox
ane A2, and leukotriene B4, and some are anti-inflammatory and anti-aggregatory such as
prostacyclin and lipoxin A4 [97-100]. Indeed, shortly after inflammation is initiated, neutro
phils that enter the tissue promote the switch of arachidonic acid-derived prostaglandins and
leukotrienes to lipoxins, which induce resolution of the inflammation via termination of
neutrophil recruitment and release of reparatory cytokines, such as transforming growth
factor-beta [102].
2.2.2. Dietary intake in humans
In humans ARA is acquired directly from the diet or is derived by desaturation-elongation of
linoleic acid (10-20 g daily) in the liver and in extra-hepatic tissues. ARA preference for
acylation and transacylation reactions favors its partition in tissue phospholipids rather than
adipose tissue and plasma triglycerides. Absorption of ingested ARA occurs in the endothe
lium of the intestinal lumen of the small intestine. Absorbed ARA is transported to various
tissues and cells throughout the body by lipoproteins and acylated into sn-2 position of
unesterified lysophospholipids, where it may remain until released by the enzymatic activa
tion of phospholipase A2.
There is considerable evidence of the importance of ARA nutrition during early child
hood development. ARA levels in circulation correlate positively with length to weight ratio
and head circumference in neonates [91, 103]. In addition, the rate of ARA accretion by the
brain increases exponentially during the brain growth-spurt, during the last trimester of
pregnancy and into the first year of neonatal growth [85, 86]. Tissue lipid data indicate that
a 70 kg human contains 50-100 g ARA distributed between cell cytosolic and membrane
compartments. It was estimated that on average, Australian diet provides ARA intake of
130 mg/day for males and 96 mg/day for females. Survey data for the intake of dietary
ARA indicates a range of 80 to 190 mg/day. Intake of ARA provided by a typical Japa
nese diet was calculated to be 300 mg/day, respectively [104 and references therein]. To my
knowledge, there is no information on the amounts of ARA diets in poor rural areas provide
to children and pregnant women, but values are expectedly far less than those reported
above. That is of concern as ARA is known to be essential for proper development of the
brain and muscles in the fetus and in infants [91, 93, 105].
2.2.3. Safety/adverse effects
We recently conducted clinical trials on the safety of ARA intake in 20 and 90 Egyptian schoolage children of Menoufiya and Kafr El Sheikh Governorate, respectively. Arachidonic acid oral
capsules, containing 396 mg ARA (ARASCO) per capsule, were provided by DSM (DSM
Nutritional Products, Columbia, MD). Children were given10 mg/kg/day (approximately 400
http://dx.doi.org/10.5772/61185
mg daily) for 15 days over 3 weeks, i.e., 5 days per week. Not a single child reported the slighted
malaise or adverse reaction during, and 6 weeks after, treatment. A panel of analyses indicated
that biochemical profiles were either unchanged or ameliorated following ARA therapy in all
children [55, 56]. These results fully confirm the reports on safety of ARA in athletes supple
mented with 1,000 mg for 50 days [106]. Regarding immunological analyses, intake of
approximately 400 mg ARA/day for 15 days led to significant (P<0.0001) decrease of S.
mansoni-infected Egyptian schoolchildren plasma levels of interleukin (IL)-10 and interferongamma (IFN-), thus rendering the plasma cytokine profile of the treated children nearer to
normal [55, 56]. Our findings are consistent with the observational studies showing that higher
ARA intake was associated with lower levels of inflammatory markers and sequelae [107, 108].
The most serious adverse reaction reported for ARA was causing platelet aggregation in adults
given 6 g ARA/day for 2 to 3 weeks [109]. However, approximately 0.5 g ARA daily intake for
15 days over 3 weeks did not alter platelet counts or blood coagulation parameters in S.
mansoni-infected schoolchildren [55, 56], and healthy adults given 1.7 g ARA daily for 50
consecutive days [106]. In a double-blind, placebo-controlled study, supplementation of
Japanese healthy adults with 838 mg/day ARA for 2 weeks led to no changes in platelet
aggregation [104].
2.2.4. Schistosomicidal effects in vitro and in experimental animals
The first indication on ARA schistosomicidal action was evident as we exposed ex vivo lungstage larvae of S. mansoni and S. haematobium to 0-500 M ARA. Incubation in the presence of
10-20 M ARA for 30 minutes induced exposure of otherwise hidden parasite surface mem
brane antigens to specific antibody binding. Higher ARA concentration or exposure time led
to irreversible death of the larvae and destruction of their surface membrane. The monounsaturated omega-9 fatty acid, oleic acid (the major, 78.6%, fatty acid in olive oil) alone or in
conjunction with linoleic acid (as in corn oil), were able to expose the larval surface mem
brane antigens to antibody binding but did not induce attrition or membrane disruption. The
study suggested that ARA is a schistosomicide for young larvae, with S. haematobium being
more sensitive than S. mansoni [110]. Experiments with inhibitors and activators of neutral
sphingomyelinase (nSMase) further indicated that ARA schistosomicidal effect is due, at least
in part, to its ability to activate the parasite tegument-associated, magnesium-dependent
nSMase [83].
Developing and adult S. mansoni and S. haematobium worms were also susceptible to in vitro
schistosomicidal action whereby 2.5 and 5 mM ARA elicited irreversible killing of ex vivo 4-,
5-, and 6-week-old S. mansoni and 9-, 10-, and 12-week-old S. haematobium worms, within 3-4
hours, depending on the parasite age, even when worms were maintained in up to 50% fetal
calf serum. Juvenile (3-week-old) S. mansoni were more sensitive to ARA as 100% irreversible
attrition was noted 1 hour after exposure to 2.5 and 5 mM concentration of ARA. Of note, ARAmediated worm attrition was prevented by concurrent incubation with nSMase inhibitors such
as CaCl2 or GW4869, providing another evidence for the mechanism of ARA schistosomicidal
action. Scanning and transmission electron microscopy revealed that ARA-mediated adult
worm killing was associated with spine destruction, membrane blebbing, and disorganization
of the apical membrane structure [111]. Expectedly, otherwise sequestered adult worm surface
157
158
membrane antigens were accessible to specific antibody binding as judged by indirect

membrane immunofluorescence. Additionally, addition of serum antibodies and peripheral
blood mononuclear cells from patently infected hosts significantly enhanced ARA-mediated
adult S. mansoni and S. haematobium attrition in vitro, suggesting that immune effectors
strongly enhance ARA-mediated schistosomicidal effect [112].
Schistosomicidal activity of ARA was evident in vivo as a single oral dose of 500 and 1000 mg/
kg pure ARA administered to mice 7 and 35 days after S. mansoni infection, respectively elicited
significant (P<0.01) reduction of approximately 40% in worm burden, documenting the ARA
susceptibility of larval and adult worms. Schistosoma haematobium appeared even more
sensitive as a single oral dose of 1000 mg/kg ARA administered 70 days after infection induced
highly significant (P=0.003) reduction of 57.5% in worm burden evaluated 20 days later. Oral
administration of mice with 300 mg/kg ARA incorporated in infant formula for 15 successive
days led to even more highly significant (P<0.0005) reduction of approximately 60% and 80%
S. mansoni and S. haematobium worm burden, respectively [111]. These results were extended
and entirely confirmed in hamster hosts where a series of 4 experiments for S. mansoni and S.
haematobium indicated that ARA oral administration after patency led to highly significant
(P<0.02-<0.001) reduction in worm burden accompanied with significant (P<0.05) decrease in
worm egg load [112]. No adverse reactions were noted in any treated mouse or hamster.
Additionally, no significant differences were noted among schistosome-infected and ARAtreated hamsters regarding serum total triglycerides and cholesterol levels, fatty acids relative
percentages, erythrocytes and platelet count, and prothrombin and partial thromboplastin
time, all evaluated in blood samples obtained 2 hours after ARA administration [112].
2.2.5. Mechanism of schistosomicidal action
We have previously shown that sphingomyelin (SM) in the schistosome apical lipid bilayer is
the major responsible for the sieving properties of the outer membrane, which readily allows
entry of nutrient molecules of <600 Da such as water, sugars, fatty acids, and cholesterol, while
it prevents access of larger molecules, namely host antibodies (>150,000 Da), via interacting
with surrounding water molecules to form a tight hydrogen barrier [83]. We have been able
to use quasi-elastic neutron scattering to formally demonstrate the existence of the hydrogen
barrier around schistosomes, and shown it is stronger in lung-stage larvae than adult worms
and S. mansoni than S. haematobium. We have also shown that the hydrogen barrier collapses
following nSMase activation and SM hydrolysis [113, 114].
We have predicted, and provided evidence for, the existence of schistosome tegumentassociated magnesium-dependent nSMase as early as 2006 [83]. The existence of the enzyme
was formally demonstrated in 2009 following the analysis of S. mansoni complete genome
[115]. The enzyme nucleotide and amino acid (aa) sequences were later fine-tuned [116]. We
succeeded in cloning and sequencing 836 bp near the 5 end of S. haematobium nSMaseencoding mRNA. The predicted amino acid sequences corresponded to aa18- aa277 in the S.
mansoni counterpart with 96% identities and 98% positives, and contained the conserved
domains characterizing the exonuclease-endonuclease-phosphatase (EEP) superfamily [12,
http://dx.doi.org/10.5772/61185
117]. The complete S. haematobium genome and the complete sequence of the nSMase were
published by Young et al. in 2012 [118].
We have been able to demonstrate the presence of nSMase in the tegument of adult S.
mansoni and S. haematobium using enzymatic, immunologic, and immune-histochemical
assays, and further shown that ARA was particularly potent in stimulating nSMase enzymatic
activity, entirely supporting our previous findings using larvae and adult worms [12, 83,
110-114, 117, and references therein].
2.2.6. Efficacy in school-age children
In Menoufiya villages of low S. mansoni prevalence, efficacy of ARA in treatment of schoolage children with <100 epg was highly comparable to that of PZQ + Placebo (Pbo) with percent
cure of 78% (11/14) and 85% (12/14), respectively, and similar levels of reduction in geometric
mean egg counts (GMEC) in uncured patients. However, the efficacy of ARA in treatment of
schoolchildren with 100-400 epg was significantly (P<0.0001) lower than for PZQ regarding
cure rate (44% and 83%, respectively) and reduction in GMEC in uncured children, suggesting
that ARA is indicated for treatment of light S. mansoni infection in children. In Kafr El Sheikh
villages of high S. mansoni endemicity and where intensive mass PZQ treatment campaigns
were implemented for 10 consecutive years, the efficacy of ARA in the treatment of school
children with light infection (<100 epg) was highly comparable to that of PZQ + Pbo with
percent cure of 50% and 60%, respectively. Efficacy of ARA and PZQ was again comparable
in school-age children with heavy infection (800-1000 epg) leading to 21% and 20% cure rate,
and 64% and 81% reduction in GMEC in uncured children, respectively. The results indicated
that either PZQ or ARA are moderately efficacious for treatment of light S. mansoni infection
in regions of elevated schistosomiasis prevalence, and neither should be used alone for
treatment of children with heavy infections, especially those residing in regions of intense
endemicity [55, 56].
It is important to assess the efficacy of ARA for treatment of S. haematobium. We expect high
cure rates as larval and adult S. haematobium worms are shown in in vitro, and in vivo
experiments in mice and hamsters to be more susceptible to ARA than S. mansoni [12, 83,
110-114-117].
2.3. PZQ and arachidonic acid combination for treatment of human schistosomiasis
2.3.1. Evidence for safety and efficacy in children
Intake of PZQ + ARA was as safe as for PZQ or ARA alone regarding metabolic panels or
immunological parameters of S. mansoni-infected schoolchildren. Regarding efficacy, ARA
and PZQ synergized for a spectacular cure of all lightly- and moderately-infected children
residing in the low endemicity villages of Menoufiya, Egypt. In the high endemicity areas of
Kafr El Sheikh, combining ARA and PZQ resulted into higher cure rates than mono-therapies
for light, moderate, and heavy infection. For light infection, mono-therapy cure rate of 50-60%
was increased to 83% with the ARA + PZQ regimen. For the children with heavy infection,
159
160
PZQ and ARA mono-therapy induced 20% cure rates, while cure rate of 78% was achieved
with the drug combination [55, 56].
Combination of PZQ-oxamniquine (OXA) was assayed in randomized, non-blinded, doseranging trials in treatment of Malawi and Zimbabwe schoolchildren with low, moderate, and
heavy infection. Cure rates were not available for Malawi children, while it reached 89% with
the higher dose (20 and 10 mg/kg for PZQ and OXA, respectively) for children in Zimbabwe.
No direct comparisons were reported for PZQ and OXA mono-therapy, and accordingly,
synergistic effect was not documented [119-121]. Additionally, opposite to PZQ and ARA,
OXA is effective against S. mansoni but not S. haematobium [121].
PZQ and artemether or artesunate in combination resulted in a protection rate of about 80%,
slightly higher than PZQ mono-therapy for treatment of schistosomiasis haematobium and
japonicum in two field trials [122, 123]. In a field trial in high S. mansoni endemicity Senegalese
villages, 1- to 60-year-old (median=18 years) patients with moderate S. mansoni infection were
treated with PZQ, artesunate, or both drugs in combination (35-39 individuals per study arm).
Cure rates were 44% for PZQ, 23% for artesunate, and 69% for the drugs combined. Combi
nation of PZQ and artesunate appeared clearly synergistic, but the efficacy was obviously
lower than for PZQ + ARA [123, 124]. This study revealed that efficacy of artemisinin derivative
alone against S. mansoni is not evident and, furthermore, was not observed in S. haematobium
infections [122]. Most importantly, artemether, and artemisin derivatives are used for malaria
therapy; artemisinin resistance in Plasmodium falciparum is now prevalent across mainland
Southeast Asia, and poses a threat to the control and elimination of malaria [125].
2.3.2. Molecular basis for efficacy
There were no reduction in efficacy of artemether and artesunate in killing PZQ-resistant and
PZQ-susceptible S. japonicum worms in mice treated 7 and 8 or 35 and 36 days post-infection
[126]. Opposite findings were observed regarding ARA, as its efficacy was as low as that of
PZQ in treating schoolchildren with heavy S. mansoni infection, residing in areas where
massive PZQ campaigns were applied for 10 consecutive years [55]. This finding implies that
S. mansoni worms were resistant to mono-therapy with either PZQ or ARA. That has led us to
propose that resistance to PZQ and ARA is attributed to continuous PZQ use, eliciting selection
for worms with tight upper lipid bilayer, consequent to excessive SM synthesis and content or
lower nSMase activity. Progeny of these worms would prevent access of even the 312 Da PZQ
molecules, and would be less susceptible to ARA-mediated nSMase activation. Exposure of
such worms to PZQ would not lead to their demise, yet likely facilitate ARA-mediated nSMase
activation, SM hydrolysis and worm attrition. Exposure of these worms to ARA would lead
to nSMase activation that is not lethal, yet sufficient to now allow entry of PZQ to perform its
schistosomicidal action. Our proposition was supported by the considerable increase in cure
rates in all children treated with PZQ + ARA versus the drugs' mono-therapy. The increase in
cure rates was most highly significant (P<0.0001) for children with heavy infections were cure
rates with either PZQ or ARA alone were 20% and attained 78% with the drugs combined.
We shall test this hypothesis via evaluation of the cholesterol/SM content and nSMase activity
in worms derived from cercariae obtained from communities of low prevalence/low PZQ use
http://dx.doi.org/10.5772/61185
and high endemicity/intense PZQ administration. For documenting hypothesized mechanism

for ARA counteraction of worm resistance to PZQ, larvae and worms that are progeny of
entirely PZQ susceptible and strongly resistant breeds will be incubated with micromolar
concentrations of ARA and then evaluated for responsiveness to PZQ, cholesterol/SM content,
and nSMase activity.
3. Conclusions and recommendations

We may conclude that PZQ or ARA treatment shows considerable efficacy uniquely in the
treatment of light infections in areas of low S. mansoni endemicity and PZQ use. Even then,
efficacy never reaches 100%, except when PZQ and ARA are combined. Chemotherapy with
PZQ alone for patients residing in regions of high S. mansoni endemicity and afflicted with
light, moderate, or heavy infection is not efficacious. Hence, it is recommended to implement
optimal treatment regimens with PZQ in conjunction with ARA.
Acknowledgements
Experiments related to ARA efficacy and safety in mice and hamsters were supported by the
Science and Technology Development Fund, Egypt, grants Nos. 144 and 2073 to R. El Ridi. For
clinical trials in Menoufiya and Kafr El Sheikh, funding was provided by DSM North America,
Columbia, Maryland.
Author details
Hatem Tallima1, Kevin Hadley2 and Rashika El Ridi1*
*Address all correspondence to: rashikaelridi@hotmail.com
1 Zoology Department, Faculty of Science, Cairo University, Cairo, Egypt
2 Human Evidence Department, DSM North America, Columbia, Maryland, USA
References
[1] Barsoum RS, Esmat G, El-Baz T. Human schistosomiasis: Clinical perspective: Re
view. Journal of Advanced Research. 2013;4(5):433-444.
161
162
[2] El Baz T, Esmat G. Hepatic and intestinal schistosomiasis: Review. Journal of Ad

vanced Research. 2013;4(5):445-452.
[3] Barsoum RS. Urinary schistosomiasis: Review. Journal of Advanced Research.
2013;4(5):453-459.
[4] Bhardwaj R, Skelly PJ. Purinergic signaling and immune modulation at the schisto
some surface? Trends in Parasitology. 2009;25(6):256-260.
[5] Othman A, El Ridi R. Schistosomiasis. In: Bruschi F. (ed.) Helminth Infections and
Their Impact on Global Public Health. The Netherlands:Springer; 2014. p49-92.
[6] Chitsulo L, Loverde P, Engels D. Schistosomiasis. Nature Reviews Microbiology.
2004;2(1):12-13.
[7] WHO Technical Report Series 912: Prevention and control of schistosomiasis and
soil-transmitted helminthiasis. Who Geneva, 2002 http://whqlibdoc.who.int/trs/
WHO_TRS_912.pdf.
[8] King CH. Parasites and poverty: The case of schistosomiasis. Acta Tropica.
2010;113(2):95-104.
[9] Hotez PJ, Alvarado M, Basez MG, Bolliger I, Bourne R, Boussinesq M, et al. The
global burden of disease study 2010: Interpretation and implications for the neglect
ed tropical diseases. PLoS Neglected Tropical Diseases. 2014;8(7):e2865.
[10] World Schistosomiasis Risk Chart. 2012 Edition. International Association for Medi
cal Assistance to Travellers. www.IAMAT.Org.
[11] El Ridi RAF, Tallima HA-M. Novel therapeutic and prevention approaches for schis
tosomiasis: Review. Journal of Advanced Research. 2013;4(5):467-478.
[12] El Ridi R, Tallima H. Solving the riddle of the lung-stage schistosomula paved the
way to a novel remedy and an efficacious vaccine for schistosomiasis. In: El Ridi R.
(ed.) Parasitic Diseases - Schistosomiasis. Croatia: Intech Open; 2013. p179-202.
www.intechopen.com/books/parasitic-diseases-schistosomiasis.
[13] Meyer F, Meyer H, Bueding E. Lipid metabolism in the parasitic and free-living flat
worms, Schistosoma mansoni and Dugesia dorotocephala. Biochimica Biophysica Acta.
1970;210(2):257-266.
[14] Becker B, Mehlhorn H, Andrews P, Thomas H, Eckert J. Light and electron micro
scopic studies on the effect of praziquantel on Schistosoma mansoni, Dicrocoelium den
driticum, and Fasciola hepatica (Trematoda) in vitro. Zeitschrift fur Pflanzenernahrung
und Bodenkunde. 1980;63(2):113-128.
[15] Mehlhorn H, Becker B, Andrews P, Thomas H, Frenkel JK. In vivo and in vitro ex
periments on the effects of praziquantel on Schistosoma mansoni. A light and electron
microscopic study. Arzneimittel-Forschung. 1981;31(3a):544-554.
http://dx.doi.org/10.5772/61185
[16] Sabah AA, Fletcher C, Webbe G, Doenhoff MJ. Schistosoma mansoni: Chemotherapy of
infections of different ages. Experimental Parasitology. 1986;61(3):294-303.
[17] Shaw MK. Schistosoma mansoni: Stage-dependent damage after in vivo treatment with
praziquantel. Parasitology. 1990;100(Pt 1):65-72.
[18] Flisser A, McLaren DJ. Effect of praziquantel treatment on lung-stage larvae of Schis
tosoma mansoni in vivo. Parasitology. 1989;98(Pt 2):203-211.
[19] Brindley PJ, Sher A. The chemotherapeutic effect of praziquantel against Schistosoma
mansoni is dependent on host antibody response. Journal of Immunology.
1987;139(1):215-220.
[20] Brindley PJ, Sher A. Immunological involvement in the efficacy of praziquantel. Ex
perimental Parasitolology. 1990;71(2):245-248.
[21] Doenhoff MJ, Modha J, Lambertucci JR, McLaren DJ. The immune dependence of
chemotherapy. Parasitology Today. 1991;7(1):16-18.
[22] Fallon PG, Cooper RO, Probert AJ, Doenhoff MJ. Fallon PG, Fookes RE, Wharton GA.
Temporal differences in praziquantel- and oxamniquine-induced tegumental dam
age to adult Schistosoma mansoni: implications for drug-antibody synergy. Parasitolo
gy. 1996;112(Pt 1):47-58.
[23] Webbe G, James C. A comparison of the susceptibility to praziquantel of Schistosoma
haematobium, S. japonicum, S. mansoni, S. intercalatum and S. mattheei in hamsters.
Zeitschrift fur Pflanzenernahrung und Bodenkunde. 1977;52(2):169-177.
[24] James C, Webbe G, Nelson GS. The susceptibility to praziquantel of Schistosoma hae
matobium in the baboon (Papio anubis) and of S. japonicum in the vervet monkey (Cer
copithecus aethiops). Zeitschrift fur Pflanzenernahrung und Bodenkunde. 1977;52(2):
179-194.
[25] Andrews P. A summary of the efficacy of praziquantel against schistosomes in ani
mal experiments and notes on its mode of action. Arzneimittel-Forschung.
1981;31(3a):538-541.
[26] Khler P. The biochemical basis of anthelmintic action and resistance. International
Journal for Parasitology. 2001;31(4): 336-345. Review.
[27] Harder A, Goossens J, Andrews P. Influence of praziquantel and Ca2+ on the bilayerisotropic-hexagonal transition of model membranes. Molecular and Biochemical Par
asitology. 1988;29(1):55-59.
[28] Schepers H, Brasseur R, Goormaghtigh E, Duquenoy P, Ruysschaert JM. Mode of in
sertion of praziquantel and derivatives into lipid membranes. Biochemical Pharma
colology. 1988;37(8):1615-16 23.
163
164
[29] Lima SF, Vieira LQ, Harder A, Kusel JR. Altered behaviour of carbohydrate-bound
molecules and lipids in areas of the tegument of adult Schistosoma mansoni worms
damaged by praziquantel. Parasitology. 1994;100(Pt 4):469-477.
[30] Kusumi A, Nakada C, Ritchie K, Murase K, Suzuki K, Murakoshi H, Kasai RS, Kon
do J, Fujiwara T. Paradigm shift of the plasma membrane concept from the two-di
mensional continuum fluid to the partitioned fluid: high-speed single-molecule
tracking of membrane molecules. Annual Review of Biophysics and Biomolecular
Structure. 2005;34:351-378. Review.
[31] Cohen C, Reinhardt B, Castellani L, Norton P, Stirewalt M. Schistosome surface
spines are "crystals" of actin. The journal of Cell biology. 1982;95(3):987-988.
[32] Zhou Y, Podesta RB. Surface spines of human blood flukes (Schistosoma mansoni) con
tain bundles of actin filaments having identical polarity. European Journal of Cell Bi
ology. 1989Feb;48(1):150-153.
[33] Abbas MK, Cain GD. Actin and intermediate-sized filaments of the spines and cytos
keleton of Schistosoma mansoni. Parasitological Research. 1987;73(1):66-74.
[34] Viola A, Gupta N. Tether and trap: regulation of membrane-raft dynamics by actinbinding proteins. Nature Reviews Immunology. 2007;7(11):889-896. Review.
[35] Morone N. Freeze-etch electron tomography for the plasma membrane interface.
Methods in Molecular Biology. 2010;657:275-86.
[36] Bricker CS, Depenbusch JW, Bennett JL, Thompson DP. The relationship between
tegumental disruption and muscle contraction in Schistosoma mansoni exposed to var
ious compounds. Zeitschrift fur Pflanzenernahrung und Bodenkunde. 1983;69(1):
61-71.
[37] Trivedi DV, Muretta JM, Swenson AM, Thomas DD, Yengo CM. Magnesium impacts
myosin V motor activity by altering key conformational changes in the mechano
chemical cycle. Biochemistry. 2013;52(27):4710-4722.
[38] Tallima H, El Ridi R. Praziquantel binds Schistosoma mansoni adult worm actin. Inter
national Journal of Antimicrobial Agents. 2007;29(5):570-575.
[39] Tallima H, El Ridi R. Re: Is actin the praziquantel receptor? International Journal of
Antimicrobial Agents. 2007;30(6):566-567.
[40] Pica-Mattoccia L, Valle C, Basso A, Troiani AR, Vigorosi F, Liberti P, Festucci A, Cioli
D. Cytochalasin D abolishes the schistosomicidal activity of praziquantel. Experi
mental Parasitology. 2007;115(4):344-351.
[41] Gnanasekar M, Salunkhe AM, Mallia AK, He YX, Kalyanasundaram R. Praziquantel
affects the regulatory myosin light chain of Schistosoma mansoni. Antimicrobial
Agents and Chemotherapy 2009;53(3):1054-1060.
[42] Kohn AB, Anderson PA, Roberts-Misterly JM, Greenberg RM. Schistosome calcium
channel beta subunits. Unusual modulatory effects and potential role in the action of
http://dx.doi.org/10.5772/61185
the antischistosomal drug

2001;276(40):36873-36876.
praziquantel.
Journal
of
Biological
Chemistry.
[43] Kohn AB, Lea J, Roberts-Misterly JM, Anderson PA, Greenberg RM. Structure of
three high voltage-activated calcium channel alpha1 subunits from Schistosoma man
soni. Parasitology. 2001;123(Pt 5):489-497.
[44] Kohn AB, Roberts-Misterly JM, Anderson PA, Khan N, Greenberg RM. Specific sites
in the Beta Interaction Domain of a schistosome Ca2+ channel beta subunit are key to
its role in sensitivity to the anti-schistosomal drug praziquantel. Parasitology.
2003;127(Pt 4):349-356.
[45] Kohn AB, Roberts-Misterly JM, Anderson PA, Greenberg RM. Creation by mutagen
esis of a mammalian Ca(2+) channel beta subunit that confers praziquantel sensitivi
ty to a mammalian Ca(2+) channel. International Journal for Parasitology.
2003;33(12):1303-1308.
[46] Salvador-Recatal V, Greenberg RM. Calcium channels of schistosomes: unresolved
questions and unexpected answers. Wiley Interdisciplinary Review of Membrane
Transport and Signaling. 2012;1(1):85-93.
[47] Pica-Mattoccia L, Orsini T, Basso A, Festucci A, Liberti P, Guidi A, Marcatto-Maggi
AL, Nobre-Santana S, Troiani AR, Cioli D, Valle C. Schistosoma mansoni: lack of corre
lation between praziquantel-induced intra-worm calcium influx and parasite death.
Experimental Parasitology. 2008;119(3):332-335.
[48] Olliaro PL, Vaillant MT, Belizario VJ, Lwambo NJ, Ouldabdallahi M, Pieri OS, Ama
rillo ML, Kaatano GM, Diaw M, Domingues AC, Favre TC, Lapujade O, Alves F,
Chitsulo L. A multicentre randomized controlled trial of the efficacy and safety of
single-dose praziquantel at 40 mg/kg vs. 60 mg/kg for treating intestinal schistoso
miasis in the Philippines, Mauritania, Tanzania and Brazil. PLoS Neglected Tropical
Diseases. 2011;5(6):e1165.
[49] Zwang J, Olliaro PL. Clinical efficacy and tolerability of praziquantel for intestinal
and urinary schistosomiasis-a meta-analysis of comparative and non-comparative
clinical trials. PLoS Neglected Tropical Diseases. 2014;8(11):e3286.
[50] Barakat R, El Morshedy H. Efficacy of two praziquantel treatments among primary
school children in an area of high Schistosoma mansoni endemicity, Nile Delta, Egypt.
Parasitology. 2011;138(4):440-446.
[51] Berhe N, Gundersen SG, Abebe F, Birrie H, Medhin G, Gemetchu T. Praziquantel
side effects and efficacy related to Schistosoma mansoni egg loads and morbidity in
primary school children in north-east Ethiopia. Acta Tropica. 1999;72(1):53-63.
[52] Utzinger J, N'Goran EK, N'Dri A, Lengeler C, Tanner M. Efficacy of praziquantel
against Schistosoma mansoni with particular consideration for intensity of infection.
Tropical Medicine and International Health. 2000;5(11):771-778.
165
166
[53] Midzi N, Sangweme D, Zinyowera S, Mapingure MP, Brouwer KC, Kumar N, Muta
pi F, Woelk G, Mduluza T. Efficacy and side effects of praziquantel treatment against
Schistosoma haematobium infection among primary school children in Zimbabwe.
Transactions of the Royal Society of Tropical Medicine and Hygiene. 2008;102(8):
759-766.
[54] King CH, Olbrych SK, Soon M, Singer ME, Carter J, Colley DG. Utility of repeated
praziquantel dosing in the treatment of schistosomiasis in high-risk communities in
Africa: A systematic review. PLoS Neglected Tropical Diseases. 2011;5(9):e1321.
[55] Barakat R, Abou El-Ela N, Sharaf S, El Sagheer O, Selim S, Tallima H, Bruins MJ,
Hadley KB, El Ridi R. Efficacy and safety of arachidonic acid for treatment of schoolage children in Schistosoma mansoni high endemicity regions. American Journal of
Tropical Medicine and Hygiene. 2015;92(4):797-894.
[56] Selim S, El Sagheer O, El Amir A, Barakat R, Hadley K, Bruins MJ, El Ridi R. Efficacy
and safety of arachidonic acid for treatment of Schistosoma mansoni-infected children
in Menoufiya, Egypt. American Journal of Tropical Medicine and Hygiene.
2014;91(5):973-981.
[57] Tchuem Tchuent LA, Momo SC, Stothard JR, Rollinson D. Efficacy of praziquantel
and reinfection patterns in single and mixed infection foci for intestinal and urogeni
tal schistosomiasis in Cameroon. Acta Tropica. 2013;128(2):275-283.
[58] Reta B, Erko B. Efficacy and side effects of praziquantel in the treatment for Schistoso
ma mansoni infection in school children in Senbete Town, northeastern Ethiopia.
Tropical Medicine and International Health. 2013;18(11):1338-1343.
[59] Erko B, Degarege A, Tadesse K, Mathiwos A, Legesse M, 2012. Efficacy and side ef
fects of praziquantel in the treatment of Schistosomiasis mansoni in schoolchildren in
Shesha Kekele Elementary School, Wondo Genet, Southern Ethiopia. Asian Pacific
Journal of Tropical Biomedicine. 2012;2(3):235-239.
[60] Black CL, Steinauer ML, Mwinzi PN, Evan Secor W, Karanja DM, Colley DG. Impact
of intense, longitudinal retreatment with praziquantel on cure rates of schistosomia
sis mansoni in a cohort of occupationally exposed adults in western Kenya. Tropical
Medicine and International Health. 2009;14:450-457.
[61] Picquet M, Vercruysse J, Shaw DJ, Diop M, Ly A. Efficacy of praziquantel against
Schistosoma mansoni in northern Senegal. Transactions of the Royal Society of Tropi
cal Medicine and Hygiene. 1998;92(1):90-93.
[62] Gryseels B, Mbaye A, De Vlas SJ, Stelma FF, Guiss F, Van Lieshout L, Faye D, Diop
M, Ly A, Tchuem-Tchuent LA, Engels D, Polman K. Are poor responses to prazi
quantel for the treatment of Schistosoma mansoni infections in Senegal due to resist
ance? An overview of the evidence. Tropical Medicine and International Health.
2001;6(11):864-873.
http://dx.doi.org/10.5772/61185
[63] Webster BL, Diaw OT, Seye MM, Faye DS, Stothard JR, Sousa-Figueiredo JC, Rollin
son D, 2013. Praziquantel treatment of school children from single and mixed infec
tion foci of intestinal and urogenital schistosomiasis along the Senegal River Basin:
monitoring treatment success and re-infection patterns. Acta Tropica. 2013;128(2):
292-302.
[64] Ismail M, Botros S, Metwally A, William S, Farghally A, Tao LF, Day TA, Bennett JL.
Resistance to praziquantel: Direct evidence from Schistosoma mansoni isolated from
Egyptian villagers. American Journal of Tropical Medicine and Hygiene. 1999;60(6):
932-935.
[65] [65]William S, Sabra A, Ramzy F, Mousa M, Demerdash Z, Bennett JL, Day TA, Bo
tros S. Stability and reproductive fitness of Schistosoma mansoni isolates with de
creased sensitivity to praziquantel. International Journal for Parasitology.
2001;31(10):1093-1100.
[66] Doenhoff MJ, Kusel JR, Coles GC, Cioli D. Resistance of Schistosoma mansoni to prazi
quantel: Is there a problem? Transactions of the Royal Society of Tropical Medicine
and Hygiene. 2002;96(5):465-469.
[67] Botros S, Sayed H, Amer N, El-Ghannam M, Bennett JL, Day TA. Current status of
sensitivity to praziquantel in a focus of potential drug resistance in Egypt. Interna
tional Journal for Parasitolology. 2005;35(7):787-791.
[68] Lawn SD1, Lucas SB, Chiodini PL. Case report: Schistosoma mansoni infection: failure
of standard treatment with praziquantel in a returned traveller. Transactions of the
Royal Society of Tropical Medicine and Hygiene. 2003;97(1):100-101.
[69] Wang W, Wang L, Liang YS. Susceptibility or resistance of praziquantel in human
schistosomiasis: A review. Parasitological Research. 2012;111(5):1871-1877.
[70] Melman SD, Steinauer ML, Cunningham C, Kubatko LS, Mwangi IN, Wynn NB, Mu
tuku MW, Karanja DM, Colley DG, Black CL, Secor WE, Mkoji GM, Loker ES. Re
duced susceptibility to praziquantel among naturally occurring Kenyan isolates of
Schistosoma mansoni. PLoS Neglected Tropical Diseases. 2009;3(8):e504.
[71] Mwangi IN, Sanchez MC, Mkoji GM, Agola LE, Runo SM, Cupit PM, Cunningham
C. Praziquantel sensitivity of Kenyan Schistosoma mansoni isolates and the generation
of a laboratory strain with reduced susceptibility to the drug. International Journal
for Parasitology: Drugs and Drug Resistance. 2014;4(3):296-300.
[72] Cioli D, Pica-Mattoccia L, Archer S. Drug resistance in schistosomes. Parasitology To
day. 1993;9(5):162-166.
[73] Pica-Mattoccia L, Dias LC, Moroni R, Cioli D. Schistosoma mansoni: Genetic comple
mentation analysis shows that two independent hycanthone/oxamniquine-resistant
strains are mutated in the same gene. Experimental Parasitology. 1993;77(4):445-449.
[74] Valentim CL, Cioli D, Chevalier FD, Cao X, Taylor AB, Holloway SP, Pica-Mattoccia
L, Guidi A, Basso A, Tsai IJ, Berriman M, Carvalho-Queiroz C, Almeida M, Aguilar
167
168
H, Frantz DE, Hart PJ, LoVerde PT, Anderson TJ. Genetic and molecular basis of
drug resistance and species-specific drug action in schistosome parasites. Science.
2013;342(6164):1385-1389.
[75] Fallon PG, Tao LF, Ismail MM, Bennett JL. Schistosome resistance to praziquantel:
Fact or artifact? Parasitology Today. 1996;12(8):316-320.
[76] Blanton RE1, Blank WA, Costa JM, Carmo TM, Reis EA, Silva LK, Barbosa LM, Test
MR, Reis MG. Schistosoma mansoni population structure and persistence after prazi
quantel treatment in two villages of Bahia, Brazil. International Journal for Parasitol
ogy. 2011;41(10):1093-1099.
[77] Valle C, Troiani AR, Festucci A, Pica-Mattoccia L, Liberti P, Wolstenholme A, Franck
low K, Doenhoff MJ, Cioli D. Sequence and level of endogenous expression of calci
um channel beta subunits in Schistosoma mansoni displaying different susceptibilities
to praziquantel. Molecular and Biochemical Parasitology. 2003 31;130(2):111-115.
[78] [78]Greenberg RM. New approaches for understanding mechanisms of drug resist
ance in schistosomes. Parasitology. 2013;140(12):1534-1546.
[79] Kasinathan RS, Sharma LK, Cunningham C, Webb TR, Greenberg RM. Inhibition or
knockdown of ABC transporters enhances susceptibility of adult and juvenile schis
tosomes to Praziquantel. PLoS Neglected Tropical Diseases. 2014;8(10):e3265
[80] Greenberg RM. Schistosome ABC multidrug transporters: From pharmacology to
physiology. International Journal for Parasitology: Drugs and Drug Resistance.
2014;4(3):301-309.
[81] Greenberg RM. Ion channels and drug transporters as targets for anthelmintics. Cur
rent Clinical Microbiology Reports. 2014;1(3-4):51-60.
[82] William S, Botros S, Ismail M, Farghally A, Day TA, Bennett JL. Praziquantel-in
duced tegumental damage in vitro is diminished in schistosomes derived from prazi
quantel-resistant infections. Parasitology. 2001;122(Pt 1):63-66.
[83] El Ridi R, Tallima H. Equilibrium in lung schistosomula sphingomyelin breakdown
and biosynthesis allows very small molecules, but not antibody, to access proteins at
the host-parasite interface. Journal of Parasitology. 2006;92(4):730-737.
[84] Rich MR. Conformational analysis of arachidonic and related fatty acids using mo
lecular dynamics simulations. Biochimica Biophysica Acta. 1993;1178(1):87-96.
[85] Martinez M. (1992). Tissue levels of polyunsaturated fatty acids during early human
development. The Journal of Pediatrics. 1992;120(4):S129-S138.
[86] Carlson SE, Werkman SH, Peeples JM, Wilson WM 3rd. Growth and development of
premature infants in relation to omega 3 and omega 6 fatty acid status. World Re
view of Nutrition and Dietetics 1994;75:63-69.
http://dx.doi.org/10.5772/61185
[87] Brenna JT, Varamini B, Jensen RG, Diersen-Schade DA, Boettcher JA, Arterburn LM.
Docosahexaenoic and arachidonic acid concentrations in human breast milk world
wide. The American Journal of Clinical Nutrition. 2007;85(6):1457-1464.
[88] Scholtz SA, Kerling EH, Shaddy DJ, Li S, Thodosoff JM, Colombo J, Carlson SE
(2014). Docosahexaenoic acid (DHA) supplementation in pregnancy differentially
modulates arachidonic acid and DHA status across FADS genotypes in pregnancy.
Prostaglandins, Leukotrienes and Essential Fatty Acids (PLEFA). 2014; pii:
S0952-3278(14)00186-0. doi: 10.1016/j.plefa.2014.10.008, in press.
[89] Innis SM. Fatty acids and early human development. Early human development.
2007;83(12):761-766.
[90] U.S. Department of Agriculture, Agricultural Research Service, Beltsville Human
Nutrition Research Center, Food Surveys Research Group (Beltsville, MD) and U.S.
Department of Health and Human Services, Centers for Disease Control and Preven
tion, National Center for Health Statistics (Hyattsville, MD). What We Eat in America,
NHANES 2009-2010 Data: Dietary Interview - Total Nutrients Intakes -- First Day
(DR1TOT_C). (2009, September). Available from: http://www.ars.usda.gov/SP2User
Files/Place/80400530/pdf/0910/Table_1_NIN_GEN_09.pdf [accessed 1/22/15].
[91] Carlson SE, Werkman SH, Peeples JM, Cooke R J, Tolley EA. Arachidonic acid status
correlates with first year growth in preterm infants. Proceedings of the National
Academy of Sciences USA. 1993;90(3):1073-1077.
[92] Field CJ, Thomson CA, Van Aerde JE, Parrott A, Lien E, Clandinin MT. Lower pro
portion of CD45R0+ cells and deficient interleukin-10 production by formula-fed in
fants, compared with human-fed, is corrected with supplementation of long-chain
polyunsaturated fatty acids. Journal of Pediatric Gastroenterology and Nutrition.
2000;31(3):291-299.
[93] Birch EE, Garfield S, Hoffman DR, Uauy R, Birch DG. A randomized controlled trial
of early dietary supply of longchain polyunsaturated fatty acids and mental devel
opment in term infants. Developmental Medicine and Child Neurology. 2000;42(3):
174-181.
[94] Lapillonne A, Pastor N, Zhuang W, Scalabrin DM. Infants fed formula with added
long chain polyunsaturated fatty acids have reduced incidence of respiratory illness
es and diarrhea during the first year of life. BMC Pediatrics. 2014:14(1):168.
[95] Field CJ, Van Aerde JE, Robinson LE, Thomas Clandinin M. Effect of providing a for
mula supplemented with long-chain polyunsaturated fatty acids on immunity in
full-term neonates. British Journal of Nutrition. 2008;99(1):91-99.
[96] Hess HA, Corl BA, Lin X, Jacobi SK, Harrell RJ, Blikslager AT, Odle J. Enrichment of
intestinal mucosal phospholipids with arachidonic and eicosapentaenoic acids fed to
suckling piglets is dose and time dependent. The Journal of Nutrition. 2008;138(11):
2164-2171.
169
170
[97] Thomas JM, Hullin F, Chap H, Douste-Blazy L. Phosphatidylcholine is the major

phospholipid providing arachidonic acid for prostacyclin synthesis in thrombinstimulated human endothelial cells. Thrombosis Research. 1984;34(2):117-123.
[98] Zhou L, Vessby B, Nilsson A. Quantitative role of plasma free fatty acids in the sup
ply of arachidonic acid to extrahepatic tissues in rats. Journal of Nutrition.
2002;132(9):2626-2631.
[99] Brash AR. Arachidonic acid as a bioactive molecule. The Journal of Clinical Investi
gation. 2001;107(11):1339-1345.
[100] Zhou L, Nilsson A. Sources of eicosanoid precursor fatty acid pools in tissues. Jour
nal of Lipid Research. 2001;42(10):1521-42. Review.
[101] Wang J, Ueda N. Biology of endocannabinoid synthesis system. Prostaglandins and
Other Lipid Mediators. 2009;89(3-4):112-129.
[102] Serhan CN, Savill J. Resolution of inflammation: The beginning programs the end.
Nature Immunology. 2005;6(12):1191-1197.
[103] Leaf AA, Leighfield MJ, Costeloe KL, Crawford MA. Long chain polyunsaturated fat
ty acids and fetal growth. Early Human Development. 1992;30(3):183-191.
[104] Kusumoto A, Ishikura Y, Kawashima H, Kiso Y, Takai S, Miyazaki M. Effects of
arachidonate-enriched triacylglycerol supplementation on serum fatty acids and pla
telet aggregation in healthy male subjects with a fish diet. British Journal of Nutri
tion. 2007;98(3):626-635.
[105] Kohn G, Sawatzki G, van Biervliet JP, Rosseneu M. Diet and the essential fatty acid
status of term infants. Acta Paediatrica Supplement. 1994;402:69-74.
[106] Roberts MD, Iosia M, Kerksick CM, Taylor LW, Campbell B, Wilborn CD, Harvey T,
Cooke M, Rasmussen C, Greenwood M, Wilson R, Jitomir J, Willoughby D, Kreider
RB. Effects of arachidonic acid supplementation on training adaptations in resist
ance-trained males. Journal of the International Society of Sports Nutrition. 2007;4:21.
[107] Ferrucci L, Cherubini A, Bandinelli S, Bartali B, Corsi A, Lauretani F, Martin A, An
dres-Lacueva C, Senin U, Guralnik JM. Relationship of plasma polyunsaturated fatty
acids to circulating inflammatory markers. The Journal of Clinical Endocrinology
and Metabolism. 2006Feb;91(2):439-446.
[108] Harris WS, Mozaffarian D, Rimm E, Kris-Etherton P, Rudel LL, Appel LJ, Engler
MM, Engler MB, Sacks F. Omega-6 fatty acids and risk for cardiovascular disease: a
science advisory from the American Heart Association Nutrition Subcommittee of
the Council on Nutrition, Physical Activity, and Metabolism; Council on Cardiovas
cular Nursing; and Council on Epidemiology and Prevention. Circulation.
2009;119(6):902-907.
[109] Seyberth HW, Oelz O, Kennedy T, Sweetman BJ, Danon A, Frlich JC, Heimberg M,
Oates JA. Increased arachidonate in lipids after administration to man: effects on
http://dx.doi.org/10.5772/61185
prostaglandin biosynthesis. Clinical Pharmacology and Therapeutics. 1975;18(5 Pt 1):

521-529.
[110] Tallima H, Salah M, El-Ridi R. In vitro and in vivo effects of unsaturated fatty acids
on Schistosoma mansoni and S. haematobium lung-stage larvae. Journal of Parasitology.
2005;91(5):1094-1102.
[111] El Ridi R, Aboueldahab M, Tallima H, Salah M, Mahana N, Fawzi S, Mohamed SH,
Fahmy OM. In vitro and in vivo activities of arachidonic acid against Schistosoma
mansoni and Schistosoma haematobium. Antimicrobial Agents and Chemotherapy.
2010;54(8):3383-3389.
[112] El Ridi R, Tallima H, Salah M, Aboueldahab M, Fahmy OM, Al-Halbosiy MF, Mah
moud SS. Efficacy and mechanism of action of arachidonic acid in the treatment of
hamsters infected with Schistosoma mansoni or Schistosoma haematobium. International
Journal of Antimicrobial Agents. 2012;39(3):232-239.
[113] Migliardo F, Tallima H, El Ridi R. Is there a sphingomyelin-based hydrogen bond
barrier at the mammalian host-schistosome parasite interface? Cell Biochemistry and
Biophysics. 2014;68(2):359-367.
[114] Migliardo F, Tallima H, El Ridi R. Rigidity and resistance of larval- and adult schisto
somes-medium interface. Biochemical and Biophysical Research Communications.
2014;446(1):255-260.
[115] Berriman M, Haas BJ, LoVerde PT, Wilson RA, Dillon GP, Cerqueira GC, Mashiyama
ST, Al-Lazikani B, Andrade LF, Ashton PD, Aslett MA, Bartholomeu DC, Blandin G,
Caffrey CR, Coghlan A, Coulson R, Day TA, Delcher A, DeMarco R, Djikeng A, Eyre
T, Gamble JA, Ghedin E, Gu Y, Hertz-Fowler C, Hirai H, Hirai Y, Houston R, Ivens
A, Johnston DA, Lacerda D, Macedo CD, McVeigh P, Ning Z, Oliveira G, Overington
JP, Parkhill J, Pertea M, Pierce RJ, Protasio AV, Quail MA, Rajandream MA, Rogers J,
Sajid M, Salzberg SL, Stanke M, Tivey AR, White O, Williams DL, Wortman J, Wu W,
Zamanian M, Zerlotini A, Fraser-Liggett CM, Barrell BG, El-Sayed NM. The genome
of the blood fluke Schistosoma mansoni. Nature. 2009;460(7253):352-358.
[116] Protasio AV, Tsai IJ, Babbage A, Nichol S, Hunt M, Aslett MA, De Silva N, Velarde
GS, Anderson TJ, Clark RC, Davidson C, Dillon GP, Holroyd NE, LoVerde PT, Lloyd
C, McQuillan J, Oliveira G, Otto TD, Parker-Manuel SJ, Quail MA, Wilson RA, Zerlo
tini A, Dunne DW, Berriman M. A systematically improved high quality genome and
transcriptome of the human blood fluke Schistosoma mansoni. PLoS Neglected Tropi
cal Diseases. 2012;6(1):e1455.
[117] Tallima H, Al-Halbosiy MF, El Ridi R. Enzymatic activity and immunolocalization of
Schistosoma mansoni and Schistosoma haematobium neutral sphingomyelinase. Molecu
lar and Biochemical Parasitology. 2011;178(1-2):23-28.
[118] Young ND, Jex AR, Li B, Liu S, Yang L, Xiong Z, Li Y, Cantacessi C, Hall RS, Xu X,
Chen F, Wu X, Zerlotini A, Oliveira G, Hofmann A, Zhang G, Fang X, Kang Y,
171
172
Campbell BE, Loukas A, Ranganathan S, Rollinson D, Rinaldi G, Brindley PJ, Yang

H, Wang J, Wang J, Gasser RB. Whole-genome sequence of Schistosoma haematobium.
Nature Genetics. 2012;44(2):221-225.
[119] Pugh RN, Teesdale CH. Synergy of concurrent low dose oxamniquine and prazi
quantel in schistosomiasis. British Medical Journal (Clinical Research Ed).
1983;287(6396): 877-878.
[120] Creasey AM, Taylor P, Thomas JE. Dosage trial of a combination of oxamniquine and
praziquantel in the treatment of schistosomiasis in Zimbabwean schoolchildren. Cen
tral African Journal of Medicine. 1986;32(7):165-167.
[121] Utzinger J, Keiser J, Shuhua X, Tanner M, Singer BH. Combination chemotherapy of
schistosomiasis in laboratory studies and clinical trials. Antimicrobial Agents and
Chemotherapy. 2003;47(5):1487-1495.
[122] Borrmann S, Szlezk N, Faucher JF, Matsiegui PB, Neubauer R, Binder RK, Lell B,
Kremsner PG. Artesunate and praziquantel for the treatment of Schistosoma haema
tobium infections: A double-blind, randomized, placebo-controlled study. Journal of
Infectious Diseases. 2001;184(10):1363-1366.
[123] Liu R, Dong HF, Guo Y, Zhao QP, Jiang MS. Efficacy of praziquantel and artemisinin
derivatives for the treatment and prevention of human schistosomiasis: A systematic
review and meta-analysis. Parasites and Vectors. 2011;4:201.
[124] De Clercq D, Vercruysse J, Verl P, Kongs A, Diop M. What is the effect of combining
artesunate and praziquantel in the treatment of Schistosoma mansoni infections? Trop
ical Medicine and International Health. 2000;5(10):744-746.
[125] Ashley EA, Dhorda M, Fairhurst RM, Amaratunga C, Lim P, Suon S, et al. Spread of
artemisinin resistance in Plasmodium falciparum malaria. New England Journal of
Medicine. 2014;371(5):411-423.
[126] Wang W, Li TY, Ji Y, Qu GL, Qian YL, Li HJ, Dai JR, Liang YS. Efficacy of artemether
and artesunate in mice infected with praziquantel non-susceptible isolate of Schisto
soma japonicum. Parasitology Research. 2014;113(3):925-931.
Chapter 9
The Role of Chiggers as Human Pathogens

Paula Santibez, Ana M. Palomar, Arnzazu Portillo, Sonia Santibez and
Jos A. Oteo
http://dx.doi.org/10.5772/61978
Abstract
Trombiculid mites (Acari: Trombiculidae) are distributed worldwide ectoparasites of a
wide range of vertebrates. More than 50 species are known to bite humans, and about 20
have medical importance. The larval stages (chiggers) of the genus Leptotrombidium are
vectors of Orientia tsutsugamushi, causative agent of scrub typhus. This life-threatening
disease is widely endemic in Asian Pacific regions where more than one billion people
are at risk of acquiring the infection and around one million new cases are estimated to
occur annually. In addition, although underreported and often misdiagnosed, trombicu
liasis, defined as a dermatitis caused by the salivary secretion of biting chiggers, is
present in America and Europe.
Keywords: Chiggers, Orientia tsutsugamushi, dermatitis, vectors
1. Introduction
This chapter includes a thorough description of the main characteristics, life cycle, and
distribution of chiggers. Moreover, a comprehensive review of the responsibility of chiggers
as infectious disease vectors and agents of troublesome dermatitis is given. The following
pages cover, for the first time in a unique chapter, the current knowledge of chigger mites.
1.1. Taxonomy and distribution
Trombiculid mites (Acari: Trombiculidae) are widespread ectoparasites of a wide range of
vertebrates. More than 50 species have been recorded attacking humans, and about 20 of them
are considered to be medically important because they cause dermatitis or due to their role as
vectors of human pathogens. The most relevant species are Eutrombicula alfreddugesi in North
and South America, Neotrombicula autumnalis in Europe, and Leptotrombidium spp. in Asia [1].
174
Trombiculidae is one of the largest families in the Acari group, including more than 3,000
species [2]. Table 1 shows the taxonomic position of these mites.
Phylum
Arthropoda
Subphylum
Chelicerata
Class
Arachnida
Subclass
Acari
Superorder
Acariformes
Order
Trombidiformes
Suborder
Prostigmata
Superfamily
Trombiculoidea
Family
Trombiculidae
Table 1. Taxonomic classification of the family Trombiculidae.
Trombiculids are distributed worldwide, but they show their greatest diversity in the sub
tropical, tropical and southern temperate zones [3]. Table 2 shows the main trombiculid species
and their geographical distribution.
Species
Distribution
Disease
Blankaartia acuscutellaris
Hungary, Spain, Moldova, Ukraine,
Trombiculiasis
Russia, Sumatra, Malaysia, and Africa

Eushoengastia koreaensis
Korea
Scrub typhusa
Euschoengastia xerothermobia
Europe
Trombiculiasis
Eutrombicula alfreddugesi
Canada, South of United States
Trombiculiasis
(except for the southwest), South and

Central America (including West
Indies)
Eutrombicula batatas
Bolivia, Mexico, Central and South
Trombiculiasis
America, southwestern and

southeastern United States
Eutrombicula lipovskyi
United States: from Alabama and
Trombiculiasis
Tennessee West to Arkansas,

Oklahoma and Kansas
Eutrombicula sarcina
Southeast Asia, Australia and the
Trombiculiasis
Pacific Islands
Eutrombicula splendens
Eastern United States (from the Gulf

Coast North to Massachusetts,
Minnesota) and Ontario
Trombiculiasis

http://dx.doi.org/10.5772/61978
Species
Distribution
Disease
Eutrombicula wichmanni
Japan, Southeast Asia, Australia, and Trombiculiasis

Pacific Islands
Kepkatrombicula desaleri
Italia, Austria, and Bulgaria
Trombiculiasis
Leptotrombidium akamushi
Japan, China, Southeast Asia,
Scrub typhus
Indonesia, Philippines, and New

Guinea
Leptotrombidium arenicola
Malaysia, Indonesia, and Thailand
Scrub typhus
Leptotrombidium chiangraiensis
Thailand
Scrub typhus
Leptotrombidium deliense
China, Taiwan, Sri Lanka, Nepal,
Scrub typhus
Bangladesh, India, Myanmar,

Vietnam, Cambodia, Thailand,
Singapore, Brunei, Malaysia,
Indonesia, Philippines, New Guinea,
southwestern Pacific Islands, northern
Australia, Pakistan, Kazakhstan,
Uzbekistan, and Afghanistan
Leptotrombidium fletcheri
Southeast Asia, Malaysia, New
Scrub typhus
Guinea, Philippines, Indonesia, and

Melanesia
Leptotrombidium fuji
Japan
Scrub typhusa
Leptotrombidium gaohuensis
China
Scrub typhus
Leptotrombidium imphalum
Thailand
Scrub typhus
Leptotrombidium intermedium
Japan
Scrub typhusa
Leptotrombidium kitasatoi
Japan
Scrub typhusa
Leptotrombidium orientale
Japan, Korea, and Primorye region of Scrub typhusa

Russia
Leptotrombidium pallidum
Japan, Korea, and Primorye region of Scrub typhus

Russia
Leptotrombidium palpale
Japan, Korea, and Primorye region of Scrub typhusa

Russia
Leptotrombidium pavlovsky
Siberia and Primorye region of Russia Scrub typhus
Leptotrombidium scutellare
Japan, northern China, Korea,
Scrub typhus
Thailand, and Malaysia
Hantavirusa
Leptotrombidium subquadratum
South Africa
Trombiculiasis
Neotrombicula autumnalis
Europe (including British Isles,
Trombiculiasis
excluding Norway, Sweden, Finland,

and northern Russia), Turkey, and
Turkmenistan
175
176
Species
Distribution
Disease
Neotrombicula inopinata
Spain, Czech Republic, England,
Trombiculiasis
Austria, Germany, Bulgaria, France,

states of former Yugoslavia, Ukraine,
Russia, Romania, Hungary, Slovakia,
and Poland
Neotrombicula japonica
Korea, Europe
Scrub typhusa
Trombiculiasis
Neotrombicula nagayoi
Japan, China, and Russia
Trombiculiasis
Neotrombicula zachvatkini
Europe
Trombiculiasis
Odontacarus spp.
Southeast Asia, Australia, and the
Trombiculiasis
Pacific Islands
Shoengastia hanmyaensis
Japan
Scrub typhusa
Schoengastia spp.
Southeast Asia, Australia, and the
Trombiculiasis
Pacific Islands
Trombicula toldti
Austria
Trombiculiasis
Not confirmed.
Table 2. Distribution and diseases transmitted by the main trombiculid mite species [1,415].
Members of this family are known by several names depending on their distribution (Table
3). They are often confused with other mites or insects and are mistakenly named as Mowers
mites [common name of Leptus autumnalis (Acari: Erythraeidae)] [16,17] or jigger, chigoe, and
niguas [common names of Tunga penetrans (Insecta: Siphonaptera)] [18,19].
Common names
Places
Harvest bug, harvest mite, harvest lice, red bug, red mite, berry mite,
North-America, Asia
scrub-itch mite
Harvest mite
Europe
Aoutats, rouget, bte rouge
France
Orange tawny
Ireland
Augustelingen
Germany
Bicho colorado, coloradilla, caro rojo
South America
Isango
Peru
Tlazahuate
Mexico
Coloradita, chivacoa
Venezuela
Table 3. Common names given to trombiculid mites worldwide. [2,4,10,16,17,2022]

http://dx.doi.org/10.5772/61978
1.2. Life cycle

Trombiculid mites undergo seven stages in their life cycle: egg, deutovum, larva, protonymph,
deutonymph, tritonymph, and adult (Figure 1). This cycle is characterized by alternating active
and inactive instars, being the larva, deutonymph, and adult the active ones. Active postlarval
stages are soil dwellers that prey on various arthropods and their eggs. Deutonymphs look
almost identical to adult mites. Both present eight legs, but deutonymphs are slightly smaller.
Sexual dimorphism is not apparently evident [23]. Larvae parasitize all groups of vertebrates,
except fishes, whereas the small mammals and birds are the main hosts [1,5,19,24]. There are
just a few reports of chiggers feeding on invertebrates [3]. Humans are only accidental hosts.
However, the question of the host specificity of trombiculids still arises. Most likely, trombi
culids are associated with specific habitats and attack and feed on the first available animal
within their favorite habitat, although they can have preference for a particular host among
the available ones [23,25].
Figure 1. Schematic description of the trombiculids life cycle. (Adapted from Takahashi et al., 2003 with the permis
sion of the author.)
During their life cycle, eggs are laid in well-drained soil, and six-legged larvae emerge from
them. The general term chigger refers to the parasitic larval stage, and this is the name
commonly given to trombiculid mites due to the importance of this instar. Chiggers are usually
reddish but can vary between yellow and orange [1,26]. These tiny larvae (about 200 m) climb
onto low vegetation, where they aggregate into clusters to wait for a suitable host. On the host,
chiggers mainly move to areas where the skin is especially thin and feed on lymph and tissue
177
178
fluids of the dermal layer (but not blood). Ears, head, armpits, abdomen, genitalia, and the
area around the tail are preferred in animals [4,27]. In humans, bites occur mainly in body
exposed areas and at sites where the clothing constricts [17,28]. Once engorged (development
to subsequent stage cannot take place unless larvae have fed on the host), larvae fall to the
ground and develop to the nymphal stages and subsequently to adults (9001,200 m).
Trombiculid mites live in moist soil covered with vegetation such as grassy and weedy
areas. In general, optimal living conditions require a relative air humidity of 80% (what
explains that chiggers are not typically found on vegetation higher than 30 cm off the
ground) and neutral to slightly alkaline soil. The optimum activity of chiggers occurs at
temperatures of 2530C [26,29].
Trombiculid mites often form localized mite islands (or mite focus, larvae focus) in
suitable areas inhabited by potential hosts [30]. Therefore, chiggers have a patchy distribution
on the vegetation. Mite islands are quite clearly defined, and larvae could not be detected in
their immediate vicinity [26,31]. A possible explanation for this focalization may be that
chiggers apparently do not move more than a few meters from where they hatched. Chiggers
would temporarily disperse if a host approached. On the contrary, if physical contact were not
managed or if the host were not close enough for them to drop on it, chiggers would invariably
and promptly return to the cluster and would continue waiting [32].
The life cycle of trombiculid mites has been mainly studied in the laboratory. The most
outstanding feature of the life cycle is the constant duration of quiescent periods and the
variable duration of active stages. Trombiculid mites usually have one generation per year,
but with overlapping generations, each well synchronized with the seasons because they can
overwinter in most stages (egg, larva, deutonynph, and adult) and because the adult mites
have a long life span [33]. In boreal species, an egg-to-egg cycle ranges from 150 to 400 days,
but it is shorter in tropical species [23]. In nature, the life cycle is supposed to be completed in
212 months or longer, depending on the species and environmental conditions. In temperate
areas, there may be 1 to 3 generations per year, whereas in tropical regions the life cycle is
shorter and continuous throughout the year [1]. In Europe, the duration has been estimated
in five to seven months under favorable conditions [26].
As mentioned above, trombiculid mites only act as parasites during their larval stage. Thus,
the greatest attention has been paid to chiggers. In addition, adults and deutonymphs of the
majority of trombiculid species have never been observed on the soil surface (in fact, their
habitats are mostly unknown). Therefore, the taxonomy of trombiculid mites is based solely
on their larvae [34]. It is estimated that only the postlarval stage of less than 10% of the total
of Trombiculidae species are known [7]. This is the case of some tropical species in contrast to
the difficulty of finding active postlarval instars in northern countries [23].
1.3. Feeding process
It is well known that when feeding on hosts, chiggers develop a characteristic feeding tube
(stylostome) in the hosts skin. The stylostome is mostly formed of the larval salivary secretions
solidifying in the hosts epidermis [7]. Larva cuts the stratum corneum with its rather short

http://dx.doi.org/10.5772/61978
chelicerae and stylostome allows chigger to reach the underlying connective tissue layer from
which it obtains nutrients. The hosts tissues around the stylostome are destroyed and
necrotized. Beneath the distal end of the stylostome, an interstitial food cavity containing
lymphoid and epithelioid cellular liquid elements is formed [23]. The feeding period in animal
host, both in nature and reared in the laboratory, usually lasts 36 days [26,35]. However,
feeding on humans may typically vary from 3 - 8 h to 12 days for most non-infectious chiggers,
but 210 days for scrub typhus vectors [1,29,36,37]. It is supposed that more than 6 h are
required for the transmission of the bacterium [14]. During this period, the larva remains on
the skin surface. For this reason, most trombiculid larvae can be classified as ectoparasites.
Larvae of some genera, however, can partly or even entirely embed within the skin of different
body cavities frequently forming various types of capsules during feeding on amphibians and
mammals [23]. In such cases, the feeding time is prolonged up to several weeks or even months.
In lizards, specific adaptive structures of skin, known as mite pockets, may evolve to
decrease the possible damage from mite feeding [38]. It is generally thought that the organi
zation and location of stylostome is species specific in trombiculid larvae, irrespectively of the
host species and of the particular feeding site on the host, whereas the length of the stylostome
is mostly a result of the width of the epidermal layer and the presence or absence of scabs at
the attachment site [39].
2. Chiggers as vectors of infectious diseases

Although different microorganisms have been detected in different species of chiggers, their
role as vectors of infectious diseases has been only demonstrated for scrub typhus.
2.1. Scrub typhus
Scrub typhus or tsutsugamushi disease [from Japanese words meaning disease (tsutsuga) mite
(mushi) is a life-threatening arthropod-borne bacterial infection that presents as an acute
undifferentiated febrile illness widely endemic in Asian Pacific regions. The disease is
transmitted to humans by chiggers of Leptotrombidium spp. and is caused by the bacterium
Orientia tsutsugamushi. Noteworthy are the reported cases that suggest other Orientia species
as etiological agents of scrub typhus-like disease.
The disease was widely reported in soldiers during World War II [40] and now is an
important illness for travelers to the endemic regions [41]. More than half (55%) of the
world population lives in areas where scrub typhus is endemic, so over one billion people
are at risk of acquiring the infection [42]. Approximately one million new cases have been
estimated to occur annually [43]. However, this is surely an underestimation because
recognition of the disease is difficult due to its overlapping clinical spectrum with other
common causes of fever in this population, the lack of awareness among affected people,
and the limitations of current diagnostic methods [44].
179
180
2.1.1. Etiology and epidemiology

The etiological agent of scrub typhus, O. tsutsugamushi (previously known as Rickettsia
orientalis or Rickettsia tsutsugamushi), is an -proteobacteria that was reclassified as a new genus
separate from Rickettsia based on phenotypic and genotypic differences [45]. Orientia differs
from Rickettsia in the structure of the cell wall, antigenic profile, and genome size, which is
almost twice the size of the Rickettsia genome.
There are three prototype strains: Gilliam, Karp, and Kato; however, more than 20 antigenically
distinct serotypes are present in endemic areas [46], and currently over 70 strains of O.
tsutsugamushi are known [47]. As chigger mites are habitat specific, O. tsutsugamushi strains
could have evolved mostly in separate biotopes, resulting in different serotypes depending on
their location [48]. The general course and the prognosis of the disease is determined by the
strain of O. tsutsugamushi implicated [49], although multiple factors such as the patients age,
genetic factors, and previous immunity are also involved [50]. It is very likely that chiggers,
as it is assumed for ticks [51], have potential immunomodulatory effects in their saliva that
could affect the pathogenesis, immunity, and outcome of the disease [47].
Chiggers act as reservoir and vector of O. tsutsugamushi, being wild rodents the main hosts.
Infected mites maintain the infection through the trombiculids life cycle by transstadial and
transovarial transmission [52]. Reverse transfer from infected animals to chiggers occurs
infrequently, and the bacteria transmitted in this manner are not usually passed on to the next
generation [53]. Chiggers cofeeding on rodents seems to be more relevant for effective mouseto-mite transmission of Orientia than feeding on rickettsemic hosts [54]. Nevertheless, the
disease can only be transmitted to humans by chiggers already transovarially infected by O.
tsutsugamushi [49].
Endemic regions are characterized by rice fields, scrubland, and the presence of primary
deforestation [55,56]. Chiggers harboring the bacterium bite exposed individuals in vulnerable
niches such as forests and infested undergrowth during occupational or recreational activities.
Leptotrombidium chiggers feed on lymph and tissue fluids of the dermal layer for a period of
24 days [57]. Following the bite, the pathogen multiplies at the site of inoculation and
subsequently induces local (eschar) and systemic manifestations of infection [58].
Several studies suggest the evidence of human infection with more than one strain of O.
tsutsugamushi [59]. It could be explained by bites from different chiggers, each one infected
with one strain or, alternatively, by the bite of individual chiggers infected with multiple
strains [60].
Seasonal occurrence of scrub typhus is determined by the time of appearance of chiggers
because humans are infected through bites of the larva. In temperate zones, scrub typhus
season is observed mainly in the autumn but also in the spring [61]. More than 45 species of
trombiculid mites are known to be infected with O. tsutsugamushi in nature, but only Lepto
trombidium pallidum, Leptotrombidium akamushi, Leptotrombidium scutellare, Leptotrombidium
deliense, Leptotrombidium arenicola, Leptotrombidium imphalum, Leptotrombidium chiangraiensis,
Leptotrombidium fletcheri, Leptotrombidium gaohuensis, and Leptotrombidium pavlovsky are proven
to transmit scrub typhus [1,13,14]. Principal vector species differ according to endemic areas

http://dx.doi.org/10.5772/61978
(Table 2): L. akamushi, L. pallidum, and L. scutellare mediate scrub typhus in temperate zones,
such as Japan and Korea, whereas L. deliense and L. arenicola are the principal vectors in tropical
and subtropical regions or Southeast Asia and the Southwest Pacific [49] (Figure 2).
Figure 2. Leptotrombidium intermedium (left) and Leptotrombidium pallidum (right). Provided by Dr. Shatrov.
Scrub typhus is confined to a 13,000,000-km2 definite geographic region, the tsutsugamushi

triangle, where it is widely distributed (Figure 3). It extends from northern Japan, Korea, and
far-eastern Russia in the North, to northern Australia in the South and to Pakistan and
Afghanistan in the West, as well as the islands of the western Pacific and Indian Oceans,
including Taiwan, Philippines, New Guinea, Indonesia, and Sri Lanka [62].
Figure 3. Tsutsugamushi triangle.
181
182
Several reports of scrub cases typhus-like infections have been described in unusual areas,
indicating that a wider geographic distribution should be taken into account [47]. Thus, the
recent isolation of Orientia chuto in a febrile patient who acquired the infection in the United
Arab Emirates, the detection of another divergent Orientia sp. in a patient in Chile, and the
serologic diagnoses of scrub typhus acquired in Africa reveal that the geographical range
accepted until now may be an underrepresentation [63,64]. To date, the genetic diversity of
the genus Orientia is being reviewed because until recently O. tsutsugamushi has been consid
ered the sole species of the genus. Apart from Leptotrombidium spp., other trombiculid mites
such as Neotrombicula japonica and Eushoengastia koreaensis have also been implicated as
possible vectors of this disease [15,65].
The disease is considered rural, and the risk of infection is closely related to occupation. In
areas where scrub typhus is prevalent, most cases are acquired through agricultural exposure.
Most travel acquired cases of scrub typhus are associated with outdoor activities such as
camping, rafting, or trekking in endemic areas [50]. Outbreaks related to military operations
have been reported [66]. The impact of scrub typhus in pregnancy is less explored. Acute scrub
typhus can be transmitted vertically but congenital malformation due to infection per se has
not been demonstrated [67].
2.1.2. Clinical features and pathogenesis
Scrub typhus ranges in severity from mild and self-limiting to fatal depending on the duration
of the illness, the strain of O. tsutsugamushi, the immune status, and other factors of the patients
[14]. After an incubation period of 1012 days (can vary between 5 and 20 days), the onset of
the disease is characterized by an eschar and regional lymphadenopathy followed subse
quently by fever, general malaise, headache, and myalgia. The disease is characterized by focal
or disseminated vasculitis and perivasculitis, which may involve the lungs, heart, liver, spleen,
and central nervous system [68]. Progression of scrub typhus is accompanied by generalized
lymphadenopathy, rash, cough, and interstitial pneumonia, acute respiratory distress syn
drome, gastrointestinal symptoms, meningoencephalomyelitis, myocarditis, acute renal
failure, hypotensive shock, and disseminated intravascular coagulation may occur in severe
cases [14,47,69].
The fever appears abruptly frequently accompanied by headache, myalgia, and malaise, with
peaks on the 3rd4th day of the disease and persists for more than 3 weeks in untreated cases.
About a week after the onset of the symptoms, the eschar, which is not always present, is
developed. It represents localized cutaneous necrosis at the site of mite feeding and is a typical
scrub typhus marker, which is considered almost diagnostic [67]. It starts as a small papule
that enlarges and subsequently undergoes central necrosis, and it eventually acquires a
blackened crust with an erythematous halo that resembles a cigarette burn (Figure 4).
The common sites for finding an eschar are trunk, arms, and legs, but it also appears on the
scalp, axilla, genitalia, waist, and other exposed parts of the body [14,49]. The prevalence of
eschars in patients diagnosed by scrub typhus ranges from 7% to 97% [67,70]. These differences
may be may be due to the difficulty in detecting small eschars in dark-skinned individuals and
atypical appearance of eschars in areas of damp and moist skin. Multiple eschars have been

http://dx.doi.org/10.5772/61978
Figure 4. Eschar and erythema on the fifth day of illness in the left arm of a patient of a 36-year-old patient (photo
provided by Dr. Takahashi).
reported in 0.6% to 2.2% of patients with confirmed scrub typhus [70]. Uncommonly, a
maculopapular rash with centrifugal distribution may appear a week after the onset of these
symptoms, starting on the chest, abdomen, or whole trunk and spreading to the limbs. Rash
lasts a few days to a week [13,71]. Regional lymphadenopathy, characterized by tenderness
and enlargement of the draining lymph node around the primary eschar, arises at the end of
the first week after the disease onset [13]. Generalized lymphadenopathy appears 23 days
later in some cases [72].
From the second week onwards, a proportion of patients (especially those untreated) will
evidence of severe systemic infection. The extended vasculitis helps to explain the great
diversity of clinical manifestations that have been described [49]. Respiratory symptoms,
including interstitial pneumonia, acute respiratory distress, and pulmonary edema, are
frequent. In fact, about 40% of scrub typhus patients complain of cough at the time of admis
sion. Gastrointestinal symptoms comprise nausea, vomiting, abdominal pain, diarrhea, or
gastrointestinal bleeding. Alterations in liver function and pancreatitis are also common. The
central nervous system (CNS) is frequently affected. Indeed, O. tsutsugamushi is detected in
the cerebrospinal fluid of 24% of the patients with no clinical signs of CNS involvement.
Transient hearing loss, eye manifestations, confusion, neck stiffness, delirium, and mental
changes occur frequently. Patients usually suffered from acute diffuse encephalomyelitis,
encephalopathy, meningitis, or meningoencephalitis. Regarding the cardiovascular system,
myocarditis, vasculitis, pericarditis, and rhythm abnormalities are often seen, but congestive
heart failure is rare. Acute renal failure develops frequently in severe cases but may also occur
in mild cases [13,14,61,62,67,69]. The case fatality rate in untreated patients is estimated in
appropriately 10%, ranging from 0% to 30% [67].
At the beginning of the infection, O. tsutsugamushi mainly infects dendritic cells in the eschar
[58]. The systemic dissemination of O. tsutsugamushi is suggested to be lymphogenous to the
regional lymph nodes, followed by spread to target organs via the blood. This pathway was
suggested based on the early development of lymphadenopathy in the regional drainage of
the eschar as well as on animal experiments and clinical observations [14,47]. Once O. tsutsu
183
184
gamushi infection progresses, the main target cells are vascular endothelial cells and macro
phages of the reticuloendothelial system, although cardiac myocytes can also been infected
[14]. The endothelial cells seem to have a central role in the systemic inflammation because in
vitro-infected human dermal microvascular endothelial cells are activated to express interleu
kin (IL)-8 and monocyte chemoattractant protein just after the infection. Moreover, soluble
endothelial cell-specific adhesion molecules (sE-selectin) are highly concentrated in serum at
the early stage of the disease.
The basic histopathologic findings reveal multiplication of O. tsutsugamushi in the endothelial
cells lining the small blood vessels, perivasculitis and focal interstitial mononuclear cell
infiltrations, and edema. Perivasculitis may involve the lung, heart, brain, kidneys, gastroin
testinal tract, liver, spleen, and lymph node [73].
2.1.3. Diagnosis and treatment
Due to the severity of Orientia infection, treatment has to be started as soon as possible, even
before having a conclusive microbiological diagnosis.
As in other infectious diseases, the gold standard of the diagnosis of scrub typhus is the
isolation of the etiological agent by culture. Isolation of O. tsutsugamushi can be done in cell
culture or in inoculated mice. Yolk sacs of 5- to 7-day-olds have been widely used in the past,
but it was replaced by cell culture systems [74]. Currently, culture in HeLa, Vero, BHK, L929,
ECV304, and HMEC-1 cell lines is the reference method for isolating O. tsutsugamushi from
clinical samples [45,49,75,76]. These techniques are restricted to biosafety level 3 facilities and
personnel with extensive experience. A positive result is given in an average time of 28 days,
being inappropriate for the routine diagnosis of the disease. The shell-vial culture technique
makes the detection of the microorganism possible in 4872 h, allowing an early diagnosis
before seroconversion [74,77]. O. tsutsugamushi can also be isolated by inoculating patient
blood into mice, but results are not available in time to guide clinical management [78]. Mouse
inoculation remains helpful when isolation of the organism from postmortem tissues is
required [74].
The mainstay in scrub typhus diagnostics remains serology [79,80]. Nevertheless, despite their
widespread use, all currently available serologic tests have limitations. The WeilFelix OX-K
agglutination reaction was the earliest serological tests used for clinical diagnosis of scrub
typhus. It is inexpensive, easy to perform, and results are available overnight; however, it lacks
specificity and sensitivity [46]. To date, the gold standard assay for the serologic detection of
scrub typhus antibodies is the indirect immunofluorescence assay (IFA) [79]. Most frequently,
IFA uses antigen from serotypes Karp, Kato, and Gilliam [46]. IFA is sensitive, and results are
available in a couple of hours. Although it is accepted that a 4-fold increase in antibody titer
between two consecutive samples (acute and convalescent-phase) is diagnostic, this is a
retrospective diagnosis and cannot guide initial treatment [79]. Anyway, IFA is expensive and
requires a level of technical expertise and equipment that may not be available in rural areas.
Indirect immunoperoxidase is an alternative that eliminates the expense of a fluorescent
microscope by substituting peroxidase for fluorescein [80].

http://dx.doi.org/10.5772/61978
The development of PCR amplification-based approaches have been incorporated to the

diagnoses of infectious diseases even in nonreference laboratories. PCR has potential benefits
in detecting Orientia-DNA before antibody response occurs. However, the high resource costs
and training required for this technique make them impractical in many areas where scrub
typhus is endemic. Moreover, the most appropriate specimen to use remains unclear. The PCR
of eschar material yields more sensitive results than blood and remains positive even after the
initiation of treatment. However, eschar-based PCR would diagnose a small amount of the
cases in a scenario with a prevalence of eschars as few as 7%. Buffy coat could improve
sensitivity compared with whole blood, but the use of blood-based assays is limited to the time
window of rickettsemia [81,82]. Moreover, low copy numbers is an important handicap of
DNA-based approaches. The optimal PCR target for diagnosing scrub typhus stays also
uncertain. A target gene enabling specific but sensitive detection as well as sufficiently broad
coverage of genotypes of O. tsutsugamushi is needed. A nested-PCR assay targeting the 56-kDa
gene is highly specific, but sequence variability of this gene may affect primer annealing and,
therefore, test sensitivity [83]. 16S rDNA-based Orientia-specific PCR may show a broader
detection spectrum than an assay based on a more variable species-specific target, such as the
56-kDa gene [47]. Real-time PCR assays targeting the 47-kDa outer membrane protein and the
groEL genes of O. tsutsugamushi are also very sensitive tools for the diagnosis of scrub typhus
[78,84]. Recently, loop-mediated isothermal PCR assay (LAMP) targeting the groEL gene has
shown diagnostic accuracy similar to real-time and nested conventional PCR assays [84]. This
assay is simple and less expensive and can be considered a valid molecular method for the
early diagnosis of scrub typhus.
The diagnosis and subsequently the antibiotic treatment are often missed or made late due to
the lack of effective commercially available diagnostic tests and the lack of specificity of the
early clinical presentation. It is important to remark that treatment must begin whenever scrub
typhus is clinically suspected, without waiting for microbiological confirmation. It is well
known that delayed treatment leads to complications such as adult respiratory distress
syndrome, disseminated intravascular coagulation, acute renal failure, meningitis, menin
goencephalitis, and gastrointestinal tract bleeding [57]. Bacterial proliferation and the time of
antibiotic treatment are very important predictors of lethality.
The clinical discrimination of scrub typhus from other undifferentiated fevers is often very
difficult because the clinical symptoms are similar. In patients presenting an eschar and/or
rash, and generalized or regional lymphadenopathy in a endemic area, scrub typhus should
be considered in the differential diagnosis along with rickettsialpox, Mediterranean spotted
fever, dengue, leptospirosis, and murine typhus [55,71].
Mortality in the pre-antibiotic era was variable and in some series approached 60%, but specific
and effective antimicrobial chemotherapy is now available [80]. Doxycycline and chloram
phenicol are both effective oral or intravenous agents against scrub typhus, dissipating fever
in 24 h in most patients [71]. Although the disease can be treated effectively with these
antibiotics, reinfection and relapse frequently occur due to the wide variety of antigenically
distinct serotypes [85]. Azithromycin and rifampicin are alternative drugs [61].
185
186
Currently, effective chemoprophylaxis or vaccination approaches for dealing with O. tsutsu

gamushi infection are still not available [42]. A prophylactic vaccine to scrub typhus is a public
health priority because of its high incidence, high mortality, nonspecific clinical presentation,
lack of sensitive diagnostic tests, and emergence of antibiotic resistance. The development of
an effective and safe vaccine has to be strongly focused on T cell-mediated immunity, empirical
testing of the immunogenicity of proteins encoded by conserved genes, and assessment of
protection in relevant animal models that truly mimic human scrub typhus resistance [57].
Therefore, prevention of scrub typhus is based mainly on avoiding the chigger bites and the
use of repellents during travel in rural areas of endemic countries [61]. Wearing protective
clothing and self-examination after visiting arthropod-vector infested areas are also recom
mended [86].
2.2. Other chigger-borne infectious diseases
Nowadays, O. tsutsugamushi remains as the unique agent whose transmission by chigger bites
has been confirmed. Nevertheless, trombiculid mites inhabit areas where the presence of
several arthropod-borne microorganisms, their vectors, and reservoirs has been demonstrated.
Thus, the vector competence of chiggers has long been investigated worldwide.
There are a lot of references in the old scientific literature that associate chiggers with the
transmission of several pathogens, being N. autumnalis the most reported species. However,
the majority of them correspond to secondary anecdotal information and present poor or no
details [87]. In the 2000s, Anaplasma phagocytophilum-DNA was detected in unfed N. autumna
lis chiggers collected on vegetation in a mountainous area from the North of Spain [88]. This
finding remains doubtful taking into consideration that the infection occurred in unfed larvae,
so chiggers are speculated to be true carriers of the bacteria and inherited it through transo
varial transmission. The presence of rickettsiae was also investigated in chiggers of the same
mountainous area of Spain. Amplicons compatible with infection by Rickettsia spp. were
detected by molecular techniques in Neotrombicula inopinata collected over vegetation [89]. Up
to date, these results remain unconfirmed. The vector competence of N. autumnalis chiggers
for the transmission of Borrelia burgdorferi sensu lato (s.l.) has been also investigated. This
bacterium was screened by PCR and further DNA hybridization in questing larvae collected
on vegetation and feeding larvae removed from trapped micromammals in Germany [87].
Borrelial DNA was amplified in chiggers from 1 larva feeding on a white-toothed shrew
(Crocidura russula), from a pool of 4 larvae feeding on a Borrelia garinii-infected laboratory
mouse, and from 1 nymph that had previously fed as a larva on a Borrelia afzelii-positive
laboratory gerbil. Therefore, the vector competence of N. autumnalis remains unclear. The
presence of B. burgdorferi s.l. and A. phagocytophilum DNA was also been investigated by PCR
and reverse line blotting in chiggers found on wild birds captured in the western Carpathian
Mountains (Czech Republic) [24]. B. garinii and B. valaisiana were found in a pool of 5 chiggers
from the genus Neotrombicula collected from a Eurasian Blackcap (Sylvia atricapilla). Regarding
A. phagocytophilum, DNA was detected in none of the samples [87]. Trombiculid mites have
also been associated to Bartonella spp. A new strain of Bartonella sp. was isolated from the gray
squirrels Sciurus carolinensis in Georgia [90]. Then this bacterium was studied in ectoparasites

http://dx.doi.org/10.5772/61978
removed from gray squirrels by PCR. None of the mites tested (Eutrombicula splendens,
Myiatrombicula cynos, and Neotrombicula whartoniy) were positive, whereas 6 Bartonella spp.
strains were detected, 2 in fleas and 4 in lice [91]. Furthermore, Leptotrombidium mites have
been reported as carriers of Bartonella tamiae [92], species isolated from patients from Thailand
[93].
Several rickettsiae previously found in humans as Rickettsia akari, Rickettsia japonica, Rickettsia
conorii, Rickettsia felis, Rickettsia typhi, and Rickettsia sp. closely related to TwKM02, Rickettsia
australis, and Cf15 were detected using molecular methods in trombiculid mites removed from
wild rodents collected in Korea [94]. Although the rickettsial DNA was detected in mites, it
has yet to be determined whether the DNA was amplified from the meal of an infected animal
or from the mite tissue itself. Tsui et al., (2007), identified TwKM02 and TwKM03 closely related
to R. australis and R. felis URRWXCal2, respectively, in Leptotrombidium chiggers collected in
Taiwan [95].
Chiggers are also suspected to be vectors of viral diseases [96]. The role of L. scutellare as
possible vector of a Hantavirus causing epidemic hemorrhagic fever with renal syndrome
(HFRS) in China was hypothesized [97]. The authors suggested that this mite could be
naturally infected by HFRS virus and transmitted to vertebrates by biting and to its offspring
via transovarian transmission. On the other hand, although the spread of Hantavirus had been
thought to be exclusively by rodent excrement and urine, Hantavirus-RNA was detected in
Leptotrombidium mites from Texas (2 larvae and 1 free-living predatory stage), suggesting a
possible role in the transmission of Hantavirus pulmonary syndrome [98].
3. Chiggers and dermatitis

Trombiculiasis, also called trombiculosis, trombidiosis, chigger dermatitis, scrub
itch, or seasonal dermatitis is defined as an skin allergic reaction (dermatitis) caused by the
salivary secretion of biting chiggers [1,99]. In our experience, as well as it is described in the
literature, trombiculiasis is a common but underreported ectoparasitosis that is probably often
misdiagnosed [100]. In many cases, trombiculiasis was primarily confused with a plant allergy
[29], as it was the case in our country. The better understanding of trombiculid mites life cycle
and their interaction with humans have made possible a proper knowledge of this disease.
3.1. Etiology and epidemiology
Although not often reported in the literature, trombiculiasis is prevalent all over the world,
except for the Arctic region [20]. However, it can be easily missed because it is normally
transient and no systemic signs are present.
In nontropical areas, bites are particularly common in the late summer and early autumn, when
outdoor activities are maximal and the peak of abundance of chiggers occurs [19,20,26,28,101].
Thus, trombiculiasis is also an important threat to travelers that visit infested areas being
unaware of chiggers [37].
187
188
Mite islands are usually found in cleared land and scrub bush with grassy vegetation, warm
soil temperatures, and high humidity. Suitable habitats also require the presence of potential
hosts [31]. Trombiculids are also found in parks, gardens, lawns, and moist areas alongside
lakes and streams [1]. Clusters of chiggers are usually waiting at elevated points of the groundlevel vegetation, such as the end of grass stalk or on dried tree branches, until an animal or
human passes by [8] (Figure 5).
Figure 5. Cluster of unfed chiggers. Original contribution.
People are usually bitten during outdoor activities for recreational or professional purposes
such as hunting, hiking, mushroom picking, forestry work, etc. [8,28,101]. Although the rate
of people bitten is very high, apparently some persons are preferred by the chiggers, resulting
in massive parasitization, while others remain unmolested even in highly infested areas
[26,28].
More than 3,000 species of chiggers are known, but about 15 frequently bite humans and
domestic animals causing cutaneous reactions [102] (Table 2). Species currently considered as
the most frequent cause of trombiculiasis are E. alfreddugesi in the Americas, N. autumnalis in
Europe, Eutrombicula batatas in South America, and Eutrombicula wichmanni in Southeast Asia,
Australia, and the Pacific Islands [4,28,37,103].
E. alfreddugesi is the most common and widespread trombiculiasis-producing species in the
New World. The larvae are present in the late summer and early autumn in temperate regions

http://dx.doi.org/10.5772/61978
of its geographical range and throughout the year in the tropics and subtropics. It is particularly
common in areas of secondary growth, along margins of swamps, and ecotones between
woodlands and open fields or grasslands [1]. E. splendens is the second most common chigger
attacking human in North America. This species is especially abundant in moist habitats such
as swamps, bogs, and low-lying areas with rotting stumps and fallen trees. The seasonality is
similar to E. alfreddugesi ones [1]. In addition, another mite causing trombiculiasis in the United
States is Eutrombicula lipovsky. It is present in moist habitats, generally characterized by an
abundance of decaying logs and stumps bordering swamps and streams [1].
E. alfreddugesi and E. batatas are the main species implicated in South-America. However,
trombiculiasis attributed to N. autumnalis (isango) is well-known in Peru [21]. Recently, a
pest called Qhapa, with the same clinical features than trombiculiasis, has been associated
with E. batatas in Bolivia [104]. In Venezuela, it is possible that a high percentage of the
diagnosed scabies may actually be trombiculiasis [22]. Recently, E. alfreddugesi was implicated
in a case of trombiculiasis in a tourist after a vacation in Brazil [20].
Seven chigger species are proven to cause trombiculiasis in Europe: N. japonica, Neotrombicula
zachvatkini, Euschoengastia xerothermobia, N. autumnalis, Kepkatrombicula desaleri, Blankaartia
acuscutellaris, and Trombicula toldti [6,29,105]. Recently, N. inopinata has been reported as a
possible causative agent of trombiculiasis in Spain [8]. As stated above, it is generally accepted
that N. autumnalis is the most common cause of trombiculiasis in Europe and the British Islands
[1]. However, in many cases, the role of harvest mite has been attributed to N. autumnalis
without enough taxonomic criteria. Therefore, other species may be causative agents of
trombiculiasis, as occurred with N. inopinata in Spain [8] (Figure 6).
Figure 6. Neotrombicula inopinata (photo provided by Dr. Stekolnikov).
Although well known in many European regions, the scientific description of trombiculiasis
cases have been only reported from Italy [36] and Spain [28]. Moreover, four different cases
suspected of trombiculiasis caused by N. autumnalis were described in Croatia [106], and one
189
190
case attributed to harvest mites was informed in the United Kingdom [107]. In Europe,
trombiculiasis is associated with the late summer and early autumn [26,28,36,101]. In fact, N.
autumnalis is known as the European harvest mite due to the seasonality of the disease [87].
Nevertheless, in the last years, trombiculiasis-like skin reactions have been reported in
Germany not only in summer and autumn but also in early spring and in winter [31].
In Southeast Asia, Australia, and the Pacific Islands, the main involved mite is E. wichmanni.
Nevertheless, E. sarcina and species of genera Odontacarus and Schoengastia are also causative
agents of trombiculiasis [4]. In addition, Neotrombicula nagayoi was involved in human
trombiculiasis in Japan [5].
A single case of trombiculiasis has been reported in Africa. L. subquadratum was described as
a cause of severe itching and dermatitis in humans and dogs in South Africa [108].
It is generally accepted that to suffer from trombiculiasis, the antecedent of direct contact with
vegetation is required. Nevertheless, it is important to remark that one of the patients reported
in Guarneri et al., 2005 [36] was not in contact with vegetation but presented similar clinical
features than the one that was hunting with the dogs. The authors speculated that trombicu
liasis was transmitted by direct contact with the infected dogs. The hypothesis is supported in
the fact that the dogs were frequently allowed to sit on the legs of the patients, and the patients
lesions were concentrated on the abdomen and thighs. Dogs can be affected by chigger bites
and suffer neurological and digestive forms that may be fatal. In our experience, massive
infections are more frequents, and untreated dogs finally die. Dogs usually began with
diarrhea, irritation, and ataxia. The precedent of visiting infested areas and the presence of
red points in the dogs eyes are essential clues to guide the diagnosis [25]
Another example of disease caused by chiggers but without direct contact to vegetation is also
a case of conjunctivitis induced by N. autumnalis, reported in a patient with no history of
travelling, hill walking, gardening, or contact with vegetation [109]. There, the authors
suggested mite infestation occurred by direct contact with the patients cat. Nevertheless, there
is no data about the cat in the manuscript. These cases suggested that close human contact
with infected pets should be considered as an unusual route of trombiculiasis, so chigger
transmission is possible without direct contact with infested soil or vegetation [36,109].
Previously, patients were rarely referred for dermatologist review unless symptoms were
severe. Over the last 15 years, cases of severe trombiculiasis have increased in western
Germany and in the United Kingdom [31,107]. The influence of climate and environmental
variations, changes in leisure habits, and broader environmental awareness in the population
have been speculated as possible explanations of this increase [26].
3.2. Clinical manifestation
Chigger bites are initially painless, and frequently the only sign of exposure is a severe itching.
Then small, red bite like lesions appears on the skin [1,19]. Typical 12 mm diameter, pruritic,
erythematous papules appear at the sites of the bites 324 h after exposure (Figure 7).
[10,28,37,101,103].

http://dx.doi.org/10.5772/61978
Figure 7. Typical papules of trombiculiasis in a patient bitten in La Rioja, Spain. Original contribution.
The presence of papulovesicles, which may gradually progress to pustules, crusty, scabby,
eczematous, and ulcerated confluent forms of skin lesions, has also been described [17,26,103].
The pruritus is very intense, especially at night in bed. Although the chigger is not present,
the papules and discomfort may persist up to 23 weeks, but regression of localized itching is
generally observed in 1 week [26]. Since trombiculid mites share habitat with hard ticks, people
may result coinfested. In fact, a patient suffering from trombiculiasis and having an erythema
migrans (related to Lyme disease) was treated in our hospital. Furthermore, during an
episode of trombiculiasis, two affected people and their dog had R. felis infection, possibly
transmitted by fleas [110].
Chiggers usually attack in large numbers due to the clustering phenomenon, resulting in
multiple grouped bites on infested hosts [32]. Given their preference for attaching where the
skin is thin or in tighter contact with clothes, the bites tend to be concentrated around the knees,
antecubital fossae, and ankles, thighs, axillary region, groins and genitalia, and wrists, and in
areas constricted by clothing, such as along the belt line or the elastic borders or undergarments
[1,17,26,28,101].
Trombiculiasis-causing chiggers do not survive more than 12 days feeding on humans due
to the adverse host reaction and because they are remove by scratching [1,23]. The irritant effect
of chiggers saliva seems to induce both dermal inflammatory reaction of moderate intensity
and an adaptive immune response. These salivary components generally reveal relatively
moderate lytic properties and weak immunological characters [111]. The type of skin inflam
matory response during the feeding of trombiculid larvae is determined by concomitant factors
such as the site of the parasite localization, condition of the hosts skin, among others [39].
Repeated exposures result in a more rapid and intense adaptive immune response [102].
Anyway, permanent or long-term human residents in an infested area increase their immunity
as a result of continued bites, and some people can develop a high degree of tolerance to the
antigenic substances injected by chiggers. However, the occurrence of unusual outbreaks of
urticaria, increasingly severe pruritus or bulla formation, are indications of hypersensitivity
to such antigenic substances [5]. It is clear that the natural hosts of trombiculids have to be
191
192
sensitized with respect to parasites that may lead the development of the strong specific
inflammatory response [39, 111].
3.3. Diagnosis and treatment
Diagnosis is based on the clinical manifestations, taking into consideration the history of being
in contact with vegetation and the seasonality. As the etiological agent of the trombiculiasis is
rarely found in the skin of the patients, these reactions are often misinterpreted and has been
wrongly associated to plant allergies, flea or mosquito bites, or even scabies [26]. Cutaneous
findings are nonspecific, so clinical examination would probably lead to a wrong diagnosis of
a nonspecific itchy dermatitis, leading to use inadequate or needless medications. Then an
accurate anamnesis is essential for making such challenging diagnosis. Chigger bites should
be considered whenever any unexplained skin eruption is presented to the physician.
Chiggers are not easily seen on humans skin with the naked eye, and common magnification
lenses and even dermoscopy (10 magnifications) have some limitations. Recently, videoder
matoscopy (150 magnification) has been used to diagnose trombiculiasis caused by N.
autumnalis in a man with a well-documented diagnosis of scabies [100].
Differential diagnosis includes infestations with other mite species (e.g., the itch mite Sarcoptes
scabiei), or blood-sucking ectoparasites, such as bed bugs, fleas, ticks, and mosquitoes. Also,
hypersensitivity to chemical substances or photoallergic skin reaction to contact with a plant
(Meadow dermatitis) should be taken into consideration [26].
Treatment is primarily symptomatic and consists of antipruritics, antihistamines, and topical
corticosteroids [112]. In our medical consultation, supportive measures such as oatmeal baths
are also highly recommended. Antibiotics might be needed in case bacterial superinfection
resulting from repeated scratching occurs.
After being in known areas of chigger activity, the dermatitis can be minimized, and the
recovery time can be significantly shortened, by taking a hot soapy shower or bath and washing
clothes with soap and hot water. These good practices are recommended immediately after
exposure, in order to remove both unattached and attached chiggers, before they have firmly
anchored to the skin (generally within 36 h following attachment) [1,26]. Once the papules
are present, scratching should be avoided in order to prevent to excoriate the lesions and the
infection.
Patients should be advised on preventive measures, including avoidance of high-risk areas
when larvae are active. Since in many cases these results are unreasonable and contact with
trombiculid mites is unavoidable, chigger infestation may be minimized by wearing protective
clothing and soaking socks and trouser legs with insect repellents [112]. Usually, the use of
repellent sprays and lotions containing benzyl benzoate or diethyltoluamide has been
recommended [29]. Permethrin was successfully used as a clothing treatment for personal
protection against chigger mites [113]. However, the active ingredient is no longer available
for this purpose in the European Union [10,26].

http://dx.doi.org/10.5772/61978
Although better than before, our contemporary knowledge on the biology and ecology of these
mites is still extremely limited. Currently, no reliable recommendations for the control of mites,
except from personal protection, can be given [26].
4. Other human diseases associated to chiggers

Apart from trombiculiasis, chiggers are responsible for other less frequent conditions. The
summer penile syndrome is a seasonal acute hypersensitivity reaction attributed to chigger
bites [114,115]. It occurs in young boys with a history of bites or outdoor exposure, and it is
characterized by the rapid onset of edema and pruritus of the penile skin. It has been described
most commonly in the spring and summer in different regions of United States [114,115].
Another example is the unique case of conjunctivitis induced by N. autumnalis, reported in
United Kingdom [109]. The patient had a 2-week history of a painful, gritty, red left eye, which
failed to improve with a liquid paraffin eye ointment. On examination, her conjunctiva was
found to be mildly red and she had normal visual acuity. On close inspection, a live mite was
identified in contact with the left upper eyelid margin.
5. Conclusions
Chiggers are worldwide distributed ectoparasites that have to be taken into account as human
pathogens. Their medical importance is based on their role as vectors of scrub typhus and as
causative agents of trombiculiasis.
Scrub typhus remains as one of the most life-threatening infection in Asian Pacific regions. The
development of a prophylactic vaccine against O. tsutsugamushi is of great interest in endemic
regions. In addition, special attention should be paid on recent reports of scrub cases typhuslike infections in unusual areas, and on reviewing the genetic diversity of the genus Orientia.
More research studies are necessary in order to clarify the relationship of chiggers with other
bacterial or viral infections.
Trombiculiasis is an extended but underreported condition that should be considered when
pruritic dermatitis in people exposed to vegetation occurs. In risky areas, personal protection
is the unique recommendation to reduce the parasitation. A deeper understanding of chiggers
life cycle, epidemiology and seasonality of trombiculiasis is required for a correct management
of this annoying dermatitis.
Acknowledgements
We are grateful to all members from the Centre of Rickettsiosis and Arthropod-Borne Diseases,
Hospital San Pedro-Centre of Biomedical Research (CIBIR), Logroo (La Rioja), Spain. We also
193
194
thank to Dr. Shatrov and Dr. Stekolnikov from the Zoological Institute of the Russian Academy
of Science, St.-Petersburg, Russia, and Dr. Takahashi from the Saitama Medical University,
Saitama, Japan, for providing us the pictures and for their invaluable help. Financial support
was provided in part by two grants (FOMENTA 2007/14 and PREDOC 2008/29) from Con
sejera de Educacin, Cultura y Deporte del Gobierno de La Rioja, Spain.
Author details
Paula Santibez*, Ana M. Palomar, Arnzazu Portillo, Sonia Santibez and Jos A. Oteo
*Address all correspondence to: psantibanez@riojasalud.es
Department of Infectious Diseases, Center of Rickettsioses and Arthropod-Borne Diseases,
Hospital San Pedro-CIBIR, Logroo, La Rioja, Spain
References
[1] Mullen G, OConnor B. Mites (Acari). In: Durden L, Mullen G (ed.). Medical and Vet
erinary Entomology. Academic Press. 2002. p449516.
[2] Brennan J, Goff M. Keys to the genera of chiggers of western hemisphere (Acarina:
Trombiculidae. J Parasitol. 1977; 77(3):554566.
[3] Moniuszko H, Mkol J. Chigger mites (Actinotrichida: Parasitengona, Trombiculi
dae) of Poland. An updated distribution and hosts. Ann Parasitol. 2014; 60(2):103
117.
[4] Burns D. Diseases caused by arthropods and othernoxious animals. In: Burns DA,
Breathnach SM, Cox NH GC (ed.). Rooks Textbook of Dermatology. 8th Edition.
Blackwell Publishing. 2009.
[5] Takahashi M, Misumi H, Urakami H, Saito T, Misumi M, Matsumoto I, Suzuki H. A new
member of the trombiculid mite family Neotrombicula nagayoi (Acari: Trombiculidae)
induces human dermatitis. Southeast Asian J Trop Med Public Health. 2004; 35: 113118.
[6] Ripka G, Stekolnikov A. First finding of the chigger Blankaartia acuscutellaris on a
human host in Europe. Belgian J Entomol. 2006; 8: 147151.
[7] ]Shatrov AB. Comparative and functional morphology of the mouthparts in larvae of
Parasitengona (Acariformes). Zoosymposia. 2011; 6: 1423.
[8] Stekolnikov A, Santibez P, Palomar AM, Oteo JA. Neotrombicula inopinata (Acari:
Trombiculidae)a possible causative agent of trombiculiasis in Europe. Parasit Vec
tors. 2014;7:90.

http://dx.doi.org/10.5772/61978
[9] Stekolnikov AA, Daniel M. Chigger mites (Acari: Trombiculidae) of Turkey. Zootaxa.
2012. 3216: 1104.
[10] White G. Medical acarology and entomology. In: Gordon CC, Zumla AI (ed.). Man
sons Tropical Diseases. 2003. p17171720.
[11] Kim JH, Roh JY, Kwon DH, Kim YH, Yoon KA, Yoo S, Noh SJ, Park J, Shin EH, Park
MY, Lee SH. Estimation of the genome sizes of the chigger mites Leptotrombidium
pallidum and Leptotrombidium scutellare based on quantitative PCR and k-mer
analysis. Parasit Vectors. 2014; 7(1): 279288.
[12] Rozendaal JA. Bedbugs, fleas, lice, ticks and mites. In: World Health Organization.
Vector control: methods for use by individuals and communities. 1997. 236283.
[13] Faccini-Martnez A, Garca-lvarez L, Hidalgo M, Oteo JA. Syndromic classification
of rickettsioses: an approach for clinical practice. Int J Infect Dis. 2014; 28: 126139.
[14] Kim IS, Walker DH. Scrub Typhus. In: Guerrant RL, Walker DH, Peter WF (ed.).
Tropical infectious diseases. Principles, pathogens and practice. 3th edition. Elsevier;
2011. p334338.
[15] Lee H, Shim S, Song B, Choi E, Hwang K, Park M, et al. Detection of Orientia tsutsu
gamushi, the causative agent of scrub typhus, in a novel mite species, Eushoengastia
koreaensis, in Korea. Vector Borne Zoonotic Dis. 2011; 11(3):209214.
[16] Ken KM, Shockman SC, Sirichotiratana M, Lent MP, Wilson ML. Dermatoses associ
ated with mites other than Sarcoptes. Semin Cutan Med Surg. 2014; 33:110115.
[17] McClain D, Dana AN, Goldenberg G. Mite infestations. Dermatol Ther. 2009; 22:327
346.
[18] Witt LH, Linardi PM, Meckes O, Schwalfenberg S, Ribeiro RA, Feldmeier H, Heukel
bach J. Blood-feeding of Tunga penetrans males. Med Vet Entomol. 2004; 18:439441.
[19] Elston D. Whats eating you? Chiggers. Cutis. 2006; 77(6): 350352.
[20] Martens H, Melo MDM, Bosch W Van Den, Genderen PJJ van. A chigsaw puzzle
after a vacation in Brazil. Neth J Med. 2012; 70(7): 321325.
[21] Beltrn M, Valdivia C, Ponce-Ramrez R, Chambergo M. Trombicula autumnalis
(isangos) en un jardn de nios de la selva peruana. Rev Peru Med Exp Salud Publi
ca. 2009; 26(1):5860.
[22] Chaccour CJ. Trombiculiasis: reporte de dos casos y revisin de la literatura. Derma
tologia Venez. 2005; 43(2):1821.
[23] Shatrov AB, Kudryashova NI. Taxonomy, life cycles and the origin of parasitism in
trombiculid mites. In: Morand S, Krasnov BR, Poulin R (ed.). Micromammals and
Macroparasites Part II. Springer. 2006. p119140.
[24] Literak I, Stekolnikov AA, Sychra O, Dubska L, Taragelova V. Larvae of chigger
mites Neotrombicula spp. (Acari: Trombiculidae) exhibited Borrelia but no Anaplas
195
196
ma infections: a field study including birds from the Czech Carpathians as hosts of
chiggers. Exp Appl Acarol. 2008; 44: 307314.
[25] Cakiroglu D, Pekmezci D, Meral Y, Gokalp G, Acici M. Trombiculidae larvae (Neo
trombicula autumnalis) infestation in a Little Bittern (Ixobrychus minutus) in Turkey.
Parasitol Res. 2008; 102:10771079.
[26] Kampen H. Die Herbstmilbe Neotrombicula autumnalis und andere parasitische
Laufmilben (Acari, Trombiculidae) als Verursacher von Hauterkrankungen in Mitte
leuropa. Biol Linz/Austria. 2002; 184:461476.
[27] Nutall T. Pruritic dermatoses. In: Nutall T, Harvey RG, McKeever PJ (ed.). A colour
handbook of skin diseases of the dog and cat. Manson Publishing; 2009. p5152.
[28] Santibez-Senz P, Palomar-Urbina AM, Imaa-Rodrguez E, Oteo-Revuelta JA.
Pruritic dermatitis after hiking in the mountains. Enferm Infecc Microbiol Clin. 2014;
32(9): 610611.
[29] Kampen H. Trombiculiden und Trombidiose. Z Allg Med. 2000; 76:392396.
[30] Moss P, Beeching NJ. Arthropods and ectoparasites. In: Cohen J, Powderly WG (ed.).
Infectious Diseases. 2nd edition. Mosby-Elsevier; 2003. p.128139.
[31] Schler A, Maier WA, Kampen H. Multiple environmental factor analysis in habitats
of the harvest mite Neotrombicula autumnalis (Acari: Trombiculidae) suggests extra
ordinarily high euryoecious biology. Exp Appl Acarol. 2006; 39:4162.
[32] Traub BR, Wissernan CL. The ecology of chigger-borne rickettsiosis (Scrub Typhus). J
Med Entomol. 1974; 11:237303.
[33] Belozerov V. Seasonal adaptations in the life cycles of mites and ticks: comparative
and evolutionary aspects. Trends in Acarology: Proceedings of the 12th International
Congress. 2010. p.319326.
[34] Mkol J, Cichocki J, Felska M, Kosiska A, aydanowicz J, upicki D, Gabry G. A
new data on biology and taxonomy of Neotrombicula inopinata (Oudemans, 1909)
and Leptotrombidium russicum (Oudemans, 1902) (Acari: Actinotrichida: Trombicu
lidae). Ann Zool. 2010; 60:419427.
[35] Shatrov AB. Some peculiarities of the life cycle and biology of chiggers in laboratory.
Entomol Rev. 1996; 76:11971208.
[36] Guarneri F, Pugliese A, Giudice E, Guarneri C, Giannetto S, Guarneri B. Trombiculia
sis: clinical contribution. Eur J Dermatology. 2005; 15:495496.
[37] Daz JH. Mite-transmitted dermatoses and infectious diseases in returning travelers. J
Travel Med. 2010; 17(1): 2131.

http://dx.doi.org/10.5772/61978
[38] ]Goldberg SR, Holshuh HJ. Ectoparasite-induced lesions in mite pockets of the Yar
rows spiny lizard, Sceloporus jarrovii (Phrynosomatidae). J Wildl Dis. 1992; 28:537
541.
[39] Shatrov AB, Takahashi M, Noda S, Misumi H. Stylostome organization in feeding
Leptotrombidium larvae (Acariformes: Trombiculidae). Exp Appl Acarol. 2014;
64:3347.
[40] Walker DH. Rickettsiae. In: Baron S (ed.). Medical Microbiology. 4th edition. Univer
sity of Texas Medical Branch at Galveston. 1996; chapter 38.
[41] Portillo A, Oteo JA. Rickettsiosis as threat for the traveller. In: Rodriguez-Morales AJ
(ed.). Current Topics in Tropical Medicine. 2012.
[42] Li T, Yang Z, Dong Z, Wang M. Meteorological factors and risk of scrub typhus in
Guangzhou, Southern China, 20062012. BMC Infect Dis. 2014;14(1):139.
[43] Watt G, Parola P. Scrub typhus and tropical rickettsioses. Curr Opin Infect Dis. 2003;
16(5):429436.
[44] Paris DH, Chansamouth V, Nawtaisong P, Lwenberg EC, Phetsouvanh R, Blacksell
SD, Lee SJ, Dondorp AM, van der Poll T, Newton PN, Levi M, Day NP. Coagulation
and inflammation in scrub typhus and murine typhusa prospective comparative
study from Laos. Clin Microbiol Infect. 2012; 18:12211228.
[45] Tamura A, Ohashi N, Urakami H, Miyamura S. Classification of Rickettsia tsutsuga
mushi in a new genus, Orientia gen. nov., as Orientia tsutsugamushi comb. nov. Int J
Syst Bacteriol. 1995; 45(3):589591.
[46] Kelly DJ, Fuerst PA, Ching W-M, Richards AL. Scrub typhus: the geographic distri
bution of phenotypic and genotypic variants of Orientia tsutsugamushi. Clin Infect
Dis. 2009; 48(3):203230.
[47] Paris DH, Shelite TR, Day NP, Walker DH. Unresolved problems related to scrub ty
phus: a seriously neglected life-threatening disease. Am J Trop Med Hyg. 2013; 89(2):
301307.
[48] Fournier PE, Siritantikorn S, Rolain JM, Suputtamongkol Y, Hoontrakul S, Charoen
wat S, Losuwanaluk K, Parola P, Raoult D. Detection of new genotypes of Orientia
tsutsugamushi infecting humans in Thailand. Clin Microbiol Infect. 2008; 14:168173.
[49] Seong SY, Choi MS, Kim IS. Orientia tsutsugamushi infection: overview and immune
responses. Microbes Infect. 2001; 3:1121.
[50] Panpanich R, Garner P. Antibiotics for treating scrub typhus. Cochrane Database
Syst Rev. 2002; (3):CD002150.
[51] Francischetti IMB, Anderson SN, Mans BJ, Santos IM, Ribeiro JMC. The role of saliva
in tick feeding. Front Biosci. 2010; 14:20512088.
197
198
[52] Traub R, Wisseman CL, Jones MR, OKeefe JJ. The acquisition of Rickettsia tsutsuga
mushi by chiggers (trombiculid mites) during the feeding process. Ann NY Acad Sci.
1975; 266:91114.
[53] Nakayama K, Kurokawa K, Fukuhara M, Urakami H, Yamamoto S, Yamazaki K,
Ogura Y, Ooka T, Hayashi T. Genome comparison and phylogenetic analysis of Ori
entia tsutsugamushi strains. DNA Res. 2010; 17:281291.
[54] Frances SP, Watcharapichat P, Phulsuksombati D TP. Transmission of Orientia tsut
sugamushi, the aetiological agent for Scrub Typhus, to co-feeding mites. Parasitolo
gy. 2000; 120:601607.
[55] Dhiman RC. Emerging vector-borne zoonoses: eco-epidemiology and public health
implications in India. Front Public Heal. 2014; 2:16.
[56] Rodkvamtook W, Gaywee J, Kanjanavanit S, Ruangareerate T, Richards AL, Sangjun
N, Jeamwattanalert P, Sirisopana N. Scrub typhus outbreak, Northern Thailand,
20062007. Emerg Infect Dis. 2013; 19(5):774777.
[57] Valbuena G, Walker DH. Approaches to vaccines against Orientia tsutsugamushi.
Front Cell Infect Microbiol. 2012; 2:170.
[58] Paris DH, Phetsouvanh R, Tanganuchitcharnchai A, Jones M, Jenjaroen K, Vongsou
vath M, Ferguson DP, Blacksell SD, Newton PN, Day NP, Turner GD. Orientia tsut
sugamushi in human scrub typhus eschars shows tropism for dendritic cells and
monocytes rather than endothelium. PLoS Negl Trop Dis. 2012; 6(1).
[59] Sonthayanon P, Peacock SJ, Chierakul W, Wuthiekanun V, Blacksell SD, Holden MT,
Bentley SD, Feil EJ, Day NP. High rates of homologous recombination in the mite en
dosymbiont and opportunistic human pathogen Orientia tsutsugamushi. PLoS Negl
Trop Dis. 2010; 4(7).
[60] Chung MH, Lee JS, Baek JH, Kim M, Kang JS. Persistence of Orientia tsutsugamushi
in humans. J Korean Med Sci. 2012; 27:231235.
[61] Raoult D. Orientia tsutsugamushi (Scrub Typhus). In: Mandell GL, Bennett JE, Dolin
R (ed.). Mandell, Douglas, and Bennetts Principles and Practice of Infectious Diseas
es. 7th edition. Elsevier; 2010. p.25292530.
[62] Jensenius M, Fournier PE, Raoult D. Rickettsioses and the international traveler. Clin
Infect Dis. 2004; 39:14931499.
[63] Osuga K, Kimura M, Goto H, Shimada K, Suto T. A case of Tsutsugamushi disease
probably contracted in Africa. Eur J Clin Microbiol Infect Dis. 1991; 10:9596.
[64] Ghorbani RP, Ghorbani AJ, Jain MK, Walker DH. A case of scrub typhus probably
acquired in Africa. Clin Infect Dis. 1997; 25:14731474.
[65] Pham X, Otsuka Y, Suzuki H, Takaoka H. Detection of Orientia tsutsugamushi (Rick
ettsiales: rickettsiaceae) in unengorged chiggers (Acari: Trombiculidae) from Oita

http://dx.doi.org/10.5772/61978
Prefecture, Japan, by nested polymerase chain reaction. J Med Entomol. 2001; 38(2):
308311.
[66] Pages F, Faulde M, Orlandi-Pradines E, Parola P. The past and present threat of vec
tor-borne diseases in deployed troops. Clin Microbiol Infect. 2010; 16(3):209224.
[67] Rajapakse S, Rodrigo C, Fernando D. Scrub typhus: pathophysiology, clinical mani
festations and prognosis. Asian Pac J Trop Med. Hainan Medical College; 2011; 5(4):
261264.
[68] Raj S, Krishnamoorthy A, Jagannati M, Abhilash K. Splenic infarct due to Scrub Ty
phus. J Glob Infect Dis. 2014; 6(2):8688.
[69] Rungta N. Scrub Typhus: emerging cause of multiorgan dysfunction. Indian J Crit
Care Med. 2014; 18(8):489491.
[70] Kim DM, Kyung JW, Chi YP, Ki DY, Hyong SK, Tae YY, et al. Distribution of eschars
on the body of scrub typhus patients: a prospective study. Am J Trop Med Hyg.
2007; 76(5):806809.
[71] Jeong YJ, Kim S, Wook YD, Lee JW, Kim K-I, Lee SH. Scrub typhus: clinical, patho
logic, and imaging findings. Radiographics. 2007; 27:161172.
[72] Kim DM, Kim SW, Choi SH Y. Clinical and laboratory findings associated with se
vere scrub typhus. BMC Infect Dis. 2010; 10(108).
[73] Lee JS, Park MY, Kim YJ, Kil H Il, Choi YH, Kim YC. Histopathological features in
both the eschar and erythematous lesions of Tsutsugamushi Disease: identification of
CD30+ cell infiltration in Tsutsugamushi disease. Am J Dermatopathol. 2009; 31(6):
551556.
[74] La Scola B, Raoult D. Laboratory diagnosis of rickettsioses: current approaches to di
agnosis of old and new rickettsial diseases. J Clin Microbiol. 1997; 35(11):27152727.
[75] Kim MK, Kee SH, Cho KA, Chung MH, Lim BU, Chang WH KJ. Apoptosis of endo
thelial cell line ECV304 persistently infected with Orientia tsutsugamushi. Microbiol
Immunol. 1999; 43(8):751757.
[76] Cho N, Seong S, Choi M, Kim I. Expression of Chemokine Genes in Human Dermal
Microvascular Endothelial Cell Lines Infected with Orientia tsutsugamushi. 2001;
69(3):12651272.
[77] Lu HY, Tsai KH, Yu SK, Cheng CH, Yang JS, Su CL, Hu HC, Wang HC, Huang JH,
Shu PY. Phylogenetic analysis of 56-kDa type-specific antigen gene of Orientia tsut
sugamushi isolates in Taiwan. Am J Trop Med Hyg. 2010; 83(3):658663.
[78] Singhsilarak T, Leowattana W, Looareesuwan S, Wongchotigul V, Jiang J, Richards
AL, Watt G. Short report: detection of Orientia tsutsugamushi in clinical samples by
quantitative real-time polymerase chain reaction. Am J Trop Med Hyg. 2005; 72(5):
640641.
199
200
[79] Blacksell SD, Bryant NJ, Paris DH, Doust JA, Sakoda Y, Day NPJ. Scrub typhus sero
logic testing with the indirect immunofluorescence method as a diagnostic gold
standard: a lack of consensus leads to a lot of confusion. Clin Infect Dis. 2007; 44:391
401.
[80] Koh GCKW, Maude RJ, Paris DH, Newton PN, Blacksell SD. Diagnosis of scrub ty
phus. Am J Trop Med Hyg. 2010; 82(3):368370.
[81] Lee YS, Wang PH, Tseng SJ, Ko CF, Teng HJ. Epidemiology of scrub typhus in east
ern Taiwan, 20002004. Jpn J Infect Dis. 2006; 59:235238.
[82] Liu YX, Cao WC, Gao Y, Zhang JL, Yang ZQ, Zhao ZT, Foley JE. Orientia tsutsuga
mushi in Eschars from scrub typhus patients. Emerg Infect Dis. 2006; 12(7):1109
1112.
[83] Furuya Y, Yoshida Y, Katayama T, Yamamoto S, Kawamura A. Serotype-specific am
plification of Rickettsia tsutsugamushi DNA by nested polymerase chain reaction. J
Clin Microbiol. 1993; 31(6):16371640.
[84] Paris DH, Blacksell SD, Nawtaisong P, Jenjaroen K, Teeraratkul A, Chierakul W, Wu
thiekanun V, Kantipong P, Day NP. Diagnostic accuracy of a loop-mediated isother
mal PCR assay for detection of Orientia tsutsugamushi during acute scrub typhus
infection. PLoS Negl Trop Dis. 2011; 5(9):17.
[85] Min CK, Yang JS, Kim S, Choi MS, Kim IS, Cho NH. Genome-based construction of
the metabolic pathways of Orientia tsutsugamushi and comparative analysis within
the Rickettsiales order. Comp Funct Genomics. 2008: 623145.
[86] Garca-lvarez L, Palomar A, Oteo J. Prevention and prophylaxis of tick bites and
tick-borne related diseases. Am J Infect Dis. 2013; 9(3):104116.
[87] Kampen H1, Schler A, Metzen M, Oehme R, Hartelt K, Kimmig P, Maier WA. Neo
trombicula autumnalis (Acari, Trombiculidae) as a vector for Borrelia burgdorferi s.l.
Exp Appl Acarol. 2004; 33:93102.
[88] Fernndez-Soto P, Prez-Snchez R, Encinas-Grandes A. Molecular detection of Ehr
lichia phagocytophila genogroup organisms in larvae of Neotrombicula autumnalis
(Acari: Trombiculidae) captured in Spain. J Parasitol. 2001; 87(6):14821483.
[89] Santibez P, Palomar AM, Santibez S PA and OJ. Chiggers (Acari: Trombiculi
dae) infected with rickettsiae in Spain: preliminary data. 6th International Meeting
on Rickettsiae and Rickettsial diseases. 2011.
[90] Bown KJ, Ellis BA, Birtles RJ, Durden LA, Lello J, Begon M, Bennett M. New world
origins for haemoparasites infecting United Kingdom grey squirrels (Sciurus caroli
nensis), as revealed by phylogenetic analysis of Bartonella infecting squirrel popula
tions in England and the United States. Epidemiol Infect. 2002; 129:647653.

http://dx.doi.org/10.5772/61978
[91] Durden LA, Ellis BA, Banks CW, Crowe JD, Oliver JH. Ectoparasites of gray squirrels
in two different habitats and screening of selected ectoparasites for Bartonellae. J Par
asitol. 2004; 90(3):485489.
[92] Kabeya H, Colborn JM, Bai Y, Lerdthusnee K, Richardson JH, Maruyama S, Kosoy
MY. Detection of Bartonella tamiae DNA in ectoparasites from rodents in Thailand
and their sequence similarity with bacterial cultures from Thai patients. Vector borne
Zoonotic Dis. 2010; 10(5):429434.
[93] Kosoy M, Morway C, Sheff KW, Bai Y, Colborn J, Chalcraft L, Dowell SF, Peruski LF,
Maloney SA, Baggett H, Sutthirattana S, Sidhirat A, Maruyama S, Kabeya H, Chomel
BB, Kasten R, Popov V, Robinson J, Kruglov A, Petersen LR. Bartonella tamiae sp.
nov., a newly recognized pathogen isolated from three human patients from Thai
land. J Clin Microbiol. 2008; 46(2):772775.
[94] Choi YJ1, Lee EM, Park JM, Lee KM, Han SH, Kim JK, Lee SH, Song HJ, Choi MS,
Kim IS, Park KH, Jang WJ. Molecular detection of various rickettsiae in mites (Acari:
Trombiculidae) in southern Jeolla Province, Korea. Microbiol Immunol. 2007; 51(3):
307312.
[95] Tsui PY, Tsai KH, Weng MH, Hung YW, Liu YT, Hu KY, Lien JC, Lin PR, Shaio MF,
Wang HC, Ji DD. Molecular detection and characterization of spotted fever group
rickettsiae in Taiwan. Am J Trop Med Hyg. 2007; 77(161):883890.
[96] Song G. Epidemiological progresses of hemorrhagic fever with renal syndrome in
China. Chin Med J (Engl). 1999; 112(5):472477.
[97] Wu G, Zhang Y, Guo H, Jiang K, Zhang J, Gan Y. The role of Leptotrombidium scu
tellare in the transmission of human diseases. Chin Med J (Engl). 1996; 109(9):670
673.
[98] Houck M, Qin H, Roberts H. Hantavirus transmission: potential role of ectoparasites.
Vector Borne Zoonotic Dis. 2001; 1(1):7579.
[99] Goff ML, Loomis RB, Welbourn WC, Wrenn WJ. A Glossary of Chigger Terminology
(Acari: Trombiculidae). J Med Entomol. 1982; 19(3):221238.
[100] Nasca MR, Lacarrubba F MG. Diagnosis of Trombiculosis by videodermatoscopy.
Emerg Infect Dis. 2014; 20(6):10591060.
[101] Jimnez S, Gastn I, Prez A, Oteo JA. A seasonal outbreak of human parasitation by
chiggers in La Rioja (Northern Spain). Clin Microbiol Infect. 2001; Abstract: p16051.
[102] Arlian LG. Chiggers and Other Disease-Causing Mites. In: Resh VH, Card RT (ed.).
Encyclopedia of Insects. Second edition. Elsevier; 2009. p152156.
[103] Steen CJ, Carbonaro PA, Schwartz RA. Arthropods in dermatology. J Am Acad Der
matol. 2004; 50:819844.
201
202
[104] ]Tweeten K, Muoz-Bravo J. Qhapa, a pest causing skin irritations in nor Yungas re
gion of Bolivia, identified as a chigger mite, Eutrombicula batatas. Trop Doct. 2008;
38(1):6364.
[105] Shatrov AB, Stekolnikov AA. Redescription of a human-infesting European trombi
culid mite Kepkatrombicula desaleri (Acari: Trombiculidae) with data on its mouth
parts and stylostome. Int J Acarol. 2011; 37:176193.
[106] Landeka N, Valic J. Description of four different cases suspected on trombidiasis. In:
Zbornik Radova 24 Znanstveno Struno Edukativni Seminar, 2011; Split; 2012. p185
91.
[107] Yates V. Harvest mites-a present from the Lake District. Clin Exp Dermatol. 1991;
16(4):277278.
[108] Heyne H, Ueckermann EA, Coetzee L. First report of a parasitic mite, Leptotrombidi
um (Hypotrombidium) subquadratum (Lawerence) (Acari: Trombiculidae: Trombi
culinae), from dogs and children in the Bloemfontein area, South Africa. J S Afr Vet
Assoc. 2001; 72(2):105106.
[109] Parcell BJ, Sharpe G, Jones B, Alexander CL. Conjunctivitis induced by a red bodied
mite, Neotrombicula autumnalis. Parasite 2013; 20(25).
[110] Oteo JA, Portillo A, Santibez S, Blanco JR, Prez-Martnez L, Ibarra V. Cluster of
cases of human Rickettsia felis infection from Southern Europe (Spain) diagnosed by
PCR. J Clin Microbiol. 2006; 44(7):26692671.
[111] Shatrov AB. Stylostome formation in trombiculid mites (Acariformes: Trombiculi
dae). Exp Appl Acarol. 2009; 49:261280.
[112] Jones J. Chiggers. Am Fam Physician. 1987; 36(2):149155.
[113] Breeden G, Schreck C, Sorensen A. Permethrin as a clothing treatment for personal
protection against chigger mites (Acarina: Trombiculidae). Am J Trop Med Hyg.
1982; 31(3):589592.
[114] Smith G, Sharma V, Knapp J, Shields B. The summer penile syndrome: seasonal
acute hypersensitivity reaction caused by chigger bites on the penis. Pediatr Emerg
Care. 1998; 14(2):116118.
[115] Schulert G, Gigante J. Summer penile syndrome: an acute hypersensitivity reaction. J
Emerg Med. 2014; 46(1).

Overview Tropical Diseases 15 I Tae

Caricato da

Informazioni sul documento

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

Overview Tropical Diseases 15 I Tae

Caricato da

Copyright:

Formati disponibili

An Overview of Tropical Diseases

Edited by Amidou Samie

An Overview of Tropical Diseases

Stole src from http://avxhome.se/blogs/exLib/

Published December 12, 2015

Chapter 1 Emerging Public Health Issues in Drug-Resistant

Chapter 8 Praziquantel and Arachidonic Acid Combination An

Emerging Public Health Issues in Drug-Resistant

An Overview of Tropical Diseases

An Overview of Tropical Diseases

Emerging Public Health Issues in Drug-Resistant Tuberculosis

An Overview of Tropical Diseases

3. MDR TB diagnosis: Clinical versus laboratory methods

Emerging Public Health Issues in Drug-Resistant Tuberculosis

3.2. Laboratory diagnosis Screening and confirmatory tools

An Overview of Tropical Diseases

4. Unrecognised MDR TB populations

Emerging Public Health Issues in Drug-Resistant Tuberculosis

5. Challenges in MDR TB therapy

An Overview of Tropical Diseases

Percentage of cohort (%)

(Adapted from WHO Global TB Report, 2014)

Emerging Public Health Issues in Drug-Resistant Tuberculosis

An Overview of Tropical Diseases

Emerging Public Health Issues in Drug-Resistant Tuberculosis

An Overview of Tropical Diseases

Emerging Public Health Issues in Drug-Resistant Tuberculosis

An Overview of Tropical Diseases

Mitochondria of Malaria Parasites as a Drug Target

An Overview of Tropical Diseases

Figure 1. Life cycle of the human malaria parasite Plasmodium falciparum.

Mitochondria, an organelle arising from alpha-proteobacterium engulfed by a eukaryotic

Mitochondria of Malaria Parasites as a Drug Target

2. Biochemical functions of malaria parasite mitochondria

An Overview of Tropical Diseases

Mitochondria of Malaria Parasites as a Drug Target

MQO is an FAD-dependent membrane-associated protein that catalyzes the oxidation of

An Overview of Tropical Diseases

Mitochondria of Malaria Parasites as a Drug Target

3. The mitochondrial genome of malaria parasites

An Overview of Tropical Diseases

mitochondrion was to date considered as being impossible. However, recently, extramito

4. Atovaquone resistance in malaria parasites

Mitochondria of Malaria Parasites as a Drug Target

An Overview of Tropical Diseases

Table 2. Mutations in the cytochrome b of Plasmodium berghei with atovaquone resistance

Mitochondria of Malaria Parasites as a Drug Target

5. 5-Aminolevulinic Acid (ALA): A new antimalarial candidate targeting

An Overview of Tropical Diseases

Mitochondria of Malaria Parasites as a Drug Target

An Overview of Tropical Diseases

Mitochondria of Malaria Parasites as a Drug Target

An Overview of Tropical Diseases

Mitochondria of Malaria Parasites as a Drug Target

An Overview of Tropical Diseases

Mitochondria of Malaria Parasites as a Drug Target

An Overview of Tropical Diseases

Mitochondria of Malaria Parasites as a Drug Target

catalytic turnover and protein expression. Journal of Biological Chemistry.

An Overview of Tropical Diseases

vo haem synthesis by Plasmodium falciparum. Biochemical Journal. 2002;367(Pt 2):

Recent Advances in Antimalarial Drug Discovery

An Overview of Tropical Diseases