Immunol Res

DOI 10.1007/s12026-015-8663-z

A repertoire of high-affinity monoclonal antibodies specific

to S. typhi: as potential candidate for improved typhoid diagnostic
Chandresh Sharma1 Anurag Sankhyan1 Tarang Sharma1
Naeem Khan2 Susmita Chaudhuri1 Niraj Kumar1
Shinjini Bhatnagar3 Navin Khanna4 Ashutosh Tiwari1

Springer Science+Business Media New York 2015

Abstract Typhoid fever is a significant global health

problem with highest burden on the developing world. The
severity of typhoid is often underestimated, and currently
available serological diagnostic assays are inadequate due
to lack in requisite sensitivity and specificity. This underlines an absolute need to develop a reliable and accurate
diagnostics that would benefit long-term disease control
and treatment and to understand the real disease burden.
Here, we have utilized flagellin protein of S. typhi that is
surface accessible, abundantly expressed, and highly immunogenic, for developing immunodiagnostic tests. Flagellin monomers are composed of conserved amino-terminal
and carboxy-terminal, and serovar-specific middle region.
We have generated a panel of murine monoclonal antibodies (mAbs) against the middle region of flagellin, purified from large culture of S. typhi to ensure its native
conformation. These mAbs showed unique specificity and
very high affinity toward S. typhi flagellin without showing
any cross-reactivity with other serovars. Genetic analysis
of mAbs also revealed high frequency of somatic mutation
due to antigenic selection process across variable region to
achieve high binding affinity. These antibodies also

& Ashutosh Tiwari

ashutosh@thsti.res.in
1

Centre for Bio-design and Diagnostics, Translational Health

Science and Technology Institute, NCR Biotech Science
Cluster, 3rd Milestone, Faridabad-Gurgaon Expressway,
Faridabad 121001, Haryana, India

National Institute of Immunology, New Delhi, India

Pediatric Biology Center, Translational Health Science and

Technology Institute, Faridabad, Haryana, India

International Centre for Genetic Engineering and

Biotechnology, New Delhi, India

displayed stable binding in stringent reaction conditions for

antigenantibody interactions, like DMSO, urea, KSCN,
guanidinium HCl, and extremes of pH. One of the mAbs
potentially reversed the TLR5-mediated immune response,
in vitro by inhibiting TLR5flagellin interaction. In our
study, binding of these mAbs to flagellin, with high affinity, present on bacterial surface, as well as in soluble
form, validates their potential use in developing improved
diagnostics with significantly higher sensitivity and
specificity.
Keywords Flagellin  S. typhi  Typhoid fever 
Monoclonal antibodies  TLR5  Typhoid diagnostics

Introduction
Typhoid, an enteric fever of humans, is a systemic lifethreatening infection caused by the bacteria Salmonella
enterica serovar Typhi (S. typhi) [1]. Occurrence is more
common in the lesser-developed regions of the world,
where overcrowding and inadequate sanitation are prevalent [2]. According to the best global estimates, the annual
incidence of typhoid fever is approximately 27 million
cases, with 216,000 deaths [3, 4]. The major proportion of
this burden is contributed by the citizens of low-income
countries, particularly those in Southeast Asia, Africa, and
Latin America. India along with Pakistan and Bangladesh
accounts for about 85 % of the worlds cases with a highest
incidence in preschool children [58]. Contaminated food
and water are responsible for the disease which is maintained in human population through carriage [9, 10]. Estimates vary, but potentially 15 % of patients with acute
infection have been reported to become chronic carriers, as

123

Immunol Res

Fig. 1 Construction, purification, and characterization of native and

recombinant flagellin protein. a Illustration of aligned amino acid
sequence of flagellin (S. typhi, S. typhimurium, and S. paratyphi),
showing conserved and hyper-variable middle region (shaded in
grey). b Illustration of cloning of fliC gene encoding flagellin (full
length) and deletant constructs (middle region) in E. coli expression
vector pPROEXHTb, for expression of recombinant flagellin. c
Protein expressed in soluble (cytosolic) fraction was IMAC-purified
and analyzed on 15 % Trisglycine, SDS-PAGE followed by staining

123

with Coomassie Brilliant Blue, from different sources (S. typhi and S.
typhimurium): molecular mass marker (lane 1), *52-kDa recombinant full-length His-tagged flagellin (lane 2), and *25-kDa recombinant middle-region His-tagged flagellin (lane 3). d Western blot
analysis using anti-His monoclonal antibody (Cell Signaling). e
Isolation of native flagellin from S. typhi and S. typhimurium;
molecular mass marker (lane 1) and *52-kDa native tagged flagellin
protein (lane 2) were analyzed on 15 % Trisglycine, SDS-PAGE
followed by staining with Coomassie Brilliant Blue

Immunol Res

Fig. 1 continued

S. typhi may persist through colonization within the gall

bladder of asymptomatic person [11, 12]. Clinically, the
disease is characterized by symptoms such as high fever,
malaise, anorexia, and liver and spleen enlargement which
are very common symptoms for febrile illnesses, leading
the disease to be mis-diagnosed as malaria, dengue, and
pneumonia, thus making definitive diagnosis difficult.
Definite diagnosis is achieved usually by isolation and
identification of the etiologic agent, from bone marrow or
blood, considered as the gold standard [4, 13]. The major
limitation of culture for diagnosis is that the facilities to
perform this complicated and time-consuming procedure
are often not available in endemic countries [14]. In such a
scenario, a more than century-old Widal test, which detects
antibodies against O and H antigens of S. typhi, often
serves as the routinely performed investigation, to support
clinical diagnosis [15]. Although robust and simple to
perform, Widal test lacks sensitivity, specificity, and reliability [16], apart from showing variation in results as
well as in background, for different endemic regions, based
on the quality of antigen and burden of infection, hence
leading to difficulties in the interpretation. These drawbacks thus prompted the development of newer diagnostic
tests such as the Typhidot or Tubex, which directly detect
IgM antibodies against a host of specific S. typhi antigens.
However, these have not proved to be sufficiently robust in
large-scale evaluations, in community settings. Essentially,
most of the serological tests for typhoid, based on the detection of antibodies to lipopolysaccharide (LPS) antigens
(O9 and O12) and flagellar H antigens, suffer from lack of
specificity, owing to cross-reactions among serovars, due to
conserved, somatic antigens of LPS and terminal regions of
flagellin [1719]. Hence, simple, rapid, sensitive and more
specific diagnostic tests for typhoid fever have been a longfelt need of clinicians working in endemic areas [20].
Immunoassays, based on the specific binding of antibody to
its antigen with increased sensitivity and selectivity, may

act as a more effective tool for definite diagnosis [21].

Immunoassays using polyclonal or monoclonal antibodies
(mAbs) have been established for the detection of Salmonella [2224].
The objective of this study was to produce anti-flagellin
mAb highly specific for S. typhi, which can be subsequently
used, to develop an immunodiagnostic method, for the rapid
detection of Salmonella. The phase 1 flagellin protein, encoded by the fliC gene, is surface accessible, abundantly
expressed and highly immunogenic [25]. Flagellin is also a
well-known ligand for TLR5 (Toll-like receptor 5), suggesting its importance in regulating intestinal immune responses, at multiple levels [26, 27]. Monomers are
composed of conserved amino-terminal (regions I, II) and
carboxy-terminal regions (region VIII), and a central variable region (regions III, IV, V, VI, and VII) [28, 29]. Studies
have shown that major serotype-specific flagellin antigenic
determinants are located in region IV [28, 30]. Hence, in this
study, we have isolated native flagellin protein (*52 kDa)
of S. typhi for the generation mAbs, by hybridoma technology. We have generated four anti-flagellin murine
monoclonal antibodies (mAbs), by exploiting speciesspecific hyper-variable recombinant middle region of S. typhi flagellin, as a specific antigen for their screening. These
mAbs have exalted and specific antigen-binding properties,
with a very high affinity for S. typhi flagellin detection and
efficiently detected antigen on the surface of flagellated
bacteria. Furthermore, we have also demonstrated a proof of
concept for specific detection of S. typhi flagellin in test
serum for point-of-care diagnosis.

Materials and methods

Plasmid construction
The genomic DNA from enterobacterial strains S. enterica
subsp. enterica serovar Typhi [31, 32] and S. enterica
subsp. enterica serovar Typhimurium (str. SL1344) [31]
were used for fliC gene amplification by PCR, using
specific primers {S. typhi fliC (GenBank: AE014613.1):
primer pairs: (full length: 50 ACGGATCCATGGCAC
AAGTCATTAATACAAACAG30 and 50 ACCTCGAGTTA
ACGCAGTAAAGAGAGGACG30 , and middle region:
50 ACGGATCCCTGACCATCCAGGTTGGTGCC30 and
50 ACCTCGAGGCTAGTATTGTCCTTATCGGCG30 ) and
S. typhimurium fliC (GenBank: FQ312003.1): primer pairs:
(full length: 50 ACGGATCCATGGCACAAGTAATCAA
CACTAACAG30 and 50 ACCTCGAGTTAACGTAACAG
AGACAG CAC30 , and middle region: 50 ACGGATCCGAA
ACTATCGATATCGATCTGAAGC30 and 50 ACCTCG
AGCCG TCAGCAGCAGTATAACTTG30 )}. PCR-amplified fragments were digested with BamH I/Xho I and

123

Immunol Res

123

Immunol Res
b Fig. 2 Purification and characterization of S. typhi anti-flagellin

monoclonal antibodies; Purification of anti-flagellin mAbs (IgG) was

performed by protein G affinity chromatography a Trisglycine, SDSPAGE (15 %) followed by staining with Coomassie Brilliant Blue
revealed the corresponding band of heavy and light chain at *50 and
*25 kDa, respectively; molecular mass marker (lane 1), mAb clone
P4D9 (lane 2), mAb clone P10F11 (lane 3), mAb clone P8F3 (lane 3),
and mAb clone P8F10 (lane 4). b Antigen-binding analysis and titers
(IgG levels) for mouse mAbs were determined by ELISA. Three
monoclonals P4D9, P10F11, and P8F3 showed very good and
comparable titers, while P8F10 had least titers. Error bars represent
the standard error calculated from triplicate measurements. c Screening and binding analysis of mAbs to the pure native, recombinant, and
recombinant middle-region flagellin as shown by ELISA. Data are
expressed as mean SE calculated from triplicate measurements.
d Immunoblotting was performed using pure native (lane N),
recombinant (lane R), and recombinant middle-region (lane M) flagellin from S. typhi or S. typhimurium for the demonstration of
specificity in detection of flagellin (in denaturing condition) by the
different monoclonal antibodies. Upper panel shows the immunoblotting analysis with native isolated flagellin; in the lower panel, pure
native, recombinant, and recombinant middle-region flagellin were
used, from both bacterial serovars. e Binding analysis of mAbs to
flagellin attached on bacterial surface performed by flow cytometry.
Negative control shows unstained cells (having PBS only). Data are
expressed as histogram and also with bar diagram (f), a shift in the
peak of histogram represents the binding of mAbs to the flagellin
attached on bacterial surface. All the four mouse monoclonal antibody
did not cross-react with E. coli (non-related antigen control) flagellin.
Data are a representation of one of the best results, obtained from
three separate experiments

cloned into respective sites in the MCS of pPROEXTM

HTb vector (Invitrogen, USA) to construct plasmid
pPROEXHTb-fliC (full length; 1-512 AA) and pPROEX
HTb-fliC (middle region; 144-316 AA), for the expression
of S. typhi or S. typhimurium recombinant flagellin. Plasmid constructs made were sequenced, which showed
100 % sequence homology with their respective fliC gene.
Purification of recombinant flagellin protein
Protein was expressed by subsequently transforming
plasmid constructs into chemically competent E. coli
Rosetta-gamiTM (DE3) cells (NovagenMerck, Darmstadt,
Germany). Briefly, overnight culture was inoculated in 1 L
of fresh 2X TY media (Difco, USA) (1:100) and induced
by 0.5 mM IPTG (Amresco LLC, OH, USA) overnight at
37 C. Cells were collected and centrifuged, and the pellet
obtained was resuspended in buffer [phosphate-buffered
saline (pH 7.4), 1 mM PMSF]. Cells were lysed by
sonication. Supernatant obtained post-centrifugation was
used for purification of recombinant flagellin protein by
immobilized metal ion affinity chromatography (IMAC)
using HisTrap FF column (GE Healthcare Buckinghamshire, UK), as per manufacturers protocol. Protein was
eluted using buffer [phosphate-buffered saline (pH 7.4),
250 mM imidazole]. Purified protein was dialyzed against

phosphate-buffered saline (pH 7.4), for the removal of

imidazole and then concentrated. Protein was quantitated
by bicinchoninic acid assay (Thermo Scientific Pierce,
Rockford, IL, USA) and analyzed using 15 % Trisglycine, SDS-PAGE, and confirmed by Western blotting,
using anti-His monoclonal antibody (Cell Signaling Technology, Inc., MA, USA).
Isolation of native flagellin
Bacteria grown overnight in 20 ml of LuriaBertani (LB)
media (Difco, USA) was inoculated in 1 L of fresh LB
media (1:1000) and incubated overnight at 37 C. Cells
were harvested by centrifugation at 50009g for 30 min,
washed thrice with PBS, and finally resuspended in PBS.
Native flagellin from the S. typhi was isolated using earlier
published method with slight modifications [33]. Briefly,
cells were subjected to mechanical tearing and supernatant
was collected by centrifugation. Two steps of ultracentrifugation of supernatant at 100,0009g followed by heat inactivation for 1 h at 70 C and final ultracentrifugation yielded
pure native flagellin. Western blotting, using anti-flagellin
monoclonal antibody, confirmed isolation of native flagellin.
Generation, purification, and characterization
of anti-flagellin mAbs
All the animal experiments in this study were carried out at
International Centre for Genetic Engineering and
Biotechnology, New Delhi, India, and in accordance with
the guidelines of Institutional animal ethics committee. A
group of female Balb/c mice (age; 68 weeks) were immunized subcutaneously (s.c.), with purified native flagellin (20 lg in 100 ll PBS per animal), from S. typhi along
with Freunds Complete Adjuvant (CFA 1:1). Mice were
boosted four times with antigen (10 lg in 100 ll PBS per
animal), along with Freunds incomplete Adjuvant (IFA
1:1). Mice were bled 3 days after the last booster, and the
mouse with the highest titer of serum antibodies to native
flagellin antigen was given final booster injections, intraperitoneally (i.p.), 4 days before aseptically removing
the spleen. Splenocytes were utilized in hybridoma generation, for preparation of monoclonal antibody using the
Clonacell-HY system (Stemcell Technologies, USA), according to manufacturers instructions. Once established,
the clones were expanded in tissue culture flasks and stored
in liquid nitrogen for future use. Hybridomas producing
anti-flagellin antibodies were rescreened and purified two
times by limiting dilution. The hybridoma culture soup was
clarified, and anti-flagellin mAbs (IgG) were purified by
protein G affinity chromatography. Purified mAbs were
dialyzed against phosphate-buffered saline (pH 7.4) and
concentrated. Protein was quantitated by determining the

123

Immunol Res

Fig. 2 continued

123

Immunol Res

OD value at 280 nm, using Nanodrop 2000c spectrophotometer (Thermo scientific, DE, USA) and analyzed using
15 % Trisglycine, SDS-PAGE. Screening and binding
analysis of mAbs to the pure native, recombinant, and recombinant middle-region flagellin was performed by
ELISA. NUNC Maxisorp ELISA plate was coated with
antigen (1 lg ml-1) in 100 ll bicarbonate buffer (pH 9.5)
and incubated overnight at 4 C. Plates were blocked with
5 % non-fat milk in PBS for 2 h at 37 C. Monoclonal
antibodies (100 ll per well), (a) hybridoma supernatant
and (b) purified mAbs, in different dilutions, were added in
antigen-coated plates and incubated for 1 h at 37 C.
Levels of bound antibodies were detected, by conjugated
anti-mouse IgG-HRPO antibody (1:2500; Cell Signaling)
using TMB (3,30 ,5,50 -tetramethylbenzidine) substrate. The
reaction was stopped after 10 min by 2N H2SO4 (50 ll per
well), and optical density (OD) was measured at 450 nm.
Immunoblotting with anti-flagellin mAbs
Specificity in detection of S. typhi flagellin was performed by
immunoblotting. Pure native, recombinant, and recombinant
middle-region flagellins from S. typhi or S. typhimurium
were resolved on a 15 % reducing Trisglycine, SDS-PAGE
and transferred to nitrocellulose membrane (GE Healthcare,
Buckinghamshire, UK). After blocking with PBS containing
5 % fat-free milk powder for 2 h, different sources of flagellin were detected, using anti-flagellin mAbs (1/5000 dilution), and secondary antibody: anti-mouse HRP conjugate
(1/10,000 dilution, Cell Signaling Technology, Inc., MA,
USA), using Amersham ECL Prime Western Blotting detection reagent (GE Healthcare, Buckinghamshire, UK).
Binding of mAbs to the flagellin attached
on bacterial surface
All enterobacterial strains were grown overnight in 20 ml of
LB media. Bacterial cells (5 9 107) were incubated on ice
with different anti-flagellin mAbs (1:500 dilution), for 1 h.
Cells were washed twice, stained, with fluorochrome-conjugated monoclonal goat anti-mouse IgG antibody (1:200;
dilution): Alexa Fluor 488 goat anti-mouse IgG (H ? L)
(Thermo Fisher Scientific Inc. MA, USA), for 1 h, and fixed
with 2 % paraformaldehyde. Bound anti-flagellin mAbs were
detected on FACSVerse (BD Biosciences) flow cytometer,
and the data were analyzed using FlowJo software (v.10.0.5).
E. coli (strain XL1-blue) was used as negative control.
Antigen-binding strength and stability of S. typhi
anti-flagellin mAb
The antigen-binding strength of anti-flagellin mAb was
assayed qualitatively by ELISA in the presence of various

destabilizing agents such as urea (06 M), DMSO

(010 %), NaCl (04 M), potassium thiocyanate (03 M),
over a wide pH range (2.59). All buffers used were
phosphate-buffered saline (PBS) based. The destabilizing
agents and their ranges were chosen as in Reference [34].
Affinity measurement of S. typhi anti-flagellin mAb
Antigenantibody interaction kinetics analysis was performed using SPR analysis on ProteOn XPR36 System
(Bio-Rad, California, USA). ProteOn GLM sensor chip
was conditioned with 30 ll of acetate buffer (pH 4.5) for
60 s, in order to get stable baseline in all the six channels.
ProteOn GLM sensor chip was chemically activated by the
injection of 30 ll an equivolume mixture (1:1) of 400 mM
1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC)
and 100 mM N-hydroxysulfosuccinimide (NHS). Subsequently, 30 ll of different S. typhi anti-flagellin mAbs
(5 lg ml-1 diluted in acetate buffer; pH 4.5) were injected
in four channels for 200 s to get an effective immobilization of anti-flagellin mAbs, on the activated ProteOn GLM
sensor chip surface. Following antibody immobilization,
the remaining active sites were then blocked with 30 ll of
1 M ethanolamine. Afterwards, 10 mM HCl was injected
to achieve regeneration of immobilized sensor surface. For
negative control measurements, the modified gold surface
was activated with EDC/NHS and then quenched with
ethanolamine in channel 5 as mentioned above and was
used as blank control surface. In order to deduce kinetic
parameters, native flagellin of S. typhi, in five different
concentrations (100, 33.33, 11.11, 3.70, and 1.23 nM), was
flowed in PBS (pH 7.4), over the antibody-immobilized
sensor chip and interacted with different concentrations of
antigen. The interaction of antibody and antigen was
measured by the SPR instrument, as a change in refractive
index over time, and sensorgram data obtained were analyzed using ProteOn ManagerTM software.
Competitive ELISA
Competitive ELISA was done to confirm that the S. typhi
anti-flagellin mAbs bind to the same epitope confirmation
of recombinant and native flagellin. For this, the optimum
dilution of the anti-flagellin mAbs capable of giving a
detectable binding below the saturation level was determined by ELISA using anti-mouse antibody. Recombinant
or native S. typhi flagellin (020 ng ml-1) was mixed with
1:200,000 diluted mAbs (of 1 mg ml-1 stocks), incubated
(in solution) for 1 h at room temperature, added to antigencoated wells, and allowed to compete for 1 h at 37 C.
Bound mouse antibody was detected by anti-mouseHRP
conjugate (Cell Signaling Technology, Inc., MA, USA).
PBS was used as the negative control, and binding of the

123

Immunol Res

123

Immunol Res
b Fig. 3 Analysis of stability and antigen-binding strength of anti-

flagellin mAbs. Effects of destabilizing agents; a KSCN, b pH of

buffer c urea d DMSO, and e NaCl, on antigen binding of S. typhi
anti-flagellin mouse monoclonal antibodies. ELISA was done in the
presence of different concentrations of all destabilizing agent. Error
bars represent the standard error calculated from triplicate measurements. Competitive ELISA was done to confirm that the anti-flagellin
mAbs bind to the same antigenic epitope of different forms
(f recombinant or g native) of flagellin. Different amounts of the
recombinant or native flagellin were mixed with mAbs, added to
antigen-coated (1 lg ml-1) wells, and allowed to compete for 1 h at
37 C. OD values of PBS (negative control)-containing wells were
used to calculate the percentage inhibition

mouse mAb in its presence was taken as the maximum

binding, to calculate the percentage inhibition.
Sandwich ELISA
Sandwich ELISA was done to confirm that the anti-flagellin mAbs could specifically capture the different forms
(recombinant or native) of soluble S. typhi flagellin. For
this experiment, the optimum concentration of the antiflagellin mAbs was 5 lg ml-1, and two different mAbs,
P10F11 and P8F3, were used, for coating 96-well plate
(Nunc Maxisorb), by adding 100 ll per well. Purified S.
typhi recombinant or native flagellins, at different concentrations (01 lg ml-1), spiked in control human serum
(1:100 dilution 1 % BSA solution in PBS, 0.1 % Tween20), were added to different capture antibody-coated wells
(100 ll per well) and incubated for an hour at 37 C. Biotinylation of P4D9 and P10F11 anti-flagellin mAbs was
performed by EZ-Link Sulfo-NHS-Biotinylation Kit
(Thermo Scientific Pierce, Rockford, IL, USA), which
were used as detection antibody. Antibody bound to the
antigen was detected by anti-biotinHRP conjugate (Cell
Signaling Technology, Inc., MA, USA). Control human
serum (1:100 dilution 1 % BSA solution in PBS, 0.1 %
Tween-20) was used as the negative control.
Amplification of antibody variable region genes
Total RNA was extracted from hybridoma cells using TRI
reagent (Amresco). cDNA was generated by reverse transcription Protoscript I RT Kit (New England Biolabs Ltd.
Ontario, Canada), using the consensus primers for mouse
antibody heavy and light variable region genes [35]. The
PCR-amplified VH and VL were cloned, using pGEM-T
Easy Vector System I TA cloning kit (Promega Corp.
USA), and clones were sequenced. The IMGT/HighVQUEST analysis tool (available at http://www.imgt.org/
IMGT_vquest/vquest) was used for genetic diversity analysis of antibody sequences [36].

Estimation of cytokines
HEK-hTLR5 and HEK-vector control stable cells (Novus
Biologicals, LLC, USA), were cultured in 96-well plates
(5 9 105 cells per well), in DMEM media, supplemented
with 10 % (v/v) fetal bovine serum and blasticidin
(10 lg ml-1), at 37 C in 5 % CO2. Cells were treated with
the mixture of variable concentrations of native flagellin (0,
0.5, 1 ng ml-1) and monoclonal antibody. Supernatants
were collected after 12 h, for cytokine assay. Cytokine
levels were determined using BD OptEIATMBD Biosciences IL-8 ELISA kit (BD Biosciences San Jose, CA,
USA).
Statistical analysis
Students t test was used for statistical analysis. p values of
\0.05 were considered significant.

Results
Native and recombinant flagellin protein
was purified and characterized
S. typhi fliC gene constructs in pPROEXHTb as illustrated in
Fig. 1, for the expression of recombinant flagellin (full
length; 1-512 AA; *52 kDa) and hyper-variable middle
region of fliC expressing recombinant flagellin (middle region; 144-316 AA; *25 kDa) were used (Fig. 1a, b).
Rosetta-gamiTM (DE3) E. coli cell lysate confirmed protein
expression, with majority being in soluble fraction. Affinity
purification yielded pure S. typhi flagellin protein, which
was resolved on 15 % Tris-glycine, SDS-PAGE (Fig. 1c).
Similarly, both full-length (*52 kDa) and middle-region
(*25 kDa) recombinant flagellin proteins of S. typhimurium were purified and resolved on 15 % Tris-glycine,
SDS-PAGE (Fig. 1c). The yield for all the proteins was
*10 mg l-1 ([80 % pure) of culture. His-specific immunoblotting confirmed expression of these proteins
(Fig. 1d).
Furthermore, SDS-PAGE analysis showed a single band
of native isolated flagellin protein of 52 kDa, for both S.
typhi and S. typhimurium, with yields of 0.75 and
0.35 mg l-1 of culture, respectively (Fig. 1e).
Purification and characterization of S. typhi
anti-flagellin mAbs
Hybridoma technology generated four robust monoclonals,
which produced antibody against S. typhi native flagellin.
Purified monoclonal antibody showed a band of heavy and

123

Immunol Res

Analysis of stability and antigen-binding strength

of anti-flagellin mAbs

light chains, at their respective molecular weights, when

resolved on 15 % Trisglycine, SDS-PAGE (Fig. 2a). The
titers for mAbs were determined by ELISA (Fig. 2b).
Antigen-binding property of mAbs was detected by ELISA
(in soluble form), Western blot (denatured form), and flow
cytometry (Fig. 2). Three anti-flagellin mAbs (P10F11,
P8F3, and P8F10) did not show any cross-reaction with the
other Salmonella strains, while one of the mAbs bound to
the native flagellin of both S. typhi and S. typhimurium
(Fig. 2c, d). Moreover, when recombinant flagellin (full
length) was used for binding analysis of mAbs, it showed
similar reaction, as shown by native flagellins (Fig. 2c, d).
However, with the recombinant flagellin (middle region),
these mAbs showed specific binding to S. typhi only, except P4D9 mAb, which did not show any binding with
either S. typhi or S. typhimurium (Fig. 2c, d).
Binding analysis of mAbs to flagellin attached on bacterial surface, performed by flow cytometry, showed
binding specificity to S. typhi, for the monoclonals, except
P4D9 mAb, which was found to bind both with S. typhi and
S. typhimurium. None of the four monoclonals exhibited
any cross-reaction with other bacteria (Fig. 2e, f).

The binding properties of the anti-flagellin mAbs were

more or less comparable among themselves, except
P10F11 clone, which showed a sturdier binding than the
other mAbs, in different conditions. Three S. typhi-specific
mAbs showed extremely stable binding up to 2 M KSCN
([90 %) and a slight decline in binding at higher concentration of KSCN ([70 %), while P4D9 clone showed
comparable stability (up to 65 %), at higher concentration
of KSCN (Fig. 3a). Monoclonals showed similar binding in
a pH range of 49. Moreover, P8F3 and P8F10 mAbs
showed sharp decline in binding at pH 4. Decline in
binding of P4D9 mAb was observed at pH 2.5, while pH
did not have any effect on binding of P10F11 (Fig. 3b).
Furthermore, binding of mAbs in the presence of high
concentrations of urea (up to 6 M), DMSO (up to 10 %),
and NaCl (4 M) was observed to be stable and comparable
(Fig. 3ce). Competitive ELISA was performed to confirm
the binding strength of the two sources of S. typhi flagellin,
native and recombinant, to different mAbs. Recombinant

Fig. 4 Kinetic analysis of the S. typhi native flagellin/anti-flagellin

mouse monoclonal antibody interaction: Sensorgrams for a mAb
clone P4D9 (920 RU ligand density), b mAb clone P10F11 (1800 RU
ligand density), c mAb clone P8F3 (1050 RU ligand density), and
d mAb clone P8F10 (1600 RU ligand density), generated in a single-

analyte injection step. Each sensorgram display the response from the
five native flagellin concentrations: i 100 nM, ii 33.33 nM, iii
11.11 nM, iv 3.70 nM, and v 1.23 nM, interacting with one immobilization level of mAbs. Straight lines represent the global fit of the
sensorgrams to a 1:1 kinetic interaction model. RU response unit

123

Immunol Res
Table 1 Kinetics and analysis of V region of mouse monoclonal antibodies against S. typhi flagellin
Clone

P4D9
P10F11
P8F3
P8F10

Variable
region

Germline
(accession
number)

No. of
mutations

No. of mutations

Antigenantibody interaction (by SPR)

CDR

KD (M)

Total

R/S

Ka or kon
(M-1s-1)

Kd or koff
(s-1)

5.52E - 10

6.76E ? 04

3.73E - 05

5.68E - 10

3.53E ? 05

2.01E - 04

1.02E - 08

3.39E ? 05

3.44E - 03

7.88E - 09

3.06E ? 05

2.41E - 03

CDR/FR

FR
R/S
ratio

R/S

R/S
ratio

VL

IGKV1-133*01F (Z72382)

13

4/9

3/1

8/1

VH

IGHV1S56*01 F (M34987)

22

4/18

3/1

11/7

1.57

VL

IGKV1-117*02 F (M28134)

16

6/10

4/2

8/2

VH

IGHV1S56*01 F (M34987)

22

4/18

3/1

11/7

1.57

VL

IGKV6-14*01 F (Y15975)

17

3/12

3/0

ND

12/0

ND

VH

IGHV1S56*01 F (M34987)

22

4/18

3/1

11/7

1.57

VL

IGKV1-135*01 F (Z72384)

14

6/8

5/1

6/2

VH

IGHV1S56*01 F (M34987)

23

4/19

3/1

11/8

1.37

SPR surface plasmon resonance, CDR complementarity-determining region, FR framework region, VL variable light chain, VH variable heavy
chain, R replacement mutations, S silent mutations, ND not determined

flagellin showed varying competitive binding in the solution, increasing with rising antigen concentration (Fig. 3f).
Similarly, native flagellin exhibited inhibition but less than
recombinant antigen (Fig. 3g). This indicated that all the
mAbs were binding best to the recombinant antigen.
Affinity and diagnostic potential of S. typhi
anti-flagellin mAbs
The affinity interactions between monoclonal antibodies and
native flagellin of S. typhi were measured by the SPR instrument as a change in refractive index over time. The
sensorgram data obtained were fitted using a simple 1:1
bimolecular interaction model (Langmuir algorithm).
Hence, the kinetic parameters such as association (ka or kon),
dissociation (kd or koff), and equilibrium (KD) constants
value were calculated for binding of Ag, with immobilized
mAbs using the software. The calculated KD values were
found to be in the nanomolar (C10-9 M) range, for all the
mAbs, representing their high affinity toward native flagellin
of S. typhi (Fig. 4). The affinities of P4D9 and P10F11
mAbs were highest and comparable and thus of high diagnostic potential (Fig. 4a, b). P8F3 showed moderate affinity
with a high dissociation rate, while P8F10 had lowest affinity with a high dissociation rate (Fig. 4c, d; Table 1).
Sandwich ELISA was performed with the pair of antibodies
(S. typhi anti-flagellin capture mAbs and biotinylated antiflagellin detection antibodies), in order to demonstrate the
application of S. typhi anti-flagellin mAbs, for specific detection of flagellin in the test serum. Pure recombinant fulllength or middle-region or native S. typhi flagellin in different dilutions (01 lg ml-1), spiked in control human
serum (1:100 dilution 1 % BSA solution in PBS, 0.1 %
Tween-20), were detected in P10F11 and P8F3 monoclonal
antibody-coated wells, using the P4D9 or P10F11

biotinylated anti-flagellin mAbs (Fig. 5). Both P10F11 and

P8F3 specifically captured recombinant full-length, middleregion, and native flagellin in a comparable lower limit, i.e.,
*15 ng ml-1 antigen, in the spiked control human serum
(Fig. 5a, b). Combination of P8F3 and biotinylated P10F11
as capture and detection mAbs exhibited specific detection
of the middle region of S. typhi flagellin, spiked in control
human serum (Fig. 5a). However, the ELISA pair of P10F11
and biotinylated P4D9, as expected, did not generate signals
in the wells containing recombinant middle region of S.
typhi flagellin, spiked in control human serum (Fig. 5b).
Amplification of variable region of S. typhi
anti-flagellin mAbs
The variable regions of both the light (VL) and heavy (VH)
chains, from all the hybridoma clones of S. typhi antiflagellin mouse mAbs, were amplified by RT-PCR, cloned
separately, and sequenced. Sequence alignment of all the
four mAbs depicted 100 % similarity in the variable heavy
chain, while light chain showed dissimilarity in amino acid
sequence of CDR-L1 and CDR-L2 and in the framework
region. Germline sequences of mouse monoclonal antibodies were identified by searching the International
ImMunoGeneTics database, to analyze genetic origin, diversity, and level of maturation of the selected monoclonal
antibodies. The four monoclonal antibodies shared a
similar VH germline; IGHV1S56*01F. However, their VL
germlines were different, showing sequence alignment
with IGHV (for VH) and IGKV (for VL) subgroups
(Table 1). The VH and VL regions of mAbs showed replacement (R) and silent (S) mutations in sequences located in the complementarity-determining region (CDR)
and framework region (FR), which are listed in Table 1.
FR showed more R and S mutations than CDR, associated

123

Immunol Res

Fig. 5 Assessment of the sensitivity of sandwich ELISA for the

specific capture and detection of soluble S. typhi flagellin antigen
spiked in the control human serum. Microwells were coated using the
optimum concentration of the anti-flagellin mouse mAbs (5 lg ml-1),
P8F3 a or P10F11 b and then reacted with purified soluble S. typhi
recombinant or native flagellins at different concentrations
(01 lg ml-1) spiked in control human serum (1:100 dilution 1 %

BSA solution in PBS, 0.1 % Tween-20). Biotinylated a P10F11 and

b P4D9 S. typhi anti-flagellin mAbs (1 lg ml-1) were used as
detection antibody, and the presence of antigen bound to the
antibodies (i.e., ELISA pairs) was detected by anti-biotinHRP
conjugate (Cell Signaling). Control human serum was used as the
negative control. Results are expressed as the mean SD optical
density at 450 nm

with both VH and VL gene, when sequences of mAbs were

compared to their germline (Table 1).

reversal of TLR5-mediated immune response by P4D9

mAb, generated on binding to its ligand flagellin.

Demonstration of TLR5 inhibition by S. typhi

anti-flagellin mAbs

Discussion

To assess whether mAbs can reverse the effect of the

flagellin binding to TLR5, which mediate IL-8 secretion, in
culture supernatant, we determined the IL-8 cytokine
levels, by adding varying concentration of mAbs in the
culture medium, before adding flagellin (TLR5 ligand).
Out of all S. typhi-specific mAbs, only the P4D9 mAb (at
concentration of 0.5 and 1 lg ml-1) showed significant
reduction in IL-8 levels, as compared to vector control cells
(Fig. 6a). Furthermore, on increasing the concentration of
antibody up to 4 lg ml-1, level of IL-8 became similar to
that of vector control (Fig. 6b). This demonstrated, in vitro,

Typhoid fever is a significant global health problem, and its

burden is comparable to some of the diseases prevalent
worldwide. However, the current diagnostic modalities for
the typhoid fever have limitations in terms of sensitivity/
specificity and in their approach to universal application.
Since the absence of reliable diagnostic methods generally
hampers estimation of the true magnitude and its management, hence, there is undoubtedly a demand for reliable, simple, and affordable diagnostic test for typhoid
fever, particularly in developing countries, where the need
is greatest. Possibly the under-explored antigen detection,

123

Immunol Res

Fig. 6 Inhibition of TLR5-mediated immune response by S. typhi

anti-flagellin monoclonal antibodies. IL-8 cytokine was estimated in
the culture supernatant of HEK-hTLR5 stable cells treated with
mixture of S. typhi native flagellin and anti-flagellin monoclonal
antibodies. HEK-vector control was used as negative control. a HEKhTLR5 stimulated with native flagellin (0, 0.5, 1 ng ml-1), and

inhibition by mAbs (at 0, 0.5, 1 lg ml-1) was calculated by

quantitative estimation of IL-8 (pg ml-1). b Inhibition by P4D9
mAb; on increasing the concentration (at 0, 1, 2, 4 lg ml-1), reached
comparable to the basal level of IL-8 secreted, by vector control. Data
are expressed as mean SE (pg ml-1), (* ? p\0.05; Students
t test)

rather than antibody detection, could provide such a test.

Earlier reports suggested detection of S. typhi antigen in the
urine of some typhoid patients by co-agglutination [37] and
ELISA [38, 39]. However, their specificity varies from 25
to 90 %. S. typhi Vi antigen was detected in the urine of
most patients with typhoid fever during the first week of
fever onset, when monoclonal Vi capture antibody was
used, in the ELISA, for antigen detection [40].
Therefore, through this study, we advocate the use of
unique epitopes of S. typhi flagellin for the generation and
screening of highly specific mAbs, for developing S. typhispecific antigen-detection-based immunodiagnostic kits.

For this purpose, to ensure the native conformation of

specific epitopes, native flagellin (*52 kDa) was isolated
from a strain of S. typhi (Fig. 1e). Isolated native flagellin
from bacteria was immunogenic and elicited generation of
four highly specific monoclonal antibodies, against S. typhi
flagellin protein. Earlier reports showed isolation of native
flagellin of *52 kDa from Salmonella culture [4145] and
production of anti-flagellin monoclonal antibodies [42, 46,
47]. We have also isolated genomic DNA, from the clinical
isolate, to perform PCR amplification of fliC gene encoding
phase 1-d flagellin. Expression of full-length (1-512 AA)
recombinant S. typhi flagellin of *52 kDa as fusion

123

Immunol Res

protein along with His-tag was also performed (Fig. 1c).

Previously, recombinant flagellin as a fusion protein has
been expressed using E. coli system [42, 43, 48, 49]. In our
current study, we also expressed hyper-variable middle
region of flagellin protein (MW: *25 kDa; 144-316 AA),
as a fusion protein (Fig. 1d).
Notably, for highest specificity, we used middle region
of S. typhi flagellin protein, for screening of the generated
monoclonal antibodies. Out of four antibodies generated,
three (P10F11, P8F3, and P8F10) showed specificity to S.
typhi flagellin. However, one (P4D9) was reactive to the
flagellin of both S. typhi and S. typhimurium (Fig. 2c, d).
Conceivably, this cross-reactivity of the pan mAb (P4D9)
was due to the contribution of N or C terminus conserved
epitopes of flagellin protein, since this mAb was unable to
bind to the variable middle region of flagellin from both S.
typhi and S. typhimurium. This phenomenon has also been
reported earlier [47]. Additionally, enhanced specificity in
antibody detection, by middle region, has been exploited
against S. enterica serotype Enteriditis, in poultry [50, 51],
and in case of S. enterica serovar Brandenburg (S. brandenburg) infection, in sheep [52].
Monoclonal antibodies were further characterized by
ELISA and competitive ELISA. Competitive ELISA depicted exalted binding strength of S. typhi recombinant
flagellin in the solution, in comparison with the native
flagellin (Fig. 3f, g). Additionally, the binding of mAbs to
antigen was highly stable in the presence of different
agents that are conventionally known to destabilize antigenantibody interactions, namely KSCN, DMSO, and
urea, by disrupting hydrophobic interaction and NaCl and
pH variations which affect electrostatic interactions
(Fig. 3ae). These anti-flagellin mAbs had affinity (Kd)
values C10-9 M, as was observed by SPR technique. The
very high affinity and stability of these mAbs, produced in
this study, indicate their high antigen binding, thereby
signifying their diagnostic potential (Fig. 4; Table 1).
Moreover, sequence analysis for somatic mutations (R and
S), across the antibody V regions of mouse monoclonals
and their comparison with their germline counterpart, reveals that these antibodies have evolved and attained their
high affinity through antigen-biased somatic hyper-mutation phenomenon. It has been reported earlier that an increase in affinity and specificity of clones are optimized by
somatic mutations and are antigen-driven processes, which
results in amplification of positively selected high-affinity
clones [53, 54]. Thus, our study has generated robust
monoclonal antibodies for specific detection of S. typhi
flagellin.
Moreover, in this study, we have also analyzed these
mAbs ability, to inhibit TLR5flagellin complex. For this
purpose, we have exploited the well-established fact that
TLR5 is activated by its only characterized ligand flagellin

123

[55, 56], using an in vitro system, namely HEK-hTLR5

cells, which express TLR5 constitutively and, on stimulation with flagellin, trigger activation of the transcription
factor NF-jB for production of cytokines (IL-8 or IL-6)
[57]. It was evident from the results that, as expected, only
pan monoclonal antibody (P4D9), which probably binds to
C terminal conserved region of flagellin, reversed the
TLR5-mediated immune response to a certain extent
(Fig. 6). It has been depicted earlier that TLR5 is induced
by binding to the C terminus of the flagellin protein [56,
58]. Therefore, this could possibly help to circumvent
flagellins role in regulating virulence and development of
Salmonella-induced colitis [27, 59] as well as in Crohns
disease [60].
Furthermore, through this study, we have, for the first
time, showed binding analysis of these monoclonal antibodies to the S. typhi flagellin, by flow cytometry, which
demonstrates the practical possibility of detection of native
conformation of flagellin, present on different bacterial
surface, characterized by higher specificity and no crossreactivity (Fig. 2e, f). Therefore, these mAbs may be used in
the generation of rapid and real-time systems for the detection of flagellated bacteria in contaminated food and therefore prevent intestinal infections. In the present study,
through the sandwich ELISA, we have demonstrated the
application of these anti-flagellin mAbs, in developing a test
for detecting soluble flagellin in serum, using P10F11 and
P8F3, the two potent anti-flagellin mAbs as capture antibody
and biotinylated P4D9 and P10F11 anti-flagellin mAbs as
detecting antibodies. This sandwich ELISA appears to be
quite sensitive with a detection limit of about 15 ng ml-1
(Fig. 5a, b). Our findings are also in corroboration with a
previous report which used murine mAb-based dual-antibody sandwich ELISA for rapid detection of S. typhi flagellar
antigen in patient serum [46].
In conclusion, we have generated a repertoire of robust
monoclonal antibodies against S. typhi flagellin, which may
be used in the development of improved diagnostics, particularly in terms of rapidity, sensitivity, and specificity,
vis-a-vis the ones currently available. This is in keeping
with the still at-large endemicity and disease burden of
typhoid fever, in our country, underlining the importance
of accurate diagnostics, as the mainstay of disease
surveillance as well as informed policy decisions.
Acknowledgments The authors gratefully acknowledge Dr. Ayub
Qadri (National Institute of Immunology, New Delhi, India) and Dr.
Bhabatosh Das (Translational Health Science and Technology Institute), for providing Salmonella strains. This study was supported by
grant from Department of Biotechnology, Government of India, to
Centre for Bio-design and Diagnostics, Translational Health Science
and Technology Institute, and the core grant of Translational Health
Science and Technology Institute to AT. C S was supported by Innovation Award from Centre for Bio-design and Diagnostics.

Immunol Res
Conflict of interest
of interest.

The authors declare that they have no conflict

18.

Ethical standards All procedures performed in this study involving

animals were in accordance with the ethical standards of the institution or practice at the International Centre for Genetic Engineering
and Biotechnology, New Delhi, India.

19.

20.

References
1. Bhan MK, Bahl R, Bhatnagar S. Typhoid and paratyphoid fever.
Lancet. 2005;366(9487):74962. doi:10.1016/S0140-6736(05)67
181-4.
2. Connor BA, Schwartz E. Typhoid and paratyphoid fever in
travellers. Lancet Infect Dis. 2005;5(10):6238. doi:10.1016/
S1473-3099(05)70239-5.
3. Crump JA, Luby SP, Mintz ED. The global burden of typhoid
fever. Bull World Health Organ. 2004;82(5):34653.
4. Parry CM, Wijedoru L, Arjyal A, Baker S. The utility of diagnostic tests for enteric fever in endemic locations. Expert Rev
Anti Infect Ther. 2011;9(6):71125. doi:10.1586/eri.11.47.
5. Maurice J. A first step in bringing typhoid fever out of the closet.
Lancet. 2012;379(9817):699700.
6. Sinha A, Sazawal S, Kumar R, Sood S, Reddaiah VP, Singh B,
et al. Typhoid fever in children aged less than 5 years. Lancet.
1999;354(9180):7347. doi:10.1016/S0140-6736(98)09001-1.
7. Brooks WA, Hossain A, Goswami D, Nahar K, Alam K, Ahmed
N, et al. Bacteremic typhoid fever in children in an urban slum,
Bangladesh. Emerg Infect Dis. 2005;11(2):3269. doi:10.3201/
eid1102.040422.
8. Siddiqui FJ, Rabbani F, Hasan R, Nizami SQ, Bhutta ZA.
Typhoid fever in children: some epidemiological considerations
from Karachi, Pakistan. Int J Infect Dis. 2006;10(3):21522.
doi:10.1016/j.ijid.2005.03.010.
9. Gasem MH, Dolmans WM, Keuter MM, Djokomoeljanto RR.
Poor food hygiene and housing as risk factors for typhoid fever in
Semarang, Indonesia. Trop Med Int Health. 2001;6(6):48490.
10. Ram PK, Naheed A, Brooks WA, Hossain MA, Mintz ED,
Breiman RF, et al. Risk factors for typhoid fever in a slum in
Dhaka, Bangladesh. Epidemiol Infect. 2007;135(3):45865.
doi:10.1017/S0950268806007114.
11. House D, Bishop A, Parry C, Dougan G, Wain J. Typhoid fever:
pathogenesis and disease. Curr Opin Infect Dis. 2001;14(5):
5738.
12. Parry CM, Hien TT, Dougan G, White NJ, Farrar JJ. Typhoid
fever. N Engl J Med. 2002;347(22):177082. doi:10.1056/
NEJMra020201.
13. World Health Organization. Background document: the diagnosis, treatment and prevention of typhoid fever. World Health
Organization; 2003. http://www.who.int/immunization/documents/
WHO_VB_03.07/en/. Accessed 06 Dec 2012.
14. Peacock SJ, Newton PN. Public health impact of establishing the
cause of bacterial infections in rural Asia. Trans R Soc Trop Med
Hyg. 2008;102(1):56. doi:10.1016/j.trstmh.2007.06.004.
15. Widal F. Serodiagnostique de la fievre typhoid. Semaine Med.
1896;16:259.
16. Hatta M, Goris MG, Heerkens E, Gooskens J, Smits HL. Simple
dipstick assay for the detection of Salmonella typhi-specific IgM
antibodies and the evolution of the immune response in patients
with typhoid fever. Am J Trop Med Hyg. 2002;66(4):41621.
17. Cooper GL, Nicholas RA, Bracewell CD. Serological and bacteriological investigations of chickens from flocks naturally

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

infected
with
Salmonella
enteritidis.
Vet
Rec.
1989;125(23):56772.
Nicholas RA, Cullen GA. Development and application of an
ELISA for detecting antibodies to Salmonella enteritidis in
chicken flocks. Vet Rec. 1991;128(4):746.
Timoney JF, Sikora N, Shivaprasad HL, Opitz M. Detection of
antibody to Salmonella enteritidis by a gm flagellin-based
ELISA. Vet Rec. 1990;127(7):1689.
Jesudason MV, Sivakumar S. Prospective evaluation of a rapid
diagnostic test Typhidot for typhoid fever. Indian J Med Res.
2006;123(4):5136.
Preechakasedkit P, Pinwattana K, Dungchai W, Siangproh W,
Chaicumpa W, Tongtawe P, et al. Development of a one-step
immunochromatographic strip test using gold nanoparticles for
the rapid detection of Salmonella typhi in human serum. Biosens
Bioelectron. 2012;31(1):5626. doi:10.1016/j.bios.2011.10.031.
Kerr S, Ball HJ, Mackie DP, Pollock DA, Finlay DA. Diagnostic
application of monoclonal antibodies to outer membrane protein
for rapid detection of Salmonella. J Appl Bacteriol.
1992;72(4):3028.
Brigmon RL, Zam SG, Wilson HR. Detection of Salmonella
enteritidis in eggs and chicken with enzyme-linked immunosorbent assay. Poult Sci. 1995;74(7):12326.
Blais BW, Martinez-Perez A. Detection of group D Salmonellae
including Salmonella enteritidis in eggs by polymyxin-based
enzyme-linked immunosorbent assay. J Food Prot. 2008;
71(2):3926.
Iino T, Komeda Y, Kutsukake K, Macnab RM, Matsumura P,
Parkinson JS, et al. New unified nomenclature for the flagellar
genes of Escherichia coli and Salmonella typhimurium. Microbiol
Rev. 1988;52(4):5335.
Donnelly MA, Steiner TS. Two nonadjacent regions in enteroaggregative Escherichia coli flagellin are required for activation of toll-like receptor 5. J Biol Chem. 2002;277(43):
4045661. doi:10.1074/jbc.M206851200.
Khan MA, Kang J, Steiner TS. Enteroaggregative Escherichia
coli flagellin-induced interleukin-8 secretion requires Toll-like
receptor 5-dependent p38 MAP kinase activation. Immunology.
2004;112(4):65160. doi:10.1111/j.1365-2567.2004.01923.x.
de Vries N, Zwaagstra KA, Huis int Veld JH, van Knapen F, van
Zijderveld FG, Kusters JG. Production of monoclonal antibodies
specific for the i and 1,2 flagellar antigens of Salmonella typhimurium and characterization of their respective epitopes. Appl
Environ Microbiol. 1998;64(12):50338.
Wei LN, Joys TM. Covalent structure of three phase-1 flagellar
filament proteins of Salmonella. J Mol Biol. 1985;186(4):
791803.
Newton SM, Wasley RD, Wilson A, Rosenberg LT, Miller JF,
Stocker BA. Segment IV of a Salmonella flagellin gene specifies
flagellar antigen epitopes. Mol Microbiol. 1991;5(2):41925.
Subramanian N, Qadri A. Lysophospholipid sensing triggers secretion of flagellin from pathogenic salmonella. Nat Immunol.
2006;7(6):5839. doi:10.1038/ni1336.
Das B, Kumari R, Pant A, Sen Gupta S, Saxena S, Mehta O, et al.
A novel, broad-range, CTXPhi-derived stable integrative expression vector for functional studies. J Bacteriol.
2014;196(23):407180. doi:10.1128/JB.01966-14.
Smith KD, Andersen-Nissen E, Hayashi F, Strobe K, Bergman
MA, Barrett SL, et al. Toll-like receptor 5 recognizes a conserved
site on flagellin required for protofilament formation and bacterial
motility. Nat Immunol. 2003;4(12):124753. doi:10.1038/ni1011.
Tiwari A, Dutta D, Khanna N, Acharya SK, Sinha S. Generation
and characterization of high affinity humanized fab against hepatitis B surface antigen. Mol Biotechnol. 2009;43(1):2940.
doi:10.1007/s12033-009-9165-9.

123

Immunol Res
35. Tiwari A, Khanna N, Acharya SK, Sinha S. Humanization of high
affinity anti-HBs antibody by using human consensus sequence
and modification of selected minimal positional template and
packing residues. Vaccine. 2009;27(17):235666. doi:10.1016/j.
vaccine.2009.02.019.
36. Brochet X, Lefranc MP, Giudicelli V. IMGT/V-QUEST: the
highly customized and integrated system for IG and TR standardized V-J and V-D-J sequence analysis. Nucl Acids Res.
2008;36(Web Server issue):W5038. doi:10.1093/nar/gkn316.
37. West B, Richens JE, Howard PF. Evaluation in Papua New
Guinea of a urine coagglutination test and a Widal slide agglutination test for rapid diagnosis of typhoid fever. Trans R Soc
Trop Med Hyg. 1989;83(5):7157.
38. Banchuin N, Appassakij H, Sarasombath S, Manatsathit S,
Rungpitarangsi B, Komolpit P, et al. Detection of Salmonella
typhi protein antigen in serum and urine: a value for diagnosis of
typhoid fever in an endemic area. Asian Pac J Allergy Immunol.
1987;5(2):1559.
39. Chaicumpa W, Ruangkunaporn Y, Burr D, Chongsa-Nguan M,
Echeverria P. Diagnosis of typhoid fever by detection of Salmonella typhi antigen in urine. J Clin Microbiol.
1992;30(9):25135.
40. Fadeel MA, Crump JA, Mahoney FJ, Nakhla IA, Mansour AM,
Reyad B, et al. Rapid diagnosis of typhoid fever by enzymelinked immunosorbent assay detection of Salmonella serotype
typhi antigens in urine. Am J Trop Med Hyg. 2004;70(3):3238.
41. Ibrahim GF, Fleet GH, Lyons MJ, Walker RA. Method for the
isolation of highly purified Salmonella flagellins. J Clin Microbiol. 1985;22(6):10404.
42. Sukosol T, Sarasombath S, Mongkolsuk S, Songsivilai S, Chaiyaroj S, Pongsunk S, et al. Molecular cloning and expression of
Salmonella typhi flagellin: characterization of 52 kDa specific
antigen of S. typhi. Asian Pac J Allergy Immunol. 1993;11(1):
5769.
43. Nempont C, Cayet D, Rumbo M, Bompard C, Villeret V, Sirard
JC. Deletion of flagellins hypervariable region abrogates antibody-mediated neutralization and systemic activation of TLR5dependent immunity. J Immunol. 2008;181(3):203643.
44. Hiriart Y, Errea A, Maciel DG, Lopez JC, Rumbo M. A method
for the purification of bacterial flagellin that allows simple upscaling. World J Microbiol Biotechnol. 2012;28(1):1521.
doi:10.1007/s11274-011-0786-3.
45. Mitra R, Bhan S, Nath G, Kumar N, Ali Z. Development of a novel
rapid immunodiagnostic kit based on flagellar 40 kDa antigen
epitope for the detection of typhoid fever in Indian patients. Sci
World J. 2013;2013:363652. doi:10.1155/2013/363652.
46. Sadallah F, Brighouse G, Del Giudice G, Drager-Dayal R, Hocine
M, Lambert PH. Production of specific monoclonal antibodies to
Salmonella typhi flagellin and possible application to immunodiagnosis of typhoid fever. J Infect Dis. 1990;161(1):5964.
47. Hiriart Y, Serradell M, Martinez A, Sampaolesi S, Maciel DG,
Chabalgoity JA, et al. Generation and selection of anti-flagellin
monoclonal antibodies useful for serotyping Salmonella enterica.
SpringerPlus. 2013;2:640. doi:10.1186/2193-1801-2-640.

123

48. Sukosol T, Sarasombath S, Songsivilai S, Ekpo P, Rungpitarangsi

B, Pang T. Fusion protein of Salmonella typhi flagellin as antigen
for diagnosis of typhoid fever. Asian Pac J Allergy Immunol.
1994;12(1):215.
49. Malapaka RR, Adebayo LO, Tripp BC. A deletion variant study
of the functional role of the Salmonella flagellin hypervariable
domain region in motility. J Mol Biol. 2007;365(4):110216.
doi:10.1016/j.jmb.2006.10.054.
50. Mizumoto N, Toyota-Hanatani Y, Sasai K, Tani H, Ekawa T,
Ohta H, et al. Detection of specific antibodies against deflagellated Salmonella enteritidis and S. enteritidis FliC-specific 9 kDa
polypeptide. Vet Microbiol. 2004;99(2):11320. doi:10.1016/j.
vetmic.2003.11.009.
51. Yap LF, Low S, Liu W, Loh H, Teo TP, Kwang J. Detection and
screening of Salmonella enteritidis-infected chickens with recombinant flagellin. Avian Dis. 2001;45(2):4105.
52. Perera K, Murray A. Development of an indirect ELISA for the
detection of serum IgG antibodies against region IV of phase 1
flagellin of Salmonella enterica serovar Brandenburg in sheep.
J Med Microbiol. 2009;58(Pt 12):157681. doi:10.1099/jmm.0.
010090-0.
53. Tonegawa S. Somatic generation of antibody diversity. Nature.
1983;302(5909):57581.
54. Bose B, Sinha S. Problems in using statistical analysis of replacement and silent mutations in antibody genes for determining antigendriven affinity selection. Immunology. 2005;116(2):17283. doi:10.
1111/j.1365-2567.2005.02208.x.
55. Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Goodlett
DR, et al. The innate immune response to bacterial flagellin is
mediated by Toll-like receptor 5. Nature. 2001;410(6832):
1099103. doi:10.1038/35074106.
56. Smith MF Jr, Mitchell A, Li G, Ding S, Fitzmaurice AM, Ryan K,
et al. Toll-like receptor (TLR) 2 and TLR5, but not TLR4, are
required for Helicobacter pylori-induced NF-kappa B activation
and chemokine expression by epithelial cells. J Biol Chem.
2003;278(35):3255260. doi:10.1074/jbc.M305536200.
57. Huang LY, Dumontelle JL, Zolodz M, Deora A, Mozier NM,
Golding B. Use of toll-like receptor assays to detect and identify
microbial contaminants in biological products. J Clin Microbiol.
2009;47(11):342734. doi:10.1128/JCM.00373-09.
58. Lightfield KL, Persson J, Brubaker SW, Witte CE, von Moltke J,
Dunipace EA, et al. Critical function for Naip5 in inflammasome
activation by a conserved carboxy-terminal domain of flagellin.
Nat Immunol. 2008;9(10):11718. doi:10.1038/ni.1646.
59. Stecher B, Hapfelmeier S, Muller C, Kremer M, Stallmach T,
Hardt WD. Flagella and chemotaxis are required for efficient
induction of Salmonella enterica serovar Typhimurium colitis in
streptomycin-pretreated mice. Infect Immun. 2004;72(7):
413850. doi:10.1128/IAI.72.7.4138-4150.2004.
60. Lodes MJ, Cong Y, Elson CO, Mohamath R, Landers CJ, Targan
SR, et al. Bacterial flagellin is a dominant antigen in Crohn disease. J Clin Invest. 2004;113(9):1296306. doi:10.1172/JCI20295.