Original Article

Detection of novel strains genetically related to Anaplasma platys in

Tunisian one-humped camels (Camelus dromedarius)
Hanne Belkahia1,2, Mourad Ben Said1, Lotfi Sayahi3, Alberto Alberti4, Lilia Messadi1
1

Laboratoire de Microbiologie, Ecole Nationale de Mdecine Vtrinaire, Institution de la Recherche et de

lEnseignement Suprieur Agricoles, Universit de La Manouba, 2020 Sidi Thabet, Tunisia
2
Facult des Sciences de Bizerte, Universit de Carthage, 7021 Jarzouna, Tunisia
3
Commissariat rgional au dveloppement agricole de Sidi Bouzid, 9100 Sidi Bouzid, Tunisia
4
Dipartimento di Medicina Veterinaria, Universit degli Studi di Sassari, Sassari, Italy
Abstract
Introduction: Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this
gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels.
Methodology: A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by
quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were
characterized by 16S rRNA sequence analysis.
Results: Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A.
bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H.
dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence
variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to
A. platys.
Conclusions: This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various
bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to
detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial
species related to A. platys.

Key words: Anaplasma species; Dromedary (Camelus dromedarius); Molecular identification; 16S rRNA gene; Tunisia.
J Infect Dev Ctries 2015; 9(10):1117-1125. doi:10.3855/jidc.6950
(Received 01 April 2015 Accepted 28 May 2015)
Copyright 2015 Belkahia et al. This is an open-access article distributed under the Creative Commons Attribution License, which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction
The
genus
Anaplasma
(Rickettsiales:
Anaplasmataceae) includes Gram negative obligate
intracellular bacteria of significant importance in
veterinary and human medicine [1]. Anaplasma
marginale, the type species of Anaplasma genus, is
highly pathogenic for ruminants and poses a
considerable constraint to animal health in tropical and
subtropical regions throughout the world [2]. It causes
a variety of clinical symptoms, including fever, weight
loss, abortion, lethargy, icterus, and often death of
animals older than two years of age [2]. The closely
related species A. centrale causes mild anaplasmosis in
cattle [3,4]; for this reason, it has been used
extensively as a live vaccine for anaplasmosis control
in several countries [5]. Indeed, infection with A.
centrale induces long-lasting protective immunity in

ruminants when challenged with highly virulent A.

marginale strains [2].
A. phagocytophilum is zoonotic and infects
neutrophil granulocytes of many host species [3],
including domestic ruminants, in which it causes tickborne fever (TBF) [6,7]. The most common symptoms
of TBF are high fever, anorexia, dullness, and reduced
milk production [8]. A. bovis, a monocytotropic
species, has been detected in different ruminant
species from many countries [9,10]. It has been
isolated from cattle and deer in Japan [11-13], cattle in
Iran [14], water deer in South Korea [15], and goats in
China [10]. A. bovis infection can cause variable
clinical conditions ranging from the absence of
symptoms to fever, anemia, weight loss, abortion, and
death [16].

Belkahia1et al. Anaplasma spp. in Tunisian camels

In Sicily, Italy, strains closely related to A. platys

have been detected in neutrophils of cattle, sheep and
goats [17] and in platelets of cats [18]. Based on
genetic analyses using 16S rRNA and groEL genes,
these strains revealed very high levels of nucleotide
identity with canine A. platys strains (99% and 92%
93% identities with A. platys 16S rRNA and groEL
genes, respectively) and were placed in a distinct
monophyletic cluster closely related to A. platys
sequences [17,18].
The dromedary (Camelus dromedarius), also
known as the one-humped camel or Arabian camel, is
a species of tremendous economic value in many
countries, including Tunisia [19]. In central and
southern regions of Tunisia, dromedary is an important
source of income and is exploited for milk and meat
production [19,20]. Dromedaries can be infested by a
variety of tick species including Hyalomma
dromedarii, H. excavatum, H. marginatum, H.
lusitanicum, H. impeltatum, Rhipicephalus bursa, R.
sanguineus, R. pulchellus, R. declorotus, Amblyomma
gemma, and A. variegatum [21-25].
To date, few data on the presence of Anaplasma
species in Tunisian domestic animals, especially in
camels,
are
available.
Molecular
findings
demonstrated the occurrence of A. phagocytophilum
infections in dogs and horses [26,27], as well as A.
ovis in sheep from the northern and central areas of the
country [28]. The presence of A. phagocytophilum in
horses and dromedaries was investigated by serology
[29,30]. Indeed, surveys of anaplasmosis in camels
have been focused mainly on A. marginale [31-35].
This study aimed to establish the presence and
prevalence of Anaplasma species in Tunisian
dromedaries by sampling three different bioclimatic
areas. Molecular epidemiology of Anaplasma spp.
strains infecting camels was also investigated by
combining quantitative PCR (qPCR) with 16S rRNA
sequence analyses.
Methodology
Sampling and DNA extraction
Blood samples and ticks were collected in 2009
(May to October) from 226 apparently healthy
dromedaries spread throughout three localities:
Bouficha (governorate of Sousse, latitude 3618'N,
longitude 1027'E), belonging to semi-arid bioclimatic
area with a mean annual rainfall of 350 mm; Sidi
Bouzid (governorate of Sidi Bouzid, latitude 350'N,
longitude 929'E), belonging to arid bioclimatic area
with a mean annual rainfall of 237 mm, and Douz
(governorate of Kebili, latitude 3327'N, longitude

J Infect Dev Ctries 2015; 9(10):1117-1125.

901'E), belonging to the Saharan bioclimatic area

with a mean annual rainfall of 89 mm (Figure 1).
Blood was collected from jugular veins into EDTA
tubes (Becton Dickinson, Franklin lakes, USA). For
each animal, the studied region, approximate age,
gender, and presence/absence of ticks were noted.
Ticks collected from severely infected animals were
preserved in 70% ethanol and identified at genus and
species levels using diagnosis keys as described by
Walker et al. [36]. DNA was extracted from 300 L
volumes of EDTA-preserved whole blood using the
Wizard Genomic DNA purification kit (Promega,
Madison, USA) according to the manufacturers
instructions. DNA yields were determined with a
spectrophotometer (Jenway, Genova, Italy). DNA
samples were stored at -20C until use.
Duplex real-time PCR
DNA samples were tested for the presence of A.
marginale and A. centrale by using species-specific
primers and TaqMan probes as described by Carelli et
al. [37] and Decaro et al. [38], targeting, respectively,
a fragment of the msp1b (77 bp) and groEL (95 bp)
Figure 1. Map of Tunisian studied regions

1: Bouficha region; 2: Sidi Bouzid region; 3: Douz region

1118

Belkahia1et al. Anaplasma spp. in Tunisian camels

genes. PCR was performed using Premix Ex Taq

(Perfect Real Time) (Takara Mirus Bio, Madison,
USA) in a 7500/7500 Fast Real-Time PCR System
quantitative thermal cycler (Applied Biosystems,
Foster City, USA). PCR amplification for A.
marginale and A. centrale detection was performed in
a duplex format by optimal reaction conditions using
primers AM-For and AM-Rev at 600 nM each, probe
AM-Pb-FAM at 200 nM, primers AC-For and AC-Rev
at 900 nM each, probe AC-Pb-VIC at 200 nM, and 2
L of template DNA (Table 1). Thermal cycling
conditions included an initial activation of the Taq
DNA polymerase at 95C for 15 minutes, followed by
50 cycles of denaturation for 1 minute at 95C
followed by a 1 minute annealing-extension step at
60C. Negative and positive controls were included in
all runs.
Single and nested PCR
Primers EE1 and EE2 were used in a simple PCR
run for amplifying the 16S rRNA gene of all
Anaplasma species in dromedaries (Table 1).
Reactions were performed in a final volume
containing 0.125 U/L Taq DNA polymerase
(Biobasic Inc., Markham, Canada), 1x PCR buer, 1.5
mM MgCl2, 0.2 mM dNTPs, 2 L genomic DNA, 0.5

J Infect Dev Ctries 2015; 9(10):1117-1125.

M of the primers, and autoclaved MilliQ water to 50

L. Thermal cycling reactions were performed in an
automated thermal cycler (Techne Flexigene,
Cambridge, UK) as described previously by Liu et al.
[10]. Primers specific for A. phagocytophilum and A.
bovis were used in two distinct nested PCRs (Table 1),
in which 1 L of the simple PCR run was used as
DNA target. Thermal cycling profiles were as
previously described by Kawahara et al. [11].
Negative (distilled water) and positive (DNA extracted
from A. phagocytophilum and A. bovis) were included
in each experiment. PCR products were
electrophoresed on 1% agarose gel to check the size of
amplified fragments by comparison with a DNA
molecular weight marker (1 Kb Plus DNA Ladder,
Promega, Madison, USA).
DNA sequencing and data analysis
Nine selected positive Anaplasma spp. PCR
products (three from each sampling region) obtained
with primers EE1/EE2 were purified with the GF-1
Ambi Clean Kit (Vivantis Technologies, Subang Jaya,
Malaysia)
according
to
the
manufacturers
instructions. Purified DNA fragments were sequenced
in both directions, using the same primers as in the
PCR amplifications (Table 1). Sequencing was

Table 1. Primers and/or probes used for detection and/or characterization of Anaplasma spp., A. platys-like, A.
phagocytophilum, A. marginale, A. centrale, and A. bovis in camels in the present study
Assay

Primer /
probe

Sequence 5 to 3

EE-1

TCCTGGCTCAGAACGAACGCTGGCGGC

EE-2

AGTCACTGACCCAACCTTAAATGGCTG

Target
gene

Amplicon
Reference
size (bp)

PCR 11
Anaplasma spp.

16S rRNA

1,433

Barlough et al.
(1996)

16S rRNA

641

Kawahara et al.
(2006)

16S rRNA

551

Kawahara et al.
(2006)

msp1b

95

Carreli et al. (2007)

groEL

77

Decaro et al. (2008)

PCR 22
A. phagocytophilum

SSAP2f 3 GCTGAATGTGGGGATAATTTAT
SSAP2r 3 ATGGCTGCTTCCTTTCGGTTA

A. bovis
Duplex real-time
PCR
A. marginale

AB1f 3

CTCGTAGCTTGCTATGAGAAC

AB1r 3

TCTCCCGGACTCCAGTCTG

AM-For
AM-Rev

TTGGCAAGGCAGCAGCTT
TTCCGCGAGCATGTGCAT
6FAM-TCGGTCTAACATCTCCAGGCTTTCAT6TAMRA
CTATACACGCTTGCATCTC
CGCTTTATGATGTTGATGC
VIC-ATCATCATTCTTCCCCTTTACCTCGT6TAMRA

AM-Pb4
A. centrale

AC-For
AC-Rev
AC-Pb5

Simple PCR allowing the detection of all Anaplasma species; 2 Second PCR, performed after the Simple PCR, allowing the specific species detection of A.
phagocytophilum and A. bovis; 3 Primers used in PCR reaction for the detection of A. phagocytophilum and A. bovis; 4 The quencher dye fluorophore for the
A. marginale probe was modified on 6-carboxyl-tetramethyl-rhodamine (6TAMRA) instead of Black Hole Quencher 1 (BHQ1) used by Carreli et al. [37]; 5
The reporter and quencher dye fluorophores for the A. centrale probe were modified on 4,7,2-trichloro-7-phenyl-6-carboxyfluorescein (VIC) and 6carboxyl-tetramethyl-rhodamine (6TAMRA) instead of Texas Red and Black Hole Quencher 2 (BHQ2), respectively used by Decaro et al. [38].

1119

Belkahia1et al. Anaplasma spp. in Tunisian camels

J Infect Dev Ctries 2015; 9(10):1117-1125.

performed using a conventional Big Dye Terminator

cycle sequencing ready reaction kit (Perkin Elmer,
Applied Biosystems, Foster City, USA) and an
ABI3730XL automated DNA sequencer by Macrogen
Europe
(Amsterdam,
the
Netherlands).
Chromatograms were edited with Chromas Lite
version 2.01. Multiple sequence alignments were
obtained with DNAMAN program (Version 5.2.2;
Lynnon Biosoft, Quebec, Canada). BLAST was used
to investigate homologies with Anaplasma sequences
available in database [39]. Neighbor-joining (NJ)
phylogenetic trees were constructed using the
DNAMAN program based on Saitou and Nei distances
[40] with bootstrap analysis of 1,000 reiterations.
Sequence accession number
The 16S rRNA partial sequences of Anaplasma
spp. AspGDr1 to AspGDr4 variants were deposited in
the GenBank under accession numbers KM401905 to
KM401908, respectively.
Statistical analyses
Exact confidence intervals (CIs) for prevalence
rates at the 95% level were calculated. To study the
possible influence of location, gender, age and tick
infestation on the molecular prevalence of Anaplasma
spp., the Chi-square test or Fishers exact test were
performed using Epi Info version 6.01 with a cut-off
value of 0.05. In order to consider any confusion
factor, a Chi-square Mantel-Haenszel test was
performed.

Results
Tick identification and molecular survey of Anaplasma
species
Ticks collected from the camels belonged to the
genus Hyalomma (H. dromedarii, H. impeltatum, and
H. excavatum). The overall tick infestation prevalence
was 37.6% (85/226). Overall infection rate of
Anaplasma spp., estimated by EE1/EE2 PCR (Table
1), was 17.7% (minimum 14.8% in Sidi Bouzid and
maximum 31.3% in Bouficha) (Table 2). Moreover,
the infection rate of Anaplasma spp. was significantly
higher in female (24.5%) than in male camels (11.7%,
p = 0.027) (Table 2). Using qPCR tests specific for A.
marginale and A. centrale, and nPCRs for A. bovis and
A. phagocytophilum (Table 1), none of the classified
Anaplasma species analyzed in this study were
detected in any of the tested camels.
Molecular characterization of Anaplasma sp. 16S
rRNA genotypes
Nine PCR products obtained from nine randomly
selected camels (three from each sampling site) with
primers EE1/EE2 targeting 1,322 bp (88.5%) of the
16S rRNA gene of Anaplasma spp. were successfully
sequenced on both DNA strands. Based on nucleotide
alignments, the sequences were grouped in four
different genotypes (AspGDr1 to AspGDr4; GenBank
accession numbers KM401905 to KM401908). All
16S rRNA sequences obtained in this study shared
99.8% to 99.9% nucleotide similarity and differed
from each other in three nucleotide positions (Tables 3
and 4).

Table 2. Factors associated with molecular prevalence of Anaplasma spp. in camels from Tunisia
Number
Locality
Bouficha
Sidi Bouzid
Douz
Age
2 years
27 years
> 7 years
Gender
Male
Female
Tick infestation
infested
Not infested
Total
1
CI: 95% confidence interval; * Significant test.

Anaplasma spp.
Positive (% CI1)

32
155
39

10 (31.3 0.16)
23 (14.8 0.06)
7 (17.9 0.12)

44
109
73

8 (18.2 0.11)
24 (22.0 0.08)
8 (11.0 0.07)

120
106

14 (11.7 0.06)
26 (24.5 0.08)

84
142
226

14 (16.7 0.08)
26 (18.3 0.10)
40 (17.7 0.05)

P value
0.086

0.158

0.027*

0.754

1120

Belkahia1et al. Anaplasma spp. in Tunisian camels

J Infect Dev Ctries 2015; 9(10):1117-1125.

Table 3. Nucleotide diversity among 16S rRNA sequences (1,322 bp) from Anaplasma sp. related to A. platys isolated from
camels and other Anaplasma species found in GenBank
Anaplasma
sp.
Anaplasma
sp.

Host

Dromedary

Goat

A. platys

Dog

Variant

Sample1/isolate

GenBank2

Country

16S rRNA nucleotide positions3

Reference

91

118

130

783

923

962

1211

1214

AspGDr1

Sb1-Sb3

Tunisia

KM401905

AspGDr2

Dz1-Dz3

Tunisia

KM401906

AspGDr3

Bf1; Bf2

Tunisia

KM401907

AspGDr4

Bf3

Tunisia

KM401908

J3

J3

China

JN558826

E10

E10

China

JN558821

Okinawa

Okinawa

Japan

AY077619

Present
study
Present
study
Present
study
Present
study
Liu et al.
(2012)
Liu et al.
(2012)
Inokuma
et al.
(2002)

Bf1-Bf3, Sb1-Sb3, and Dz1-Dz3 samples were collected from Bouficha, Sidi Bouzid, and Douz localities, respectively; 2 GenBank
accession number; 3 Numbers represent the nucleotide position with respect to the clone J3 from China for Anaplasma sp. related to A.
platys (GenBank accession number JN558826); Conserved nucleotide positions are indicated with asterisks. Nucleotides: T: thymine; C:
cytosine; G: guanine; A: adenine.

Table 4. Comparison of 16S rRNA sequences (1,322 bp) from Anaplasma sp. related to A. platys isolated from camels and
other Anaplasma species found in GenBank. The numbers represent the nucleotide identity rates found between the
sequences.
A. sp
A. sp
A. sp
A. sp
(AspGDr1) (AspGDr2) (AspGDr3) (AspGDr4)
A. sp
(AspGDr1)
A. sp
(AspGDr2)
A. sp
(AspGDr3)
A. sp
(AspGDr4)

A. sp
(J3)

A. sp
(E10)

A. p
A. pl
(China(Okinawa)
C-Y)

A. b
(G49)

A. m
A. o
A. c (CC)
(Lushi)
(Jingtai)

100
99.9

100

99.8

99.9

100

99.8

99.8

99.9

100

A. sp (J3)

99.7

99.8

99.8

99.8

100

A. sp (E10)

99.6

99.7

99.8

99.7

99.8

100

99.7

99.8

99.8

99.8

99.8

99.8

100

98.7

98.8

98.9

98.8

98.9

98.8

99.0

100

A. b (G49)

97.0

97.0

97.0

97.0

96.9

97.1

96.9

97.0

100

A. m (Lushi)

97.0

97.1

97.2

97.1

97.2

97.3

97.2

97.3

96.1

100

A. c (CC)

97.0

96.9

97.0

96.9

97.0

97.0

97.1

97.2

96.3

99.3

100

A. o (Jingtai)

97.0

96.9

97.0

97.0

97.0

97.0

97.1

97.1

96.1

99.2

99.5

A. pl
(Okinawa)
A. p (China-CY)

100

A. sp (AspGDr1-4): Anaplasma sp. isolated from Tunisian dromedaries (AspGDr1-4 strains, GenBank accession numbers KM401905- KM401908,
respectively); A. sp (J3, E0): Anaplasma sp. isolates found on Chinese goats (J3 and E10 isolates, GenBank accession numbers JN558826 and JN558821,
respectively); A. pl (Okinawa): A. platys isolate found on Japanese dog (Okinawa isolate, GenBank accession number AY077619); A. p (China-C-Y): A.
phagocytophilum strain isolated from Chinese sheep (China-C-Y strain, GenBank accession number GQ412338); A. b (G49): A. bovis isolate found on
Chinese goat (G49 isolate, GenBank accession number JN558824); A. m (Lushi): A. marginale isolate found on Chinese cattle (Lushi isolate, GenBank
accession number AJ633048); A. c (CC): A. centrale strain isolated from Italian cattle (CC strain, GenBank accession number EF520686); A. o (Jingtai): A.
ovis isolate found on Chinese goat (Jingtai isolate, GenBank accession number AJ633049)

1121

Belkahia1et al. Anaplasma spp. in Tunisian camels

Based on BLASTN analyses and nucleotide

alignments, the four identified genotypes were 99.6%
99.8% similar to those of J3 and E10 Anaplasma sp.
isolates (GenBank accession numbers JN558826 and
JN558821, respectively) found on Chinese goats and
considered as A. platys-like by Liu et al. [10] and
differed in seven and six nucleotide positions,
respectively (Tables 3 and 4). Obtained sequences also
shared 99.7%99.8% similarity with an A. platys
Okinawa isolate recovered from a dog in Japan
(GenBank accession number AY077619) and differed
in five nucleotide positions (Tables 3 and 4). Lower
nucleotide sequence identities were obtained on
comparisons with other Anaplasma species (98.7%
98.9% with A. phagocytophilum; 97.0%97.1% with
A. marginale; 97.0% with A. bovis; 96.9%97.0% with
A. centrale, and 96.9%97.0% with A. ovis; Table 4).
Similarly, comparisons based on 763 bp of the 16S
rRNA gene highlighted a similarity of 99.3% with
strains BovineCaprine1 and Caprine2 found on Italian
cattle and goats (GenBank accession numbers
KC335220KC335222) and classified as Anaplasma
sp. strains closely related to A. platys [17].
Phylogenetic analysis placed all the sequences
obtained in this study in monophyletic clusters
including A. platys (Figure 2A, 2B). In particular, all
Anaplasma sp. Tunisian strains were closely related to
A. platys strains isolated from Chinese goats and to
Italian strains isolated from goats and cattle [10,17].
Discussion
Dromedary camels can host different pathogens,
including several Anaplasma species [35,41]. In
Tunisia, a molecular survey of Anaplasma species in
dromedaries is still lacking [29]. In this study,
molecular epidemiology of selected Anaplasma
species was investigated in dromedary camels from
different bioclimatic areas of Tunisia. Results clearly
indicate evidence of Anaplasma infection in camels
from all studied localities with an average prevalence
of 17.7% (minimum 14.8% in Sidi Bouzid and
maximum 31.3% in Bouficha). This is the first
estimate of the molecular prevalence of Anaplasma
spp. in Tunisian camels. Despite the important
difference in bioclimatic characteristics between the
three investigated areas, the difference in prevalence
rates is not statistically significant (p > 0.05) (Table 2).
This is probably due to the frequent camel movement
between these areas as well as the similarity of tick
populations infesting camels in sampling locations
[29].

J Infect Dev Ctries 2015; 9(10):1117-1125.

Compared to other countries, the overall

prevalence rate in Tunisia remains higher than that in
Spain (0%) [35], and appreciably lower than that in
Saudi Arabia (95.5%) [42]. In Spain, a 3% Anaplasma
spp. prevalence was established in camels by serology
[35]. This high discrepancy between prevalence rates
may result from differences in tick control programs,
farm management, husbandry practices, wildlife
reservoir hosts, and/or abiotic factors. In fact, several
studies have reported the variability of Anaplasma
species prevalence in ruminants according to
geographic location, associated with suitable tick
habitats and animal management [10,28,43].
Moreover, the infection rate of Anaplasma spp. was
significantly higher in females compared to males (p =
0.027) (Table 2). This can be explained by the
immunosuppression of females which may occur
during pregnancy and lactation periods [41], which
could last up to two years [44].
Notably, we failed to recover A. marginale, A.
centrale, A. bovis, and A. phagocytophilum from
investigated camels. It can be postulated that
dromedaries are not relevant reservoirs for classified
Anaplasma species in the studied regions, but
alternative ruminants and other wild and domestic
animal species could act as reservoir hosts in this area.
The seroprevalence of A. phagocytophilum in the same
animals was investigated in a previous study [29].
Overall, 66 out of 226 camels (29.2%) were
seropositive. The discrepancy between molecular and
serological tests could be explained by cross-reactivity
of the antigen used in serology with anti-cytoplasmic
antibodies, as well as with other autoimmune
antibodies and/or with antibodies related to other
Anaplasma species closely related to those of A.
phagocytophilum [17,18,45]. Notably, previous studies
reported a great degree of cross-reactivity in
serological tests between Anaplasma species [46-48].
In the present study, H. dromedarii, H.
impeltatum, and H. excavatum were collected from
camels. These data are in agreement with what
observed by Gharbi et al. [25], who reported the
infestation of dromedaries by these tick species in
Tunisia. All tick genera identified in investigated areas
have never been reported as vectors of A.
phagocytophilum, A. marginale, A. bovis, or A.
centrale [36], suggesting that these tick species may
be vectors of other Anaplasma species probably not
yet classified. Further studies are needed to clarify the
role of these tick species in transmission of Anaplasma
species to camels in Tunisia.

1122

Belkahia1et al. Anaplasma spp. in Tunisian camels

The 16S rRNA gene is considered a sensitive

molecular tool for the discrimination of Anaplasma
species in phylogenic studies [3,49]. Sequencing of
1,322 bp of the 16S rRNA gene isolated from
randomly selected Anaplasma spp.-positive camels
revealed four different and novel Anaplasma sp.
variants. Alignment (Table 3) and percent sequence
identity comparison (Table 4) of the 16S rRNA
sequence variants obtained in this study suggests that
Tunisian dromedaries are infected by Anaplasma
strains genetically related to A. platys. Indeed, these
sequence variants shared a similarity greater than 99%
with the 16S rRNA sequences of the canine A. platys
and related strains found in Chinese and Italian
ruminants [10,17] (Tables 3 and 4).
Phylogenetic analysis of 16S rRNA partial
sequences performed with Anaplasma sp. sequences
isolated from camels and selected sequences of
Anaplasma species obtained from GenBank confirmed
what was observed by percent sequence identity
Figure 2. Phylogenetic trees of Anaplasma species inferred
with partial sequences (1,322 and 763 bp for A and B,
respectively) of the 16S rRNA gene using the neighbor-joining
method showing the location of the four new sequences from
Tunisian camels

Sequence variants from this study represented in bold and marked with
asterisks. Numbers associated with nodes represent the percentage of
1,000 bootstrap reiterations supporting the nodes (only percentages
greater than 50% were represented). The host or vector, the strain or
isolate name, the country of origin and the GenBank accession number
are indicated

J Infect Dev Ctries 2015; 9(10):1117-1125.

comparison (Figure 2). In agreement with Ooshiro et

al. [12], Liu et al. [10], Ybaez et al. [50], and Zobba
et al. [17], the phylogenetic tree based on 1,322 bp of
the 16S rRNA gene shows two main clusters, one
containing A. phagocytophilum, A. platys, A. bovis
sequences, and another containing A. marginale, A.
centrale, and A. ovis sequences. Anaplasma sp.
variants isolated from Tunisian dromedaries cluster
with A. platys and related strains (Figure 2A).
A. platys, the etiologic agent of canine infectious
cyclic thrombocytopenia, has been associated with
thrombocytopenia and anemia [17,18]. In this study,
randomly selected dromedaries did not show any
symptoms specifically referable to A. platys infection.
Therefore the A. platys-like strains isolated in camels
might not be pathogenic and not cause any symptoms,
as previously observed in ruminants from China and
Italy [10,17] and in cats from Italy [18].
Conclusions
This paper reports the presence of novel
Anaplasma sp. strains genetically related to A. platys
in dromedaries from various bioclimatic areas of
Tunisia. Findings open new concerns about the
specificity of the direct and indirect diagnostic tests
routinely used to detect different Anaplasma species in
ruminants and provide useful molecular information to
elucidate the evolutionary history of bacterial species
related to A. platys. Further studies are needed to
investigate if these A. platys-like strains infect other
animal species in Tunisia, to better characterize these
different strains by more discriminative genes, and to
identify vectors implicated in the transmission of the
potentially novel Anaplasma to which these strains
could be ascribed.

Acknowledgements
This work was supported by the Laboratoire
dpidmiologie dinfections enzootiques des herbivores en
Tunisie (LR02AGR03), funded by the Ministry of Higher
Education, Scientific Research and Information and
Communication Technologies of Tunisia, and the research
project Epidmiologie de maladies bactriennes
transmission vectorielle des herbivores (06-680-0029),
which was funded by the Ministry of Agriculture of Tunisia.
The authors would like to thank Dr. Mounir Aloui, Dr.
Amen Allah Djaem, Dr. Mohamed Bayoudh, and Dr.
Bacem Hadj Mohamed for their help in blood sampling and
tick collection.

1123

Belkahia1et al. Anaplasma spp. in Tunisian camels

References
1.
2.

3.

4.

5.
6.
7.
8.

9.
10.

11.

12.

13.

14.
15.

Rikihisa Y (2007) New findings on members of the family

Anaplasmataceae of veterinary importance. Ann N Y Acad
Sci 1078: 438-445.
Kocan KM, de la Fuente J, Guglielmone AA, Melndez RD
(2003) Antigens and alternatives for control of Anaplasma
marginale infection in cattle. Clin Microbiol Rev 16: 698712.
Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH,
Ray SC, Rikihisa Y, Rurangirwa FR (2001) Reorganization of
genera in the families Rickettsiaceae and Anaplasmataceae in
the order Rickettsiales: unification of some species of
Ehrlichia with Anaplasma, Cowdria with Ehrlichia and
Ehrlichia with Neorickettsia, descriptions of six new species
combinations and designation of Ehrlichia equi and HGE
agent as subjective synonyms of Ehrlichia phagocytophilum.
Int J Syst Evol Microbiol 51: 2145-2165.
Rar V, Golovljova I (2011) Anaplasma, Ehrlichia, and
Candidatus
Neoehrlichia
bacteria:
Pathogenicity,
biodiversity, and molecular genetic characteristics, a review.
Infect Genet Evol 11: 1842-1861.
Kocan KM, de la Fuente J, Blouin EF, Coetzee JF, Ewing SA
(2010) The natural history of Anaplasma marginale. Vet
Parasitol 167: 95-107.
Stuen S (2007) Anaplasma phagocytophilum the most
widespread tick-borne infection in animals in Europe. Vet Res
Commun 31: 79-84.
Woldehiwet Z (2010) The natural history of Anaplasma
phagocytophilum. Vet Parasitol 167: 108-122.
Tuomi J (1967) Experimental studies on bovine tick-borne
fever .1. Clinical and haematological data, some properties of
the causative agent, and homologous immunity. Acta Pathol
Microbiol Scand 70: 429-445.
Sreekumar C, Anandan R, Balasundaram S, Rajavelu G
(1996) Morphology and staining characteristics of Ehrlichia
bovis. Comp Immunol Microbiol Infect Dis 19: 79-83.
Liu Z, Ma M, Wang Z, Wang J, Peng Y, Li Y, Guan G, Luo J,
Yin H (2012) Molecular survey and genetic identification of
Anaplasma species in goats from central and southern China.
Appl Environ Microbiol 78: 464-470.
Kawahara M, Rikihisa Y, Lin Q, Isogai E, Tahara K, Itagaki
A, Hiramitshu Y, Tajima T (2006) Novel genetic variants of
Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma
centrale, and a novel Ehrlichia sp. in wild deer and ticks on
two major islands in Japan. Appl Environ Microbiol 72:
1102-1109.
Ooshiro M, Zakimi S, Matsukawa Y, Katagiri Y, Inokuma H
(2008) Detection of Anaplasma bovis and Anaplasma
phagocytophilum from cattle on Yonaguni island, Okinawa,
Japan. Vet Parasitol 154: 360-364.
Jilintai, Seino N, Hayakawa D, Suzuki M, Hata H, Kondo S,
Matsumoto K, Yokoyama N, Inokuma H (2009) Molecular
survey for Anaplasma bovis and Anaplasma phagocytophilum
infection in cattle in a pastureland where sika deer appear in
Hokkaido, Japan. Jpn J Infect Dis 62: 73-75.
Noaman V, Shayan P (2010) Molecular detection of
Anaplasma bovis in cattle from central part of Iran. Vet Res
Forum 1: 117-122.
Kang JG, Ko S, Kim YJ, Yang HJ, Lee H, Shin NS, Choi KS,
Chae JS (2011) New genetic variants of Anaplasma
phagocytophilum and Anaplasma bovis from Korean water
deer (Hydropotes inermis argyropus). Vector Borne Zoonotic
Dis 11: 929-938.

J Infect Dev Ctries 2015; 9(10):1117-1125.

16. Donatien A, Lestoquard F (1936) Rickettsia bovis, nouvelle

espce pathogne pour le boeuf. Bull Soc Pathol Exot 29:
1057-1061.
17. Zobba R, Anfossi AG, Pinna Parpaglia ML, Dore GM,
Chessa B, Spezzigu A, Rocca S, Visco S, Pittau M, Alberti A
(2014) Molecular investigation and phylogeny of Anaplasma
spp. in Mediterranean ruminants reveal the presence of
neutrophil-tropic strains closely related to A. platys. Appl
Environ Microbiol 80: 271-280.
18. Zobba R, Anfossi AG, Visco S, Sotgiu F, Dedola C, Pinna
Parpaglia ML, Battilani M, Pittau M, Alberti A (2015) Cell
tropism and molecular epidemiology of Anaplasma platyslike strains in cats. Ticks Tick Borne Dis 6: 272-280.
19. Ben Dhia M, Smiti N, Gadouar T (1999) [Current situation
and development prospect of breeding camels in Tunisia
during the Vlllth Plan]. Options Medit 9-15.
20. Moslam M, Megdiche F (1989) [The camel breeding in
Tunisia]. Options Mdit 2: 33-36.
21. Zeleke M, Bekele T (2004) Species of ticks on camels and
their seasonal population dynamics in eastern Ethiopia. Trop
Anim Health Prod 36: 225-231.
22. Loftis AD, Reeves WK, Szumlas DE, Abbassy MM, Helmy
IM, Moriarity JR, Dasch GA (2006) Rickettsial agents in
Egyptian ticks collected from domestic animals. Exp Appl
Acarol 40: 67-81.
23. Elghali A, Hassan SM (2009) Ticks (Acari: Ixodidae)
infesting camels (Camelus dromedarius) in Northern Sudan.
Onderstepoort J Vet Res 76: 177-185.
24. Fard SR, Fathi S, Asl EN, Nazhad HA, Kazeroni SS (2012)
Hard ticks on one-humped camel (Camelus dromedarius) and
their seasonal population dynamics in southeast, Iran. Trop
Anim Health Prod 44: 197-200.
25. Gharbi M, Moussi N, Jedidi M, Mhadhbi M, Sassi L,
Darghouth MA (2013) Population dynamics of ticks infesting
the one-humped camel (Camelus dromedarius) in central
Tunisia. Ticks Tick Borne Dis 4: 488-491.
26. Mghirbi Y, Ghorbel A, Amouri M, Nebaoui A, Haddad S,
Bouattour A (2009) Clinical, serological, and molecular
evidence of ehrlichiosis and anaplasmosis in dogs in Tunisia.
Parasitol Res 104: 767-774.
27. Mghirbi Y, Yach H, Ghorbel A, Bouattour A (2012)
Anaplasma phagocytophilum in horses and ticks in Tunisia.
Parasit Vectors 30: 180.
28. Belkahia H, Ben Said M, El Hamdi S, Yahiaoui M, Gharbi M,
Daaloul-Jedidi M, Mhadhbi M, Jedidi M, Darghouth MA,
Klabi I, Zribi L, Messadi L (2014) First molecular
identification and genetic characterization of Anaplasma ovis
in sheep from Tunisia. Small Ruminant Res 121: 404-410.
29. Ben Said M, Belkahia H, Sayahi L, Aloui M, Jemli MH, Hadj
Mohamed B, Sassi L, Darghouth MA, Djaem AA, Bayoudh
M, Messadi L (2013) First serological study of the prevalence
of Anaplasma phagocytophilum in dromedary (Camelus
dromedarius) in Tunisia. Bull Soc Pathol Exot 107: 1-6 (in
French).
30. Ben Said M, Belkahia H, Hni MM, Bouattour A, Ghorbel A,
Gharbi M, Zouari A, Darghouth MA, Messadi L (2014)
Seroprevalence of Anaplasma phagocytophilum in wellmaintained horses from Northern Tunisia. Trop Biomed 31:
432-440.
31. Ajayi SA, Omyali IO, Oluigbo FO, Ajayi ST (1984)
Serological evidence of exposure to Anaplasma marginale in
Nigerian one-humped camels. Vet Rec 114: 478.

1124

Belkahia1et al. Anaplasma spp. in Tunisian camels

32. Mohammed AK, Sackey AKB, Tekdek LB, Gefu JO (2007)

Common health problems of the one humped camel (Camelus
dromedarius) introduced into sub-humid climate in Zaria,
Nigeria. Res J Animal Sci 1: 1-5.
33. Alsaad KM (2009) Clinical, hematological and biochemical
studies of anaplasmosis in arabian one humped camels
(Camelus dromedarius). J Animal Vet Adv 8: 2106-2109.
34. Rabana JL, Kumshe HA, Kamani J, Hafsat G, Turaki UA,
Dilli HK (2011) Effects of parasitic infections on erythrocyte
indices of camels in Nigeria. Vet Res Forum 2: 59-63.
35. Mentaberre G, Gutirrez C, Rodrguez NF, Joseph S,
Gonzlez-Barrio D, Cabezn O, Jos de la Fuente J, Gortazar
C, Boadella M (2013) A transversal study on antibodies
against selected pathogens in dromedary camels in the Canary
Islands, Spain. Vet Microbiol 167: 468-473.
36. Walker AR, Bouattour A, Camicas JL, Estrada-Pena A,
Horak IG, Latif AA, Pegram RG, Prestom PM (2013) Ticks
of domestic animals in Africa: A guide to identification of
species. Bioscience reports. Part 4: species of ticks. 45-221.
37. Carelli G, Decaro N, Lorusso A (2007) Detection and
quantification of Anaplasma marginale DNA in blood
samples of cattle by real-time PCR. Vet Microbiol 124: 107114.
38. Decaro N, Carelli G, Lorusso E, Lucente MS, Greco G,
Lorusso A, Radogna A, Ceci L, Buonavoglia C (2008)
Duplex real-time polymerase chain reaction for simultaneous
detection and quantification of Anaplasma marginale and
Anaplasma centrale. J Vet Diagn Invest 20: 606-611.
39. Altschul SF, Madden TL, Schffer AA, Zhang J, Zhang Z,
Miller W, Lipman DJ (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search
programs. Nucleic Acids Res 25: 3389-3402.
40. Saitou N, Nei M (1987) The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol Evol
4: 406-425.
41. Wernery U, Kaaden OR (2002) Infectious Diseases of
Camelids. Berlin: Blackwell Science. 404 p.
42. Ghafar MW, Shobrak MY (2014) Molecular detection and
characterization of Anaplasma phagocytophilum, the
causative agent of human granulocytic anaplasmosis, in some
animals suspected to be competent reservoirs in Taif district,
Kingdom of Saudi Arabia. Life Sci J 11: 63-69.
43. Torina A, Alongi A, Naranjo V, Estrada-Pea A, Vicente J,
Scimeca S, Marino AM, Salina F, Caracappa S, de la Fuente J
(2008) Prevalence and genotypes of Anaplasma species and

J Infect Dev Ctries 2015; 9(10):1117-1125.

44.
45.
46.

47.

48.

49.

50.

habitat suitability for ticks in a Mediterranean ecosystem.

Appl Environ Microbiol 74: 7578-7584.
ElWishy AB (1988) A study of the genital organs of the
female dromedary (Camelus dromedarius). J Reprod Fertility
82: 587-593.
Blanco JR, Oteo JA (2002) Human granulocytic ehrlichiosis
in Europe. Clin Microbiol Infect 8: 763-772.
Dreher UM, de la Fuente J, Hofmann-Lehmann R, Meli ML,
Pusterla N, Kocan KM, Woldehiwet Z, Braun U, Regula G,
Staerk KD, Lutz H (2005). Serologic cross-reactivity between
Anaplasma marginale and Anaplasma phagocytophilum. Clin
Diagn Lab Immunol 12: 1177-1183.
Alberti A, Sparagano OA (2006) Molecular diagnosis of
granulocytic
anaplasmosis
and
infectious
cyclic
thrombocytopenia by PCR-RFLP. Ann N Y Acad Sci 1081:
371-378.
Al-Adhami B, Scandrett WB, Lobanov VA, Gajadhar AA
(2011) Serological cross-reactivity between Anaplasma
marginale and an Ehrlichia species in naturally and
experimentally infected cattle. J Vet Diagn Invest 23: 11811188.
Lew AE, Gale KR, Minchin CM, Shkap V, de Waal DT
(2003) Phylogenetic analysis of the erythrocytic Anaplasma
species based on 16S rDNA and GroEL (HSP60) sequences
of A. marginale, A. centrale, and A. ovis and the specific
detection of A. centrale vaccine strain. Vet Microbiol 92: 145160.
Ybaez AP, Tagawa M, Matsumoto K, Kishimoto T,
Yokoyama N, Inokuma H (2013) Specific molecular
detection of Anaplasma sp. closely related to Anaplasma
phagocytophilum in Ixodid ticks and cattle in a pastureland in
Hokkaido, Japan. Vector Borne Zoon Dis 13: 6-11.

Corresponding author
Dr. Mourad Ben Said
Laboratoire de Microbiologie
Ecole Nationale de Mdecine Vtrinaire
2020 Sidi Thabet, Tunisie
Tel: +216 71 552 200
Fax: +216 71 552 441
E-mail: bensaidmourad83@yahoo.fr

Conflict of interests: No conflict of interests is declared.

1125