Veterinary Microbiology 144 (2010) 371376

Contents lists available at ScienceDirect

Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic

Detection of type III secretion system genes in Aeromonas hydrophila and

their relationship with virulence in Nile tilapia
G.A. Carvalho-Castro a, C.O. Lopes a, C.A.G. Leal a, P.G. Cardoso b, R.C. Leite a, H.C.P. Figueiredo a,*
a
b

AQUAVET, Laboratory of Aquatic Animal Diseases, Department of Veterinary Medicine, Federal University of Lavras, Lavras MG 37200-000, Brazil
Laboratory of Molecular Biology, Department of Biology, Federal University of Lavras, Lavras MG 37200-000, Brazil

A R T I C L E I N F O

A B S T R A C T

Article history:
Received 22 August 2009
Received in revised form 15 January 2010
Accepted 25 January 2010

The goals of this study were to develop a PCR technique to detect ascV and aopB genes from
the type III secretion system (T3SS), to evaluate the frequency of these genes in Aeromonas
hydrophila strains isolated from diseased sh and from aquaculture environments, and to
determine the relationship between the presence of these genes and virulence of A.
hydrophila in Nile tilapia. The PCR assay developed here successfully detected the target
genes, showing three different proles for the strains ascV+/aopB+, ascV+/aopB, and
ascV/aopB. A higher frequency of ascV+/aopB+ was veried in isolates from diseased sh
compared to those from aquaculture environments (P < 0.05). Among 64 isolates from
diseased sh, ascV+/aopB+ (62.5%) was the most frequent prole (P < 0.05) and caused
more intensive mortality rates. Environmental strains containing the ascV+/aopB+ prole
were less virulent than isolates from clinical cases. These results suggest that the presence
of a functional T3SS probably increases the virulence of A. hydrophila. The PCR technique
was shown to be a specic and efcient tool for detection of T3SS, and this technique can
be used for virulence typing of A. hydrophila isolates.
2010 Elsevier B.V. All rights reserved.

Keywords:
Aeromonas hydrophila
Type III secretion system
Diseased sh
Aquaculture environment

1. Introduction
Aeromonas hydrophila, an ubiquitous bacterium in
aquatic environments, has been isolated from drinking
water and food, thus it is a serious concern to public and
animal health (Edberg et al., 2007). It has been associated
with illness in a broad spectrum of hosts as reptiles,
amphibians, mammals (Vivas et al., 2004) and sh, causing
outbreaks in sh farms with high mortality rates and
elevated economic losses to the aquaculture industry
(Fang et al., 2004).
The pathogenesis of A. hydrophila infections is complex
involving several virulence factors. Among these the type

* Corresponding author at: Federal University of Lavras, Veterinary

Medicine, UFLAs Campus, 37200-000 Lavras, Minas Gerais, Brazil.
Tel.: +55 35 3829 1714; fax: +55 35 3829 1715.
E-mail address: henrique@ua.br (H.C.P. Figueiredo).
0378-1135/$ see front matter 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetmic.2010.01.021

III secretion system (T3SS), has been considered to be of

great importance (Chacon et al., 2004; Vilches et al., 2004;
Yu et al., 2004; Sha et al., 2005; Cornelis, 2006; Sierra et al.,
2007; Mueller et al., 2008). The genes ascV and aopB,
essential components of the A. hydrophila T3SS, codify
proteins associated with the xation of the T3SS in the
bacterial inner membrane and with assembly of the
translocon, respectively. Because of these functions, ascV
and aopB genes are reasonable constituents of the T3SS to
be screened in bacterial strains. Chacon et al. (2004)
reported no signicant differences between the presence
of T3SS genes in A. veronii, A. caviae, and A. hydrophila
recovered from human cases of intestinal and extraintestinal illness. Likewise, Vilches et al. (2004) demonstrated
that the frequency of T3SS genes was higher in isolates
from human clinical cases when compared with environmental strains. However, no data exist about the comparative frequency of these genes in A. hydrophila isolated
from diseased sh and from aquaculture environments.

372

G.A. Carvalho-Castro et al. / Veterinary Microbiology 144 (2010) 371376

The goals of this study were to develop PCR protocols to

detect ascV and aopB genes in A. hydrophila strains, to
evaluate their frequency in isolates from diseased sh and
from aquaculture environments, as well as to address the
in vivo virulence in Nile tilapia (Oreochromis niloticus) of
strains belonging to the different genetic proles.
2. Materials and methods
2.1. Bacterial strains
From a total of 418 Aeromonas spp. isolates of
AQUAVET bacterial culture collection, 104 strains identied as A. hydrophila were evaluated in this study. The
isolates were obtained from 12 sh farms located in three
different Brazilian states (Supplementary Table 1). 64
strains were isolated from the brain (n = 6), spleen (n = 5),
kidney (n = 33), wounds (n = 14), liver (n = 5), and ascites
uids (n = 1) of diseased sh of the following ve species:
O. niloticus, Rhamdia quelen, Piaractus mesopotamicus, Beta
splendens, and Brycon orbignyanus. In addition, 40 isolates
were from aquaculture environments (28 from supply
water and 12 from pond water). A. hydrophila isolates
were biochemically characterized following Abbott et al.
(2003), and bacterial species conrmed by genotypic
identication using PCR-RFLP analysis of the 16S rRNA
gene digested with the enzymes AluI and MboI according
to Borrel et al. (1997), with minor modication. Briey,
the digestion products were resolved using 8% polyacrylamide gel electrophoresis. The isolates were stored at
70 8C until use.
2.2. DNA extraction
The strains were thawed, streaked onto trypticase soy
agar (TSA) and incubated at 30 8C for 18 h. A single colony
from the culture was resuspended in 50 ml of sterile
ultrapure water, vortexed at high speed for 1 min and
incubated at 95 8C for 10 min in thermocycler for cell lyses.
The extracted DNA was used immediately as a template for
PCR reactions. Sterilized ultrapure water was used as a
negative control of extraction.
2.3. Oligonucleotide primers
For development of our PCR technique, primer sets to
detect the ascV and aopB genes from A. hydrophila strains
were designed. Nucleotide sequences of these genes were
available in NCBI database and were obtained and aligned
for the primer design. The construction and preliminary
evaluation of the primers were performed using the
softwares DNAMAM version 4.0 (Lynnon Corporation,
Canada) and BLAST (http://www.ncbi.nlm.nih.gov/BLAST)
for characteristics and specicity analysis, respectively.
The primers ascV sense and ascV antisense were designed
based on the highly conserved regions of ascV sequences
from A. hydrophila strains AH1 and AH3 (GenBank
accession numbers AY394563 and AY528667, respectively) (Vilches et al., 2004; Yu et al., 2004) to amplify
an ascV fragment of approximately 891 bp. The primers
aopB sense and aopB antisense were constructed based on

Table 1
Primers for PCR amplication of genes ascV and aopB from A. hydrophila
strains.
Primer

Position in genes
of A. hydrophila
AH1a

Sequence (50 30 )

ascV sense
ascV antisense
aopB sense
aopB antisense

509527
13801399
1633
947966

AGCAGATGAGTATCGACGG
AGGCAT TCTCCTGTACCAG
TACCTGTTGGAATGATTCCG
AGTGAACGCCCTCTCTCC

Accession number Genbank AY394563.

the aopB sequence from A. hydrophila strain AH1, with the

aim of amplifying an aopB fragment of 951 bp. The four
primers were synthesized by Integrated DNA Technologies
(USA). Table 1 shows the oligonucleotide primers.
2.4. PCR amplication
PCR reactions were standardized using different concentrations of MgCl2, 100 mM deoxyribonucleoside triphosphate (dNTPs) mixture solution (Amresco, USA), primers,
Taq DNA polymerase, and annealing temperature. The
absence of unspecic products and band intensity of PCR
products were evaluated for choice of the best reaction.
The PCR was performed in a thermocycler using the GoTaq
Flexi DNA Polymerase kit (Promega, USA), which included
5 buffer and 25 mM MgCl2. After standardization, the
best PCR mix for ascV amplication consisted of 1 buffer,
0.25 mM of each primer, 1.5 mM of MgCl2, 0.1 mM of each
dNTP (dATP, dTTP, dGTP, and dCTP), 1.25 U of Taq DNA
polymerase, and 2 ml of DNA template. For the aopB gene,
the best amplication was achieved using 1 buffer, 0.
25 mM of each primer, 3.0 mM MgCl2, 0.2 mM of each of
dNTP, 3.0 U of Taq DNA polymerase, and 2 ml of DNA
template. All reactions were completed using sterilized
ultrapure water for a total volume of 25 ml. A. hydrophila
ATCC 7966T was included as a negative control in each test,
since the absence of T3SS in this reference strain veried
after its whole genome sequencing (Seshadri et al., 2006).
The PCR for all isolates was performed twice to conrm
reproducibility.
PCR conditions for both genes consisted of an initial
denaturation step at 95 8C for 5 min followed by 35 cycles of
amplication in which denaturation, annealing, and elongation temperatures were 95 8C for 1 min, 58 8C for 90 s, and
72 8C for 1 min. The nal elongation was at 72 8C for 5 min.
The amplication products were analyzed using 1.5%
(w/v) agarose gel electrophoresis with 1 Trisacetate
buffer (0.04 M Trisacetate, pH 8.4, 1 mM EDTA) and were
visualized with a UV transilluminator after staining with
ethidium bromide solution (0.5 mg/mL). A 100 bp ladder
DNA molecular marker (New England Biolabs, USA) was
used in each electrophoresis assay.
2.5. DNA sequencing
PCR products for ascV and aopB genes were puried using
a Wizard PCR Preps kit (Promega) and then sequenced.
Sequencing reactions were performed using a BigDyeTM
Terminator Cycle sequencing kit (Applied Biosystems, USA)

G.A. Carvalho-Castro et al. / Veterinary Microbiology 144 (2010) 371376

373

and run on an ABI 3730XL genetic analyzer (Applied

Biosystems). Sequences were aligned and then compared
with sequences of ascV genes and aopB genes available in the
NCBI database using the BLASTn algorithm.
2.6. Experimental infection
To address the virulence of isolates with different genetic
patterns, 22 A. hydrophila strains were randomly selected
based on the three proles resulted from PCR reactions.
From those, nine were ascV+/aopB+ (positive for the two
genes), nine were ascV/aopB (negative for both genes),
and four were ascV+/aopB (positive only for the ascV gene).
The selected strains were inoculated in tryptic soy broth
under calcium-depleted conditions and incubated at 30 8C
for 6 h under low agitation (150 rpm). The bacterial
suspension was then adjusted to an optical density of
0.180  0.020 at 600 nm, corresponding approximately to
106 CFU/mL. Suspensions were serially diluted in 0.5 M
phosphate-buffered saline (PBS), streaked onto TSA, and
incubated at 30 8C for 18 h for bacterial counting. To prepare
the bacterial inoculum, after growth the cells were harvested
by centrifugation (3000  g, 30 min), washed once and
resuspended in sterile PBS. Nile tilapia (O. niloticus) ngerlings
with an average weight of 25.6  5.3 g were acquired from a
commercial hatchery for A. hydrophila challenge and acclimatized to laboratory conditions by 15 days. Each experimental
group consisted of eight sh kept in a 57-L aquarium supplied
with ow-through dechlorinated tap water (0.5 L/h). Fish were
maintained on a 12 h:12 h light/dark period at a water
temperature of 26 8C and were fed with VITAFISH 32% PB
(Matsuda, Brazil) to satiation four times a day. Fish were
anesthetized by immersion in a bucket containing 100 mg/L
benzocaine. The challenged groups were injected intraperitoneally with PBS washed A. hydrophila cells corresponding to
106 CFU/sh and the control sh with 0.1 mL of sterile PBS.
Challenged sh were monitored for 15 days. Samples of brain,
liver, and kidney were aseptically collected from all dead sh
and inoculated on sheep blood agar to recover the bacteria.
After a period of 15 days, all sh (challenged and controls
groups) were killed by benzocaine overdose and submitted to
bacteriologic assay. All in vivo experiments were carried out
according to animal welfare standards and were approved by
the Ethical Committee for Animal Experiments of the Federal
University of Lavras, Brazil.
2.7. Statistical analysis
Fishers Exact Test using SAS1 statistical software STAT
Version 6.12 (SAS Institute Inc., USA) was applied to
determine whether the gene frequencies obtained in
isolates from different origins were statistically different.
A P value of 0.05 or less was considered statistically
signicant.
3. Results
3.1. PCR standardization
Positive PCR reactions were obtained for the ascV and
aopB genes of A. hydrophila isolates. Fig. 1 presents the 891

Fig. 1. The pairs 1, 2 and 3 demonstrate the three genetic proles ascV+/
aopB+, ascV+/aopB and ascV/aopB, respectively, from PCR products of
Aeromonas hydrophila strains. Bands of 891 and 951 bp represent,
respectively, ascV and aopB genes.

and 951 bp fragments that resulted from the amplication

of the respective genes. Negative reactions were veried
for the A. hydrophila ATCC 7966T DNA template and
ultrapure water, as expected. The sequenced amplicons
were analyzed by the BLASTn algorithm, and a high degree
of similarity was found between the PCR products obtained
in this work and ascV and aopB gene sequences available in

G.A. Carvalho-Castro et al. / Veterinary Microbiology 144 (2010) 371376

374

Table 2
Frequency of T3SS genes in A. hydrophila isolated from diseased sh and from aquaculture environments, as detected by PCR.
Strain source

Farm
A

Clinical case
ascV+/aopB+a
ascV+/aopB
ascV/aopB

Total (%)
B
2
0
0

Environment
ascV+/aopB+
ascV+/aopB
ascV/aopB

2
0
6

Total

02

16
2
1

3
2
11

19

16

13
0
6

6
0
12

1
0
3

18

19

L
6
0
2

2
0
1

1
0
0

1
0
2

1
0
3

40 (62.5)
4 (6.25)
20 (31.25)

13 (32.5)
0 (0)
27 (67,5)
8

104

The frequency of the prole ascV+/aopB+ in strains from diseased sh was signicantly higher than that from strains from aquaculture environments
(P < 0.05). No signicant differences were obtained between the other proles (P = 0.243).

the NCBI database for A. hydrophila (accession numbers

AY528667/AY394563 and AY394563, respectively); 98%
and 96% identity conrmed the specicity of the primers
used in this study. The sequenced products for genes ascV
and aopB of strains AE288 and AE110 were deposited in the
NCBI GenBank database with the accession numbers
GU384670, GU384671, GU384672, and GU384673.
3.2. Frequency of ascV and aopB genes
The T3SS genes evaluated in this work were detected in
A. hydrophila isolates from all farms and all sh species
tested (Supplementary Table 1). Table 2 shows the
distribution of positive and negative strains according to
sh farm and source. Three genetic types occurred in the
strains analyzed: ascV+/aopB+, ascV/aopB, and ascV+/
aopB. A total of 53 strains were ascV+/aopB+, of which 40
(75.5%) were isolated from diseased sh and 13 (24.5%)
from the environment. A signicant difference (P < 0.05)
was observed among these sources. Four isolates from
diseased sh showed were ascV+/aopB (6.25%). Among 64
isolates from diseased sh, ascV+/aopB+ (62.5%) was the
most frequently observed prole (P < 0.05).
3.3. Experimental infection
During the experimental infection period, no signs of
disease or mortalities were observed in the control group.
Likewise, negative results were veried in bacteriological
analyses at the end of experiment, showing absence of A.
hydrophila infection in those sh. In the groups challenged
with ascV+/aopB+ strains, the rst signs of disease were
apparent 4 h post-infection. The majority of mortalities
occurred by 8 h post-challenge, except for some sh within
the groups infected with strains AE 110, AE 288, and AE
111. For these groups, mortalities occurred from 48 h to 7
days. Bacterial reisolation was conducted from brain, liver,
and kidney of all dead sh. The main clinical signs observed
in sh groups challenged with ascV+/aopB+ strains were
cutaneous hemorrhage at the base of all ns and in the
mouth, ascites with a serobloody uid, and, in some sh,
exophthalmia and erratic swimming. In contrast, in the
sh infected with AE 204 (ascV+/aopB) and with AE 190,
AE 220, and AE 266 (all belonging to ascV/aopB), the

mortalities began after 24 h post-inoculation. The diseased

sh presented only anorexia, lethargy, and skin darkening,
followed by death.
Mortality rates varied between 12.5% and 87.5% in the
groups challenged with A. hydrophila ascV+/aopB+. Strains
AE 067, AE 110, AE 111, and AE 406 were highly virulent to
Nile tilapia ngerlings, inducing 75%, 75%, 87.5%, and 87.5%
mortality, respectively (Table 3). Strains AE 190, AE 220,
and AE 266 (all ascV/aopB) exhibited low virulence in
Nile tilapia ngerlings, resulting in mortality rates of 37.5%,
12.5%, and 12.5%, respectively. Likewise, among the ascV+/
aopB strains, only AE 204 caused disease, with a mortality
rate of 12.5%. Environmental strains with the ascV+/aopB+
prole were less virulent than isolates from clinical cases.
4. Discussion
We developed a PCR method to detect the genes ascV
and aopB, which both encode essential components of the
T3SS nanomachine. Positive results were obtained using
our PCR technique to detect these genes in A. hydrophila
strains isolated from diseased sh and from the aquaculture environment. Neither unspecic products nor
positive reactions to the A. hydrophila strain ATCC 7966T
were found with this methodology. Previous studies have
used hybridization procedures to identify the T3SS in
human and sh isolates of Aeromonas spp. (Burr et al.,
2002; Stuber et al., 2003; Chacon et al., 2004). However,
these methods are time consuming, labor intensive, and
expensive. In contrast, the PCR reaction developed herein
was fast, highly specic, had high reproducibility, and was
easily implemented in the laboratory. Thus, our technique
is a feasible method to detect T3SS in A. hydrophila.
Previous studies showed that the T3SS is related to
bacterial pathogenesis and its presence can be used as an
indicator of virulence (Stuber et al., 2003; Chacon et al.,
2004). Our results demonstrated that the presence of the
T3SS is widespread in A. hydrophila, since T3SS genes were
detected in all farms independent of the strain origin (i.e.,
clinical cases or the environment). Furthermore, the higher
frequency of the ascV+/aopB+ prole observed in strains
from diseased sh suggests that this system can increase
the bacterial infectivity. Similar results of T3SS frequency
were obtained by Vilches et al. (2004), who evaluated

G.A. Carvalho-Castro et al. / Veterinary Microbiology 144 (2010) 371376

375

Table 3
Results of experimental infection with A. hydrophila strains belonging to different genetic proles of ascV and aopB genes.
Straina

Source

Typeb ascV/aopB

Main clinical sign observedc

Mortality%

AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE
AE

Water supply
Kidney
Kidney
Kidney
Wounded n
Kidney
Pond water
Brain
Kidney
Pond water
Spleen
Water supply
Water supply
Water supply
Water supply
Pond water
Kidney
Kidney
Kidney
Kidney
Liver
Liver

+/+
+/+
+/+
+/+
+/+
+/+
+/+
+/+
+/+
/
/
/
/
/
/
/
/
/
/
+/
+/
+/

Cutaneous hemorrhage
Cutaneous hemorrhage
Cutaneous hemorrhage
Erratic swimming and exophthalmia
Cutaneous hemorrhage
Erratic swimming
Cutaneous hemorrhage
Cutaneous hemorrhage
Cutaneous hemorrhage

Anorexia, lethargy, darkening skin

Anorexia and lethargy

Anorexia, lethargy, darkening skin

Anorexia, lethargy, darkening skin

Anorexia and lethargy

12.5
75
75
87.5
25
12.5
25
25
87.5
0
37.5
12.5
0
0
12.5
0
12.5
0
0
0
0
12.5

a
b
c

049-02
067-02
110-02
111-02
152-02
288-03
344-03
403-04
406-04
080-02
190-02
220-02
221-02
225-02
266-03
333-03
410-04
413-04
178-02
179-02
203-02
204-02

Strains randomly chosen according to ascV/aopB gene proles for experimental infection.
(+/+) positive to both genes, (+/) positive to ascV and negative to aopB, (/) negative to both genes.
Main clinical signs observed in challenged groups.

mesophilic Aeromonas isolated from environment and

clinical cases of human diseases. The prole ascV+/aopB+ in
some environmental strains could be explained due to
ubiquitous condition of A. hydrophila in aquatic environments associated with the abilities of bacteria to transfer
horizontally the T3SS (Troisfontaines and Cornelis, 2005).
The relationship between the presence of the T3SS in
isolates from different sources and A. hydrophila virulence
to sh is unclear.
In this work, four ascV+/aopB strains were found,
which suggests that the aopB gene was absent or that these
isolates have mutations in this gene and thus could not be
detected by PCR. There are no previous descriptions about
this phenomenon in A. hydrophila isolates. Even though,
the occurrence of a degenerate T3SS that become the
virulence factor afunctional have been reported in
Escherichia coli, seeming to be a common situation in
Gram negative bacteria (Tobe et al., 2006).
Based on the mortality rates and clinical signs observed,
ascV+/aopB+ strains were more virulent than ascV+/aopB
and ascV/aopB strains in the experimental infection.
Although strains belonged in the three genetic proles
caused disease, different clinical signs and illness evolution
were observed among them. The isolates ascV+/aopB+
promoted sudden disease, with fast evolution, characterized by widespread hemorrhage on the body surface and in
the mucosa. In contrast, sh challenged with ascV/aopB
or ascV+/aopB isolates showed only apathy, anorexia, and
skin darkening accompanied by low mortality rates. The
pathogenesis of A. hydrophila is multifactorial, and previous studies have demonstrated the involvement of many
virulence factors including other secretion systems as T6SS
(Wong et al., 1998; Yu et al., 2005; Suarez et al., 2008).
Nevertheless, the ascV+/aopB strains seemed to be poorly
adapted to promoting sh infection than the ascV+/aopB+

strains. These results agree with those from studies of A.

hydrophila T3SS gene mutants that showed a decrease in
virulence and lower cytotoxicity (Vilches et al., 2004; Yu
et al., 2004; Sha et al., 2005). The low mortality rates
observed in challenge assays performed with four ascV+/
aopB+ strains (Table 3) might be associated with possible
variations in the secretion mechanism of the effector
toxins or with different behaviors in global gene expression, compared to other ascV+/aopB+ strains that induced
high mortality (Francis et al., 2002; Meja et al., 2008).
Overall, the results obtained from the experimental
infections suggest that A. hydrophila, similar of veried
in E. coli, can show different subpopulations or pathotypes
with variable ability to infect the hosts and induce clinical
signs (Kaper et al., 2004).
We conclude that the screened genes were more
frequent in A. hydrophila strains associated with clinical
disease in sh than in the environment and that ascV+/
aopB+ strains were more virulent to Nile tilapia compared
to the other two genetic proles. The PCR protocols
developed for both genes proved to be good assays for T3SS
screening and could be used in routine analyses for A.
hydrophila virulence typing.
Competing interest
The authors declare no competing nancial interests.
Acknowledgments
This work was supported by grants FAPEMIG CVZ APQ
01734/08, CNPq (INCT 573899/2008-8). We would like to
thank FAPEMIG and CAPES for the student fellowships. We
also thank Dirceia A. da Costa Custodio for her technical
assistance.

376

G.A. Carvalho-Castro et al. / Veterinary Microbiology 144 (2010) 371376

Appendix A. Supplementary data

Supplementary data associated with this article can be
found, in the online version, at doi:10.1016/j.vetmic.
2010.01.021.
References
Abbott, S.L., Cheung, W.K.W., Janda, J.M., 2003. The genus Aeromonas:
biochemical characteristics, atypical reactions and phenotypic identication schemes. J. Clin. Microbiol. 41, 23482357.
Borrel, N., Acinas, S.G., Figueras, M.J., Martinez-Murcia, A.J., 1997. Identication of Aeromonas clinical isolates by restriction fragment length
polymorphism of PCR-amplied 16S rRNA genes. J. Clin. Microbiol. 35
(7), 16711674.
Burr, S.E., Stuber, K., Whali, T., Frey, J., 2002. Evidence for a type III
secretion system in Aeromonas salmonicida subsp salmonicida. J. Bacteriol. 151, 21112118.
Chacon, M.R., Soler, L., Groisman, E.A., Guarro, J., Figueras, M., 2004. Type
III secretion system genes in clinical Aeromonas isolates. J. Clin.
Microbiol. 42 (3), 12851287.
Cornelis, G.R., 2006. The type III secretion injectisome. Nat. Rev. Microbiol.
4, 811825.
Edberg, S.C., Browne, F.A., Allen, M.J., 2007. Issues for microbial regulation: Aeromonas as a model. Crit. Rev. Microbiol. 33, 89100.
Fang, H.M., Ge, H., Sin, Y.M., 2004. Cloning, characterization and expression of Aeromonas hydrophila major adhesion. Fish Shellsh Immunol.
16, 645658.
Francis, S.M., Wolf-Watz, H., Forsberg, A., 2002. Regulation of type III
secretion systems. Curr. Opin. Microbiol. 5, 166172.
Kaper, J.B., Nataro, J.P., Mobley, H.L., 2004. Pathogenic Escherichia coli. Nat.
Rev. Microbiol. 2, 123140.
Meja, E., Bliska, J.B., Viboud, G.I., 2008. Yersinia controls type III effector
delivery into host cells by modulating rho activity. PLoS Pathog. 4 (1),
e3 00140024.
Mueller, C.A., Broz, P., Cornelis, G.R., 2008. The type III secretion system tip
complex and translocon. Mol. Microbiol. 68 (5), 10851095.

Seshadri, R., Joseph, S.W., Chopra, A.K., Sha, J., Shaw, J., Graf, J., et al., 2006.
Genome sequence of Aeromonas hydrophila ATCC 7966TT: Jack of all
trades. J. Bacteriol. 188, 82728282.
Sha, J., Pillai, L., Fadl, A.A., Galindo, C.L., Erova, T.E., Chopra, A.K., 2005. The
type III secretion system and cytotoxic enterotoxin alter the virulence
of A. hydrophila. Infect. Immun. 73 (10), 64466457.
Sierra, J.C., Suarez, G., Sha, J., Foltz, S.M., Popov, V.L., Galindo, C.L., et al.,
2007. Biological characterization of a new type III secretion system
effector from a clinical isolate of Aeromonas hydrophilaPart II.
Microb. Pathog. 43, 147160.
Suarez, G., Sierra, J.C., Sha, J., Wang, S., Erova, T.E., Fadl, A.A., et al., 2008.
Molecular characterization of a functional type IV secretion system
effector from a clinical isolate of Aeromonas hydrophila. Microb.
Pathog. 44 (4), 344361.
Stuber, K., Frey, J., Kuhnert, P., 2003. Detection of type III secretion genes
as a general indicator of bacterial virulence. Mol. Cell. Probes 17, 25
32.
Tobe, T., Beatson, S.A., Taniguchi, H., Abe, H., Bailey, C.M., Fivian, A., et al.,
2006. An extensive repertoire of type III secretion effectors in Escherichia coli O157 and the role of lambdoid phages in their dissemination.
Proc. Natl. Acad. Sci. U.S.A. 103, 1494114946.
Troisfontaines, P., Cornelis, G.R., 2005. Type III secretion: more systems
than you think. Physiology 20, 326339.
Vilches, S., Urgell, C., Merino, S., Chacon, M.R., Soler, L., Castro-Escarpulli, G.,
2004. Complete type III secretion system of a mesophilic Aeromonas
hydrophila strain. Appl. Environ. Microbiol. 70 (11), 19161919.
Vivas, J., Carracedo, B., Riano, J., Razqin, B.E., Lopez-Fierro, P., Acosta, F.,
Naharro, G., Villena, A.J., 2004. Behavior of an Aeromonas hydrophila
aroA live vaccine in water microcosms. Appl. Environ. Microbiol. 70,
27022708.
Wong, C.Y., Heuzenroeder, M.W., Flower, R.L., 1998. Inactivation of two
haemolytic toxin genes in Aeromonas hydrophila attenuates virulence
in a suckling mouse model. Microbiology 144, 291298.
Yu, H.B., Sirinivasa Rao, P.S., Lee, A.C., Vilches, S., Merino, S., Tomas, J.M.,
Leung, K.Y., 2004. A type III secretion system is required for Aeromonas
hydrophila AH-1 pathogenesis. Infect. Immun. 72 (3), 12481256.
Yu, H.B., Zhang, Y.L., Lau, Y.L., Yao, F., Vilches, S., Merino, S., et al., 2005.
Identication and characterization of putative virulence genes and
gene clusters in A. hydrophila PPD134/91. Appl. Environ. Microbiol. 71
(8), 44694477.