Characterization of Cry Proteins in Native Strains

of Bacillus thuringiensis and Activity Against

Anastrepha ludens
Author(s): S. Buentello-Wong, L. Galn-Wong, K. Arvalo-Nio,
V. Almaguer-Cant and G. Rojas-Verde
Source: Southwestern Entomologist, 40(1):15-24.
Published By: Society of Southwestern Entomologists
DOI: http://dx.doi.org/10.3958/059.040.0102
URL: http://www.bioone.org/doi/full/10.3958/059.040.0102

BioOne (www.bioone.org) is a nonprofit, online aggregation of core

research in the biological, ecological, and environmental sciences. BioOne
provides a sustainable online platform for over 170 journals and books
published by nonprofit societies, associations, museums, institutions, and
presses.
Your use of this PDF, the BioOne Web site, and all posted and associated
content indicates your acceptance of BioOnes Terms of Use, available at
www.bioone.org/page/terms_of_use.
Usage of BioOne content is strictly limited to personal, educational, and
non-commercial use. Commercial inquiries or rights and permissions
requests should be directed to the individual publisher as copyright holder.
BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors,
nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of
maximizing access to critical research.

VOL. 40, NO. 1

SOUTHWESTERN ENTOMOLOGIST

MAR. 2015

Characterization of Cry Proteins in Native Strains of Bacillus thuringiensis

and Activity against Anastrepha ludens1
S. Buentello-Wong, L. Galn-Wong, K. Arvalo-Nio, V. Almaguer-Cant, and
G. Rojas-Verde*
Instituto de Biotecnologa - Facultad de Ciencias Biolgicas - Universidad
Autnoma de Nuevo Len, Ave. Pedro de Alba s/n cruz con Ave. Manuel L.
Barragn s/n,/ Cd. Universitaria, C.P. 66450 San Nicols de los Garza, Nuevo
Len, Mxico
Abstract. Bacillus thuringiensis (Berliner) strains isolated from soil of citrus
orchards were tested for insecticidal activity against the Mexican fruit fly,
Anastrepha ludens (Loew), a key citrus pest in Mexico. From a total of 55 soil
samples, 201 isolates were selected, for a total B. thuringiensis index of 0.66. The
collection was characterized through light microscopy, polyacrylamide gel
electrophoresis (SDS-PAGE), and PCR analysis detecting cry2, cry4, cry10, cry11,
and cry19 genes. Of the 201 isolates, 51% produced ovoid crystals, 28% adhered
to the spore, 15% were pleomorphic, 3% were bipyramidal, 2% cubic, and 1% was
pyramidal type. Six colonies were positive for the cry10 gene and one for the cry19
gene. SDS-PAGE of spore-crystal preparations revealed seven electrophoresis
patterns. These were bioassayed against Mexican fruit fly adults, obtaining
maximum mortality of 28%.
Introduction
Bacillus thuringiensis (Berliner) is a sporogenic soil bacterium that produces
crystal (Cry) proteins (-endotoxins) specific against various insect pests (Hofte and
Whitely 1989, Shnepf et al. 1998). Many crystalline proteins are characterized
because of entomopathogenic activity and specificity to several insect orders
(Lepidoptera, Diptera, Coleoptera, Hymenoptera, and Orthoptera). However,
several crystal-producing B. thuringiensis (Bt) strains are nontoxic (Ohba and
Aizawa 1986, Hofte and Whitely 1989). In recent years, increased interest has
been in collecting, analyzing, and evaluating B. thuringiensis strains isolated from
environmental samples. New strains with new pathogenic spectra or host ranges
have been sought worldwide (Martin and Travers 1989, Iriarte et al. 1998). Many
dipteran species are susceptible to B. thuringiensis; these include fruit flies, such as
Mexican fruit fly, Anastrepha ludens (Loew) (Robacker et al. 1996, Toledo et al.
1999); Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Gingrich 1987,
Aboussaid et al. 2010); and the olive fruit fly, Bactrocera oleae (Gmelin)
(Karamanlidou et al. 1991, Alberola et al. 1999).

Diptera: Tephritidae

15

In Mexico, as in other countries, fruit flies can cause 37% loss of fruit,
increasing marketing and production costs, affecting the quality of the product, and
increasing environmental pollution by the use of insecticides such as malathion for
control. They also cause quarantine restrictions that limit access of production to
international markets (Aluja 1994).
The most common techniques used for B. thuringiensis characterization are
determination of protein crystal morphology, protein electrophoresis of spore-crystal
mixtures, PCR of cry and/or cyt genes, and flagellar serotyping by H-antigen
agglutination (Lecadet et al. 1999). Most studies using these methods presented
results for each technique individually or considered only representative strains of
the collection. Few reports attempted to establish correlations of data as a whole.
The aim of this study was to isolate and select B. thuringiensis strains from soil from
citrus orchards in northeastern Mexico where Mexican fruit fly is a major pest.
Strains were characterized by morphological (light microscopy) and molecular
methods (protein electrophoresis and PCR analysis) to identify cry genes. The
strains obtained were tested against a laboratory colony of Mexican fruit fly.
Materials and Methods
Bacterial strains of B. thuringiensis were isolated from soil samples from
citrus orchards at Montemorelos NL, considered the primary producer of citrus in
northeastern Mexico. The samples were collected from the surface to a depth of 10
cm. The method is based on selective inhibition of germination of B. thuringiensis
spores by sodium acetate while other bacterial spore-forming strains germinate in
the presence of this salt in rich media. The strains of bacilli were isolated from soil
collected in the field, and the selection procedure in acetate was used with some
modifications (Travers et al. 1987): 0.25 g of sample was placed in a 125 ml flask
that contained 25 ml LB broth (bacto tryptone 10 g, yeast extract 5 g, NaCl 10 g,
formula per liter) with 0.25 M sodium acetate. The suspension was stirred for 4
hours at 250 rpm and 30C to allow germination of all sporulating bacteria except B.
thuringiensis. One milliliter of suspension was placed in a 1.5-mm Eppendorf tube
and heated for 10 minutes at 80C in a water bath. All nonsporulating bacteria and
resulting vegetative cells of spore-forming bacteria were removed by heat
treatment. Subsequently, 100 l of heat-treated sample were placed on LB plates
incubated 24 hours at 30C.
For DNA extraction, 202 previously isolated colonies were sown in 125-ml
flasks containing 50 ml of nutrient broth (beef extract 3 g, peptone 5 g, formula per
liter), and the colonies were incubated 24 hours at 30C and 250 rpm of stirring.
This step was followed by the procedure of Cheng and Jiang (2006).
We obtained the sequences of cry genes from the classification of Crickmore
et al. (2014): cry2 genes (72 sequences), cry4 (15 sequences), cry10 (five
sequences), cry11 (eight sequences), and cry19 (three sequences) deposited in the
NCBI database. The Sequence Assembly Program software was used (Huang and
Madan 1999) to create a contig for each of the five genes. Five pairs of primers
(2M, 4M, 10M, 11M, and 19M) were designed for multiplex PCR with the software
Mpprimer (Shen et al. 2010); primer pair 2M: 5'-ACCCCAGTTCCAGATGCAAGGA/
5'-TGCTGTGGTCCACTACCACTTGC, product size 369 bp for the gene cry2; 4M:
5'-TGGATGCACGAGTGGCACAAGC/
5'-GCATTTCCAGTTACATGCCACCCCA,
product
size
106
bp
for
the
gene
cry4;
10M:
5'CGCAACATAATCTGGGGAGCGGT/
5'-TCCACCTGTGTGACCAGGACCTT,

16

product size 468 bp for the gene cry10; 11M: 5'-TTTAACTGCGCCAGCACCAGCA/

5'-ACCCGTATTCCAGCAGGTAAGCGA, product size 588 bp for the gene cry11;
19M:
5'-CGAGGAAGCTTCTTATGCATCTTCAGG/
5'CACGCAGCGAGAGCTCGGTTAT, product size 291 bp for the gene cry19, with the
corresponding Tm of 59.2C for all the previous primer pairs, these primers were
used for partial classification of genes by multiplex PCR. Subsequent PCR primers
reported in the literature (Carozzi et al. 1991, Ejiofor and Johnson 2002) were used
to confirm the presence of the cry genes by uniplex PCR: primer pair 4U: 5'CAAGCCGCAAATCTTGTGGA/ 5'-TGGCTTGTTTCGCTACATC, product size 797
bp, for the gene cry4 (Carozzi et al. 1991); 10U: 5'-TCGTGGAATGGGCAAAAAC/
5'-TATCCCCCTTCAACATCCTCA, product size 404 bp for the gene cry10; 11U:
5'-TTTGCACCAGATAATACTAAGGAC/
5'-AACAACTGCGATAAATACCACTCT,
product
size
485
bp
for
the
gene
cry11;
19U:
5'AGGGGAGTCCAGGTTATGAGTTAC/
5'-ATTTCCCTAGTTAGTTCGGTTTTT,
product size 355 bp for the gene cry19 (Ejiofor and Johnson 2002), with the
corresponding Tm of 55C for all the previous primer pairs.
The concentration and quality of each DNA sample were determined in an
Epoch Micro-Volume Spectrophotometer (Model 255781, BioTek, Winooski, VT).
Values of 3000-3500 ng/l were obtained from the samples, and a dilution of 1/100
in Milli-Q water was used directly as a template for multiplex and uniplex PCR
reactions. The final volume of the PCR mixture was 50 l, containing 5 mM dNTP's,
10 mM of each of the primers, 1 U of DNA polymerase with the corresponding
buffer (GenScript, Piscataway, NJ). PCR was by a Mastercycler Gradient Thermal
Cycler (Model 950000015, Eppendorf, Enfield, CT), and amplification conditions
were initial denaturation for 5 minutes at 95C, followed by 30 cycles of denaturation
for 30 seconds at 95C, annealing for 45 seconds at variable temperature
depending on the primer pair, extension for 30 to 60 seconds (depending on
amplicon expected size) at 72C, and a final extension step of 7 minutes at 72C.
PCR products were separated by electrophoresis in 1% agarose gels.
Protein profiling was done according to Bel et al. (1997). B. thuringiensis for
bioassays was prepared by extraction with the Dulmage (1970) precipitation lactose
acetone method. The seven isolated colonies with genes cry10 and cry19 were
incubated in 2 liters of nutrient broth (beef extract 3 g, peptone 5 g, formula per liter)
with the Bt tohokuensis strain as a reference; these were grown for 7 days at 30C
and 250 rpm. Optimal crystal formation was corroborated by light microscopy.
Mexican fruit flies were obtained from the insectary of the Institute of
Biotechnology at the UANL. Bioassays used 20 adult flies (10 males and 10
females) 2 days old in a 1-liter transparent plastic cup covered with mesh fabric and
fed 20 g of Shorey and Hale (1965) solid diet. The treatments were applied
following the slightly modified methodology of Vidal-Quist et al. (2009). The
parasporal crystals were mixed with 10% sucrose solution; each day, five drops (10
l per drop) were placed on a piece of Parafilm in the bottom of the cup, or only
10% sucrose was used for checks. The concentration of the parasporal crystals
was 50 mg/ml. Controlled conditions of 25C and photoperiod of 16:8 light:dark
hours were used. Three replications were used.
The number of flies that died was recorded at 7 days. The numbers that died
were corrected according to Abbotts formula (1925) when flies in the check group
died. Percentages of mortality from bioassay tests were analyzed using one-way
analysis of variance (ANOVA, P = 0.05), and Tukeys test was used at a
significance of P < 0.05 to analyze differences among the Bt strains tested.

17

Results and Discussion

In total, 304 colonies were isolated resembling the colonial morphology of B.
thuringiensis, of which 201 strains of bacilli showed a variety of crystals in the
sporulation phase: ovoid, pleomorphic, pyramidal, and others, with a Bt index of
0.66 (the number of identified Bt colonies divided by the total number of Bacillus-like
colonies examined). The indices for soil samples have been reported to range from
values less than 0.06 (Delucca et al. 1981, Ohba and Aizawa 1986, Hastowo et al.
1992, Ohba and Aratake 1994), to 0.5 (Chilcott and Wigley 1994), or 0.85 by
acetate selection (Martin and Travers 1989). The proportion was greater than
previous reports (Delucca et al. 1981, Ohba and Aizawa 1986, Hastowo et al. 1992,
Ohba and Aratake 1994) suggesting B. thuringiensis is better maintained or
protected in the soil. One reason for this could be that, when samples of soil and
dust are collected, the surface is always rejected and the material of the sample is
from a soil layer at least 5 cm below the surface where UV light damage is not
possible and temperature is more stable. More B. thuringiensis colonies might be
obtained but with less diversity in a single sample of field soil than in a water sample
(Bel et al. 1997).
The method of Travers (1987) is selective, allowing routine isolation of 20 to
90% of Bacillus species of entomopathogenic crystal formers, such as B.
thuringiensis. Of the crystal-forming bacilli colonies isolated, 51% produced ovoid
crystals, 28% adhered to the spore, 15% were pleomorphic, 3% bipyramidal, 2%
cubic, and 1% was pyramidal type, unlike data reported by Vidal-Quist et al. (2009).
They characterized strains of bacilli from samples including soil from citrus orchards
at Valencia, Spain and found 45% bipyramidal, 40% round, 7% adhered to spore,
5% small, and 3% irregular of a total of 896 crystalliferous colonies analyzed.
Bacilli with oval or round crystals were dominant in the soil from the citrus
regions in the state of Nuevo Leon, Mexico. The crystals varied in size from small
to large ovoid crystals. Strains with bipyramidal crystal are said to usually be
associated with the presence of the Cry1 protein and toxicity against lepidopteran
insects. Cubic and ovoid crystals are active against both Lepidoptera and Diptera,
and the Cry2 protein is related to cubic inclusion (Glare and O'Callaghan 2000).
Ibarra et al. (2003) showed crystalline inclusions of ovoid type that belonged to
Cry4, Cry10, and Cry11 proteins were characterized by activity against Diptera.
This is consistent when correlating the main activity of the zone (citrus harvest) with
the main pest (Mexican fruit fly), which is native to the area.
Recent reports on the frequency of B. thuringiensis isolates from natural
environments indicate high probability of isolating a novel strain. Success in
isolation of crystalliferous B. thuringiensis depends on the techniques used. The
sodium acetate selective method used in combination with heat treatment and
crystal staining seemed sensitive compared with the enrichment technique because
it has a lower limit of detection of 103 bacteria per gram of soil. Detection and
identification of known and novel cry genes from a large number of isolates is
arduous. Researchers have used a wide variety of techniques to identify and
characterize cry genes carrying B. thuringiensis. Many workers have used PCR or
a combination of the technique with other methods such as serology, insecticidal
activity, and SDS-PAGE to detect and characterize cry genes from isolates.
We combined molecular and physiological methods to characterize colonies.
Basic microbiological and physiological studies showed a high degree of isolation
as well as detection of the present cry gene. DNA sequence homology is used to

18

confirm a novel cry gene. A novel cry must have a significant sequence similarity to
one or more toxins within the nomenclature or be a B. thuringiensis parasporal
inclusion protein that exhibits pesticide activity or some experimentally verifiable
toxic effect to a target organism for a new name to be assigned.
Of the 202 colonies analyzed by PCR, 10 were positive for any of the five
genes analyzed by multiplex PCR (cry2, cry4, cry10, cry11, cry19), endpoint PCR
for each of the 10 positive samples with primers reported in the literature was used
(Carozzi et al. 1991, Ejiofor and Johnson 2002), only seven colonies that showed a
single band corresponding to the expected size were selected for further analysis,
and these were characterized by light microscopy based on the shape of the crystal
(Table 1). The protein crystals were characterized by SDS-PAGE.
It was possible to characterize seven colonies; six were positive for the cry10
gene and one of these for the cry19 gene. We discarded the possibility of
redundancy between the six colonies positive for cry10 because the protein profile
by SDS-PAGE (Table 2) was different for each of the strains. The possibility of
having found a new cry10 gene other than that reported previously cannot be

Table 1. Crystal and Molecular Morphology of the Seven Colonies of Bacillus

thuringiensis Selected by PCR, in the Northeastern Region of Mexico Selected for
Control of Mexican Fruit Fly
Colony
Crystal morphologya
Bacilli size
Amplification of cry gene
1
Round small
Small
cry10
2
Round small,
Small
cry10
3
Round small, pleomorphic
Small
cry19
4
Pleomorphic
Large
cry10
5
Round small
Small
cry10
6
Round small
Small
cry10
7
Ovoid large
Large
cry10
a
The colonies of B. thuringiensis were examined by microscopic morphology of
bacilli and crystal form using an optical light microscope adjusted at 100X objective
using immersion oil.

Table 2. Protein Profiles of Spore-crystal Mixtures Obtained by SDS-PAGE of

Seven Colonies of Bacillus thuringiensis from Soil Selected by PCR and the
Reference Strain Bt Tohokuensis Selected for Control of the Mexican Fruit Fly
Selected colony
Band size pattern (kDa)a
1
60, 50, 40
2
200, 60, 55, 35
3
60, 50, 35, 32
4
200, 45, 33
5
62, 55, 45
6
62, 55, 45, 33
7
150, 50, 40
Bt Tohokuensis
130, 70
a
The profiles of cry protein were determined by 10% polyacrylamide gel using the
Smart Advanced Broad-Range Protein Standard (GenScript, Piscataway, NJ).

19

discarded, because the protein profile does not match the typical profile of B.
thuringiensis israelensis (Bti) (130, 72, 42, and 28 kDa) and does not amplify for the
genes cry4 and cry11 that are also part of it.
Our results are in agreement with those of Vidal-Quist et al. (2009) who
reported 6.6% of isolates for the cry10 gene. We found 3.4% for cry10 only isolated
from soil. We also characterized a strain with the cry19 gene.
We determined the toxicity of eight isolates on Mexican fruit fly adults.
Larvae of fruit flies develop inside the fruit and, therefore, insecticide sprayed on the
surface would not be effective for control. However, Karamanlidou et al. (1991)
reported that larval stages of Tephritidae seemed more susceptible than adults to B.
thuringiensis. But, even if we had found strains active against Mexican fruit fly
larvae, it would not mean the isolates also were active against adult flies, as was
proven in previous reports (Robacker et al. 1996, Alberola et al. 1999). Corrected
mortality in our study ranged from 5 to 28% (Fig. 1), which is considered low.
Similar results were obtained by Vidal-Quist et al. (2009) who tested 376 strains
against the Mediterranean fruit fly and recorded maximum mortality of 30% by 5.9%
of strains using spore-crystal suspensions. Despite the complexity of working with
Mexican fruit fly adults, we developed a new and simpler bioassay, one of few
studies of toxicity of strains of Bt against Mexican fruit fly adults (Robacker et al.
1996, Martinez et al. 1997).

Fig. 1. Percentage of mortality of Anastrepha ludens recorded after 7 days of

treatment with the parasporal crystal of selected colonies of B. thuringiensis (1
through 7) and Bt ssp tohokuensis (8). The data were given as means SD and
analyzed by one-way ANOVA followed by the Tukey test, using Statistical Software
Minitab 17 (2010). Bars with the same letter are not statistically different at P =
0.05, (F = 9.11; df = 8, 26; P < 0.001).

20

Biological activity of Bt strains has been studied by many authors who

determined insecticidal potential of the toxins using spores and crystals. Gingrich
(1987) tested 94 strains of Bt, and 15 of them killed at least 80% of Mediterranean
fruit fly adults that fed on pellets for 9 days.
Robacker et al. (1996) evaluated the action of 55 Bt strains on larvae of
Mexican fruit fly and found only seven strains toxic to adults; centrifuge pellets or
precipitates of Bt strains killed more than 50% of the larvae. Percentages killed
ranged from 4 to 62 after application of pellets of these strains against adult flies.
Only five killed 65-80% of adults in 10 days compared with 2.7% mortality in checks.
The other killed 40% of adults.
Alberola et al. (1999) studied Bt activity against second-instar olive fruit fly
larvae and newly emerged adults. They reported that both spore-crystal mixtures
(109/ml) killed 70% of larvae in 72 hours and 80% of adult flies in 6 to 10 days of
application. Karamanlidou et al. (1991) reported more than 80% killed when various
Bt strains were used against older olive fruit fly larvae.
Hassani and Gaouar (2008) tested the effect of Bti on third-instar
Mediterranean fruit fly larvae and adults from citrus orchards in Algeria and
observed toxicity in high doses (100 mg/g), with 84.6% reduction in average
emergence.
They concluded that third-instar larvae and adults were very
susceptible to the dose of Bti.
PCR analysis can be considered, with some limitations, a tool to predict the
biological activity of a B. thuringiensis isolate. No cry gene could be identified by
PCR in almost 96% of our collection, 195 strains; their potential biological activity
remains unknown. No field-collected isolate of B. thuringiensis killed more than
30% of Mexican fruit fly adults, which is less than recorded previously for other adult
tephritids (80% killed in 6 to 10 days) (Robacker et al. 1996, Alberola et al. 1999).
We concluded that we developed a large and diverse collection of B. thuringiensis
strains with potential to control different agricultural pests, although further research
is needed to find B. thuringiensis strains active against Mexican fruit fly. In addition,
an innovative approach was presented to integrate the complex information
provided by some of the most common techniques used to characterize B.
thuringiensis. The frequency of isolation of B. thuringiensis strains suggests a
combination of techniques would help on a larger scale. This would subsequently
help in determining the overall distribution and ecological significance of B.
thuringiensis cry genes for control of dipterans such as Mexican fruit fly in
northeastern Mexico.
Acknowledgement
We thank Adriana E. Flores for critical review of the manuscript and
Katiushka Arvalo Nio for supplying insects (both from Universidad Autnoma de
Nuevo Len, Facultad de Ciencias Biolgicas). S. Buentello-Wong was the
recipient of a Ph.D. grant from the Consejo Nacional de Ciencia y Tecnologa
(CONACyT) Grant No. 446174.
References Cited
Abbott, W. S. 1925. A method of computing the effectiveness of an insecticide. J.
Econ. Entomol. 18: 265-267.

21

Aboussaid H., A. L., S. Messoussi, and K. Oufdou. 2010. Biological activity of

Bacillus thuringiensis (Berliner) strains on larvae and adults of Ceratitis
capitata (Wiedemann) (Diptera: Tephritidae). J. Environ. Protection 1: 337345. doi: 10.4236/jep.2010.14040
Alberola, T. M., S. Aptosoglou, M. Arsenakis, Y. Bel, G. Delrio, D. J. Ellar, and E.
Vasara. 1999. Insecticidal activity of strains of Bacillus thuringiensis on
larvae and adults of Bactrocera oleae Gmelin (Dipt. Tephritidae). J. Invertebr.
Pathol. 74: 127-136. doi: 10.1006/jipa.1999.4871
Aluja, M. 1994. Bionomics and management of Anastrepha. Annu. Rev. Entomol.
39: 155-178.
Bel, Y., F. Granero, T. M. Alberola, M. J. Martinez-Sebastian, and J. Ferre. 1997.
Distribution, frequency and diversity of Bacillus thuringiensis in olive tree
environments in Spain. System. Appl. Microbiol. 20: 652-658.
Carozzi, N. B., V. C. Kramer, G. W. Warren, S. Evola, and M. G. Koziel. 1991.
Prediction of insecticidal activity of Bacillus thuringiensis strains by
polymerase chain reaction product profiles. Appl. Environ. Microbiol. 57:
3057-3061.
Cheng, H. R., and N. Jiang. 2006. Extremely rapid extraction of DNA from bacteria
and yeasts. Biotechnol. Lett. 28: 55-59. doi: 10.1007/s10529-005-4688-z
Chilcott, C. N., and P. J. Wigley. 1994. Opportunities for finding new Bacillusthuringiensis strains. Agric. Ecosys. Environ. 49: 51-57. doi: Doi
10.1016/0167-8809(94)90022-1
Crickmore, N., J. Baum, A. Bravo, D. Lereclus, K. Narva, K. Sampson, E. Schnepf,
M. Sun, and D. R. Zeigler. 2014. Bacillus thuringiensis toxin nomenclature.
http://www.btnomenclature.info/
Delucca, A. J., J. G. Simonson, and A. D. Larson. 1981. Bacillus-thuringiensis
distribution in soils of the United States. Canadian J. Microbiol. 27: 865-870.
Dulmage, H. T. 1970. Production of the spore-delta-endotoxin complex by variants
of Bacillus thuringiensis in two fermentation media. J. Invertebr. Pathol. 16:
385-389.
Ejiofor, A. O., and T. Johnson. 2002. Physiological and molecular detection of
crystalliferous Bacillus thuringiensis strains from habitats in the South Central
United States. J. Ind. Microbiol. Biotechnol. 28: 284-290. doi:
10.1038/sj/jim/7000244
Gingrich, R. E. 1987. Demonstration of Bacillus thuringiensis as a potential control
agent for the adult Mediterranean fruit fly, Ceratitis capitata (Wied). J. Appl.
Entomol.-Zeitschrift Fur Angewandte Entomologie 104: 378-385.
Glare, T. R. and O'Callaghan. 2000 . Bacillus Thuringiensis: Biology, Ecology and
Safety. Chichester, UK: John Wiley & Sons.
Hassani, F. and Gaouar, N. 2008. Application of Bacillus thuringiensis (Bti)
Struggling Microbiological Control of the Fruit Fly Ceratitis capitata (wied)
(Diptera: Tephritidae). IBSCientific Journal of Science, 3(1), 10-13.
Hastowo, S., B. W. Lay, and M. Ohba. 1992. Naturally-occurring Bacillus
thuringiensis in Indonesia. J. Appl. Bacteriol. 73: 108-113. doi: DOI
10.1111/j.1365-2672.1992.tb01695.x
Hofte, H., and H. R. Whiteley. 1989. Insecticidal crystal proteins of Bacillus
thuringiensis. Microbiol. Rev. 53: 242-255.
Huang, X., and A. Madan. 1999. CAP3: A DNA sequence assembly program.
Genome Res. 9: 868-877.

22

Ibarra, J. E., M. C. del Rincon, S. Orduz, D. Noriega, G. Benintende, R. Monnerat,

and A. Bravo. 2003. Diversity of Bacillus thuringiensis strains from Latin
America with insecticidal activity against different mosquito species. Appl.
Environ. Microbiol. 69: 5269-5274. doi: Doi 10.1128/Aem.69.9.52695274.2003
Iriarte, J., Y. Bel, M. D. Ferrandis, R. Andrew, J. Murillo, J. Ferre, and P. Caballero.
1998. Environmental distribution and diversity of Bacillus thuringiensis in
Spain. Syst. Appl. Microbiol. 21: 97-106.
Karamanlidou, G., A. F. Lambropoulos, S. I. Koliais, T. Manousis, D. Ellar, and C.
Kastritsis. 1991. Toxicity of Bacillus thuringiensis to laboratory populations
of the olive fruit fly (Dacus oleae). Appl. Environ. Microbiol. 57: 2277-2282.
Lecadet, M. M., E. Frachon, V. C. Dumanoir, H. Ripouteau, S. Hamon, P. Laurent,
and I. Thiery. 1999. Updating the H-antigen classification of Bacillus
thuringiensis. J. Appl. Microbiol. 86: 660-672. doi: DOI 10.1046/j.13652672.1999.00710.x
Martin, P. A. W., and R. S. Travers. 1989. Worldwide abundance and distribution
of Bacillus thuringiensis isolates. Appl. Environ. Microbiol. 55: 2437-2442.
Martinez, A. J., D. C. Robacker, and J. A. Garcia. 1997. Toxicity of an isolate of
Bacillus thuringiensis subspecies darmstadiensis to adults of the Mexican
fruit fly (Diptera: Tephritidae) in the laboratory. J. Econ. Entomol. 90: 130134.
Ohba, M., and K. Aizawa. 1986. Distribution of Bacillus thuringiensis in soils of
Japan. J. Invertebr. Pathol. 47: 277-282. doi: Doi 10.1016/00222011(86)90097-2
Ohba, M., and Y. Aratake. 1994. Comparative study of the frequency and flagellar
serotype flora of Bacillus thuringiensis in soils and silkworm-breeding
environments. J. Appl. Bacteriol. 76: 203-209. doi: DOI 10.1111/j.13652672.1994.tb01617.x
Robacker, D. C., A. J. Martinez, J. A. Garcia, M. Diaz, and C. Romero. 1996.
Toxicity of Bacillus thuringiensis to Mexican fruit fly (Diptera: Tephritidae). J.
Econ. Entomol. 89: 104-110.
Schnepf, E., N. Crickmore, J. Van Rie, D. Lereclus, J. Baum, J. Feitelson, and D. H.
Dean. 1998. Bacillus thuringiensis and its pesticidal crystal proteins.
Microbiol. Mol. Biol. Rev. 62: 775-+
Shen, Z., W. Qu, W. Wang, Y. Lu, Y. Wu, Z. Li, . . . and C. Zhang. 2010.
MPprimer: a program for reliable multiplex PCR primer design. BMC
Bioinformatics 11: 143.
Shorey, H. H., and R. L. Hale. 1965. Mass-rearing of the larvae of nine noctuid
species on a simple artificial medium. J. Econ. Entomol. 58: 522-524.
Toledo, J., P. Liedo, T. Williams, and J. Ibarra. 1999. Toxicity of Bacillus
thuringiensis beta-exotoxin to three species of fruit flies (Diptera:
Tephritidae). J. Econ. Entomol. 92: 1052-1056.
Travers, R. S., P. A. Martin, and C. F. Reichelderfer. 1987. Selective process for
efficient isolation of soil Bacillus spp. Appl. Environ. Microbiol. 53: 12631266.
Vidal-Quist, J. C., P. Castanera, and J. Gonzalez-Cabrera. 2009. Diversity of
Bacillus thuringiensis strains isolated from citrus orchards in Spain and
evaluation of their insecticidal activity against Ceratitis capitata. J. Microbiol.
Biotechnol. 19: 749-759.

23

24