Outer Membrane Targeting, Ultrastructure, and Single Molecule Localization of The Enteropathogenic Escherichia Coli Type IV Pilus Secretin BFPB

Outer Membrane Targeting, Ultrastructure, and Single Molecule
Localization of the Enteropathogenic Escherichia coli Type IV Pilus

Secretin BfpB
Joshua A. Lieberman,a Nicholas A. Frost,b Michael Hoppert,c Paula J. Fernandes,a* Stefanie L. Vogt,d Tracy L. Raivio,d
Thomas A. Blanpied,b and Michael S. Donnenberga
Division of Infectious Diseases, Department of Medicine, University of Maryland School of Medicine, Baltimore, Maryland, USAa; Department of Physiology and Program in
Neuroscience, University of Maryland School of Medicine, Baltimore, Maryland, USAb; Institut fuer Mikrobiologie und Genetik, Universitaet Goettingen, Goettingen,
Germanyc; and Department of Biological Sciences, University of Alberta, Edmonton, Alberta, Canadad
Type IV pili (T4P) are filamentous surface appendages required for tissue adherence, motility, aggregation, and transformation
in a wide array of bacteria and archaea. The bundle-forming pilus (BFP) of enteropathogenic Escherichia coli (EPEC) is a prototypical T4P and confirmed virulence factor. T4P fibers are assembled by a complex biogenesis machine that extrudes pili through
an outer membrane (OM) pore formed by the secretin protein. Secretins constitute a superfamily of proteins that assemble into
multimers and support the transport of macromolecules by four evolutionarily ancient secretion systems: T4P, type II secretion,
type III secretion, and phage assembly. Here, we determine that the lipoprotein transport pathway is not required for targeting
the BfpB secretin protein of the EPEC T4P to the OM and describe the ultrastructure of the single particle averaged structures of
the assembled complex by transmission electron microscopy. Furthermore, we use photoactivated localization microscopy to
determine the distribution of single BfpB molecules fused to photoactivated mCherry. In contrast to findings in other T4P systems, we found that BFP components predominantly have an uneven distribution through the cell envelope and are only found
at one or both poles in a minority of cells. In addition, we report that concurrent mutation of both the T4bP secretin and the retraction ATPase can result in viable cells and found that these cells display paradoxically low levels of cell envelope stress response activity. These results imply that secretins can direct their own targeting, have complex distributions and provide feedback information on the state of pilus biogenesis.
nteropathogenic Escherichia coli (EPEC) is an important cause

of pediatric infectious diarrhea throughout the developing
world (26, 32, 43). Typical EPEC strains carry a large EPEC adherence factor (EAF) plasmid that encodes a type IV pilus (T4P), the
bundle-forming pilus (BFP) (73). The BFP is a confirmed virulence factor (8) and adhesin that mediates the initial stages of
adherence to the host intestinal epithelium (40). The expression of
BFP is associated with a distinctive pattern of three-dimensional
clusters when incubated with cells, termed localized adherence
(67), and the formation of dynamic autoaggregates of bacteria in
liquid culture (3). T4Ps mediate diverse cellular processes in a
broad range of bacteria, including adhesion and colonization (15,
25, 86), twitching and social motility (10, 41), and horizontal gene
transfer (5, 36).
T4Ps are long, thin, flexible homopolymeric three-start helical
fibers approximately 85 in diameter (21, 60). The fibers are
composed of the pilin structural protein (21) and are both assembled and disassembled by complex biogenesis machines consisting
of 10 to 18 proteins (57, 58). T4Ps are common to many Gramnegative pathogens, including Vibrio cholerae (34), Pseudomonas
aeruginosa (10), Neisseria meningitidis (14), Francisella tularensis
(15), Legionella pneumophila (72), and EPEC (25). T4Ps are subdivided into T4aP and T4bP based on key differences in the pilin
monomer and genetic organization (51). T4b pilins generally have
a larger more complex structure, a longer leader sequence, and are
N methylated on small hydrophobic residues instead of the phenylalanine typical for T4a pilins. The genes encoding T4bP biogenesis machines are generally contiguous, while those for T4aP
machine components are found in unlinked operons. Further-
1646
jb.asm.org
more, T4bP predominate in enteric bacteria and mediate aggregation phenotypes more often than the T4aP systems (51).
T4P machinery proteins share significant sequence similarity
and structural homology to components of type II secretion (T2S)
systems, DNA uptake systems (5, 57), and filamentous phage assembly systems (45, 65) and even have orthologues in proteins
involved in archaeal flagellum assembly (57). Furthermore,
T4Ps have recently been detected in Gram-positive pathogens
of the genus Clostridium (79, 80) and in archaea (28, 53). The
sequence and structural similarities across such a wide range of
organisms strongly suggest an ancient and shared evolutionary
history (57, 58).
All T4Ps consist of a mature pilin that is cleaved and, in Gramnegative bacteria, N methylated by a dedicated pre-pilin peptidase
(74). Gram-negative T4P biogenesis machines contain a core set
of conserved proteins thought to assemble into a supramolecular
biogenesis machine that spans both the inner membrane (IM) and
the outer membrane (OM) (39). These proteins include a polytopic IM protein, at least one cytoplasmic nucleotide binding pro-
Received 6 October 2011 Accepted 5 January 2012

Published ahead of print 13 January 2012
Address correspondence to Michael S. Donnenberg, mdonnenb@umaryland.edu.
* Present address: Global Scientific Solutions for Health, Baltimore, Maryland, USA.
Supplemental material for this article may be found at http://jb.asm.org/.
Copyright 2012, American Society for Microbiology. All Rights Reserved.
doi:10.1128/JB.06330-11
0021-9193/12/$12.00
Journal of Bacteriology
p. 1646 1658
Fine Localization of BfpB
tein energizing pilus dynamics, pre-pilin-like proteins, and the

OM secretin protein (21, 57, 58). The well-conserved secretin proteins are not only essential for T4P biogenesis but also form the
OM ring structure found in T2S systems (9, 64), type 3 secretion
(T3S) systems (6), and the filamentous phage assembly system
(45). Secretins are reported to form homomultimers of 12 to 15
monomers (9, 18, 42, 55, 64).
Nonlipoprotein secretins require a small lipoprotein pilotin, or
another small lipoprotein, for targeting to the OM and multimerization, while some secretins are lipoproteins themselves and
do not require a pilotin (42, 54). True pilotin proteins, such as
PulS of the Klebsiella oxytoca T2S machine, are acylated and transported to the OM by the Lol-sorting pathway (17) and are required for multimer stability (6). A recent report (76) showed that
lipidation of the N. meningitidis lipoprotein, PilW, is required for
both the stability of PilW and the efficient assembly of the PilQ
secretin complex, although PilW does not appear to be a bona fide
pilotin such as PulS. The Lol pathway acylates an N-terminal cysteine of lipoproteins following signal peptide cleavage and transport from the cytosol by the Sec apparatus (77). By default, the Lol
machinery transports lipoproteins to the OM, unless an aspartic
acid, glycine, proline, or aromatic residue is present at the second
N-terminal residue constituting a Lol-avoidance signal (70, 85).
Unlike nonlipoprotein secretins with cognate pilotins, the BfpB
secretin of EPEC is itself a lipoprotein and is palmitoylated in vivo
(61), and no pilotin can be identified in the BFP machine components (68). HxcQ is the T2S secretin of Pseudomonas aeruginosa
and one of the few other secretins experimentally demonstrated to
be a lipoprotein (81). Lipidation of HxcQ is required for protein
function and transport to the OM, suggesting that lipoprotein
secretins can self-pilot (81). However, the role of Lol in transporting lipoprotein secretins has not been determined (61, 81).
Secretins play a crucial role in T4P biogenesis machines; without a functional secretin multimer T4P biogenesis fails, a phenotype that manifests in EPEC as the loss of autoaggregation in the
bfpB deletion mutant (4, 61). Secretins are thought to serve as the
exit pore for pilus fibers as they extend and, in some systems such
as BFP, retract (6, 19, 42). To successfully transport substrates,
secretins interact with other system components. In the case of the
BFP system, BfpB interacts with two soluble proteins in the
periplasm, BfpU and BfpG, and recruits these proteins to the OM
(23). Although the exact function of BfpU is unknown, it is required for the function of BFP machines; BfpU is likely not a
specific chaperone since its absence does not alter expression, processing, or localization of the pilin (69).
In many T4P systems, including the BFP of EPEC (30), as well
as those of Neisseria gonorrhoeae (83) and N. meningitidis (14),
pilus retraction is an important step in pilus function and is driven
by a dedicated hexameric ATPase (3, 62). In the case of the N.
gonorrhoeae T4Ps, deletion of genes encoding both the secretin
(pilQ) and the retraction ATPase (pilT) resulted in cell toxicity
and membrane blebbing, which was attributed to pili assembling
without an exit pore (84). Curiously, a separate study found that a
pilQ pilT double mutant strain of N. meningitidis was viable, despite the presence of intraperiplasmic pilus fibers (14). It is unclear
what accounts for these species-specific differences. The effects of
simultaneous mutations in the secretin and retraction ATPase in
T4bP systems have not been studied.
The subcellular localization of T4P and T2S components has
been the subject of some debate. Although T4Ps in Myxococcus
April 2012 Volume 194 Number 7
xanthus and Pseudomonas aeruginosa have been shown by transmission electron microscopy (TEM) and fluorescence microscopy
to exit the cell primarily at the pole (13, 20, 36, 56), the case is
much less clear for other T4Ps. Moreover, Cowles and Gitai (20)
detected T4Ps with nonpolar origins in P. aeruginosa. In the case of
BFP fibers, TEM has not revealed an exit location perhaps because
of the extensive, overlapping, and complex meshwork formed by
these interacting fibers. Studies with fluorescent fusion proteins
have been complicated by gene dosage effects. Lybarger et al. (47)
described polar localization patterns when T2S proteins were expressed in trans but peripheral foci of fluorescence when expressed in their native stoichiometry from their wild-type locus.
Buddelmeijer et al. (12) observed a similar effect of the PulS pilotin on the localization of the PulD secretin in the T2S of Klebsiella
oxytoca. Furthermore, all localization studies of T4P or T2S components with fluorescent fusion proteins to date have been restricted in resolution by the limits of diffraction, and no previous
studies of T2S systems and T4P protein localization studies have
imaged single fluorescent molecules. Given the small sizes of bacteria, diffraction limited resolution and bulk excitation of fluorescent probes dramatically limit the ability to localize the pilus biogenesis machine and its components. Recent advances in
fluorescent imaging have made subdiffraction limit imaging possible (7, 35). These so-called super-resolution techniques reveal
unprecedented detail of bacterial cell biology.
In these studies we attempted to reconcile some of the unresolved questions related to the BfpB secretin of the EPEC T4bP,
including its basic architecture, the role of the Lol sorting system
in targeting BfpB to the OM, the effect of simultaneous mutations
eliminating the secretin, and the retraction ATPase and the subcellular localization of the protein. We used a combination of
genetic and functional techniques and applied photoactivation
localization microscopy (PALM) to capture the distribution of
single molecules of BfpB in fixed cells.
MATERIALS AND METHODS
Strains, plasmids, and growth conditions. The strains and plasmids used
in the present study are listed in Table 1. Bacterial strains were cultured in
Luria-Bertani broth (LB) at 37C, except for ALN92, which was grown at
30C. In EPEC strains, BFP was expressed as previously described (69) by
growing strains in Dulbecco modified eagle medium (DMEM) lacking
phenol red. Antibiotics were added at the following concentrations to
select for or maintain plasmids: ampicillin, 200 g ml1; chloramphenicol, 20 g ml1; and kanamycin, 50 g ml1.
UMD946 was constructed by deleting codons 121 to 128 (the Walker
A box) of bfpF, replacing these residues with a scar sequence using the
method of Datsenko and Wanner (24), PCR template pKD4, and the
primers Donne664 and 665 (Table 2). The mutation was confirmed by
sequencing and complementation to confirm that the mutation is nonpolar. UMD947 was created by electroporating into UMD946(pKD4) the
5.6-kb BamHI fragment from the nonpolar bfpB insertion mutant
UMD923, containing bfpB sequence flanking the kanamycin resistance
gene and replacing the native bfpB gene by one-step inactivation. No FRT
sites are present in this fragment, and there was no further recombination,
leaving this strain resistant to kanamycin.
Electron microscopy. Carbon support films approximately 10 to 15
nm thick were prepared by indirect sublimation of carbon onto freshly
cleaved mica. Homogeneous preparations of BfpB were diluted in 10 mM
Tris-HCl buffer (pH 7.0) to a final concentration between 10 and 30
g/ml. The samples were then prepared for electron microscopy by using
4% (wt/vol) uranyl acetate as a negative staining solution essentially as
described previously (78). The carbon film was partially floated off the
jb.asm.org 1647
Lieberman et al.
TABLE 1 Strains and plasmids used in this study

Strain or plasmid
Strains
E2348/69
UMD901
UMD923
UMD946
UMD947
NH4
ALN92
XL1Blue
BL21-AI slyD
DH5
XL10gold
Plasmids
pKD4
pASK-IBA3
pBAD24
pmOrange
pmCherry3
pAD07
pWS15
pJAL-B2
pKDS302
pEM116
pEM119
pJAL-B5
pJAL-B6
pJAL-B8
pJAL-B9
pJAL-F1
pJW15
pACYC184
pNLP27
pNLP27-Cm
a
Description and/or genotypea
Source or reference
Serotype O127:H6 EPEC strain isolated from an outbreak in the United Kingdom
E2348/69 bfpA(C129S)
E2348/69 bfpB::aphA3
E2348/69 bfpF(121128)
UMD 946 bfpB::aphA3
E2348/69 hsrD
MC4100 RS88 (spy-lacZ) cpxA101 zii::Tn10
recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F= proAB lacIqZM15 Tn10 (Tetr)]
F ompT hsdSB(rB mB) gal dcm araB::T7RNAP-tetA slyD::cat
supE44 lacU169(80dlacZM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1
Tetr (mcrA)183 (mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac Hte
[F= proAB lacIqZM15 Tn10 (Tetr) Amy Camr]
44
87
4
This study
This study
37
52
Stratagene
23
66
Stratagene
Flip-recombinase vector for the one-step method

Strep tag expression vector
Ampr; L-arabinose-inducible expression vector
Cloning vector containing mOrange
Cloning vector containing PAmCherry3
bfpU-His gene cloned into pBAD24
bfpB-Strep gene cloned into pASK-IBA3
pASK-IBA3::bfpB-mOrange
pTRC99a carrying IPTG-inducible BFP operon
pKDS302::XhoI-SacII
pKDS302::XhoI-mOrange-SacII-bfpC
mOrange cloned into XhoI and SacII sites pEM119
pJAL-B5 with stop codon of bfpB and XhoI site removed by QuikChange mutagenesis
PAmCherry cloned into XhoI and SacII sites pEM119
pJAL-B8 with stop codon of bfpB and XhoI site removed by QuikChange mutagenesis
bfpF cloned into pBAD24
Lux reporter
pSC101 derived cloning vector
degP promoter cloned into pJW15
Camr cloned into pNLP27; Kans
24
IBA
33
Clontech
75
23
23
This study
73
This study
This study
This study
This study
This study
This study
86
49
16
This study
This study
Camr, chloramphenicol resistant; Tetr, tetracycline resistant; Ampr, ampicillin resistant; Kans, kanamycin sensitive.
mica by introduction into a sample drop, then transferred to a drop of

washing solution (double distilled water), and then completely floated off
on a drop of negative staining solution, where it was adsorbed onto a
400-mesh specimen grid. The staining solution was completely removed,
resulting in a shallowly stained specimen. Electron microscopic imaging
was performed with a Philips EM 301 transmission electron microscope at
calibrated magnifications. The resulting images were grouped into projection forms essentially as described previously (11) and processed by
modified Markham rotational analysis (38, 50).
Selection of defined areas, trimming, and image rotation were performed with Scion Image (Scion Corp.). For image analysis, 1,300 single
particles were evaluated. Class averaging was used to verify three obviously predominant projection forms (46). Based upon the outlines of the
projection forms (cf. Fig. 1), three-dimensional models were designed
with Adobe Dimension 3.0 (Adobe Corp.).
Generation of fluorescent fusion proteins. Inverse PCR was performed on pWS15 to create a SacI restriction site immediately upstream
of the stop codon. The fluorescent protein mOrange was amplified from
pmOrange (Clontech) with primers mOrange Fw 2 and mOrange Rv 2
and cloned into the newly generated SacI site and the BstBI site already
present in the vector backbone to create pJAL-B2. The pJAL-B2 plasmid
was confirmed to complement the bfpB-null EPEC strain, UMD923. The
plasmid pEM116 was created by using QuikChange site-directed mutagenesis on pKDS302 with the primers Donn-1312 and Donn-1308 to
create an XhoI and SacII site between bfpB and bfpC. The mOrange gene
1648
jb.asm.org
was cloned into these sites using the primers Donn-1305 and Donn-1311,
yielding pEM119. To create fusions of bfpB-mOrange and bfpB-PAmCherry3 in the context of the native BFP operon, both proteins were amplified with the primers mOrange Fusion Fw or mCherry Fusion Fw and
mOrange Fusion Rv. The PCR products were spliced into pEM119 digested with XhoI and SacII by the In-Fusion method (Clontech), replacing the mOrange gene fused 5= to bfpC in pEM119 so that the gene products would produce a functional C-terminal fusion with BfpB and contain
a stop codon before bfpC. The two resulting plasmids, pJAL-B5 carrying
mOrange and pJAL-B8 carrying PAmCherry3, were then subjected to
QuikChange site-directed mutagenesis to remove the bfpB stop codon
and XhoI sites using the primers pJALB6&9 QC Fw and pJALB6&9 QC
Rv. The resulting plasmids, pJAL-B6 and pJAL-B9, carry an in-frame
translational fusion of BfpB with either mOrange or PAmCherry3 with
the same two amino acid linker as found in pJAL-B2, but in the native bfpB
locus in the BFP operon. These two plasmids were each found to be sufficient to build functional pili when expressed in ALN92, and free BfpB
degradation products were not detected by Western blotting. All three
BfpB fusion protein constructs were confirmed by sequencing.
Microscopy and image analysis. For epifluorescence microscopy,
overnight cultures of DH5 (pJAL-B2) were diluted 1:250 into LB with
ampicillin and 2 g 100 ml1 anhydrotetracycline (AHT) and grown for
3 h at 37C with shaking. Bacteria were spotted onto a poly-L-lysinecoated slide under cover glass and observed in an LSM510 Meta (Zeiss)
confocal microscope. Fluorescent proteins were excited with a 543-nm
TABLE 2 Primers used in this study

Primer
Sequence (5=3=)
Source or reference
Donn664
Donn665
bfpB C18S Fw
bfpB C18S Rv
bfpB S19D Fw
bfpB S19D Rv
pWS15 iPCR Fw 2
pWS15 iPCR Rv 2
mOrange Fw 2
mOrange Rv 2
Donn-1312
Donn-1308
Donn-1305
Donn-1311
mOrange Fusion Fw
mOrange Fusion Rv
mCherry Fusion Fw
pJALB6&9 QC Fw
pJALB6&9 QC Rv
DegP5=Eco
DegP3=Eco
CamRNcoIF
CamRNcoIR
GAATACATTAAAATTGATGGGGAAGAAAAGAGGTTTGCTTTTAGTTAGTGGTGTAGGCTGGAGCTGCTT
AATATCACCGTATTTCTGAACATAATATGTCAGCAAAGCATAGATTGTTGTCATATGAATATCCTCCTTA
CGCTCCTGGCATCTTCGTCGGGTAATGGATTTATAAAGATAATCTTGG
CCAAGATTATCTTTATAAATCCATTACCCGACGAAGATGCCAGGAGCG
CCGCTCCTGGCATCTTGCGACGGTAATGGATTTTATAAAGATAATCTTGG
CCAAGATTATCTTTATAAAATCCATTACCGTCGCAAGATGCCAGGAGCGG
TTAATTATGAGCTCGCTTGGAGTCACCCGCAG
TATATTTAGAGCTCGCCAGATGCCTTGAGATCAATAATTC
GAGATGGGAGCTCGTGAGCAAGGGAGAGGAG
CTATATATTCGAATTACTTGTACAGCTCCATGCC
CTCAAGGCTTCTGGCGAATGATACTCGAGCTGCGCTCCCGCGGCATAAAGAATAATCTTGGCG
CGCCAAGATTATTCTTTATGCCGCGGGAGCGCAGCTCGAGTATCATTCGCCAGAAGCCTTGAG
GCGATGGCTCGAGGTGAGCAAGGGCGAGGAG
CTATATACCGCGGGAGCGCAGGCCCGACTTGTACAGCTCGTCCATGCC
GCGAATGATACTCGAGCTCGTGAGCAAGGGCGAGGAGAATAACATGG
ATTATTCTTTATGCCGCGGATCATTCGCCAGAAGCCTTCTTGTACAGCTCGTCCAT
GCGAATGATACTCGAGCTCGTGAGCAAGGGCGAGGAGGATAACATGG
TCAAGGCTTCTGGCGAGCTCGTGAGCAAGG
CCTTGCTCACGAGCTCGCCAGAAGCCTTGA
GGAATTCCCGCCATCGGCTGGCCTATGT
CGGATCCGAGAGCCAGTGCACTCAGTGCT
TTTTCCATGGTAAATACCTGTGACGGAAGAT
TTTTCCATGGTATCACTTATTCAGGCGTAGC
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
59
59
This study
This study
FIG 1 Electron micrograph of pure BfpB preparation after negative staining.

(A) Examples of the prominent projection forms 1 (top view), 2 (side
view), and 3 (bottom view) are circled. Approximately 23% of all particles
could be assigned to projection form 1, 53% to form 2, and 16% to form 3. (B)
Galleries of the three prominent projection forms. For forms 1 and 3, the
rotational symmetry appears to be obvious, whereas form 2 shows bilateral
symmetry. (C) Approximately 8% of all particles on the carbon film could not
be assigned to one of the three described forms but are interpretable as transient projections of the complex. The gallery shows a schematic view of a tilted
complex (right column) and respective views of the negatively stained BfpB
particles. Rotation axis and tilting direction (following the complexes from top
to bottom) is indicated by the arrow symbol. (D) The projection forms after
image enhancement by rotational and translational analysis (1, top view; 2,
side view; 3, bottom view). (E) Processed original image (see panel D1); the
darkest and brightest areas in the original image are colored blue and red. (F)
Model of the bisected complex illustrating the distribution of negative staining
salt (blue). The protein masses identified as brightest areas in the original
image (see panel E) are marked by red asterisks; grooves between these masses
are highlighted by arrows. (G and H) Model of the complex from two views
(panel G is tilted toward the bottom view; panel H is tilted toward the top
view) after the removal of a quarter section of the whole complex.
HeNe laser with an HFT477/543 beam splitter, and emission was collected
with a 560-605BP filter. ALN92(pJAL-B6) and UMD923(pJAL-B2) were
prepared in the same manner, except that UMD923(pJAL-B2) was diluted
into DMEM and ALN92(pJAL-B6) was diluted 1:50 and grown at 30C
with 0.1 M IPTG (isopropyl--D-thiogalactopyranoside).
For photoactivated localization microscopy (PALM), ALN92(pJALB9) was grown as described above. After 3 h of growth in the presence of
inducer, the cell culture was centrifuged for 5 min at 13,000 g and 25C
and then resuspended in one-fifth volume of filter-sterilized phosphatebuffered saline (PBS). A droplet of 75 l of concentrated cell culture was
placed on a coverslip coated overnight with poly-L-lysine (0.05% [wt/
vol]) and allowed to settle for 30 min in the dark at 25C. Excess fluid was
removed, and 75 l of freshly prepared, filter-sterilized 4% paraformaldehyde at pH 7.4 was added for 45 min to fix the bacteria to the coverslip.
Adhered cells were washed in filtered PBS and imaged using an Olympus
IX81 inverted microscope with a 100/1.45 Plan Apo oil immersion objective lens essentially as previously described (29). A total of 15,000
frames were collected per field of view at a rate of 100 Hz during excitation
at 561 nm. Molecules were activated by 405-nm excitation initially set at
50 W and gradually increased over the course of the imaging to maintain a low density of activated molecules (3 per frame). Molecules were
localized by fitting a two-dimensional elliptical Gaussian function to a
99 pixel array at the peak, and the distribution of localized molecules
was analyzed in Matlab. The molecular density was calculated within 40
nm square pixels, and the distribution of BfpB-PAmCherry was analyzed
in the resulting plots.
We observed monopolar, bipolar, envelope, and indeterminate patterns of BfpB-PAmCherry distributions by eye and identified four bacteria that represented each category. In order to classify the distributions
objectively, we analyzed the images in ImageJ and developed an algorithm
that assigned the representative bacteria to their predicted classes with
high fidelity. Only bacteria whose entire outline could be seen were included for analysis. We used linescan analysis to assign each bacteria as
having a nonenvelope or envelope distribution of BfpB-PAmCherry molecules and to further categorize these envelope distributions as bipolar,
monopolar, or nonpolar. Four-pixel wide lines were drawn along the long
axis down the center of each bacterium and along the short axis at the
jb.asm.org 1649
Lieberman et al.
approximate midpoint of the cell length. The proximal and distal 10% of
the longitudinal linescan was taken to represent the cell poles and that of
the short axis the nonpolar envelope, whereas the middle 80% of each
linescan was used to represent the cell interior. The fluorescence intensity
per pixel for each of these six regions was determined for each bacterium,
representing the fluorescence intensity of the boundary pixels at the poles
and longitudinal midline, as well as the cell interior. If the average fluorescence intensity per pixel of the four cell boundary regions was at least
1.6-fold greater than the average fluorescence intensity of the cell interior
sections, the distribution of molecules in that bacterium was classified as
envelope and considered for further analysis. If the fluorescence intensity
per pixel for either cell pole was at least 1.5-fold more than the average
fluorescence intensity of the longitudinal midline boundary regions, that
bacterium was classified as having a monopolar distribution. These cutoff
values were selected because they assigned the reference bacteria to their
predicted classes with the highest concordance. If both ends of the long
axis were greater than the short axis ends, the bacterium was classified as
bipolar. Nonenvelope distributions were not considered in the final analysis because BfpB is an OM protein and never found in the cytoplasm (61,
68), and therefore nonenvelope distributions are either artifacts of imaging or optical slices through the membrane of the bacteria likely to confound the analysis.
Excel was used for multivariable correlation analysis. Cell length, cell
width, and the ratio of length to width were treated as independent variables. The measurements tested as dependent values were: (i) the ratio of
fluorescence intensities at one pole to the other, (ii) the ratio of the total
polar intensity to the total nonpolar membrane intensity, (iii) the ratio
polar and nonpolar envelope fluorescence to the fluorescence of the cell
interior, (iv) the distribution class of nonpolar, monopolar, or bipolar, or
(v) the distribution class of nonpolar or any polar.
Autoaggregation assays. The autoaggregation phenotype requires expression of functional BFP (4) and serves as a proxy metric for functional
BFP machines. Autoaggregation assays were performed as previously described (22) with minor modifications: overnight cultures were diluted
1:100 in DMEM with appropriate antibiotics and inducer (AHT at 2 g
100 ml1; arabinose at 0.2%) and grown at 37C. The autoaggregation
index was determined as previously described (3) at 3, 4, and 5 h postinoculation. Each experiment contained three biological replicates of individual colonies, and each experiment was performed three times. Differences between strains at each time point were determined by pairwise
analysis of variance (ANOVA) in Microsoft Excel using data from all nine
time points. E. coli cpxA laboratory strain ALN92 carrying pKDS302 or its
derivatives, pJAL-B6 and pJAL-B9, was grown overnight at 30C in Luria
broth, diluted 1:100 in medium containing antibiotics, and 0.1 mM IPTG
and observed microscopically for autoaggregation at 4 to 6 h postinduction.
Construction of DegP-luciferase reporter and reporter assays. The
DegP-Lux reporter plasmid, pNLP27-Cm, was made by cloning the degP
promoter sequence into pJW15 using the primers DegP5=Eco and
DegP3=Bam, creating pNLP27 (N. L. Price and T. L. Raivio, unpublished
data). The chloramphenicol resistance cassette was amplified from
pACYC184 by using the primers CamRNcoIF and CamRNcoIR and
cloned into the NcoI site of pNLP27 rendering this plasmid kanamycin
sensitive (Kans) and chloramphenicol resistant (Camr), creating pNLP27Cm. The final reporter plasmid, pNLP27-Cm, was passaged through
EPEC strain NH4 and then electroporated into the strains used in the
present study.
Luciferase reporter assays were performed as previously described (49,
82). In four independent experiments, quadruplicate colonies were grown
overnight and diluted 1:100 in DMEM with antibiotics and buffered with
0.1 M Tris (pH 7.5). For each culture, 200 l was transferred to a clear
96-well plate (Nunc, catalog no. 439454) and to a 96-well white-walled,
opaque bottom luminometry plate (Dynex, catalog no. 7417), and the
cells were grown at 37C, with shaking at 225 rpm. The A595 and luminescence (400 ms) were determined from these plates for samples and for
1650
jb.asm.org
medium-only wells. The plates were then covered, placed at 37C with
225-rpm orbital shaking. The final measurement was determined by the
following formula:
RLU(cps)
2.5 [(400-ms luminescence) (luminescence blank)]

[(absorbance sample) (absorbance blank)]
Thus, giving the cell density-adjusted relative luminescence units in

counts per second per culture. The relative luminescence intensity units
(RLU) for the four cultures for each strain were averaged and plotted
(error bars represent the standard error of the mean [SEM] in the figures).
Single-factor, pairwise ANOVA was performed as described above for the
autoaggregation assay except that 12 data points were used for each strain
at each time point.
Western blotting. Western blotting for bundlin, BfpB, and BfpU was
performed as previously described (23, 27, 69). SDS-PAGE gels were run
according to the manufacturers instructions (Bio-Rad) and transferred at
21 V for 80 min at 4C to Immobilon polyvinylidene fluoride (Micropore,
catalog no. IPFL0010) and blocked overnight in 5% milkPBSTween.
The blots were then probed for 1 h at room temperature with rabbit
anti-bundlin (1:2,000), rabbit anti-BfpB (1:15,000), or mouse anti-BfpU
(1:15,000) in 5% milkPBSTween, washed three times for 5 min in PBSTween, and probed for 1 h at room temperature with IRDye (680 or 800
nm)-conjugated anti-rabbit or anti-mouse secondary antibodies (Licor
Biosciences). The blots were washed again three times for 5 min in PBSTween at room temperature and scanned with an Odyssey Western system (Licor Biosciences).
Quantitative Western blotting was performed to determine the stoichiometry of BfpB to BfpU and the quantity of each protein per EPEC
CFU. BfpU was selected for this experiment because it is known to interact
with BfpB in vivo (23), and therefore the relative stoichiometry may provide insight into machine function. In addition, the BfpU antibody is a
mouse monoclonal antibody that does not recognize other His-tagged
proteins, while the BfpB antibody is a rabbit polyclonal that does not
recognize other Strep-tagged proteins. Since these antibodies are from
different species, they can be used simultaneously to probe for BfpU and
BfpB in the same Western blot. Wild-type E2348/69 EPEC was grown
overnight at 37C in Luria broth with shaking and then diluted 1:100 in
DMEM and grown for 5 h at 37C. Several 1-ml aliquots were taken and
centrifuged at 4C at 13,000 g in a benchtop refrigerated centrifuge. The
pellet was resuspended in 100 l of Laemmli buffer and boiled for 10 min.
Simultaneously, serial dilutions of the culture were prepared, 100 l from
the 105 and 106 dilutions were plated on LB plates and grown overnight
at 37C, and the numbers of CFU were counted the next day. Four volumes of whole-cell lysate (10, 5, 2.5, and 1 l) were loaded onto an SDSPAGE gel, along with a range of purified BfpU (35 to 1,500 ng) and BfpB
(40 to 2,500 ng) mixed together. BfpU and BfpB were purified as previously described, and concentrations determined using the extinction coefficients and the measured A280 (23, 69). Western blotting was performed
as described above, and blots were simultaneously probed with anti-BfpU
and anti-BfpB, and then with both anti-mouse and anti-rabbit secondary
antibodies. For each BfpB- and each BfpU-reactive band the integrated
intensity was measured using the Odyssey software. Using the integrated
intensities, standard curves were generated, and the numbers of BfpB and
BfpU molecules per CFU of EPEC were calculated for each protein.
RESULTS
Electron microscopy and single particle averaging reveal BfpB is

a dodecameric gated pore. We purified BfpB-Strep to homogeneity by affinity chromatography on a Strep-Tactin column as previously described (23). Electron microscopy and image analysis of
negatively stained preparations revealed two different BfpB projection forms exhibiting rotational symmetry (Fig. 1A1, A3, 1B1,
B3, 1D1, and D3) and a third projection form with bilateral symmetry (Fig. 1A2, B2, and D2). These three forms may be interpreted as top, bottom, and side views of the complex, with
FIG 2 Representative quantitative Western blot for BfpB and BfpU stoichiometry. Lane 1, marker; lanes 2 to 5, EPEC whole-cell lysates, 10, 5, 2.5, and 1
l; lane 6, empty; lanes 7 to 13, protein standards were loaded as 2-fold serial
dilutions containing both purified recombinant BfpB from 621 to 9.7 ng and
BfpU from 148 to 2.2 ng. BfpB-reactive bands appear in the top panel, and
BfpU-reactive bands appear in the lower panel. The double asterisk indicates
the 50-kDa marker band, while the single asterisk indicates the 15-kDa marker
band. The predicted molecular mass of purified recombinant BfpB is 52 kDa,
and that of BfpU is 16.5 kDa.
outer and inner diameters of approximately 20 and 18 nm, respectively. It is not clear which of the top or bottom views represents
the periplasmic or outer face of the complex. Markham rotational
analysis of a top or bottom view of a single particle reveals that
rotation by angles of n 30 around the central axis of the particle
meets the periodicity of the structure, which accounts for a 12-fold
rotational symmetry. Other angles result in a blurred image (data
not shown). Twelve bright spots on the ring-like projection form
and 12 dark spots of staining salt clearly indicate the presence of 12
protein masses. This is illustrated for the top view in Fig. 1E. Here,
the darkest and lightest areas of the original image are colored blue
and red, respectively. The dark stain is accumulated in small
grooves, located between protein masses (see Fig. 1F; grooves are
marked by arrows, and protein masses are marked by asterisks).
The distribution of negative staining salt may be easily explained
by a model as depicted in Fig. 1F. The H-shaped side view of the
complex has a trapezoidal outline (Fig. 1D2). The long side of the
trapezium measures 20 nm, corresponding to the diameter of
the ring-like top view, and the height of the complex measures
14 nm. The ring-like projection forms (Fig. 1D1 and D3) exhibit
a central accumulation of dark staining solution, which is indicative of a central depression or pore in the complex as previously
suggested (Fig. 1F) (68, 68). A bright mass located in the center of
the top view is indicative of a shallow depression (Fig. 1D1),
whereas from the bottom view, the depression appears to be
deeper, i.e., a bright central mass is not visible (Fig. 1D3). This
interpretation is confirmed by the appearance of the side view
(Fig. 1D2), where the blocking mass is located close to the top side
of the complex. Besides these prominent views it is possible to
detect transient forms showing views of molecules tilted to the
respective forms 1, 2, and 3 (Fig. 1C). In addition, the bottom view
(Fig. 1D3) reveals six triangular leaflets emanating from the inside
of the ring structure and extending toward the center of the pore.
A tentative model based upon these data shows two views of the
whole complex from the outside and from the inside after a quarter of the complex has been removed (Fig. 1G and H).
Quantitative Western blotting reveals the relative stoichiometry of BfpB and BfpU in wild-type E2348/69. The number of
molecules of BfpB per CFU of wild-type EPEC was determined
through five independent trials of quantitative Western blotting
(Fig. 2) using the Odyssey system (Licor Biosciences). As a standard against which to measure the quantity of all Bfp components,
we also measured the number of BfpU molecules per cell, since a
mouse monoclonal antibody against BfpU is available (69). BfpU
was quantified in quadruplicate. On average ( the standard error

of the mean [SEM]), there were 6.3 104 (1.4 104) molecules
of BfpB and 5.9 104 (2.8 104) molecules of BfpU per CFU.
The average ratio of BfpB molecules to BfpU molecules per CFU
was 1.3 0.43, with a range of 0.6 to 2.4. Assuming a dodecameric
structure for BfpB based on the EM structure reported above,
these data suggest 5.2 103 (1.2 103) BfpB multimers per
CFU, assuming all BfpB molecules are in multimers. This calculation yields an estimate of 0.1 0.04 intact BfpB multimers per
molecule of BfpU monomer, or 12.9 3.9 BfpU molecules per
secretin multimer. The ratio of BfpU molecule to BfpB multimer
had a range of 4.9 to 21.2. There was significantly more variability
in the number of BfpU molecules detected than was the case for
BfpB. The variations in BfpU concentrations did not appear to
correlate with the abundance of BfpB. It should be noted that these
estimates assume that the antibodies bind with equivalent affinity
to cellular and purified recombinant protein after each is boiled
and denatured in SDS.
The Lol-sorting pathway is required for BfpB stability. To
test the hypothesis that the Lol-sorting pathway is required for
BfpB transport to the outer membrane, two separate site-directed
point mutations in the bfpB coding sequence were generated in the
complementing plasmid, pWS15. The first amino acid after the
predicted signal peptide cleavage site, Cys18, was mutated to a
serine generating the plasmid pJAL-B10, which codes for
BfpBC18S. In addition, a Lol avoidance signal was created by mutating Ser19 to an aspartic acid residue, generating pJAL-B11,
which codes for BfpBS19D. Each of these mutated plasmids was
assayed for its ability to restore the autoaggregation defect in the
bfpB deletion mutant.
As expected, the wild-type BfpB construct was able to restore
autoaggregation in this strain, while the empty vector could not
(Fig. 3A and B). The plasmid coding for the mutated Lol lipidation
target, BfpBC18S, was unable to restore autoaggregation at any time
point assayed (Fig. 3C). Surprisingly, the Lol avoidance signal mutant, BfpBS19D, was able to restore autoaggregation by 4 h postinduction (Fig. 3D). Although the BfpBS19D mutant is able to complement the bfpB deletion mutant, autoaggregation occurred later
than when this strain was complemented with wild-type BfpB
(Fig. 3F). The BfpBS19D-expressing strain was not statistically different from the negative control at 3 h postinduction, was different from both the positive and the negative controls at 4 h, and was
not statistically different from the wild-type BfpB control at 5 h. In
contrast, the BfpBC18S-expressing construct was equivalent to the
negative control at all time points (Fig. 3F). To determine whether
the altered proteins were expressed, we performed immunoblotting. We were unable to detect the BfpBC18S construct, suggesting
that it is unstable, whereas both wild-type BfpB and BfpBS19D are
readily detected at 4 h postinduction (Fig. 3E). Since BfpBS19D is
functional, this protein must be present in the OM at 4 and 5 h
postinduction.
PALM reveals that BfpB is not found predominantly at the
bacterial poles. T4Ps are polar in some, but perhaps not all species, and the location of these structures may influence their function. To test the hypothesis that BFP components localize to the
cell pole, we fused either the gene for photoactivatable mCherry
(PAmCherry) or mOrange to the 3= end of bfpB and examined the
cellular distribution of the fusion proteins using PALM or traditional epifluorescence. These fluorescent proteins were chosen because mCherry was successfully fused to the PulD of Klebsiella
jb.asm.org 1651
Lieberman et al.
FIG 3 BfpB Residue C18 is required for protein stability, while the S19D Lol avoidance signal can be overcome. Images of bfpB mutant strain cultures at 3.5 h
postinoculation complemented with null cloning vector (pASK-IBA3) (A) or vector encoding wild-type BfpB (pWS15) (B), BfpBC18S (pJAL-B10) (C), or
BfpBS19D (pJAL-B11) (D). (E) Western blot of whole-cell lysates from cultures at 4 h using anti-BfpB antiserum. An asterisk indicates the 50-kDa marker. An
arrowhead indicates the BfpB monomer band. (F) Quantitative autoaggregation index (AI) determined at 3, 4, and 5 h postinoculation into DMEM for each
strain. Diamonds indicate null vector control, squares correspond to wild-type BfpB, triangles indicate BfpBC18S, and crosses () indicate BfpBS19D.
oxytoca in a previous report (12) and mOrange, like mCherry, is a

derivative of DsRed (71). Indeed, we found that the bfpB-mOrange fusion could complement the bfpB mutant in trans and restore autoaggregation, while the bfpB-mOrange and bfpB-PAmCherry fusions in the context of the entire BFP operon could
confer the capacity to autoaggregate on the ALN92 laboratory
strain of E. coli that carries a constitutively activated cell envelope
sensor in the form of the cpx mutation. ALN92 was previously
demonstrated to support BFP elaboration and autoaggregation
from the cloned BFP operon due to the cpx mutation; the Cpx
pathway is important for efficient BFP expression and adherence
to host cells (52).
When BfpB-mOrange was expressed in trans, either in a laboratory strain of E. coli or in the bfpB-null mutant, intense foci of
fluorescence were observed at one or both cell poles (see Fig. S1 in
the supplemental material). A small amount of fluorescence could
be detected around the cell periphery. However, when BfpB-mOrange was expressed in the context of the other BFP proteins from
the bfp operon in ALN92, we observed a more diffuse pattern of
fluorescence around the cell envelope; in some bacteria, fluorescence was exclusively observed at the poles.
The results from the epifluorescence imaging illustrate the
concept that expression of BfpB-mOrange in the context of the
native operon gives strikingly different results from expression of
the protein in trans. For finer resolution and quantification of the
distribution of BfpB molecules, we used PALM to localize single
BfpB-PAmCherry molecules with high precision. We examined
ALN92 expressing BfpB-PAmCherry from the BFP operon in
1652
jb.asm.org
fixed cells. We imaged 427 bacteria in three independent experiments. Briefly, single molecules of BfpB-PAmCherry were imaged
by oblique illumination of fixed cells, using low-intensity UV photoactivation to maintain a sparse density of activated molecules.
Bacteria lacking the pmCherry3 plasmid displayed no photoactivatable fluorescence (results not shown). Individual molecules
were identified and localized as described previously (29), and the
molecular density was plotted in 40-nm pixels. We observed that
the distribution of BfpB-PAmCherry molecules appeared to fall
into one of four categories, i.e., bipolar, monopolar, envelope, or
indeterminate, and we selected four model bacteria for each class.
Bacteria expressing soluble PAmCherry from pmCherry3 were
indistinguishable from the indeterminate class, as expected of
an exclusively cytosolic distribution of the free fluorophore (data
not shown).
We used a linescan analysis to estimate the average fluorescence intensity at four regions of interest: the envelope at the longitudinal midline of the cell; the first and last 10% of the cell
length, which we defined as the cell poles; and the cell interior.
Bacteria whose margins could not be clearly seen were excluded
from the linescan analysis, leaving 276 bacteria for further classification. Of note, bacteria involved in autoaggregates were excluded from this analysis because the margins between aggregated
bacteria could not be precisely defined.
To objectively classify the distribution of molecules in a bacterium, we generated a set of rules that utilized these data to assign
the model bacteria to their predicted classes. We reasoned that
since BfpB is an outer membrane protein that is not detected in the
FIG 4 Distributions of single BfpB-PAmCherry molecules localized using

PALM. Single molecules of BfpB-PAmCherry expressed from the complete bfp
operon in ALN92 cells were imaged by PALM and classified as bipolar (7.1%)
(A), monopolar (12.8%) (B), or nonpolar (80.1%) (C) distributions. (D) Bacteria with a low ratio of fluorescence at the cell envelope relative to the cell
interior were classified as nonenvelope and were not included in the cell polarity analysis. (E and F) Two unanticipated distributions of BfpB-PAmCherry
molecules were also observed: nonpolar foci of fluorescence (E) and banding at
oblique angles to the longitudinal axis, suggesting a helical distribution of
molecules (F). Note that the bacterium pictured in panel C has bilateral peripheral clusters suggestive of a helical distribution. For all images, the gray
value indicates the number of molecules per pixel and was normalized to the
brightest pixel in each image.
cytoplasmic fraction (61, 68), localization of molecules in the apparent interior of the cell occurred primarily when the portion of
the cell membrane closest to the coverslip was in the focal plane.
To select cells in which the focal plane crossed the center of the
z-axis of the cell, we excluded any bacteria from further analysis if
the average fluorescence at the boundary of the cells, including at
the longitudinal midline of the bacterium and at the poles, did not
exceed the average interior fluorescence by 1.6-fold. For the
remaining 141 cells, we determined whether the intensity at either
pole was at least 1.5-fold greater than the average fluorescence of
the boundary pixels at the longitudinal midline of the cell. These
two cutoff values gave the highest concordance between assignment of model bacteria by eye and by our algorithm. In this way,
we were able to assign bacteria to monopolar, bipolar, or nonpolar
classes. In contrast to the results observed by fluorescence microscopy when BfpB-mOrange was expressed in trans, 80.1% (n
113) of all included bacteria displayed a nonpolar distribution of
BfpB-PAmCherry molecules characterized by a distribution of
molecules along the boundary of the cell. A further 12.8% (n 18)
had a concentration of molecules at a single pole, and 7.1% (n
10) had a bipolar distribution of molecules (Fig. 4).
We reasoned that physical and temporal changes in the bacterial life cycle may modulate the location of BFP components
within the cell. Therefore, we performed a multivariable correlation analysis to determine whether particular distributions were
associated with physical parameters of the bacteria (Table 3). Of

the relationships tested, only one approached statistical significance: the ratio of the total polar fluorescence to the total nonpolar
membrane fluorescence was positively associated with the ratio of
cell length to cell width (r 0.266, P 0.074).
In addition, we observed two novel distributions of BfpBPAmCherry. In 8.5% (n 12) of the imaged bacteria, we noted
foci of fluorescence away from the poles. Although not included
for polarity analysis, bacteria involved in autoaggregates commonly formed nonpolar foci, often multiply in each cell envelope
(data not shown). Furthermore, in 2.8% (n 4) of the imaged
bacteria, we saw banding of BfpB-PAmCherry with lines of molecules apparently oriented at an oblique angle to the long axis, as
might be expected of a helical distribution. Example images are
seen in Fig. 4. Taken together, these results illustrate in unprecedented detail a subcellular localization of the T4P secretin more
complex than previously demonstrated. Furthermore, these studies extend the previously reported importance of gene dosage effects when studying the distribution of bacterial secretion systems
with fluorescent fusion proteins from type 2 secretion systems to
type IV pili (47).
A bfpB bfpF double mutant is viable in BFP-inducing conditions and expresses bundlin at levels similar to those for wildtype E2348/69. In N. gonorrhoeae the absence of the secretin and
the retraction ATPase is cytotoxic (84), while the equivalent double mutation in N. meningitidis is viable (14). In both systems,
intraperiplasmic pili were observed (14, 84). To test the hypothesis that the bfpB bfpF double mutation in EPEC is cytotoxic, strain
UMD947 was created as described in Materials and Methods. Importantly, complementation of UMD947 with a plasmid encoding
BfpB resulted in a strain that could form autoaggregates, but could
not disaggregate, a phenotype consistent with the bfpF mutation.
In contrast, complementation of UMD947 with a plasmid encoding BfpF resulted in a strain that could not form autoaggregates, as
expected from a bfpB mutation. Thus, the phenotypes of the double bfpB bfpF mutant were consistent with its genetic defects (see
Fig. S2 in the supplemental material). UMD947 was grown in
BFP-inducing conditions along with wild-type E2348/69, the bfpB
mutant (UMD923), and the bfpF deletion mutant (UMD946),
and with each strain complemented for the relevant mutation(s)
in trans (data not shown). These strains were assayed for their
growth rates in BFP-inducing conditions and growth curves were
constructed from the optical density at 600 nm (OD600) values
determined after vortexing to disrupt autoaggregates (Fig. 5). This
result was corroborated by CFU counts on serial dilutions of wild
type, single, and double mutants at 3, 4, and 5 h postinduction as
described in Materials and Methods for quantitative Western
blotting.
Surprisingly, no strain showed evidence of growth defects in
TABLE 3 Multi variable correlation of fluorescence distribution with cell parameters

Putative dependent variables (coefficients of correlation SEM)
Dependent
variable
Pole A/pole B ratio
Pole B/pole A ratio
Poles/nonpolar
membrane ratio
Envelope ratio
(yes/no)
Total membrane
interior
Nonpolar vs any
polar
Length
Width
Length/width
0.0
0.0
0.50 1.5
0.0
0.0
0.90 1.1
0.0
0.0
16.32 9.1a
0.0
0.0
3.53 6.8
0.0
0.0
0.19 0.49
0.0
0.0
0.1 0.34
r 0.266, P 0.074.
jb.asm.org 1653
Lieberman et al.
FIG 5 The bfpB bfpF double mutant strain is viable in BFP-inducing conditions. Growth curves for wild-type EPEC (), bfpB mutant strain UMD923
(), bfpF mutant strain UMD946 (), and the bfpB bfpF double mutant strain
UMD947 () are shown.
FIG 6 Neither bundlin degradation nor degP activation account for the via-
DMEM when assayed by determining the OD600 (Fig. 5). Similarly, there was no evidence that the growth rate of the double
mutant was reduced in comparison to the other strains when assayed by viable counts (data not shown). Although all of the noncomplemented strains displayed growth rates similar to wild-type
E2348/69, two strains did not grow nearly as well: the bfpB bfpF
double mutant complemented for bfpB and the bfpF mutant complemented for bfpF (data not shown). These results strongly suggest that the bfpB bfpF double mutation is not cytotoxic to EPEC.
The reduced growth rate in some of the complemented strains
may be the result of Bfp protein expression at aberrant levels.
We performed immunoblotting to determine whether the viability of the bfpB bfpF strain was due to the degradation of bundlin, the major pilus subunit. Bundlin was detected in all of the
strains tested, except the negative control, bfpA mutant strain
UMD901 (Fig. 6A). To determine whether any evidence of intracellular T4P expression by the bfpB bfpF double mutant could be
detected, cells from wild-type E2348/69 and the isogenic bfpB,
bfpF, and bfpB bfpF double mutant strains were observed by TEM.
No membrane abnormalities were observed (data not shown). In
addition, when cells harboring the bfpB bfpF mutation were
probed with an antibody against bundlin, no fluorescence was
observed by microscopy before or after osmotic shock (see Fig. S3
in the supplemental material). Not only does the bfpB bfpF strain
thrive in BFP-inducing conditions, but it is also free of membrane
abnormalities and altered expression levels of bundlin do not account for this survival. Despite the presence of bundlin detected
by immunoblotting, no intraperiplasmic pili were observed by
either fluorescence microscopy or TEM. These results suggest the
existence of a feedback mechanism to limit expression of BFP
when OM egress is prevented.
In BFP-inducing conditions degP transcriptional activation
in the bfpB bfpF double mutant is similar to that of wild type.
Given that reduced expression of bundlin does not account for the
ability of EPEC cells to tolerate a double mutation of bfpB and
1654
jb.asm.org
bility of the bfpB bfpF double mutant. (A) Representative Western blot for
bundlin in whole-cell lysates of wild-type EPEC strain E2348/69 (lane 2), bfpA
mutant strain UMD901 (lane 3), bfpB bfpF double mutant strain UMD947
(lane 4), bfpB bfpF double mutant complemented for BfpB (lane 5), bfpB bfpF
double mutant complemented for BfpF (lane 6), bfpB mutant strain UMD923
(lane 7), and bfpF mutant strain UMD946 (lane 8). *, 20 kDa; **, 15 kDa. The
arrowhead indicates the bundlin band. (B) Luminescence data from degP-lux
reporter assay from three independent experiments each performed in quadruplicate. Error bars represent the SEM. Diamonds indicate wild-type EPEC
strain E2348/69, squares indicate bfpA mutant strain UMD901, triangles indicate bfpB mutant strain UMD923, crosses () indicate bfpF mutant strain
UMD946, and asterisks indicate bfpB bfpF double mutant strain UMD947.
bfpF, we hypothesized that the envelope stress response pathway

was upregulated in UMD947 and protected the cell envelope from
damage. BFP proteins encounter periplasmic Cpx pathway effectors such as DegP and DsbA once they cross the IM (48); indeed,
some low level of Cpx activity is required for pilus biogenesis (49,
82). To assess the activity of the cell envelope stress response system in wild-type and various mutant strains, we constructed a
luciferase reporter for degP transcriptional activation, pNLP27Cm, that is compatible with the mutants.
Strains carrying the degP-lux reporter plasmid were grown in
BFP-inducing conditions in quadruplicate independent cultures
and assayed for cell density (OD595) and luciferase activity at 2, 4,
6, and 8 h postinoculation. The luminescence was normalized by
cell density, and the experiment was performed four times (Fig.
6B). Surprisingly, the bfpB bfpF double mutant exhibited degP-lux
activation that was indistinguishable from that of the wild-type
strain at 2 h. At 4 h, various strains showed differing levels of
degP-lux activity, except for the bfpA and bfpB mutants. At 6 h and
at 8 h, however, the bfpB bfpF strain had degP-lux levels that were
similar to both bfpB and bfpF single mutants. Interestingly, the
level of degP-lux activation in the bfpB single mutant was much
greater than that of the other strains tested, peaking at 2 h, reflecting an early spike in cell envelope stress when this mutant is first
inoculated into BFP-inducing media. Thus, the viability and lack
of detectable intracellular BFP formation by the bfpB bfpF double

mutant is not due to higher levels of compensatory Cpx envelope
stress activation.
DISCUSSION
Secretins are outer membrane proteins common to and required

for the function of T4P, T2S, and T3S systems. BfpB is a lipoprotein secretin required for biogenesis of the EPEC BFP. We addressed several questions related to BfpB targeting to the OM,
complex structure, subcellular localization, and the viability of a
secretin and retraction ATPase double mutant, and our results
illustrate the complexities of secretin function.
As predicted, we found that the N-terminal cysteine immediately downstream of the proposed signal peptidase II cleavage site
in BfpB is necessary for protein stability since BfpBC18S does not
complement a bfpB-null mutant strain and cannot be detected by
Western blotting. BfpB contains only two cysteine residues, Cys18
and Cys540. Unlike BfpBC18S, mutation of Cys540 to a serine does
not affect the stability or function of BfpB (J. A. Lieberman et al.,
unpublished data). Therefore, these data strongly suggest that
Cys18 is the palmitoylated cysteine residue and lipid anchor for
BfpB (61) and show that acylation is required for stability. Moreover, we found that a Lol avoidance signal delayed but did not
block complementation of the bfpB mutant with BfpBS19D. Since
BfpBS19D can support autoaggregation at 4 and 5 h postinoculation, this protein must be localized to the OM at these times. These
results suggest that while the Lol pathway likely lipidates BfpB at
Cys18, a Lol-avoidance signal retards but does not ablate BfpB
function. Thus, BfpB likely contains dominant intrinsic OM targeting information, similar to the HxcQ lipoprotein secretin of the
T2S system in P. aeruginosa (81). Our results complement and
extend those of the previous HxcQ study in which the role of Lol in
secretin transport was not tested (81).
Once inserted in the outer membrane, BfpB is presumed to
serve as a pore for growing pili (19). Surprisingly, bfpB bfpF double
mutant cells were viable, displayed no growth defect, and neither
periplasmic pili nor membrane blebs could be detected using electron microscopy in such cells (not shown). Furthermore, we could
not detect pili in these cells by immunofluorescence microscopy
in either intact cells or after osmotic shock. Complementation
with each individual gene verified that the double bfpB bfpF mutant had the expected phenotypes. We considered the possibility
that bfpB bfpF mutant cells are viable because they degrade bundlin and thus avoid membrane damage. Surprisingly, bundlin was
detected at similar levels in bfpB and bfpF single mutants, the
double mutant, and the complemented forms of the double mutant. Since bundlin was expressed in BFP-inducing conditions in
the double mutant strain, we next tested the hypothesis that these
cells had an elevated cell envelope stress (Cpx) response as a mechanism to protect against damage from periplasmic pili. To our
surprise, a degP-lux gene reporter assay revealed that the Cpx effector degP was transcribed in the bfpB bfpF double mutant at a
level similar to or lower than that observed in wild-type EPEC.
Furthermore, all other mutants tested had significantly elevated
transcription of degP over the wild type. The upregulation of degP
transcription was most pronounced in the bfpB mutant strain.
Previous reports suggested that BfpB mediates extrusion of
periplasmic EPEC proteins, including T3S system components
(68). It may be that the inability to expel these components from
the periplasm triggers an exaggerated stress response. Further-
more, the relative reduction in degP activation in the bfpB bfpF

double mutant suggests that BfpF may play a role in activating this
stress response and that BfpB may play a role in such signaling.
Alternatively, it may be that when either the secretin or the retraction ATPase is absent, the cells experience more stress on the
membrane due to the resulting aberrant machines and activate
Cpx. However, when both BfpB and BfpF are lacking, either the
BFP machine may not be able to assemble or there may be disrupted signaling for activation of Cpx.
The BfpB complex observed by electron microscopy represents
the first published single particle averaging model structure for a
T4bP secretin but in many ways resembles other secretin complexes (42). From the 12-fold symmetry observed through
Markham rotational analysis, we conclude that the complex is a
homododecamer; the six centripetal projections in Fig. 1D3 suggest a possible configuration of six dimers. The long bottom part
of the trapezium structure seen in transverse views is most likely
the periplasmic N terminus, with a large vestibule for the assembling pilus, as has been reported for secretins and their substrates
of the T2S, T3S, and T4aP machines (19, 42, 63). However, this
suggestion requires experimental evidence for confirmation. We
propose that the contoured sides of the cylinder represent the
structured N0 and N3 subdomains of the N terminus (42, 64).
The central density in the complex indicates that there is at least
one gate occluding the central channel. Our results underscore the
concept that each secretin family displays structural variations on
a common theme and identify several key features of T4bP secretin complexes for the first time: a dodecameric structure, a channel plug, and the presence of centripetal projections inside the
channel. It is apparent that significant conformational changes
would be required to accommodate the dynamic T4P fibers; further studies of secretin topology and architecture will elucidate the
mechanics of pilus and substrate extrusion and the structural differences between secretin families.
Previous studies have demonstrated that the N terminus of
BfpB interacts with the soluble, periplasmic protein BfpU and that
this interaction is required for BFP machine function (69). We
quantified the number of BfpB and BfpU molecules per CFU and
estimate approximately 5.22 103 BfpB multimers and 5.91
104 BfpU molecules per CFU. A previous study estimated 4 105
molecules of bundlin per CFU (69); thus, if all of the detected BfpB
is involved in forming multimers and each is associated with a
pilus, the ratio of bundlin to secretin complex is at least 76 to 1.
The same study estimated 9 103 molecules of BfpU per EPEC
cell (69), approximately one-sixth of the current estimate. This
difference may reflect the variability of BfpU protein levels noted
in the results. Although the antibodies used are highly specific for
the two BFP proteins they recognize, and they were raised against
affinity-tagged, purified proteins that are confirmed by complementation analysis to be functional, it has not been proven that
they have identical affinity for the wild-type proteins, and thus
these estimates should be viewed with caution.
Once the dodecameric BfpB complex is transported to and
assembled in the OM, it appears to undergo an organized distribution through the cell. When BfpB-mOrange was expressed in
trans we observed polar foci; however, when all BFP machine
components were coordinately expressed from their cloned
operon, we saw a more diffuse pattern of membrane localization.
We were able to observe the distribution of BfpB in unprecedented detail through super-resolution microscopy. We used
jb.asm.org 1655
Lieberman et al.
PALM to localize single functional BfpB-PAmCherry molecules

and objectively quantified their distribution in a recombinant expressing BFP from the bfp operon. We did not find that these
molecules localized predominantly to the poles. Instead, the majority of bacteria had an uneven distribution of BfpB molecules at
the cell periphery. Although infrequent, we also observed clusters
of BfpB molecules away from the poles, particularly in cells involved in autoaggregates, and occasionally a banding pattern suggestive of a helical distribution. These observations indicate that
BfpB distribution is most likely not random. Cowles and Gitai
(20) discovered that the bacterial actin homologue, MreB, was a
crucial determinant for the initiation and maintenance of PilT
retraction ATPase complexes at the poles of P. aeruginosa. Based
on the results of the present study and two recent studies demonstrating a helical organization for the type IV secretion system in
Agrobacterium spp. (1, 2), we speculate that the bacterial cytoskeleton plays a role in regulating BFP machine protein localization in
EPEC. MreB could coordinate the initiation of pilus biogenesis
machines at the cell pole, possibly in a cell cycle-dependent manner. Furthermore, our studies extend earlier findings that protein
stoichiometry is a key determinant of machine localization in the
membrane from T2S systems (47) to T4P systems.
The use of emerging super-resolution microscopy, coupled
with coexpression of all BFP components from the cloned operon
provide new and robust insight into the distribution of T4P biogenesis machines. Our PALM results suggest a different distribution for the secretin and, by inference, the BFP than for some other
T4P systems. The nonpolar localization of BFP may be a feature
common to T4bP, and it may be related to function. The polar
localization of T4aP in M. xanthus and P. aeruginosa are likely
essential for longitudinally directed movement, as observed in
twitching motility and social gliding (31, 56). However, EPEC may
not use BFP for motility but rather for cell interactions. By distributing pili around the cell envelope, EPEC cells may be better able
to form the BFP-dependent spherical autoaggregates characteristic of localized adherence. More efficient aggregation at the early
infection time points where BFP is most critical (86) may be a
considerable advantage to the pathogen as it first colonizes the
gastrointestinal tract, where it must compete with the commensal
flora.
The results presented here identify several key features for a
member of the T4bP family of secretins. We confirmed a previous
report (81) that lipoprotein secretins can direct themselves to the
OM and determined that a Lol avoidance signal can delay but not
eliminate this OM targeting. We report for the first time that simultaneous mutation of the genes for a T4bP secretin and retraction ATPase can result in viable apparently healthy cells that paradoxically display less evidence of cell envelope stress than does a
single secretin mutant. This observation suggests a possible role
for BfpB in sensing or suppressing cell envelope stress that may be
mediated through BfpF. It is possible that differences in cell envelope stress response could account for the striking differences in
viability of N. meningitidis and N. gonorrhoeae strains with the
equivalent double mutations. The structure of the BfpB complex
by TEM and single particle averaging displays similarities and intriguing differences compared to other secretins, emphasizing the
concept that differences between secretin families are functionally
important. Finally, new insights into secretin cellular localization
gained through PALM suggest that pilus function may be influenced by subcellular distribution of pilus machines.
1656
jb.asm.org
ACKNOWLEDGMENTS
We thank Ekaterina Milgotina for the construction of plasmids pEM116
and pEM119, Wiebke Schreiber for BfpB purification for structure determination, Brian Peters for assistance with epifluorescence imaging, Ruching Hsia and John Strong for assistance with TEM, and Wensheng Luo
and Courtney D. Sturey for helpful discussions of the manuscript.
Support was provided by National Institutes of Health grants T32
GM008181 (J.A.L. and N.A.F.), F30 MH086185 (N.A.F.), R01 AI37606
(J.A.L. and M.S.D.), and R01 MH080046 (T.A.B.).
REFERENCES
1. Aguilar J, Cameron TA, Zupan J, Zambryski P. 2011. Membrane and
core periplasmic Agrobacterium tumefaciens virulence type IV secretion
system components localize to multiple sites around the bacterial perimeter during lateral attachment to plant cells. mBio 2(5):e00218-11. doi:
10.1128/mBio.00218-11.
2. Aguilar J, Zupan J, Cameron TA, Zambryski PC. 2010. Agrobacterium
type IV secretion system and its substrates form helical arrays around the
circumference of virulence-induced cells. Proc. Natl. Acad. Sci. U. S. A.
107:3758 3763.
3. Anantha RP, Stone KD, Donnenberg MS. 1998. The role of BfpF, a
member of the PilT family of putative nucleotide-binding proteins, in type
IV pilus biogenesis and in interactions between enteropathogenic Escherichia coli and host cells. Infect. Immun. 66:122131.
4. Anantha RP, Stone KD, Donnenberg MS. 2000. Effects of bfp mutations
on biogenesis of functional enteropathogenic Escherichia coli type IV pili.
J. Bacteriol. 182:2498 2506.
5. Averhoff B, Friedrich A. 2003. Type IV pilus-related natural transformation systems: DNA transport in mesophilic and thermophilic bacteria.
Arch. Microbiol. 180:385393.
6. Bayan N, Guilvout I, Pugsley AP. 2006. Secretins take shape. Mol.
Microbiol. 60:1 4.
7. Betzig E, et al. 2006. Imaging intracellular fluorescent proteins at nanometer resolution. Science 313:16421645.
8. Bieber D, et al. 1998. Type IV pili, transient bacterial aggregates, and
virulence of enteropathogenic Escherichia coli. Science 280:2114 2118.
9. Bitter W, Koster M, Latijnhouwers M, De Cock H, Tommassen J. 1998.
Formation of oligomeric rings by XcpQ and PilQ, which are involved in
protein transport across the outer membrane of Pseudomonas aeruginosa.
Mol. Microbiol. 27:209 219.
10. Bradley DE. 1980. A function of Pseudomonas aeruginosa PAO polar pili:
twitching motility. Can. J. Microbiol. 26:146 154.
11. Braks IJ, Hoppert M, Roge S, Mayer F. 1994. Structural aspects and
immunolocalization of the F420-reducing and non-F420-reducing hydrogenases from Methanobacterium thermoautotrophicum Marburg. J.
Bacteriol. 176:76777687.
12. Buddelmeijer N, Krehenbrink M, Pecorari F, Pugsley AP. 2009. Type II
secretion system secretin PulD localizes in clusters in the Escherichia coli
outer membrane. J. Bacteriol. 191:161168.
13. Bulyha I, et al. 2009. Regulation of the type IV pili molecular machine by
dynamic localization of two motor proteins. Mol. Microbiol. 74:691706.
14. Carbonnelle E, Helaine S, Nassif X, Pelicic V. 2006. A systematic genetic
analysis in Neisseria meningitidis defines the Pil proteins required for assembly, functionality, stabilization and export of type IV pili. Mol. Microbiol. 61:1510 1522.
15. Chakraborty S, et al. 2008. Type IV pili in Francisella tularensis: roles of
pilF and pilT in fiber assembly, host cell adherence, and virulence. Infect.
Immun. 76:28522861.
16. Chang ACY, Cohen SN. 1978. Construction and characterization of
amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134:11411156.
17. Collin S, Guilvout I, Nickerson NN, Pugsley AP. 2011. Sorting of an
integral outer membrane protein via the lipoprotein-specific Lol pathway
and a dedicated lipoprotein pilotin. Mol. Microbiol. 80:655 665.
18. Collins RF, et al. 2003. Three-dimensional structure of the Neisseria
meningitidis secretin PilQ determined from negative-stain transmission
electron microscopy. J. Bacteriol. 185:26112617.
19. Collins RF, et al. 2005. Interaction with type IV pili induces structural
changes in the bacterial outer membrane secretin PilQ. J. Biol. Chem.
280:1892318930.
20. Cowles KN, Gitai Z. 2010. Surface association and the MreB cytoskeleton
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
regulate pilus production, localization and function in Pseudomonas

aeruginosa. Mol. Microbiol. 76:14111426.
Craig L, Pique ME, Tainer JA. 2004. Type IV pilus structure and bacterial
pathogenicity. Nat. Rev. Microbiol. 2:363378.
Crowther LJ, Anantha RP, Donnenberg MS. 2004. The inner membrane
subassembly of the enteropathogenic Escherichia coli bundle-forming pilus machine. Mol. Microbiol. 52:6779.
Daniel A, et al. 2006. Interaction and localization studies of enteropathogenic Escherichia coli type IV bundle-forming pilus outer membrane components. Microbiology 152:24052420.
Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal
genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci.
U. S. A. 97:6640 6645.
Donnenberg MS, Girn JA, Nataro JP, Kaper JB. 1992. A plasmidencoded type IV fimbrial gene of enteropathogenic Escherichia coli associated with localized adherence. Mol. Microbiol. 6:34273437.
Donnenberg MS, Kaper JB. 1992. Minireview: enteropathogenic Escherichia coli. Infect. Immun. 60:39533961.
Fernandes PJ, Guo Q, Donnenberg MS. 2007. Functional consequences
of sequence variation in bundlin, the enteropathogenic Escherichia coli
type IV pilin protein. Infect. Immun. 75:4687 4696.
Frols S, et al. 2008. UV-inducible cellular aggregation of the hyperthermophilic archaeon Sulfolobus solfataricus is mediated by pili formation.
Mol. Microbiol. 70:938 952.
Frost NA, Shroff H, Kong H, Betzig E, Blanpied TA. 2010. Singlemolecule discrimination of discrete perisynaptic and distributed sites of
actin filament assembly within dendritic spines. Neuron 67:86 99.
Gauthier NC. 2009. Bundle-forming pili from enteropathogenic Escherichia coli generate moderate forces. Biophys. J. 96:519a.
Gibiansky ML, et al. 2010. Bacteria use type IV pili to walk upright and
detach from surfaces. Science 330:197.
Guerrant RL, et al. 2002. Magnitude and impact of diarrheal diseases.
Arch. Med. Res. 33:351355.
Guzman LM, Belin D, Carson MJ, Beckwith J. 1995. Tight regulation,
modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177:4121 4130.
Herrington DA, et al. 1988. Toxin, toxin-coregulated pili, and the toxR
regulon are essential for Vibrio cholerae pathogenesis in humans. J. Exp.
Med. 168:14871492.
Hess ST, Girirajan TP, Mason MD. 2006. Ultra-high resolution imaging
by fluorescence photoactivation localization microscopy. Biophys. J. 91:
4258 4272.
Higashi DL, et al. 2011. N. elongata produces type IV pili that mediate
interspecies gene transfer with Neisseria gonorrhoeae. PLoS One 6:e21373.
Hobson N, Price NL, Ward JD, Raivio TL. 2008. Generation of a
restriction minus enteropathogenic Escherichia coli E2348/69 strain that is
efficiently transformed with large, low copy plasmids. BMC Microbiol.
8:134.
Horne RW, Hobart JM, Markham R. 1976. Electron microscopy of
tobacco mosaic virus prepared with the aid of negative staining-carbon
film techniques. J. Gen. Virol. 31:265269.
Hwang J, Bieber D, Ramer SW, Wu CY, Schoolnik GK. 2003. Structural
and topographical studies of the type IV bundle-forming pilus assembly
complex of enteropathogenic Escherichia coli. J. Bacteriol. 185:6695 6701.
Hyland RM, Beck P, Mulvey GL, Kitov PI, Armstrong GD. 2006.
N-Acetyllactosamine conjugated to gold nanoparticles inhibits enteropathogenic Escherichia coli colonization of the epithelium in human intestinal biopsy specimens. Infect. Immun. 74:5419 5421.
Kaiser D. 1979. Social gliding is correlated with the presence of pili in
Myxococcus xanthus. Proc. Natl. Acad. Sci. U. S. A. 76:59525956.
Korotkov KV, Gonen T, Hol WG. 2011. Secretins: dynamic channels for
protein transport across membranes. Trends Biochem. Sci. 36:433 443.
Kosek M, Bern C, Guerrant RL. 2003. The global burden of diarrhoeal
disease, as estimated from studies published between 1992 and 2000. Bull.
World Health Organ. 81:197204.
Levine MM, et al. 1978. Escherichia coli strains that cause diarrhoea but do
not produce heat-labile or heat-stable enterotoxins and are non-invasive.
Lancet i:1119 1122.
Linderoth NA, Model P, Russel M. 1996. Essential role of a sodium
dodecyl sulfate-resistant protein IV multimer in assembly-export of filamentous phage. J. Bacteriol. 178:19621970.
Ludtke SJ, Baldwin PR, Chiu W. 1999. EMAN: semiautomated soft-
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
ware for high-resolution single-particle reconstructions. J. Struct. Biol.

128:8297.
Lybarger SR, Johnson TL, Gray MD, Sikora AE, Sandkvist M. 2009.
Docking and assembly of the type II secretion complex of Vibrio cholerae.
J. Bacteriol. 191:3149 3161.
MacRitchie DM, Buelow DR, Price NL, Raivio TL. 2008. Twocomponent signaling and gram negative envelope stress response systems.
Adv. Exp. Med. Biol. 631:80 110.
MacRitchie DM, Ward JD, Nevesinjac AZ, Raivio TL. 2008. Activation
of the Cpx envelope stress response downregulates expression of several
locus of enterocyte effacement-encoded genes in enteropathogenic Escherichia coli. Infect. Immun. 76:14651475.
Markham R, Frey S, Hills GJ. 1963. Methods for the enhancement of
image detail and accentuation of structure in electron microscopy. Virology 20:88 102.
Milgotina E, Sonnenberg M. 2009. The bundle-forming pilus and other
type IVb pili, p 4157. In Jarrell K (ed), Pili and flagella: current research
and future trends. Caister Academic Press, Norfolk, United Kingdom.
Nevesinjac AZ, Raivio TL. 2005. The Cpx envelope stress response affects
expression of the type IV bundle-forming pili of enteropathogenic Escherichia coli. J. Bacteriol. 187:672 686.
Ng SY, et al. 2011. Genetic and mass spectrometry analyses of the unusual
type IV-like pili of the archaeon Methanococcus maripaludis. J. Bacteriol.
193:804 814.
Nickerson NN, et al. 2011. Outer membrane targeting of secretin PulD
relies on disordered domain recognition by a dedicated chaperone. J. Biol.
Chem. 286:14221432.
Nouwen N, et al. 1999. Secretin PulD: association with pilot PulS, structure, and ion-conducting channel formation. Proc. Natl. Acad. Sci.
U. S. A. 96:8173 8177.
Nudleman E, Wall D, Kaiser D. 2006. Polar assembly of the type IV pilus
secretin in Myxococcus xanthus. Mol. Microbiol. 60:16 29.
Peabody CR, et al. 2003. Type II protein secretion and its relationship to
bacterial type IV pili and archaeal flagella. Microbiology 149:30513072.
Pelicic V. 2008. Type IV pili: e pluribus unum? Mol. Microbiol. 68:827
837.
Price NL, Raivio TL. 2009. Characterization of the Cpx regulon in Escherichia coli strain MC4100. J. Bacteriol. 191:1798 1815.
Ramboarina S, et al. 2005. Structure of the bundle-forming pilus from
enteropathogenic Escherichia coli. J. Biol. Chem. 280:40252 40260.
Ramer SW, Bieber D, Schoolnik GK. 1996. BfpB, an outer membrane
lipoprotein required for the biogenesis of bundle-forming pili in enteropathogenic Escherichia coli. J. Bacteriol. 178:6555 6563.
Ramer SW, et al. 2002. The type IV pilus assembly complex: biogenic
interactions among the bundle-forming pilus proteins of enteropathogenic Escherichia coli. J. Bacteriol. 184:34573465.
Reichow SL, et al. 2011. The binding of cholera toxin to the periplasmic
vestibule of the type II secretion channel. Channels (Austin) 5:215218.
Reichow SL, Korotkov KV, Hol WG, Gonen T. 2010. Structure of the
cholera toxin secretion channel in its closed state. Nat. Struct. Mol. Biol.
17:1226 1232.
Russel M, Linderoth NA, Aali. 1997. Filamentous phage assembly:
variation on a protein export theme. Gene 192:2332.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory
manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Scaletsky ICA, Silva MLM, Trabulsi LR. 1984. Distinctive patterns of
adherence of enteropathogenic Escherichia coli to HeLa cells. Infect. Immun. 45:534 536.
Schmidt SA, et al. 2001. Structure-function analysis of BfpB, a secretinlike protein encoded by the bundle-forming-pilus operon of enteropathogenic Escherichia coli. J. Bacteriol. 183:4848 4859.
Schreiber W, et al. 2002. BfpU, a soluble protein essential for type IV pilus
biogenesis in enteropathogenic Escherichia coli. Microbiology 148:2507
2518.
Seydel A, Gounon P, Pugsley AP. 1999. Testing the 2 rule for lipoprotein sorting in the Escherichia coli cell envelope with a new genetic
selection. Mol. Microbiol. 34:810 821.
Shaner NC, et al. 2004. Improved monomeric red, orange and yellow
fluorescent proteins derived from Discosoma sp. red fluorescent protein.
Nat. Biotechnol. 22:15671572.
Stone BJ, Abu Kwaik Y. 1998. Expression of multiple pili by Legionella
pneumophila: identification and characterization of a type IV pilin gene
jb.asm.org 1657
Lieberman et al.
73.
74.
75.
76.
77.
78.
79.
80.
and its role in adherence to mammalian and protozoan cells. Infect. Immun. 66:1768 1775.
Stone KD, Zhang H-Z, Carlson LK, Donnenberg MS. 1996. A cluster of
fourteen genes from enteropathogenic Escherichia coli is sufficient for biogenesis of a type IV pilus. Mol. Microbiol. 20:325337.
Strom MS, Nunn DN, Lory S. 1993. A single bifunctional enzyme, PilD,
catalyzes cleavage and N-methylation of proteins belonging to the type IV
pilin family. Proc. Natl. Acad. Sci. U. S. A. 90:2404 2408.
Subach FV, et al. 2009. Photoactivatable mCherry for high-resolution
two-color fluorescence microscopy. Nat. Methods 6:153159.
Szeto TH, Dessen A, Pelicic V. 2011. Structure/function analysis of
Neisseria meningitidis PilW, a conserved protein that plays multiple roles
in type IV pilus biology. Infect. Immun. 79:3028 3035.
Tokuda H. 2009. Biogenesis of outer membranes in Gram-negative bacteria. Biosci. Biotechnol. Biochem. 73:465 473.
Valentine RC, Shapiro BM, Stadtman ER. 1968. Regulation of glutamine
synthetase. XII. Electron microscopy of the enzyme from Escherichia coli.
Biochemistry 7:21432152.
Varga JJ, et al. 2006. Type IV pili-dependent gliding motility in the
Gram-positive pathogen Clostridium perfringens and other clostridia. Mol.
Microbiol. 62:680 694.
Varga JJ, Therit B, Melville SB. 2008. Type IV pili and the CcpA protein
1658
jb.asm.org
81.
82.
83.
84.
85.
86.
87.
are needed for maximal biofilm formation by the gram-positive anaerobic

pathogen Clostridium perfringens. Infect. Immun. 76:4944 4951.
Viarre V, et al. 2009. HxcQ liposecretin is self-piloted to the outer membrane by its N-terminal lipid anchor. J. Biol. Chem. 284:3381533823.
Vogt SL, et al. 2010. The Cpx envelope stress response both facilitates and
inhibits elaboration of the enteropathogenic Escherichia coli bundleforming pilus. Mol. Microbiol. 76:10951110.
Wolfgang M, et al. 1998. PilT mutations lead to simultaneous defects in
competence for natural transformation and twitching motility in piliated
Neisseria gonorrhoeae. Mol. Microbiol. 29:321330.
Wolfgang M, van Putten JP, Hayes SF, Dorward D, Koomey M. 2000.
Components and dynamics of fiber formation define a ubiquitous biogenesis pathway for bacterial pili. EMBO J. 19:6408 6418.
Yamaguchi K, Yu F, Inouye M. 1988. A single amino acid determinant of
the membrane localization of lipoproteins in Escherichia coli. Cell 53:423
432.
Zahavi EE, et al. 2011. Bundle forming pilus retraction enhances enteropathogenic Escherichia coli infectivity. Mol. Biol. Cell 22:2436 2447.
Zhang H-Z, Donnenberg MS. 1996. DsbA is required for stability of the
type IV pilin of enteropathogenic Escherichia coli. Mol. Microbiol. 21:787
797.

Outer Membrane Targeting, Ultrastructure, and Single Molecule Localization of The Enteropathogenic Escherichia Coli Type IV Pilus Secretin BFPB

Caricato da

Informazioni sul documento

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

Outer Membrane Targeting, Ultrastructure, and Single Molecule Localization of The Enteropathogenic Escherichia Coli Type IV Pilus Secretin BFPB

Caricato da

Copyright:

Formati disponibili

Outer Membrane Targeting, Ultrastructure, and Single Molecule

Localization of the Enteropathogenic Escherichia coli Type IV Pilus

nteropathogenic Escherichia coli (EPEC) is an important cause

Received 6 October 2011 Accepted 5 January 2012

Fine Localization of BfpB

tein energizing pilus dynamics, pre-pilin-like proteins, and the

April 2012 Volume 194 Number 7

TABLE 1 Strains and plasmids used in this study

Description and/or genotypea

Flip-recombinase vector for the one-step method

mica by introduction into a sample drop, then transferred to a drop of

Fine Localization of BfpB

TABLE 2 Primers used in this study

FIG 1 Electron micrograph of pure BfpB preparation after negative staining.

April 2012 Volume 194 Number 7

2.5 [(400-ms luminescence) (luminescence blank)]

Thus, giving the cell density-adjusted relative luminescence units in

Electron microscopy and single particle averaging reveal BfpB is

Fine Localization of BfpB

April 2012 Volume 194 Number 7

was quantified in quadruplicate. On average ( the standard error

oxytoca in a previous report (12) and mOrange, like mCherry, is a

Fine Localization of BfpB

FIG 4 Distributions of single BfpB-PAmCherry molecules localized using

associated with physical parameters of the bacteria (Table 3). Of

TABLE 3 Multi variable correlation of fluorescence distribution with cell parameters

Pole A/pole B ratio

Pole B/pole A ratio

April 2012 Volume 194 Number 7

bfpF, we hypothesized that the envelope stress response pathway

Fine Localization of BfpB

of detectable intracellular BFP formation by the bfpB bfpF double

Secretins are outer membrane proteins common to and required

April 2012 Volume 194 Number 7

more, the relative reduction in degP activation in the bfpB bfpF

PALM to localize single functional BfpB-PAmCherry molecules

Fine Localization of BfpB

regulate pilus production, localization and function in Pseudomonas

April 2012 Volume 194 Number 7

ware for high-resolution single-particle reconstructions. J. Struct. Biol.

are needed for maximal biofilm formation by the gram-positive anaerobic

Potrebbero piacerti anche