Sei sulla pagina 1di 3

Turning DNA into proteins: The genetic code

When you know a DNA sequence, you can translate it into the corresponding
protein sequence by using the genetic code, the very same way the cell itself
generates a protein sequence. The genetic code is universal (with some
exceptions otherwise life would be too simple!), and it is natures solution
to the problem of how one uniquely relates a 4-nucleotide sequence (A, T, G,
C) to a suite of 20 amino acids; were using symbols (rather than actual
chem- icals) to do the same. Understanding how the cell does this was one of
the most brilliant achievements of the biologists of the 1960s. Yet the final
answer can be contained in a (miraculously small) table as shown in Figure
1-9. Have a look, but feel free to indulge in awed silence as you enter the
most sacred monument of modern biology.
Heres how to use the table shown in Figure 1-9: From a given starting point
in your DNA sequence, start reading the sequence 3 nucleotides (one triplet)
at a time. Then consult the genetic code table to read which amino acid
corre- sponds to the current triplet (technically referred to as codons). For
instance, the following DNA (or messenger RNA) sequence is decoded as
follows:
1. Read the DNA sequence:
ATGGAAGTATTTAAAGCGCCACCTATTGGGATATAAG
2. Decompose it into successive triplets:
ATG GAA GTA TTT AAA GCG CCA CCT ATT GGG ATA TAA G . . .
3. Translate each triplet into the corresponding amino acid:
M E V F K A P P I G I STOP
If your DNA sequence is correctly listed in the 5' to 3' orientation, you generate the protein sequence in the conventional N- to C-terminus as well. This
approach has an advantage: You dont have to think about these orientation
details ever again.
Thus, if you know where a protein-coding region starts in a DNA sequence,
your computer can pretend to be a cell and generate the corresponding
amino-acid sequence! This simple computer translation exercise is at the
origin of most of the so-called protein sequences that you can find in databases. Many sequence analysis programs acknowledge this fact by offering
on-the-fly translation, so you can process DNA sequences as virtual protein
sequences with a simple mouse click.
DNA (deoxyribonucleic acid) functions primarily by directing the production of

proteins. Each DNA molecule can carry thousands of genes. Every gene
carries the plan for building a particular protein, or part of a particular
protein. Which proteins are produced decides everything about a cell, from
whether it is part of a muscle or the blood, and the human body as a whole,
from the color of the hair and skin to a propensity to certain diseases.
The Central Dogma This describes the flow of genetic information from DNA
to protein: DNA makes ribonucleic acid (RNA), which makes protein. This
involves two main stages: transcription and translation. 1 Transcription The
genetic informationthe nucleotide sequencecarried by one strand of the
DNA helix is transcribed onto an mRNA (messenger RNA). 2 Translation The
information in the mRNA is then read by tRNA (transfer RNA) and translated
into a sequence of amino acids that make a protein. 3 Reverse transcription
An enzyme called reverse transcriptase can make DNA by copying RNA, but
there are no enzymes that can convert protein sequences into DNA or RNA
sequences, and no enzymes that can make proteins directly from DNA.
The process of making RNA from DNA is called transcription. 1The two DNA
strands that make up the double helix become detached from each other.
They partly unwind from the helix. This exposes the genes (sequences of
bases) and makes it possible to transcribe them. Just one of the strands
serves as a template to produce the RNA strand. 2The enzyme RNA
polymerase binds to the DNA and moves along it, attaching free nucleotides
to the exposed complementary DNA bases, making this a strand of mRNA.
3The new mRNA molecule has exactly the same nucleotide sequence as one
of the DNA strandsthe one that was not acting as the template. However,
RNA molecules do not have the base thymine. Instead they contain uracil.
Uracil bonds to adenine, in the same way as thymine. The mRNA travels out
of the nucleus to the ribosome where translation occurs.
RNA abbr. and common name for ribonucleate (def. 1) or ribonucleic acid; one
of the two main types of nucleic acid, consisting of a long, unbranched
macromolecule formed from ribonucleotides, the 3- phosphate group of each
constituent ribonucleotide (except the last) being joined in 3,5phosphodiester linkage to the 5-hydroxyl group on each ribose moiety of the
next one. The presence of a free 2-hydroxyl group on each ribose moiety
renders these phosphodi- ester bonds susceptible to hydrolytic attack by
alkali, in contrast to those of DNA. The RNA chain has polarity, with one 5
end and one 3 end. Two purines, adenine and guanine, and two pyrimidines,
cy- tosine and uracil, are the major bases usually present. In addition, minor
bases may occur; transfer RNA, however, contains unusual bases in relatively
large amounts. The sequence of bases carries in- formation, whereas the
sugar and phosphate groups play a struc- tural role. RNA is fundamental to
protein biosynthesis in all living cells. Messenger RNA (mRNA) is responsible
for carrying the coded genetic message, transcribed from DNA, to sites of

protein assem- bly at the ribosomes. The latter are composed of ribosomal
RNA (rRNA) plus proteins. A third species, transfer RNA (tRNA), is instrumental in importing amino acids to the assembly site, according to
instructions carried by mRNA. In some viruses, RNA is the ge- netic material
instead of DNA. Specific forms, functions, mol- ecules, or preparations of RNA
may be designated by prefixes or suffixes, thus: A-RNA or RNA-A, A-form of
RNA; cRNA, comple- mentary RNA; dsRNA, double-strand(ed) RNA; hnRNA or
H-RNA or HnRNA, heterogeneous nuclear RNA; mRNA, messenger RNA;
micRNA, messenger-RNA-interfering complementary RNA; mtRNA,
mitochondrial RNA; nRNA, nuclear RNA; rRNA, ribosomal RNA; sRNA or S-RNA,
soluble RNA; scRNA, small cytoplasmic RNA; snRNA, small nuclear RNA;
snoRNA, small nucleolar RNA; ssRNA, single-strand(ed) RNA; tRNA, transfer
RNA; tcRNA, translational- control RNA; Z-RNA or RNA-Z, Z-form of RNA. RNA I
a short 108 nucleotide plasmid-encoded transcript that is anti- sense to the 5
end of RNA II, with which it forms a duplex. It acts as a negative regulator of
plasmid replication as it inhibits the ac- tion of RNase H on RNA II. Pairing
between RNA I and RNA II is facilitated by the Rop protein. RNA II a plasmidencoded transcript that initiates 555 bp upstream from the Col E1 origin of
replication. Its cleavage by RNase H leaves a primer with a 3-hydroxy end
that is used for initiating DNA synthesis during plasmid replication.

Potrebbero piacerti anche