JOURNAL OF CLINICAL MICROBIOLOGY, July 2004, p.

31283136
0095-1137/04/$08.000 DOI: 10.1128/JCM.42.7.31283136.2004
Copyright 2004, American Society for Microbiology. All Rights Reserved.

Vol. 42, No. 7

Quantitative Analysis of Diverse Lactobacillus Species Present

in Advanced Dental Caries
Roy Byun,* Mangala A. Nadkarni, Kim-Ly Chhour, F. Elizabeth Martin,
Nicholas A. Jacques, and Neil Hunter
Institute of Dental Research, Westmead Millennium Institute, and
Westmead Centre for Oral Health, Sydney, Australia
Received 23 December 2003/Returned for modification 10 February 2004/Accepted 21 March 2004

and unexpected diversity of lactobacilli, with representation by

species that are not commonly found in the oral cavity.

Dental caries continues to be a significant public health

problem in many parts of the world. Although the bacteria
responsible for caries initiation and early caries progression
have been studied extensively, the microbiology of dentine
caries has been reported to show considerable diversity and has
not yet been fully characterized. Dissolution by acid of the
surface enamel exposes the underlying avascular mineralized
connective tissue matrix of dentine, which is prone to invasion.
This occurs by migration of bacteria into the network of tubules occupied by processes of the pulpal odontoblasts. The
early stage of invasion involves lactobacilli, Actinomyces spp.,
veillonellae, and mutans streptococci (for a review, see reference 19). This phase is followed by the invasion of a more
diverse group of microorganisms including gram-negative
anaerobes. There is evidence that interspecies cooperation enhances the migration of the mixed bacterial flora through the
dentinal tubules (20, 27).
Lactobacilli have been reported to occur in high numbers in
both superficial and deep caries (9), though they are not suspected of being involved in bacterial invasion of nonexposed
dental pulp (12). Our previous analysis of lactobacilli by culture under microaerophilic conditions in 65 deep caries samples indicated that Lactobacillus acidophilus was numerically
dominant, although Lactobacillus paracasei, Lactobacillus rhamnosus, and Lactobacillus fermentum were also present in many
samples (22). In the present study, analysis of samples by quantitative molecular techniques indicated a greater abundance

MATERIALS AND METHODS

Bacterial strains. Lactobacilli (Table 1) were obtained from the Institute of
Dental Research collection and the Australian Starter Culture Research Centre
(Werribee, Victoria, Australia) and cultured in MRS medium (Oxoid, Basingstoke, United Kingdom). Other bacteria were cultured as described previously
(26).
Carious dentine samples. The source of material for analysis was the collection of carious dentine from 65 extracted teeth described previously (protocol
approved by the Human Ethics Committee of Central Sydney Area Health
Service) (22, 26). Patients elected to have extractions for unrestored teeth which
presented large coronal dentine caries that, by macroscopic examination, had not
penetrated to the underlying vital pulp tissue and had adjacent periodontal
probing depths of less than 4 mm. The carious zone of decalcified and partially
decalcified dentine in proximity to the advancing front of the lesion in each tooth
was excavated, weighed, and resuspended in reduced transport fluid (10 mg [wet
weight] of dentine per ml) at 37C inside an anaerobic chamber. The carious
dentine fragments were initially dispersed in reduced transport fluid by vortexing
for 20 s, followed by manual homogenization in a 2-ml glass homogenizer for 30 s
prior to extraction of bacterial DNA (22).
Underlying pulpal tissue was examined for pathological change and categorized for the predominant presentation of essentially normal histology (category
1), hyaline soft tissue degeneration (category 2), extensive calcification (category
3), or infiltration of inflammatory cells (category 4) (22).
Isolation of DNA. DNA was isolated from carious dentine as described previously (22) with the ATL buffer reagent (Qiagen, Clifton Hill, Victoria, Australia), which efficiently releases DNA from gram-negative bacteria and from
organisms cultured under anaerobic conditions. DNA was extracted from reference Lactobacillus strains (Table 1) with the QIAamp DNA mini kit (Qiagen)
according to the manufacturers instructions.
PCR primers and conditions. Primers specific for the genus Lactobacillus were
designed from regions of identity within the 16S ribosomal DNA (rDNA) sequence from a wide diversity of Lactobacillus spp. (GenBank accession numbers
in parentheses): Lactobacillus acetotolerans (M58801), Lactobacillus alimentarius
(M58804), Lactobacillus amylolyticus (Y17361), Lactobacillus amylophilus
(M58806), Lactobacillus animalis (M58807), Lactobacillus aviarius (M58808),

* Corresponding author. Mailing address: Institute of Dental Research, Westmead Centre for Oral Health, P.O. Box 533, Wentworthville, NSW 2145, Australia. Phone: 612-9845-8767. Fax: 612-9845-7599.
E-mail: roybyun@dental.wsahs.nsw.gov.au.
3128

Downloaded from http://jcm.asm.org/ on June 14, 2015 by guest

Our previous analysis of 65 advanced dental caries lesions by traditional culture techniques indicated that
lactobacilli were numerous in the advancing front of the progressive lesion. Production of organic acids by
lactobacilli is considered to be important in causing decalcification of the dentinal matrix. The present study
was undertaken to define more precisely the diversity of lactobacilli found in this environment and to quantify
the major species and phylotypes relative to total load of lactobacilli by real-time PCR. Pooled DNA was
amplified by PCR with Lactobacillus genus-specific primers for subsequent cloning, sequencing, and phylogenetic analysis. Based on 16S ribosomal DNA sequence comparisons, 18 different phylotypes of lactobacilli were
detected, including strong representation of both novel and gastrointestinal phylotypes. Specific PCR primers
were designed for nine prominent species, including Lactobacillus gasseri, L. ultunensis, L. salivarius, L. rhamnosus, L. casei, L. crispatus, L. delbrueckii, L. fermentum, and L. gallinarum. More than three different species
were identified as being present in most of the dentine samples, confirming the widespread distribution and
numerical importance of various Lactobacillus spp. in carious dentine. Quantification by real-time PCR revealed various proportions of the nine species colonizing carious dentine, with higher mean loads of L. gasseri
and L. ultunensis than of the other prevalent species. The findings provide a basis for further characterization
of the pathogenicity of Lactobacillus spp. in the context of extension of the carious lesion.

LACTOBACILLUS SPP. IN ADVANCED DENTAL CARIES

VOL. 42, 2004

3129

TABLE 1. Bacterial strains and the specificity of primers for the detection of bacteria by PCR
Specificity of primer pair for detection of bacteria
Species

casei subsp. casei

paracasei subsp. paracasei
rhamnosus
rhamnosus
fermentum
fermentum
gasseri
salivarius subsp. salivarius
salivarius subsp. salicinus
crispatus
gallinarum
delbrueckii subsp. bulgaricus
delbrueckii
acidophilus
brevis
reuteri
plantarum
plantarum
oris
oris
leichmanni

Escherichia coli
Staphylococcus aureus
Pseudomonas aeruginosa
Haemophilus influenzae
Streptococcus pyogenes
Streptococcus pneumoniae
Moraxella catarrhalis
Porphyromonas gingivalis
Fusobacterium nucleatum
Peptostreptococcus micros
Serratia marcescens

UniF, LactoF, LcaseF, LrhamF, LfermF, LactoF, LsaliF, LcrisF, LgallF, LdelbF, LultF,
LactoR LactoR LcaseR LcaseR LactoR LgassR LactoR LcrisR LcrisR LdelbR LcrisR

ATCC 393
ATCC 25302
ATCC 7469
CCUG 27772
ATCC 14931
ATCC 9338
ATCC 33323
ATCC 11741
ATCC 11742
ATCC 33820
ATCC 33199
ATCC 11842
ATCC 9649
ATCC 4356
ATCC 14869
ATCC 23272
ATCC 10241
ATCC 14917
NCFB 2160
NCFB 2164
ATCC 4797

XL-1 Blue
ATCC 12600
ATCC 19660
MSHRIN-1
MSHRPY-1
MSHRPN-1
MSHRCA-1
ATCC 33277
ATCC 25586
ATCC 33270
ATCC 274

/
/

Lactobacillus bifermentans (M58809), Lactobacillus brevis (M58810), Lactobacillus buchneri (M58811), Lactobacillus casei (AY196975), Lactobacillus collinoides
(AB005893), Lactobacillus crispatus (AF257097), Lactobacillus delbrueckii
(AJ414691), L. fermentum (AF302116), Lactobacillus fructivorans (M58818),
Lactobacillus gallinarum (AJ417737), Lactobacillus gasseri (AF519171), Lactobacillus iners (Y16329), Lactobacillus jensenii (AF243176), Lactobacillus
lactis (M58823), Lactobacillus lindneri (X95423), Lactobacillus manihotivorans
(AF000162), Lactobacillus mucosae (AF126738), Lactobacillus nagelii (Y17500),
Lactobacillus oris (X94229), Lactobacillus perolens (Y19168), Lactobacillus plantarum (AL935253), Lactobacillus pontis (X76329), Lactobacillus reuteri (L23507),
L. rhamnosus (AF243146), Lactobacillus sakei (M58829), Lactobacillus salivarius
(AF089108), Lactobacillus sharpeae (M58831), Lactobacillus vaginalis (AF243177),
and Lactobacillus zeae (D86516).
Sequences were retrieved from GenBank and aligned with CLUSTAL W
(35) together with sequences from the taxonomically related bacteria Bacillus
subtilis (AB016721), Staphylococcus aureus (SA16SRRN), Listeria monocytogenes (S55472), Clostridium botulinum (CBA16S), Peptostreptococcus micros
(PEP16SRR8), Streptococcus mutans (SM16SRNA), Enterococcus faecalis
(AB012212), and Pediococcus acidilactici (X95976). The sequences of selected Lactobacillus-specific primers LactoF and LactoR are shown in Table 2.
The specificity of the primer sequences was determined by BLAST (1) homology
searches for short, nearly exact matches in GenBank. BLAST was accessed
through the Australian National Genomic Information Service (ANGIS; http:
//www.angis.org.au). The specificity of the primers was confirmed by PCR on
DNA templates from taxonomically related and unrelated bacteria in 25-l
reaction mixtures containing 1 HotStarTaq Master mix (Qiagen), 2 l of
template (40 ng of DNA), and 100 nM (each) primer. PCR was performed with
the GeneAmp PCR System 9700 (Perkin Elmer, Wellesley, Mass.) with an initial
denaturation step of 95C for 15 min, followed by 40 cycles of 95C for 15 s and
62C for 1 min. A 10-l aliquot of the PCR was subjected to electrophoresis on
a 2% agarose gel containing ethidium bromide, and the DNA bands were
visualized by UV illumination.
Real-time quantification of total Lactobacillus load in carious dentine. Quantitative PCRs were performed in a reaction volume of 25 l containing 1 SYBR

Green PCR Master Mix (Applied Biosystems, Foster City, Calif.), 100 nM each
of the LactoF and LactoR primers, and 2 l of DNA extracted from the carious
dentine samples. The amount of DNA in the 65 carious dentine samples was
determined in triplicate, and the mean values were calculated. Amplification and
detection of DNA were performed with the ABI-Prism 7700 sequence detection
system (Applied Biosystems) with optical grade 96-well PCR plates and optical
caps. The reaction conditions were 50C for 2 min and 95C for 10 min, followed
by 40 cycles of 95C for 15 s and 62C for 1 min. Data analysis was conducted with
Sequence Detection Software version 1.6.3, supplied by Applied Biosystems.
Purified genomic DNA in the range 10 fg to 1 ng of Lactobacillus delbrueckii
subsp. bulgaricus (ATCC 11842) was used as the standard for determining the
amount of Lactobacillus DNA by real-time PCR. This was equivalent to approximately 4.0 to 4.0 105 copies of the genome (genome size of 2.3 Mb). DNA
concentrations were determined with the PicoGreen double-stranded DNA
quantitation kit (Molecular Probes, Eugene, Oreg.) and Luminescence spectrometer model LS 50B (Perkin Elmer).
Enumeration of Lactobacillus species. Species- or phylotype-specific primers
were designed from either the V1 or V2 variable region (28) from the sequence
alignment of the above-mentioned Lactobacillus sequences together with representatives of the major phylotypes identified from the Lactobacillus diversity
profile. In most cases, a specific complementary primer could not be designed,
and either the LactoF or LactoR primer was used (Table 2). For L. gasseri, the
reverse primer was designed from the V3 region. Specificity was checked by
BLAST analysis of the sequence databases and confirmed by PCR (Table 1).
PCR primers could not be designed to differentiate Lactobacillus ultunensis and
the oral Lactobacillus clone represented by L5 (Fig. 1), as their 16S rDNA
amplicon sequences differed on average by only 1.5%. A common forward
primer, LultF, was therefore designed to be specific for both of these species or
phylotypes.
PCR primers were designed to be optimal for real-time PCR and for the
amplification of sequences within the size range detectable with this system.
Real-time PCR analysis was conducted with the SYBR Green PCR Master Mix
(Applied Biosystems) with the ABI-Prism 7700 sequence detection system (Applied Biosystems). For the quantification of L. casei (including Lactobacillus

Downloaded from http://jcm.asm.org/ on June 14, 2015 by guest

Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus
Lactobacillus

Strain

3130

BYUN ET AL.

J. CLIN. MICROBIOL.
TABLE 2. PCR primers

Primer

Sequence (5-3)

Specificity

Locationa
(5-3)

Region of
16S rRNAb

Annealing
temp (C)

Amplicon
sizec (bp)

GAGAGTTTGATCCTGGCTCAG
TGGAAACAGRTGCTAATACCG
GTCCATTGTGGAAGATTCCC

Most bacteria
All lactobacilli
All lactobacilli

727
157167
379360

5-V1
V2.1-V2.2
V2.2-V3

60
62

391406
231233

LcaseF
LrhamF
LcaseR
LfermR
LdelbF
LdelbR
LgassR
LsaliF
LcrisF
LgallF
LultF
LcrisR
T7 primer

GCACCGAGATTCAACATGG
TGCTTGCATCTTGATTTAATTTTG
GGTTCTTGGATYTATGCGGTATTAG
GCACCTGATTGATTTTGGTCG
GGRTGATTTGTTGGACGCTAG
GCCGCCTTTCAAACTTGAATC
CAGTTACTACCTCTATCTTTCTTCACTAC
CGAAACTTTCTTACACCGAATGC
AGCGAGCGGAACTAACAGATTTAC
CGGTAATGACGCTGGGGAC
GAGCGGAACCAGCAGATCTG
AGCTGATCATGCGATCTGCTT
TAATACGACTCACTATAGGG

L. casei/L. paracasei
L. rhamnosus
L. casei group
L. fermentum
L. delbrueckii
L. delbrueckii
L. gasseri
L. salivarius
L. crispatus
L. gallinarum
L. ultunensis
L. acidophilus groups A1A4d
T7 promoter

86104
81104
196169
8694
92102
219199
470442
6791
6589
7897
6887
205185

V1
V1
V2.2
V1
V1
V2.2
V3
V1
V1
V1
V1
V2.2

60
62

117
122

60
60

317
138

60
60
60
64
60

322
332
154
128
151

Locations relative to positions in the E. coli 16S rRNA gene.

Variable regions according to Neefs et al. (28).
Theoretical amplicon sizes based on the reference sequence for that species; for L. gasseri, L. salivarius, and L. fermentum, either LactoF or LactoR was the
complementary primer.
d
L. acidophilus groups according to Johnson et al. (15).
b
c

paracasei), L. crispatus, L. delbrueckii, L. fermentum, L. gallinarum, L. gasseri, L.

rhamnosus, and L. salivarius, purified genomic DNA from strains Lactobacillus
paracasei subsp. paracasei (ATCC 25302), L. crispatus (ATCC 33820), L. delbrueckii subsp. bulgaricus (ATCC 11842), L. fermentum (ATCC 14931), L. gallinarum (ATCC 33199), L. gasseri (ATCC 33323), L. rhamnosus (ATCC 7469),
and Lactobacillus salivarius subsp. salivarius (ATCC 11741), respectively, were
used as standards in 10-fold dilution series in the range from 10 fg to 1 ng DNA.
For the quantification of L. ultunensis and its related phylotype, purified plasmid
DNA containing the appropriate L. ultunensis 16S rDNA insert was used as the
standard in a 10-fold dilution series in the range from 100 ag to 10 pg of DNA.
The standard DNA concentrations were determined with the PicoGreen doublestranded DNA quantitation kit (Molecular Probes) as described above.
Calculation of bacterial cell numbers. Conversion of the amount of Lactobacillus DNA in the carious dentine samples determined by real-time PCR to
theoretical genome equivalents required the assumption that the genome size
and 16S rRNA gene copy number for all lactobacilli was similar. From the review
by Klaenhammer et al. (16) of current and completed Lactobacillus genomic
sequencing projects, the average genome size for lactobacilli commonly found in
the oral cavity of humans is estimated to be 2.2 Mb, so that each cell contains
approximately 2.4 fg of DNA.
Identification of Lactobacillus 16S rDNA amplicons. DNAs from 58 of the 65
carious dentine samples were diluted in sterile H2O to contain 20 pg of Lactobacillus DNA l1 and pooled. Seven samples containing 50 pg of Lactobacillus DNA (mg [wet weight] of dentine)1 were excluded.
PCR of the pooled carious dentine samples was performed with primers UniF
and LactoR (Table 2) as described above except that 30 cycles of amplification
and 50-l reaction volumes were used. Aliquots (10 l) from four independent
PCRs were verified by electrophoresis with 2% agarose gels containing ethidium
bromide, followed by visualization under UV illumination to confirm the generation of 400-bp amplicons. Amplified DNA was pooled, purified with the
UltraClean PCR Clean-up kit (Mo Bio Laboratories, Carlsbad, Calif.), and
ligated into linearized pGEM-T Easy vectors (Promega, Sydney, New South
Wales, Australia), according to the manufacturers protocol.
Transformation was done with electrocompetent Escherichia coli XL-1 Blue
cells and plated onto Luria-Bertani agar plates supplemented with 25 g of
ampicillin ml1, 30 g of 5-bromo-4-chloro-3-indolyl--D-galactopyranoside (XGal) ml1 and 20 g of isopropyl--D-thiogalactopyranoside (IPTG) ml1 and
incubated overnight at 37C. White transformants were picked randomly, transferred to Luria-Bertani medium in either 15-ml tubes or 2.2-ml deep-well plates,
and grown with shaking for 18 h at 37C. Plasmid DNA was extracted either
individually with a Wizard Plus SV miniprep kit (Promega) or in 96-well blocks
with the Perfectprep Plasmid 96 Vac Direct Bind system (Eppendorf, North
Ryde, New South Wales, Australia) with a Perfect Vac manifold (Eppendorf).
Purified plasmids containing the cloned 16S rDNA amplicons were sequenced by
cycle sequencing at the Westmead DNA Sequencing Facility at Westmead Hos-

pital, Wentworthville, New South Wales, Australia. All clones were sequenced
with the T7 promoter sequence primer in order to provide full coverage of the
400-bp insert.
Sequence analysis of lactobacillus 16S rDNA amplicons. Sequences were
compared with the 16S rRNA gene sequences in the Ribosomal Database
Project (6) and in GenBank to identify related sequences in the databases.
Sequences which were found to have 99% identity were grouped, and representative sequences were aligned with the 16S rDNA sequences of closely related
Lactobacillus spp. in GenBank with CLUSTALW (35). The distance matrix was
calculated with DNADIST with the Jukes-Cantor model (15), and the phylogenetic tree was constructed by the neighbor-joining method of Saitou and Nei
(31) with NEIGHBOR. The corresponding region of the 16S rDNA sequence of
E. coli was used to root the phylogenetic tree. Phylogenetic data were subjected
to bootstrap analysis of 100 replicates with SEQBOOT and CONSENSE, accessed through ANGIS.
Possible chimeric structures among the sequences that were identified by the
program CHIMERA_CHECK, accessed through the Ribosomal Database
Project (6), or by visual detection of anomalous clustering in the phylogenetic
tree, were excluded from the analysis.
Statistical analyses. Correlations between Lactobacillus sp. and between lactobacilli and pulp tissue responses were determined by a nonparametric Spearman test. Differences were analyzed by nonparametric analysis with the Freidman test, followed by Dunns post test for comparison of multiple paired samples.

RESULTS
Specificity of LactoF and LactoR primers. The specificity of
the Lactobacillus genus-specific primers was evaluated by PCR
with DNA purified from the strains listed in Table 1. For all 21
Lactobacillus strains tested, a 230-bp PCR product was obtained. When tested against non-Lactobacillus strains, no amplicons were generated at an annealing temperature of 62C,
confirming the specificity of the primers. LactoF and LactoR
are almost identical in sequence to the primary Lactobacillus
primers designed by McOrist et al. (25) for the detection of
lactobacilli in human fecal samples and therefore are also
predicted to exclude DNA from bacteria commonly isolated
from the gastrointestinal tract of humans.
Quantification of total Lactobacillus DNA by real-time PCR.
Lactobacillus DNA was found in all 65 carious dentine samples, and quantification by real-time PCR found that it ranged

Downloaded from http://jcm.asm.org/ on June 14, 2015 by guest

UniF
LactoF
LactoR

VOL. 42, 2004

LACTOBACILLUS SPP. IN ADVANCED DENTAL CARIES

3131

Downloaded from http://jcm.asm.org/ on June 14, 2015 by guest

FIG. 1. Neighbor-joining tree of the Lactobacillus species and phylotypes identified from 58 carious dentine samples, based on 100 sequences
of the Lactobacillus-specific 16S rRNA amplicon (400 bp) and closely related amplicon regions from Lactobacillus 16S rRNA gene sequences
in GenBank (accession numbers in parentheses). Sequences were aligned with CLUSTALW, and the distance matrix was calculated with the
Jukes-Cantor algorithm. Shaded boxes adjacent to the representative sequence correspond to the number of clones of the different Lactobacillus
spp. or phylotypes identified. Lactobacillus spp. or phylotypes quantified by real-time PCR in the carious dentine samples are marked by the
species-specific primer pairs used. Novel phylotypes (*) were defined to differ by 2% in sequence comparisons of their 16S rDNA amplicons from
their closest related species. Bootstrap values (50) near the nodes are represented as percentages of 100 replicates. The phylogenetic tree was
rooted with the appropriate amplicon region of the 16S rRNA gene sequence of E. coli K-12 strain MG1655. The scale bar represents the genetic
distance.

3132

BYUN ET AL.

J. CLIN. MICROBIOL.
TABLE 3. Lactobacilli detected in carious dentine by real-time PCR

Species

Total lactobacilli
L. rhamnosus
L. casei/L. paracasei
L. fermentum
L. delbrueckii
L. gasseri
L. salivarius
L. crispatus
L. gallinarum
L. ultunensis/Lactobacillus sp.
oral clone

No. of
positive
samples
(%)

65 (100)
35 (54)
26 (40)
14 (22)
4 (6)
35 (54)
39 (60)
29 (45)
6 (9)
33 (51)

DNA (pg [mg(wet wt) of dentine]1)

Range

Mean SEM

Median
5

253.6 10
2.0 1023.4 104
4.02.2 104
1.5 1024.7 104
1.08.8 104
6.1 101.6 105
1.3 105.3 104
1.4 103.9 104
1.4 1022.6 104
5.3 101.8 105

Cell equivalentsa (mg [wet wt] of dentine)1

1.5 10
4.1 103
6.4 102
9.3 102
5.9 10
7.4 103
2.1 103
2.1 103
3.3 103
3.2 103

Range
4

4.7 10 7.0 10
7.6 103 8.8 103
2.7 103 5.1 103
4.7 102 12.4 103
2.1 104 3.7 104
1.7 104 3.0 104
9.2 103 12.5 103
5.9 103 9.0 103
8.4 103 10.8 103
2.0 104 3.5 104

Mean SEM

Median
8

1.0 10 1.4 10
7.6 1041.3 107
1.4 1037.6 106
6.3 1042.0 107
3.8 1023.5 107
3.1 1048.0 107
5.5 1032.2 107
5.9 1031.6 107
5.7 1041.1 107
2.2 1047.4 107

5.9 10
1.5 106
2.2 105
3.9 105
2.2 104
3.8 106
8.7 105
8.5 105
1.4 106
1.3 106

1.9 107 2.8 107

2.9 106 3.4 106
9.6 105 17.6 105
1.9 106 5.1 106
8.4 106 14.8 106
8.7 106 15.2 106
3.8 106 5.2 106
2.4 106 3.7 106
3.5 106 4.5 106
8.1 106 14.4 106

from 25 pg to 359 ng (mg [wet weight] of dentine)1 (Table 3).

When converted to theoretical cell numbers, these values corresponded to levels of lactobacilli in the carious lesions ranging
from 1.0 104 to 1.4 108 cells (mg [wet weight] of dentine)1 (Table 3). Compared with the number of Lactobacillus
CFU for each dentine sample (22), the values obtained with
real-time PCR were, on average, 34-fold higher.
Diversity of lactobacilli in carious dentine. In contrast to the
traditional culture methods used to define species, 16S rDNA
amplicon sequences can determine the similarity between
phylotypes or species when the sequences of the 16S rDNA
amplicons differ by 1%. Thus, the phylogenetic inferences
among the 100 Lactobacillus 16S rDNA amplicon sequences
obtained from carious dentine could be compared with the
equivalent regions of reference 16S rDNA sequences of known
species and phylotypes (Fig. 1). However, since the analysis
was based on a 400-bp sequence comprising the V1 and V2
regions of the 16S rRNA gene, the phylogenetic tree only
provides an indication of the diversity and relationships of the
Lactobacillus spp. found in carious dentine samples. The phylogenetic distances between the species or phylotypes may not
be truly representative of the genetic distances between the
species if the entire 16S rRNA gene sequences had been used
for the analysis (13).
Considerable diversity was displayed among the 100 Lactobacillus 16S rDNA amplicon sequences. Based on the definition that 16S rDNA sequences of phylotypes differ from one
another by 2% of nucleotide sites within the amplified region, 18 different phylotypes were identified. Among these, 12
phylotypes showed 99% identity with the 16S rDNA amplicon sequences of known lactobacilli. The remaining phylotypes
were either novel species or showed relatedness to uncharacterized lactobacilli from various environments.
Among the 100 Lactobacillus 16S rDNA amplicon sequences, L. gasseri was the most frequently identified species,
represented by 28 randomly selected clones. This was followed
by L. rhamnosus (13 clones) and a possible novel oral Lactobacillus sp., L5, represented by 12 clones. Other species that
were also identified at higher frequency were L. crispatus,
L. casei, L. ultunensis (each represented by seven clones), and
L. salivarius (five clones).
Novel Lactobacillus phylotypes in carious dentine. Several
sequences were found on multiple occasions among the se-

quenced clones that were either novel species or phylotypes

(Fig. 1) or showed high identity to sequences previously identified from sites other than the human oral cavity. The third
most frequently isolated 16S rDNA amplicon, that of the novel
Lactobacillus phylotype represented by L5 (12 clones), showed
a single nucleotide difference over a 393-bp sequence from an
uncultured Lactobacillus sp. identified in the human oral cavity
(GenBank accession no. AY349383) (B. J. Paster, unpublished
data). Closely related is the 391-bp 16S rDNA amplicon from
Lactobacillus phylotypes represented by L86 (7 clones), which
was identical to the 16S rDNA sequence from L. ultunensis,
which was recently isolated from human stomach mucosa
(GenBank accession no. AY253660) (S. Roos, unpublished
data).
Another novel phylotype in the L. acidophilus group included three clones represented by L84 (Fig. 1), which was most
closely related to an uncultured bacterium from the pig gastrointestinal tract (18) and probably represented a novel species. Within 395 bp, these sequences differed by only 2% on
average but were 3% different from the most closely related
16S rDNA, that of L. gallinarum.
Additionally, within the L. acidophilus group were clones
L33, L80, and L97 (Fig. 1), whose 16S rDNA amplicon sequences differed on average by 0.7%. These three clones may
also represent a novel species, since their 16S rDNA amplicon
sequences differed by 2% from that of L. crispatus, the closest
related known species, a level of difference sufficient to classify
a species within the L. acidophilus group.
Distribution of major species of lactobacilli in carious dentine samples. A qualitative screen of the 65 carious dentine
samples by PCR analysis with species-specific primer sets (Table 2) showed that in most dentine samples, at least three
different species or phylotypes were present. The qualitative
screen revealed that members of the L. casei group, which includes L. casei, L. paracasei, and L. rhamnosus, were the most
prevalent species, being present in 68% of the samples. L. rhamnosus and L. casei/L. paracasei were found in 54 and 40% of
samples, respectively. In decreasing order, other prevalent species or phylotypes identified in the dentine were L. salivarius
(60%), L. gasseri (54%), L. ultunensis and related phylotype
(52%), and L. crispatus (45%). Less prevalent were L. fermentum (22%), a heterofermentative species frequently associated

Downloaded from http://jcm.asm.org/ on June 14, 2015 by guest

a
The genome sizes assumed for calculating cell numbers were as follows: L. casei, 2.6 Mb; L. rhamnosus, 2.4 Mb; L. fermentum, L. salivarius, L. crispatus, L. gallinarum
and L. ultunensis, 2.2 Mb; L. gasseri, 1.8 Mb; and L. delbrueckii, 2.3 Mb.

VOL. 42, 2004

LACTOBACILLUS SPP. IN ADVANCED DENTAL CARIES

3133

with the initiation of dental caries (4, 21, 33), L. gallinarum

(9%), and L. delbrueckii (6%).
Enumeration of Lactobacillus species and phylotypes. Among
the more prevalent species identified by population analysis
of pooled DNA (Fig. 1), real-time PCR analysis showed that
L. gasseri and L. ultunensis (and its related phylotype) were
present in higher numbers than the other species, with mean
loads of 8.7 106 and 8.1 106 cells (mg [wet weight] of
dentine)1, respectively (Table 3). L. gasseri and L. ultunensis
also comprised the highest loads of any lactobacilli in any
sample, with levels as high as 8.0 107 and 7.4 107 cells (mg
[wet weight] of dentine)1, respectively (Table 3), suggesting
an association between these species and advanced dental caries. In several carious dentine samples, these two prevalent
species were also estimated to constitute the majority of the
Lactobacillus spp. present. L. ultunensis (and its related phylotype) were found to constitute 84 and 68% of the total
Lactobacillus load in samples E32 and E35, respectively (Fig.
2). In sample E56, L. ultunensis constituted approximately 90%
of the total Lactobacillus load. Similarly, L. gasseri was found to
constitute 91 and 58% of the total Lactobacillus load in samples E64 and E65, respectively (Fig. 2).
The mean loads of the other prevalent species varied from
9.5 105 cells (mg [wet weight] of dentine)1 for L. casei to
3.8 106 cells (mg [wet weight] of dentine)1 for L. salivarius
(Table 3). Although the less prevalent species L. fermentum,
L. gallinarum, and L. delbrueckii were present in fewer samples,
when they were found, they constituted comparable loads.

Associations between Lactobacillus load and specific Lactobacillus species and the histopathology of pulpitis. The pulps
from the 65 carious teeth were divided into four histopathological categories on the basis of the dominant pathology described previously (22). In each of the four histopathological
categories, multivariate analyses were performed on the mean
values of DNA loads estimated by real-time PCR for the total
lactobacilli and for the different species with the Freidman test.
For the total load of lactobacilli, no statistically significant
relationships with histological category of pulp response were
observed. Similarly, no significant relationships between the
different Lactobacillus spp. and histological response were detected.
Possible relationships between pairs of Lactobacillus spp. in
each carious dentine sample were determined with the Spearman correlation (Table 4). For most of the associations, the
correlation coefficients (r) were low and insignificant (P
0.05). However, analysis revealed multiple positive associations
between L. gasseri and L. salivarius with the other Lactobacillus
spp. examined. Several of these associations were found to be
significant, e.g., L. gasseri and L. salivarius (r 0.5434, P
0.0001) and L. gasseri and L. rhamnosus (r 0.5313, P
0.0001), indicating that the presence of one of these species in
the carious site was associated with the colonization and proliferation of the other species.
When pairs of Lactobacillus spp. within the four histopathological categories were analyzed separately, several significant
relationships were revealed (Table 5), indicating that positive

Downloaded from http://jcm.asm.org/ on June 14, 2015 by guest

FIG. 2. Graphic representation of the DNA loads of the nine predominant Lactobacillus species or phylotypes in carious dentine determined
by real-time PCR. Forty samples with the highest total Lactobacillus loads are shown. The difference in the total Lactobacillus load with the
cumulative total of the nine species in each sample (referred to as unknown) was attributed to the presence of other, less-prevalent Lactobacillus
spp. that were not quantified by real-time PCR. Patient samples are indicated on the x axis.

3134

BYUN ET AL.

J. CLIN. MICROBIOL.

TABLE 4. Correlations between Lactobacillus species

within the carious dentine
Microbial associationa
Lactobacillus sp.

L.
L.
L.
L.
L.
L.
L.
L.
L.

casei
rhamnosus
crispatus
ultunensis
gasseri
salivarius
fermentum
delbrueckii
gallinarum

L. gasseri

L. salivarius

0.1638
0.5313
0.4078
0.3027

NS
0.0001
0.0007
0.0142

0.5434
0.4305
0.08768
0.1774

0.0001
0.0003
NS
NS

0.2075
0.375
0.3003
0.3687
0.5434

NS
0.0021
0.0151
0.0025
0.0001

0.323
0.1425
0.05456

0.0087
NS
NS

associations between certain Lactobacillus spp. are correlated

with changes in disease progression. Interestingly, in all histopathological states, a positive relationship between L. gasseri
and another species was observed.
Presence of other lactobacilli in carious dentine. Comparisons of the total Lactobacillus DNA with the cumulative
contribution from individual species showed that there was a
significant component of Lactobacillus load that remained unidentified in several samples (Fig. 2). Although the differences
in the amount of Lactobacillus DNA could be due to differences in the genome sizes and/or the copy number of 16S
rRNA genes relative to that in L. delbrueckii subsp. bulgaricus,
which was used as the standard, there was a substantial proportion of undetected species in several of the lesions, such as
samples E25 and E73, where 74 and 61%, respectively, of the
total Lactobacillus load remained unaccounted for (Fig. 2).
Random cloning and sequencing of 16S rDNA amplicons in
the samples that contained high proportions of unknown lactobacilli revealed the presence of species of lactobacilli other
than the predominant species determined from pooling the
carious dentine samples (data not shown). In the case of sample E25, for example, in which 74% of the total Lactobacillus
load was unidentified, 67% of the 16S rDNA amplicon sequences showed identity with the phylotype cluster represented by Lactobacillus clones L33, L80, and L97 in the L. acidophilus group (Fig. 1). Other species present in these carious
dentine samples but not identified among the sequences of the
100 16S rDNA amplicons were Lactobacillus panis, Lactobacillus colehominis, and Lactobacillus nagelii (unpublished data).
It appears that these species and the other previously identified
species that were not quantified by real-time PCR most likely
constitute the unidentified lactobacilli in these carious dentine
samples.
DISCUSSION
Compared with lactobacillus counts determined by culturebased methods (22), the values reported in this study determined by real-time PCR were considerably higher, as found
previously with the use of this enumeration technique (22, 26).
The molecular approaches used in this study also led to the
identification of 18 different phylotypes of lactobacilli. Of
these, only 12 showed relatedness to known Lactobacillus spp.,

TABLE 5. Correlations between Lactobacillus species and

histopathological categoriesa
Histological category

Microbial association

Minimal inflammatory
change

L. gasseri, L. salivarius
L. salivarius, L. rhamnosus
L. gasseri, L. rhamnosus

0.6729 0.0001
0.5124
0.0053
0.5083
0.0057

Soft tissue degenerative

change

L. rhamnosus, L. gasseri
L. rhamnosus, L. ultunensis

0.6553
0.6375

0.0023
0.0033

Hard tissue degenerative

change

L. fermentum, L. salivarius 0.8748

L. fermentum, L. rhamnosus 0.8669
L. gasseri, L. crispatus
0.7952

0.0123
0.0123
0.0341

Inflammatory degenerative L. gasseri, L. crispatus

change
L. gasseri, L. ultunensis
a

0.7075
0.6392

Correlation coefficients were calculated with the Spearman test.

0.0149
0.0342

Downloaded from http://jcm.asm.org/ on June 14, 2015 by guest

a
r, correlation coefficients were calculated with the Spearman test. NS, not
significant (P 0.05).

with only about half of these being similar to species previously

isolated from the human oral cavity (24, 9, 33). The remaining
phylotypes were novel or related to uncultured bacteria. Many
of these novel phylotypes were found in significant numbers,
indicating their possible association with the progression of the
disease. For example, 30% of the clones belonged to the L.
acidophilus group and were either new species or phylotypes or
similar to species not associated with the human oral cavity,
such as clones L84 and L29/L72, which were related to uncultured bacteria identified in the gastrointestinal tract of pigs
(18). The failure to detect these lactobacilli in carious dentine
by culture-based techniques could simply reflect the difficulties
encountered in distinguishing between species of this group
with standard biochemical tests (8). Alternatively, members of
this group may have additional nutrient requirements that impede their cultivation by conventional methods.
Although the PCR amplification and cloning technique used
in this study may bias the reflection of microbial diversity (38),
the fact that individual dentine samples were diluted to contribute equal quantities of Lactobacillus DNA to a pooled
sample prior to phylogenetic analysis meant that the numerical
frequency of the identified species in the clone library reflected
their overall numerical predominance within the pooled carious dentine samples. Thus, L. gasseri, L. rhamnosus, and a
novel Lactobacillus phylotype (represented by clone L5) were
the most numerically dominant species within the 65 carious
dentine samples. With classic culture-based methods, L. casei,
L. rhamnosus, and L. acidophilus are the most frequently isolated species (4, 9, 23, 32, 33).
Of particular note was that neither L. brevis nor L. plantarum
was identified among the 100 16S rDNA amplicons that were
analyzed even though these two species were previously isolated in significant numbers (2, 5, 9, 11, 33). Other species
cultured from carious dentine include Lactobacillus coryniformis, L. sakei, L. lactis, and L. fermentum (9), whereas those
identified at low frequency in the current study showed phylogenetic relatedness to lactobacilli not typically found in the
human oral cavity. These included phylotypes isolated from the
gastrointestinal tract of animals (30), sourdough (37), maize
silage (17), and semifermented wine (7). An exception was
clone L128, which was related to the oral clone CX036, obtained from human subgingival plaque (29). Whether the presence of numerous Lactobacillus spp. in pooled carious dentine

LACTOBACILLUS SPP. IN ADVANCED DENTAL CARIES

VOL. 42, 2004

REFERENCES
1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.
Basic local alignment search tool. J. Mol. Biol. 215:403410.
2. Ando, N., and E. Hoshino. 1990. Predominant obligate anaerobes invading
the deep layers of root canal dentin. Int. Endodont. J. 23:2027.
3. Bjorndal, L., and T. Larsen. 2000. Changes in the cultivable flora in deep
carious lesions following a stepwise excavation procedure. Caries Res. 34:
502508.
4. Botha, S. J., S. C. Boy, F. S. Botha, and R. Senekal. 1998. Lactobacillus
species associated with active caries lesions. J. Dent. Assoc. S. Afr. 53:36.
5. Brown, L. R., R. J. Billings, and A. G. Kaster. 1986. Quantitative comparisons of potentially cariogenic microorganisms cultured from noncarious and
carious root and coronal tooth surfaces. Infect. Immun. 51:765770.
6. Cole, J. R., B. Chai, T. L. Marsh, R. J. Farris, Q. Wang, S. A. Kulam, S.
Chandra, D. M. McGarrell, T. M. Schmidt, G. M. Garrity, and J. M. Tiedje.
2003. The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy.
Nucleic Acids Res. 31:442443.
7. Edwards, C., M. Collins, P. Lawson, and A. Rodriguez. 2000. Lactobacillus
nagelii sp. nov., an organism isolated from a partially fermented wine. Int. J.
Syst. Evol. Microbiol. 50:699702.
8. Fujisawa, T., Y. Benno, T. Yaeshima, and T. Mitsuoka. 1992. Taxonomic
study of the Lactobacillus acidophilus group, with recognition of Lactobacil-

9.
10.
11.
12.
13.
14.
15.
16.

17.

18.

19.
20.

21.
22.

23.
24.
25.
26.
27.
28.
29.
30.
31.
32.

lus gallinarum sp. nov. and Lactobacillus johnsonii sp. nov. and synonymy of
Lactobacillus acidophilus group A3 (Johnson et al. 1980) with the type strain
of Lactobacillus amylovorus (Nakamura 1981). Int. J. Syst. Bacteriol. 42:487
491.
Hahn, C. L., W. A. Falkler, Jr., and G. E. Minah. 1991. Microbiological
studies of carious dentine from human teeth with irreversible pulpitis. Arch.
Oral Biol. 36:147153.
Helderman, W. H. V., M. I. N. Matee, J. S. vanderHoeven, and F. H. M.
Mikx. 1996. Cariogenicity depends more on diet than the prevailing mutans
streptococcal species. J. Dent. Res. 75:535545.
Hoshino, E. 1985. Predominant obligate anaerobes in human carious dentin.
J. Dent. Res. 64:11951198.
Hoshino, E., N. Ando, M. Sato, and K. Kota. 1992. Bacterial invasion of
non-exposed dental pulp. Int. Endodont. J. 25:25.
Hugenholtz, P., B. M. Goebel, and N. R. Pace. 1998. Impact of cultureindependent studies on the emerging phylogenetic view of bacterial diversity.
J. Bacteriol. 180:47654774.
Johnson, J. L., C. F. Phelps, C. S. Cummins, J. London, and F. Gasser. 1980.
Taxonomy of the Lactobacillus acidophilus group. Int. J. Syst. Bacteriol.
30:5368.
Jukes, T. H., and C. R. Cantor. 1969. Evolution of protein molecules, p.
21132. In H. N. Munro (ed.), Mammalian protein metabolism. Academic
Press, New York, N.Y.
Klaenhammer, T., E. Altermann, F. Arigoni, A. Bolotin, F. Breidt, J. Broadbent, R. Cano, S. Chaillou, J. Deutscher, M. Gasson, M. van de Guchte, J.
Guzzo, A. Hartke, T. Hawkins, P. Hols, R. Hutkins, M. Kleerebezem, J. Kok,
O. Kuipers, M. Lubbers, E. Maguin, L. McKay, D. Mills, A. Nauta, R.
Overbeek, H. Pel, D. Pridmore, M. Saier, D. van Sinderen, A. Sorokin, J.
Steele, D. OSullivan, W. de Vos, B. Weimer, M. Zagorec, and R. Siezen.
2002. Discovering lactic acid bacteria by genomics. Antonie van Leeuwenhoek 82:2958.
Krooneman, J., F. Faber, A. C. Alderkamp, S. Oude Elferink, F. Driehuis, I.
Cleenwerck, J. Swings, J. C. Gottschal, and M. Vancanneyt. 2002. Lactobacillus diolivorans sp. nov., a 1,2-propanediol-degrading bacterium isolated
from aerobically stable maize silage. Int. J. Syst. Evol. Microbiol. 52:639
646.
Leser, T. D., J. Z. Amenuvor, T. K. Jensen, R. H. Lindecrona, M. Boye, and
K. Moller. 2002. Culture-independent analysis of gut bacteria: the pig gastrointestinal tract microbiota revisited. Appl. Environ. Microbiol. 68:673
690.
Love, R. M., and H. F. Jenkinson. 2002. Invasion of dentinal tubules by oral
bacteria. Crit. Rev. Oral Biol. Med. 13:171183.
Love, R. M., M. D. McMillan, Y. Park, and H. F. Jenkinson. 2000. Coinvasion of dentinal tubules by Porphyromonas gingivalis and Streptococcus gordonii depends upon binding specificity of streptococcal antigen I/II adhesin.
Infect. Immun. 68:13591365.
Marchant, S., S. R. Brailsford, A. C. Twomey, G. J. Roberts, and D. Beighton. 2001. The predominant microflora of nursing caries lesions. Caries Res.
35:397406.
Martin, F. E., M. A. Nadkarni, N. A. Jacques, and N. Hunter. 2002. Quantitative microbiological study of human carious dentine by culture and realtime PCR: association of anaerobes with histopathological changes in
chronic pulpitis. J. Clin. Microbiol. 40:16981704.
Massey, W. L., D. M. Romberg, N. Hunter, and W. R. Hume. 1993. The
association of carious dentin microflora with tissue changes in human pulpitis. Oral Microbiol. Immunol. 8:3035.
McGrady, J. A., W. G. Butcher, D. Beighton, and L. M. Switalski. 1995.
Specific and charge interactions mediate collagen recognition by oral lactobacilli. J. Dent. Res. 74:649657.
McOrist, A. L., M. Jackson, and A. R. Bird. 2002. A comparison of five
methods for extraction of bacterial DNA from human faecal samples. J.
Microbiol. Methods 50:131139.
Nadkarni, M. A., F. E. Martin, N. A. Jacques, and N. Hunter. 2002. Determination of bacterial load by real-time PCR using a broad-range (universal)
probe and primers set. Microbiology 148:257266.
Nagaoka, S., Y. Miyazaki, H. J. Liu, Y. Iwamoto, M. Kitano, and M. Kawagoe. 1995. Bacterial invasion into dentinal tubules of human vital and nonvital teeth. J. Endodont. 21:7073.
Neefs, J. M., Y. Van de Peer, P. De Rijk, S. Chapelle, and R. De Wachter.
1993. Compilation of small ribosomal subunit RNA structures. Nucleic Acids
Res. 21:30253049.
Paster, B. J., S. K. Boches, J. L. Galvin, R. E. Ericson, C. N. Lau, V. A.
Levanos, A. Sahasrabudhe, and F. E. Dewhirst. 2001. Bacterial diversity in
human subgingival plaque. J. Bacteriol. 183:37703783.
Roos, S., F. Karner, L. Axelsson, and H. Jonsson. 2000. Lactobacillus mucosae sp nov, a new species with in vitro mucus-binding activity isolated from
pig intestine. Int. J. Syst. Evol. Microbiol. 50:251258.
Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406425.
Shovlin, F. E., and R. E. Gillis. 1968. Biochemical and antigenic studies
of lactobacilli isolated from deep dentinal caries. I. Biochemical aspects.
J. Dent. Res. 48:356360.

Downloaded from http://jcm.asm.org/ on June 14, 2015 by guest

reflects the diverse dietary habits of the patients (10, 34) remains to be determined. Some of these species were poorly
represented in the pooled sample, suggesting their presence in
a small number of individual carious dentine samples.
Among the more prevalent lactobacilli identified by population analysis, at least three different species or phylotypes
were found in the majority of the 65 carious dentine samples
(Fig. 2). This is consistent with previous reports from culturebased studies (3). In accordance with these previous findings
(4), members of the L. casei group were the most prevalent,
followed by L. salivarius, L. gasseri, L. ultunensis (and its related phylotype), and L. crispatus. However, quantification of the
prevalent species by real-time PCR showed that L. gasseri and
L. ultunensis (and its related phylotype) were present in considerably higher numbers than the other species, consistent
with the findings of their numerical predominance in the pooled
carious dentine sample (Fig. 1 and 2). These two species also
constituted the majority of lactobacilli present in several dentine samples, suggesting that they may possess a selective advantage for colonization and proliferation in decaying dentine.
This notion is consistent with the observation of higher proportions of lactobacilli in severely demineralized dentine (36)
and their affinity for collagen type I (24). Other prevalent species were found to constitute variable proportions in the dentine sample, and their role in caries progression cannot be
overlooked (Fig. 2).
In conclusion, the findings of the present study indicate a
complex and diverse presentation of lactobacilli in the advancing front of dentinal carious lesions. Phylogenetic analysis
based on regions of the 16S rRNA genes enabled both an
appreciation of this diversity and a high degree of precision in
classifying representative lactobacilli. Although the combined
approach of population analysis and real-time PCR quantification indicated a complete profile of the genus for many
lesions, it was also evident that additional and as yet undefined
lactobacilli were present in some lesions (Fig. 2). On the basis
of known habitats, it is postulated that environmental influences, particularly dietary influences, have a determining role
in colonization profiles within the lesions. It is also evident that
both synergistic and antagonistic interactions would determine
the final profile of Lactobacillus spp. and phylotypes within
these lesions.

3135

3136

BYUN ET AL.

33. Smith, S. I., A. J. Aweh, A. O. Coker, K. O. Savage, D. A. Abosede, and K. S.

Oyedeji. 2001. Lactobacilli in human dental caries and saliva. Microbios
105:7785.
34. Staat, R. H., T. H. Gawronski, D. E. Cressey, R. S. Harris, and L. E. Folke.
1975. Effects of dietary sucrose levels on the quantity and microbial composition of human dental plaque. J. Dent. Res. 54:872880.
35. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W:
improving the sensitivity of progressive multiple sequence alignment through
sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res. 22:46734680.

J. CLIN. MICROBIOL.
36. van Strijp, A. J., T. J. van Steenbergen, and J. M. ten Cate. 1997. Bacterial
colonization of mineralized and completely demineralized dentine in situ.
Caries Res. 31:349355.
37. Vogel, R. F., G. Bocker, P. Stolz, M. Ehrmann, D. Fanta, W. Ludwig, B. Pot,
K. Kersters, K. H. Schleifer, and W. P. Hammes. 1994. Identification of
lactobacilli from sourdough and description of Lactobacillus pontis sp. nov.
Int. J. Syst. Bacteriol. 44:223229.
38. von Wintzingerode, F., U. B. Gobel, and E. Stackebrandt. 1997. Determination of microbial diversity in environmental samples: pitfalls of PCR-based
rRNA analysis. FEMS Microbiol. Rev. 21:213229.

Downloaded from http://jcm.asm.org/ on June 14, 2015 by guest