Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
seed (1), thus complicating pathogen iden- tification. Some isolates sporulate sparsely or produce sterile mycelium under labora- tory
conditions. Morphological identifica- tion is impossible when this occurs.
Molecular approaches, mainly the poly- merase chain reaction (PCR), frequently h ave been used as tools for the detection of numerous
fungal pathogens (4,14,17). A sensitive and rapid PCR assay, based on amplification of sequences of the internal transcribed spacer (ITS)
regions of the ribosomal DNA, recently was developed to detect A. brassicicola or A. japonica infec- tion of cruciferous seed (8).
Unfortunately, this method did not generate a reliable diagnosis when seed were contaminated
with A. brassicae because cross-reactions
with other fungal species sometimes were
observed.
The genus Alternaria comprises saprophytic and pathogenic species of filamen- tous fungi. Plant pathogens of this genus have a distinct and limited host range. It has been
strongly suggested that both viru- lence and host specificity are partly de- pendent on the production of host-specific toxins (HSTs; 18,27). A
complex of three species, A. brassicae, A. brassicicola, and A. japonica (formerly named A. raphani), is responsible for the black spot
disease of crucifers and is transmitted by seed of many species belonging to the genera Brassica and Raphanus. The disease is of major
importance in cultivated crucifers worldwide, with most commercial culti- vars being susceptible (25). It occurs at all host plant growth
stages, on aerial parts, and is identifiable by black lesions, often surrounded by chlorotic zones (26). The disease also can be destructive
for seed producers because infection often leads to premature pod shatter and shriveled seed, with altered germination efficiency, as
noted in various crucifer hosts such as Brassica juncea, B. campestris, and B. rapa (20,21). Black spot disease results in
a serious reduction of crop yields, such as reduced market quality of cauliflower heads and oil quality in family Brassicaceae oilseed
species. The fungi overwinter on infected crop residues, seed, and any related cruciferous weed species. They can be seedborne via mycelia
within the seed or transitory spores on the seed surface. Spores are readily windborne and can be dispersed great distances through- out the
growing season.
Common practices to prevent the dis- ease do not always provide satisfactory control of infection. Genetic control could be the most
effective strategy, but most commercially available cultivars show little resistance to the pathogen. Black spot disease could be controlled
with fungi- cides, but field isolates of A. brassicicola expressing cross-resistance to common broad-spectrum fungicides recently were
identified in France (7). Rotations with noncruciferous crops, crop residue destruc- tion, and weed control also can help to reduce the incidence
of this disease. More- over, the use of pathogen-free seed is es- sential to limit the spread and incidence of the disease. The current routine
technique used to assess levels of pathogenic Alter- naria spp. contamination in cruciferous seed is based on the culture of the seedborne fungi
on nutritive media and further morphological characterization. This is a time-consuming process, whereby it ta kes at least 1 week to obtain a
diagnos- tic result. Accurate diagnosis is not easy because numerous saprophytic Alternaria spp. commonly are found on cruciferous
Johnson et al. (10) recently described the use of a PCR-based technique using primers designed from a gene i nvolved in pathogenicity
(synthesis of the host-spe- cific AM-toxin) to specifically detect A. alternata apple pathotypes among Alter- naria field isolates. Host
specificitytypi- cal of several pathogenic Alternaria spp. is dependent mainly on toxin production; therefore, effective molecular probes
could be developed for diagnostic techniques by cloning genes involved in virulence.
In the present study, we developed PCR assays for detecting A. brassicae in seed batches. These methods used oligonucleo- tides
complementary to sequences located on a cluster of genes that may be required for the pathogenicity of the fungus. The specificity and
suitability of the designed primers were tested using standard and real-time PCR.
MATERIALS AND METHODS
Fungal strains and culture conditions. Isolates of Alternaria spp. and other gen- era (Table 1) were recovered from seed. Cultures were
grown and maintained in petri dishes on potato dextrose agar. Alternaria isolates were identified on the basis of morphology criteria (11,16).
Iden- tifications then were confirmed by PCR using specific ITS primer pairs (8) for Alternaria spp. pathogenic to crucifers.
Preparation of seed samples. Seed samples were prepared from contaminated seed of radish and cabbage as described by IacomiVasilescu et al. (8). For artificial contaminations, seed were disinfected with
490
1% sodium hypochlorite, rinsed with ster- ile water, soaked for 1 h in a calibrated spore suspension (10 6 spores/ml), and dried at room
temperature on sterile filter paper. Disinfection and inoculation accu- racy was confirmed by placing 20 seed on the surface of malt-agar
plates for 1 week at 25C. Seed batches showing 0% (disin- fected seed) or 100% (inoculated seed) infection were selected and mi xed
together to prepare seed samples with different levels of contamination (0, 5, 10, 50, and
100%). Samples were produced by placing
20 seed (artificially contaminated) or 100 seed (naturally contaminated) in a sterile tube and covering them with 0.5 and 3 ml, respectively, of
liquid culture MDP medium (2% malt extract, 2% dextrose, 0.1% pep- tone). The tubes were incubated at 25C for
48 h with occasional shaking. This incuba- tion step is an enrichment phase that allows an optimal increase of the fungal biomass from seed.
The tubes then were vortexed briefly to separate mycelia and conidia from seed. The seed were discarded and the fun- gal structures were
collected on mi- crocentrifuge filters (pore size: 0.45 m; Ultrafree-Mc Millipore, Bedford, MA) by centrifugation at 5,000 g for 10 min.
DNA manipulation. DNA was ex- tracted from fungal mycelia and conidia harvested by scraping the surface of petri plate cultures
(extraction from fungal cul- tures) or collected on microcentrifuge filters (extraction from seed samples). Nucleic acids were isolated
according to the microwave miniprep procedure de- scribed by Goodwin and Lee (6). Alterna- tively, DNA was extracted using the Nucleospin Food kit (Macherey-Nagel, Dren, Germany) according to the manu- facturers instructions.
PCR-based assay. Specific oligonu- cleotides ABCsens (5-CTGGTGAAA- AGGTTGCGATCGT-3) and ABCrev (5GTGACTTTCATGAAATGACATTGATG3), complementary to the 3 end of open reading frame (ORF)2, and 115sens (5- AACCCTATAGACCCACGTCGACTA-3) and 115rev (5GATGGTACGCAAGGC- TTGGT-3), complementary to a portion of ORF1, were designed for the standard and real-time PCR assays,
respectively, using the appropriate software (Primer 3 online and ABI PRISM Primer Express). The two ORFs were deduced from the
nucleotide sequence of an A. brassicae genomic DNA fragment identified after screening a cosmid library with a probe corresponding to a portion of the nonribosomal peptide syn- thase (NRPS) gene. In order to test the specificity of
the primer pairs against A. brassicae isolates, amplifications were performed using DNA extracted from pure fungal cultures from a range of
Alternaria spp. and other fungi isolated from seed. Then the PCR procedure was applied to detect seed contamination. The universal
primer pair ITS1/ITS2 (28) was used as a positive control to assess the quality of the extracted DNA. Conventional PCR was performed
using 2 l of undiluted DNA preparations under the following condi- tions: Tris-HCl, pH 9.0, 20 mM (NH4)2SO4, 0.01% (wt/vol)
Tween 20, 1.5 mM MgCl2, 200 M each deoxyribonu- cleotide triphosphate, and 1 unit of ther- mostable DNA polymerase (Goldstar Red
DNA polymerase, Eurogentec, Seraing, Belgium). A Thermojet thermocycler (Equibio, Seraing, Belgium) was used with an initial step of 3
min at 95C; followed by 35 cycles of 30 s at 95C, 50 s at 60C, and 1 min at 72C; and a final step of 10 min at 72C. The amplification
results were visualized after electrophoresis of an aliquot (10 l) of the reaction mixture on a
Fig. 1. Gel electrophoresis of polymerase chain reaction products obtained with internal transcribed spacer (ITS) 1/2 universal primers and with
ABCsens/rev diagnostic primers. DNA was extracted from pure Alternaria brassicae cultures or from radish seed infected with A. brassicae, using the Nucleospin Food kit. Lanes M were loaded with a DNA ladder (SmartLadder Classic, Eurogentec, Seraing, Belgium).
Plant Disease / May 2004
491
1.2% agarose gel. The real-time PCR reac- tions were carried out in a 25-l final vol- ume containing: 2.5 l of DNA, 12.5 l of SYBR
Green PCR Master Mix 2X (Ap- plied Biosystems, Courtaboeuf, France),
300 nM forward and reverse primers and H2O up to 25 l. An ABI PRISM 700 Se- quence Detection System (Applied Biosys- tems) was
used with the following steps: 2 min at 50C, 10 min at 95C, and 40 cy- cles consisting in one step at 95C for 15 s foll owed by one step at
60C for 1 min. Nucleic acids were quantified in unknown samples by direct comparison to a stan- dard. The DNA used as standard was
ex- tracted from fungal cultures, with the con- centration measured by fluorometric assay (Turner Design Inst. 700, Sunnyvale, CA) before
dilution.
RESULTS
Selection of the diagnostic PCR prim- ers. Bacterial and fungal genes involved in toxin production have been used success- fully to
develop molecular diagnostic tools (10). Therefore, primer pairs were de- signed on the basis of the nucleotide se- quence of a potential
pathogenic cluster of two A. brassicae genes encoding an NRPS and an ATP-binding cassette (ABC) trans- porter. These genes putatively
are involved in the synthesis and excretion of a toxic peptide metabolite produced by A. brassi- cae and, thus, may be suitable targets for
PCR-based detection of this pathogen. We
expected to find homologous genes in related pathogenic Alternaria spp.; there- fore, PCR screening of the A. japonica and A. brassicicola
genomes was performed using primers that span the A. brassicae gene cluster. This preliminary approach revealed that the two A. brassicae
ORFs have counterparts on the genome of other Alternaria spp. pathogenic to crucifers (data not shown). However, the central part and 3 end
of the NRPS and ABC trans- porter, respectively, were found to be less conserved among the three species. There- fore, we focused on these
regions to select primers for specific detection of A. brassi- cae. Two primer pairs were designed: one for standard PCR assays, called ABCsens/ABCrev, located near the 3 end of the ABC transporter gene coding se- quence; and one for real-time PCR assays, called
115sens/115rev, located at ap- proximately 10 kb of the NRPS gene start codon.
DNA extraction from seed. DNA was extracted routinely from fungal mycelia in pure cultures or from seed samples using a standard
miniprep procedure. This tech- nique involved lysis at high temperature in a detergent-containing buffer, extraction with organic solvents, and
nucleic acid precipitation in the presence of alcohol. However, alternative extraction procedures using commercial kits were tested with the aim
of designing a simple and safe diag- nostic assay that could be automated to
process numerous samples. The Nucleo- spin Food kit was found to be the most efficient. Irrespective of the method used for isolating
nucleic acids (i.e., from pure fungal cultures or seed samples), similar amplification patterns were obtained with both universal and specific
primer pairs (Fig. 1). The DNA obtained with the Nu- cleospin Food kit also was tested successfully as template for real-time PCR
(described below).
Specificity of the selected PCR prim- ers. To test the specificity toward A. bras- sicae isolates, ABCsens/rev primers were first used in a
PCR reaction with genomic DNA extracted from mycelial pure cultures of different fungal isolates (Table 1). These were selected to
represent a range of fungi commonly found on cruciferous seed, including the three pathogenic Alternaria spp. A. brassicicola (five isolates),
A. ja- ponica (five isolates), and A. brassicae (five isolates), as well as saprophytic A. alternata isolates (two isolates), and iso- lates of
Fusarium spp. (two isolates), Peni- cillium spp., Aspergillus spp., and Phoma spp. (one isolate each). Another seedborne Alternaria sp. (A.
dauci) and isolates from the closely related genera Ulocladium and Stemphylium also were tested, along with one Botrytis cinerea strain
isolated from sunflower seeds. A representative sample gel is shown in Figure 2. After optimisa- tion of the cycling parameters, PCR products of the expected size (780 bp) were obtained from A. brassicae isolates only. No cross hybridization was observed with
Table 1. Names and origins of species and isolates used in the present study
Detection by
Origin
conv-PCRa
Species
Isolate no.
Q-PCRb
Alternaria brassicae
Bre14
Radish seed
+
+ A. brassicae
Bre16
Radish
seed
+
+ A. brassicae
Bre39
Radish seed
+
+ A. brassicae
Bre103
Radish seed
+
+ A. brassicae
Bre112
Radish seed
+
+ A. brassicicola
Bra3
Radish seed
A. brassicicola
Bra18
Radish seed
A. brassicicola
Bra40
Radish seed
A.
brassicicola
Bra41
Radish seed
A. brassicicola
Bra43
Radish
seed
A. japonica
Jap4
Radish seed
A. japonica
Jap19
Radish seed
A. japonica
Jap52
Radish seed
A. japonica
Jap63
Radish seed
A. japonica
Jap108
Radish seed
A. alternata
Alt62
Radish seed
A. alternata
R7404
Cabbage seed
A . dauci
R9228
Cress seed
nt
sp.
Fu6
Phoma sp.
Cabbage seed
C27381
Cabbage seed
S. botryosum
Botrytis cinerea
BC40
Sunflower seed
Radish seed
Fusarium sp.
Fu7
Pho1
Radish seed
Penicillium sp.
Aspergillus sp.
A2
Cabbage seed
R7410
nt Fusarium
Radish seed
P1
Verticillium sp.
a
b
V1
Tomato seed
nt
conv-PCR refers to conventional polymerase chain reaction (PCR) with the ABCsens-ABCrev primer set.
Q-PCR refers to real-time PCR with the 115sens-115rev primer set; + = amplification, = no ampli- fication, and nt = not tested.
temperature profiles of the PCR products at the end of the cycling reactions were determined with samples containing A. brassicae DNA.
A single dissociation peak of increased fluorescence was obtained for the specific 115sens-115rev primer at a melting temperature of 83 to
84C (data not shown). This indicated that the specific amplification obtained did not involve cross hybridization with other A.
brassi- cae-related sequences or the formation of primer dimers.
492
PCR detection in seed samples. In a preliminary experiment, the PCR detection test was applied to radish and cabbage seed batches
artificially contaminated with A. brassicae (isolate Bre112). DNA was extracted from the different seed samples and used as a template in
PCR experiments with either the ABCsens-ABCrev primer pair (standard assays) or the 115sens115rev primer pair (real-time PCR). In the latter case, parallel experiments with serial dilutions of a calibrated A. brassicae DNA extract
were carried out. A. brassicae was detected using the conventional PCR pro- cedure in all contaminated seed batches (Fig. 3), even at
contamination levels as low as 5% (Fig. 3B). As expected, a sig- nal also was observed with the positive control (DNA extracted from a
mycelial pure culture of the A. brassicae isolate) but not with the negative control (disin- fected seed). Amplifications using the
universal ITS1/ITS2 primer pair were successful with all samples, indicating that the extracted DNA was suitable for PCR (Fig. 3A).
No fungal growth was observed with disinfected seed plated on solid growth medium; therefore, the sig- nal obtained with these seed after
amplifi- cation with the nonspecific primers probably originated from co-extracted host plant DNA.
When real-time PCR was used with se- rial dilutions of an A. brassicae DNA cali- brated extract as template, a standard curve was plotted
using known amounts of A. brassicae DNA against the CT calculated with ABI Prism 7000 sequence detection system (SDS) software (Fig.
4). This curve revealed that the primer set used in this experiment was quite accurate over a linear range of at least 3.5 orders of magnitude
and that the correlations between CT and DNA quantities were high (R2 = 0.986). The mean CT values obtained with 100 and
10% artificially contaminated radish seed batches were 25.56 and 32.55, respec- tively, corresponding to approximately 250 and 3.5 pg of A.
brassicae DNA, respec- tively.
These results were obtained with artifi- cially contaminated seed free of other fun- gal or bacterial contaminations. It was then necessary to
check this molecular diagno- sis approach with cabbage and radish seed naturally contaminated with pathogenic Alternaria spp. Six different
seed lots were tested (Table 2). Infection levels were de- termined on 200 seed using the standard plating technique. Amplifications using the
nonspecific ITS1-ITS2 primer pair were successful with all DNA extracted from samples, indicating that this DNA was suitable for
further amplifications (Fig.
5B). When the ABCsens/rev primer pair
Real-time PCR was carried out with samples prepared with the six radish seed lots. Amplification curves were obtained only with DNA
extracted from lots C to F. Similar CT values (mean: 32.54) were noted for seed lots E and F (Fig. 4). This mean value is close to that
obtained with the 10% artificially contaminated seed batch. The CT value for seed lot C, with an A. brassicae infection level of 2%, was
34.28.
DISCUSSION
Conventional tests used to detect A. brassicae in seed involve a combination of pathogenicity assays and morphological characterization.
However, the drawback of such methods is that accurate pathogen identification can be difficult and time- consuming. Hence, there is an
urgent need for a sensitive and rapid test that could
detect seedborne A. brassicae. With ad- vances in molecular biology, most recently developed techniques for microorganism detection
involve PCR analysis. The ad- vantages of PCR-based assays include specificity, sensitivity, and speed. Hence, such assays have been
designed for the detection of various plant pathogens, in- cluding seedborne fungi (22,24). A few PCR-based methods have already been
reported for the detection of Alternaria spp. on carrot (12,19), linseed (15), and cruciferous (8) seed, as well as in host tissues (15) or food
products (32). The ITS region of nuclear rDNA (8,12,15,32) is the main genomic region targeted for PCR primer development. Recently,
Iacomi- Vasilescu et al. (8) reported a sensitive and rapid PCR diagnostic assay for the identi- fication of A. brassicicola and A. japonica on
cruciferous seed. Nevertheless, the ITS
was used, A. brassicae contaminations up to 3% (seed lot D) were detected (Fig. 5A). No amplification signal was obtained with DNA
extracted from the A, B, and C seed lots.
Fig. 2. Gel electrophoresis of polymerase chain reaction products obtained with the ABCsens/rev
diagnostic primers and DNA extracted from pure cultures of various Alternaria brassicae isolates or from pure cultures of A, A. brassicicola isolates or B, A.
japonica isolates or C, isolates from different fungal species recovered from seed. Numbers above the gels correspond to isolate identification codes as
described in Table 1. M lanes were loaded with a DNA ladder (SmartLadder Classic, Eurogentec, Belgium).
Plant Disease / May 2004
493
primers designed in this study for A. bras- sicae were found to be not very specific because amplification signals were consis- tently obtained
with DNA from some A. japonica isolates.
In the present study, we used two primer sets, highly specific to A. brassicae, de- signed from two clustered genes corre- sponding to an
NRPS gene and an ABC transporter gene. These two genes may produce and secrete factors associated with the virulence of the fungal
pathogen (i.e., host-specific peptidic toxins or sideropho- res).
The conventional PCR-based seed assay that we developed specifically detects the presence of A. brassicae in cruciferous seed, even at
infection levels as low as 3% and after only 2 days of incubation. The first major obstacle that we had to over- come was the low levels of
target DNA from the fungi. An incubation of 48 h in MDP liquid nutritive medium was suitable to obtain an optimal increase of the fungal
biomass (8); therefore, the amount of fun- gal genomic DNA recovered generally was sufficient for amplification of the target
Fig. 4. Standard curve of Alternaria brassicae DNA concentration standards against the cycle thresh- old (CT). CTs were determined, using real-time PCR
and 115sens/rev diagnostic primers, as the cycle at which the fluorescent signal exceeded background fluorescence. CTs obtained with DNA extracted from
100% () and 10% () artificially contaminated radish seed or 10% naturally infected radish seed () are indicated on the plot.
Fig. 3. Gel electrophoresis of polymerase chain reaction products obtained with internal transcribed spacer (ITS) 1/2 universal primers or ABCsens/rev
diagnostic primers and DNA extracted from seed artificially infected with Alternaria brassicae. Seed contamination levels are indicated above the gels.
Lanes labeled T+ were loaded with DNA extracted from a pure culture of A. brassicae and lanes labeled M were loaded with a DNA ladder (SmartLadder
Classic, Eurogentec, Seraing, Belgium).
494
DNA sequences. The nutritive medium used for macerating seed was chosen on the basis of our previous observations. Two other
liquid incubation media (i.e., clari- fied V8 broth and CW; 30), also were tested by Iacomi-Vasilescu et al. (8). Simi- lar results were
obtained with MDP or V8 media, but MDP was preferred because of easier handling during a subsequent filtra- tion step, whereas no signal
was obtained with the CW medium. PCR inhibitors
represent another obstacle commonly en- countered when conducting assays using complex samples (3,9). These inhibitors often have seed
component origins (19). In this study, the seed were removed after incubation and prior to DNA extraction and fungal mycelia and conidia
were col- lected using a spin filter unit. For technical reasons (e.g., size of the spin filter), we used seed batches containing only 100 seed.
Thus, infection levels lower than 3%
were not detected with good repeatability. In the original PCR diagnostic method described for A. japonica and A. brassici- cola (8), phenolchloroform extraction followed by an isopropanol precipitation step were sufficient to obtain a crude DNA preparation that subsequently
could be used as template for amplification without any further treatment. In the present work, we demonstrated that this DNA isolation
procedure could be replaced successfully
Table 2. Infection level (%) of seed lots naturally infected with pathogenic Alternaria spp. used in the present study
Infection level (%) of seed lot number
Fungal species
Alternaria brassicae
A. brassicicola
A. japonica
A. alternata
Fusarium sp.
Phoma sp.
A (cabbage)
B (radish)
C (radish)
D (radish)
E (radish)
F (radish)
0
8
0
19
2
1
0
0
1
39
0
0
2
0
0
11
0
0
3
0
0
38.5
1
1.5
9.5
0
0
27
0
0
10
0
0
13.5
0.5
0
Fig. 5. Gel electrophoresis of polymerase chain reaction products obtained with A, ABCsens/rev diagnostic primers or B, internal transcribed spacer (ITS)
1/2 universal primers and DNA extracted from seed. Samples were prepared with seed naturally infected with Alternaria spp. from seed lots A to E. Lanes
labeled T+ were loaded with DNA extracted from a pure culture of Alternaria brassicae and lanes labeled M were loaded with a DNA ladder (SmartLadder
Classic, Eurogentec, Seraing, Belgium).
Plant Disease / May 2004
495
by treating the fungal mycelium with a lysis buffer initially designed for process- ing food samples, and purifying DNA us- ing an
affinity-based method with silica membranes from a commercial kit. This DNA extraction procedure potentially could be used for
routine analysis of seed lots and is amenable to automation. In the same vein, routine analyses require an alternative method for
electrophoretic separation of the amplification products. Our preliminary results with real-time PCR using SYBR green are encouraging.
This fluorescent reporter dye binds double- stranded DNA; therefore, increasing fluo- rescence may be monitored continuously during the
amplification procedure, thus eliminating the need for post-PCR analy- sis. Real-time PCR assays have been im- plemented for the detection
of fungal plant pathogens in several recent studies (2,5,13,29,31). This technique should soon be useful for seed health testing, and Tay- lor et
al. (23) already have used it for the detection of Microdochium nivale in wheat seed. We showed here that rapid and spe- cific detection of A.
brassicae is possible using real-time PCR in the presence of SYBR green with a primer set designed from an NRPS gene sequence. This
primer set gave satisfactory results with a wide range of target DNA concentrations, thus allowing accurate quantification of seed
infection levels. We obtained similar CT values with DNA extracted from naturally contaminated seed (10% infection, as esti- mated by the
standard plating method) or from seed artificially infected with A. brassicae at a level of 10%. Real-time PCR was found to be more
sensitive than the standard amplification procedure, and a successful amplification was obtained with a seed lot with 2% A. brassicae infection. According to the Internal Seed Testing Association, this corresponds to the maximal level of infection of com- mercial
cruciferous seed by pathogenic Alternaria spp.
The PCR diagnosis method described here, which combines DNA extraction from seed using the Nucleospin Food kit and real-time
PCR in the presence of SYBR green and primers designed from an NRPS gene, is readily amenable to auto- mation. With this method,
after ap- proximately 50 h, A. brassicae can be accurately and sensitively detected in in- fected seed. Homologous sequences have been
identified in the A. japonica and A. brassicicola genomes; therefore, the same method also may be applied for the detec- tion of these two
seed pathogens, provided that relevant primers are designed. More- over, although many tests probably will be necessary to accurately
correlate the amount of DNA extracted from infected seed and their level of infection (particularly when testing seed lots with very low
infection levels), it should be
possible to further develop this method to make it quantitative.
ACKNOWLEDGMENTS
We thank the Agence Universitaire de la Fran- cophonie for providing B. Iacomi-Vasilescu with a post-doctoral fellowship.
LITERATURE CITED
1. Babadoost, M., Gabrielson, R. L., Olson, S.
A., and Mulanax, M. W. 1993. Control of Al- ternaria disease of brassica seed crops caused by Alternaria brassicae and Alternaria brassi- cicola with ground and
aerial fungicide appli- cations. Seed Sci. Technol. 21:1-7.
2. Cullen, D. W., Lees, A. K., Toth, I. K., and Duncan, J. M. 2002. Detection of Colleto- trichum coccodes from soil and potato tubers by conventional PCR and
quantitative real- time PCR. Plant Pathol. 281-292.
3. De Boer, S. H., Ward, L. J., Li, X., and Chitta- ranjan. 1995. Attenuation of PCR inhibition in the presence of plant compounds by addition of BLOTTO. Nucleic
Acids Res. 23:25672568.
4. Fernandez, D., Ouinten, M., Tantaoui, A., Geiger, J. P., Daboussi, M. J., and Langin, T.
1998. Fot 1 insertions in the Fusarium ox- ysporum f. sp. albedinis genome provide diag- nostic PCR targets for detection of the date palm pathogen. Appl.
Environ. Microbiol.
64:633-636.
5. Frederick, R. D., Snyder, K. E., Tooley, P. E., Berthier-Schaad, Y., Peterson, G. B., Bonde, M. R., Schaad, N. W., and Knorr, D. A. 2000. Identification and
differentiation of Tilletia in- dica and T. walkeri using the polymerase chain reaction. Phytopathology 90:951-960.
6. Goodwin, D. C., and Lee, S. B. 1993. Micro- wave miniprep of total genomic DNA from fungi, plants, protists and animals for PCR. Biotechniques 15:438-444.
7. Iacomi-Vasilescu, B., Avenot, H., Bataill- Simoneau, N., Laurent, E., Gunard, M., and Simoneau, P. In vitro fungicide sensitivity of Alternaria species pathogenic
to crucifers and identification of Alternaria brassicicola field isolates highly resistant to both dicarboximides and phenylpyrroles. Crop Prot. In press.
8. Iacomi-Vasilescu, B., Blancard, D., Gunard, M., Molinero-Demilly, V., Laurent, E., and Simoneau, P. 2002. Development of a PCR- based diagnostic assay for
detecting patho- genic Alternaria species in cruciferous seeds. Seed Sci. Technol. 30:87-95.
9. Jobes, D. V., Hurley, D. L., and Thien, L. B.
1995. Plant DNA isolation: a method to effi- ciently remove polyphenolics, polysaccha- rides, and RNA. Taxon 44:379-386.
10. Johnson, R. D., Johnson, L., Kohomoto, K., Otani, H., Lane, C; R., and Kodama, M. 2000. A Polymerase Chain Reaction-based method to specifically detect
Alternaria alternata ap- ple pathotype (A. mali), the causal agent of Al- ternaria blotch of apple. Phytopathology
90:973-976.
11. Joly, P. 1964. Le genre Alternaria. (The Genus
Alternaria). P. Lechevalier Press, Paris.
12. Konstantinova, P., Bonants, P. J. M., Van Gent- Pelzer, M. P. E., Van der Zouwen, P., and Van den Bulk, R. 2002. Development of specific primers for detection and
identification of Al- ternaria spp. in carrot material by PCR and comparison with blotter and plating assays. Mycol. Res. 106:23-33.
13. Lees, A. K., Cullen, D. W., Sullivan, L., and Nicolson, M. J. 2002. Development of conven- tional and real-time PCR assays for the detec- tion and identification of
Rhizoctonia solani AG-3 in potato in soil. Plant Pathol. 51:293302.
14. Li, K. N., Rouse, D. I., and German, T. L.
1994. PCR primers that allow intergeneric dif- ferentiation of ascomycetes and their applica- tion to Verticillium spp. Appl. Environ. Micro- biol. 60:4324-4331.
15. McKay, G. J., Brown, A. E., Bjourson, A. J., and Mercer, P. C. 1999. Molecular charaterisa- tion of Alternaria linicola and its detection in linseed. Eur. J. Plant
Pathol. 105:157-166.
16. Neegard, P. 1945. Danish Species of Alter- naria and Stemphylium. Oxford University Press, London.
17. Niessen, M. L., and Vogel, R. F. 1998. Group specific PCR-detection of potential trichothe- cene-producing Fusarium-species in pure cul- tures and cereal
samples. Syst. Appl. Micro- biol. 21:618-631.
18. Nishimura, S., and Kohmoto, K. 1983. Host- specific toxins and chemical structures from Alternaria species. Annu. Rev. Phytopathol.
21:87-116.
19. Pryor, B. M., and Gilbertson, R. L. 2001. A PCR-based assay for detection of Alternaria radicina on carrot seed. Plant Dis. 85:18-23.
20. Rude, S. K., Duczek, L. J., and Seidle, E.
1999. The effect of Alternaria brassicae, Al- ternaria raphani and Alternaria alternata on seed germination of Brassica rapa canola. Seed Sci. Technol. 27:795798.
21. Shrestha, S. K., Mathur, S. B., and Munk, L.
2000. Alternaria brassicae in seeds of rape- seed and mustard, its location, transmission from seeds to seedling and control. Seed Sci. Technol. 28:75-84.
22. Smith, O. P., Peterson, G. L., Beck, R. J., Schaad, N. W., and Bonde, M. R. 1996. Devel- opment of a PCR-based method for identifica- tion of Tilletia indica,
causal agent of Karnal bunt of wheat. Phytopathology 86:115-122.
23. Taylor, E., Bates, J., Kenyon, D., Maccaferri, M., and Thomas, J. 2001. Modern molecular methods for characterization and diagnosis of seed-borne fungal
pathogens. J. Plant Pathol.
83:75-81.
24. Taylor, J. L. 1993. A simple, sensitive, and rapid method for detecting seed contaminated with highly virulent Leptosphaeria maculans. Appl. Environ.
Microbiol. 59:3681-3685.
25. Tewari, J. P. 1991. Structural and biochemical bases of the blackspot disease of crucifers. Adv. Struct. Biol. 1:325-349.
26. Verma, P. R., and Saharan, G. S. 1994. Mono- graph of Alternaria diseases of Crucifers. In: Saskatoon Research Centre Technical Bulletin
1994-6E. Agriculture and Agri-Food Canada, Saskatoon, SK, Canada.
27. Walton, J. D. 1996. Host-selective toxins: Agents of compatibility. Plant Cell 8:17231733.
28. White, T. J., Bruns, T., Lee, S., and Taylor, J.
1990. Amplification and direct sequencing of fungal ribosomal genes for phylogenetics. In: PCR protocols: A guide to methods and appli- cations. Academic Press.
San Diego, CA.
29. Winton, L. M., Stone, J. K., Watrud, L. S., and Hansen, E. M. 2002. Simultaneous one-tube quantification of host and pathogen DNA with real-time polymerase
chain reaction. Phytopa- thology 92:112-116.
30. Wu, W. S., and Chen, T. W. 1999. Develop- ment of a new selective medium for detecting Alternaria brassicicola in cruciferous seeds. Seed Sci. Technol.
27:397-409.
31. Zhang, A. W., Hartman, G. L., Curio-Penny, B., and Becker, K. B. 1999. Molecular detec- tion of Diaporthe phaseolorum and Phomopsis longicolla from
soybean seeds. Phytopa- thology 89:796-804.
32. Zur, G., Hallerman, E. M., Sharf, R., and Kashi, Y. 1999. Development of a Polymerase Chain Reaction-based assay for the detection of Alternaria fungal
contamination in food products. J. Food Prot. 62:1191-1197.
496
ESPAOL
Pgina 1
mtodo basado en la PCR en tiempo que aqu se presenta se puede automatizar fcilmente y los
resultados preliminares indican que es eficaz para la estimacin cuantitativa de las semillas
infeccin.
Palabras clave adicionales: ABC transportador, diagnstico molecular, no ribosomal pptido
sintasa
semillas (1), lo que complica patgeno identificacin. Algunos aislamientos esporulan
escasamente o producen micelio estril bajo laboratorio
condiciones. La identificacin morfolgica es imposible cuando esto ocurre.
Enfoques moleculares, principalmente la reaccin en cadena de la polimerasa (PCR), con
frecuencia se han utilizado como herramientas para la deteccin de numerosos
hongos patgenos (4,14,17). Un ensayo de PCR sensible y rpido, basado en la amplificacin
de secuencias del espaciador transcrito interno (ITS)
regiones del ADN ribosomal, recientemente se ha desarrollado para
detectar A. brassicicola o A. cin japonica infeccin de las semillas de las crucferas (8).
Desafortunadamente, este mtodo no gener un diagnstico fiable cuando estaban
contaminados de semillas
con un. brassicae porque reacciones cruzadas
con otras especies de hongos en otro tiempo estabais
observado.
El gnero Alternaria comprende saproftico y especies patgenas de hongos filamentosos tous. Patgenos de las plantas de este
gnero tienen una gama de huspedes distinta y limitada. Ha sido
sugiere fuertemente que tanto la virulencia y especificidad de acogida son parte de- pendiente
de la produccin de toxinas especficas de servidor (HSTS; 18,27). La
complejo de tres especies, A. brassicae, A. brassicicola, y A. japonica (anteriormente
llamado A. raphani), es el responsable del punto negro
enfermedad de las crucferas y se transmite por la semilla de muchas especies pertenecientes a
los gneros Brassica y Raphanus. La enfermedad es de gran
importancia en crucferas cultivadas en todo el mundo, con la mayora de cultivares
comerciales siendo susceptible (25). Ocurre en todo el crecimiento planta husped
etapas, en las partes areas, y es identificable por lesiones negras, a menudo rodeados por
zonas clorticas (26). La enfermedad tambin puede ser destructivo
para los productores de semillas porque la infeccin a menudo conduce a aicos pod prematuro
y semilla arrugada, con una eficiencia de germinacin alterada, como
observado en varios hosts de crucferas, tales como Brassica juncea,
B. campestris, y B. rapa (20,21). La enfermedad mancha negra en
una seria reduccin de los rendimientos de los cultivos, como la reduccin de la calidad del
mercado de cabezas de coliflor y la calidad del aceite en la familia Brassicaceae oleaginosa
especies. Los hongos pasan el invierno en los residuos infectados de cultivos, semillas y
cualquier especie de malezas crucferas relacionadas. Pueden ser transmitidos por semilla a
travs de micelios
dentro de la semilla o esporas de transitorios en la superficie de la semilla. Las esporas son
fcilmente arrastrados por el viento y pueden dispersarse a grandes distancias pasantes a cabo
la
estacin de crecimiento.
4
)2SO4
, 0,01% (peso / vol)
, 200 mM de cada trifosfato cleotide desoxirribonucletidos, y 1 unidad de ADN polimerasa
ter- resistente a la deformacin .
Un termociclador se utiliz por 3 min a 95 C; seguido por 35 ciclos de 30s a 95 C, 50 s a
60 C y 1 min a 72 C; y una etapa final de 10 min a 72 C.
Los resultados se visualizaron despus de la electroforesis de una alcuota
Fig. 1. Gel de electroforesis de los productos de reaccin en cadena de la polimerasa
obtenida con espaciador transcrito interno (ITS) 1/2 cebadores universales y con
Page 3
Deteccin por
Especies
Aislar no.
Origen
CONV-PCR
un
Q-PCR
b
Alternaria brassicae
Bre14
Semilla de rbano
+
+ A. brassicae
Bre16
Rbano
semilla
+
+ A. brassicae
Bre39
Semilla de rbano
+
+ A. brassicae
Bre103
Semilla de rbano
+
+ A. brassicae
Bre112
Semilla de rbano
+
+ A. brassicicola
Bra3
Semilla de rbano
- A. brassicicola
Bra18
Semilla de rbano
- A. brassicicola
Bra40
Semilla de rbano
- A.
brassicicola
Bra41
Semilla de rbano
- A. brassicicola
Bra43
Rbano
semilla
- A. japonica
Jap4
Semilla de rbano
- A. japonica
Jap19
Semilla de rbano
- A. japonica
Jap52
Semilla de rbano
- A. japonica
Jap63
Semilla de rbano
- A. japonica
Jap108
Semilla de rbano
- A. Alternaria
Alt62
Semilla de rbano
- A. Alternaria
R7404
Semillas de col
- A. dauci
R9228
Semillas de berro
Nuevo Testamento
otra Alternaria patgena crucferas
2A y 2B), con no patgeno A. alternativas hongos ensayados nata u otros (Fig. 2C). Seales se
obtuvieron con todos los hongos ensayados cuando el
universal de par de cebadores ITS1-ITS2 se utiliz como un control de la calidad del
ADN (datos no mostrados).
La especificidad de los cebadores de PCR en tiempo real se comprob usando 100 pg de ADN
extrado de cultivos puros de hongos listados en la Tabla 1. Todos
de los hongos seleccionados origi- nado a partir de semillas de las crucferas. No hay seal
fluorescente creciente exceda la fluorescencia de fondo (lnea de base
umbral) se observ excepto cuando A. ADN brassicae fue utilizado como plantilla. En ese
caso, las curvas de amplificacin fluorescentes estndar
que representa un crecimiento exponencial de productos de PCR fueron grabadas y una media
26.65
Stemphylium botryosum
C27381
Semillas de col
- S. botryosum
R7410
Semillas de col
- Botrytis cinerea
FC40
Semilla de girasol
nt Fusarium
sp.
FU6
Semilla de rbano
- Fusarium sp.
FU7
Semilla de rbano
- Phoma sp.
Pho1
Semilla de rbano
- Penicillium sp.
P1
Semillas de col
- Aspergillus sp.
A2
Semillas de col
Pgina 4
Verticillium sp.
V1
Tomate de semillas
Nuevo Testamento
un
conv-PCR se refiere a la reaccin en cadena de la polimerasa convencional (PCR) con el
conjunto de cebadores ABCsens-ABCrev.
b
Q-PCR se refiere a la PCR en tiempo real con el conjunto de cebadores 115sens-115rev; + =
Amplificacin, - = sin amplificacin, y nt = no ensayado.
perfiles de temperatura de los productos de PCR en el extremo de las reacciones cclicas se
determinaron con muestras que contienen A. ADN brassicae. La
pico disociacin solo del aumento de la fluorescencia se obtuvo para el cebador especfico
115sens-115rev a una temperatura de fusin de 83 a
lotes de semilla fueron probados (Tabla 2). Los niveles de infeccin eran de- minada de 200
semillas utilizando la tcnica de recubrimiento estndar. Ampliaciones utilizando el
inespecfica par de cebadores ITS1-ITS2 tuvieron xito con todo el ADN extrado de muestras,
lo que indica que este ADN era adecuado para
amplificaciones adicionales (Fig.
5B). Cuando el ABCsens / par de cebadores rev
PCR en tiempo real se llev a cabo con muestras preparadas con los seis lotes de semillas de
rbano. Curvas de amplificacin se obtuvieron solamente con DNA
extrado de lotes C a F. Similar C
T
Se tom nota de los lotes de semillas E y F (Fig. 4): valores (32,54 media). Este valor medio es
similar a la
obtenido con el 10% contaminado artificialmente por lotes de semillas. El C
T
valor para el lote de semillas C, con una A. nivel de infeccin brassicae del 2%, fue
34.28.
DISCUSIN
Las pruebas convencionales utilizan para detectar A. brassicae en las semillas de implicar una
combinacin de ensayos de patogenicidad y la caracterizacin morfolgica.
Sin embargo, el inconveniente de tales mtodos es que la identificacin de patgenos exacta
puede ser difcil y consume mucho tiempo. Por lo tanto, hay una
urgente necesidad de una prueba sensible y rpido que pude
detectar transmitida por semilla A. tcnicas brassicae. Con ad- adelantos en biologa molecular,
desarrollados ms recientemente para la deteccin de microorganismos
involucrar a anlisis de PCR. Las ventajas de los ensayos basados en PCR incluyen
especificidad, sensibilidad y velocidad. Por lo tanto, tales ensayos han sido
diseado para la deteccin de varios patgenos de plantas, hongos in- transmitida por semilla
INCLUYENDO (22,24). Unos mtodos basados en PCR ya han sido
reportado para la deteccin de Alternaria spp. en la zanahoria (12,19), semillas de lino (15), y
crucferas (8) de semillas, as como en los tejidos del husped (15) o comida
productos (32). La regin ITS del ADNr nuclear (8,12,15,32) es la principal regin genmica
especfica para el desarrollo de cebadores de PCR. Recientemente,
Iacomi- Vasilescu et al. (8) report un ensayo de diagnstico PCR sensible y rpido para la
identificacin de A. brassicicola y A. japonica en
semillas de crucferas. Sin embargo, el ITS
se utiliz, A. Se detectaron contaminaciones brassicae hasta 3% (semilla lote D) (Fig. 5A). No
hay seal de amplificacin se obtuvo con el ADN
extrado de los lotes de semillas A, B y C.
Fig. 2. Gel de electroforesis de los productos de reaccin en cadena de la polimerasa obtenida
con el ABCsens / rev
cebadores de diagnstico y ADN extrado de cultivos puros de varios aislamientos
de Alternaria brassicae o a partir de cultivos puros de A, A. brassicicola asla o B, A.
japonica asla o C, aislados de diferentes especies de hongos recuperados a partir de
semillas. Los nmeros encima de los geles corresponden a aislar cdigos de identificacin
como
Secuencias de ADN. El medio nutritivo utilizado para las semillas de maceracin fue elegido
sobre la base de nuestras observaciones anteriores. Otros dos lquidos
medios de incubacin (es decir, clari- caldo V8 cado y CW, 30), tambin fueron probados por
Iacomi-Vasilescu et al. (8). Se obtuvieron resultados simi- lares
con MDP o medios V8, pero MDP se prefiere debido a un manejo ms fcil durante una etapa
de filtracin posterior, mientras que no hay seal era
obtenida con el medio de CW. Inhibidores de la PCR
representar un obstculo ms comnmente ES- contrarrestado cuando se realizan ensayos con
muestras complejas (3,9). Estos inhibidores tienen a menudo semilla
orgenes de componentes (19). En este estudio, la semilla se retiraron despus de la incubacin
y antes de la extraccin de ADN y micelios fngicos y conidios
se recopilaron utilizando una unidad de filtro giratorio. Por razones tcnicas (por ejemplo, el
tamao del filtro giratorio), se utiliz los lotes de semillas que contienen slo 100 semillas.
Por lo tanto, los niveles de infeccin menor que 3%
no se detectaron con una buena repetibilidad. En el mtodo de diagnstico de PCR original
descrito por A. japonica y A. brassici- cola (8), fenolextraccin con cloroformo seguido por una etapa de precipitacin con isopropanol fueron
suficientes para obtener una preparacin de ADN crudo que posteriormente
podra ser utilizado como molde para la amplificacin sin ningn tratamiento adicional. En el
presente trabajo, hemos demostrado que este aislamiento de ADN
procedimiento podra ser reemplazado con xito
Tabla 2. Nivel de Infeccin (%) de los lotes de semillas naturalmente infectado con
patgeno Alternaria spp. utilizado en el presente estudio
Nivel de Infeccin (%) de semillas de nmero de lote
Especies de hongos
A (col)
B (rbano)
C (rbano)
D (rbano)
E (rbano)
F (rbano)
Alternaria brassicae
0
0
2
3
9.5
10
A. brassicicola
8
0
0
0
0
0
A. japonica
0
1
0
0
0
0
A. alternata
19
39
11
38.5
27
13.5
Fusarium sp.
2
0
0
1
0
0.5
Phoma sp.
1
0
0
1.5
0
0
Fig. 5. Gel de electroforesis de los productos de reaccin en cadena de la polimerasa obtenidos
con A, ABCsens / rev cebadores o B de diagnstico, espaciador transcrito interno (ITS)
Medio cebadores universales y ADN extrados de la semilla. Las muestras se prepararon con
semillas naturalmente infectados con Alternaria spp. de lotes de semillas de A a E. Lanes
Pgina 7
3. De Boer, SH, Ward, LJ, Li, X. y Chitta- ranjan. 1995. La atenuacin de inhibicin de la PCR
en presencia de compuestos de la planta mediante la adicin de BLOTTO. Nucleico
Acids Res. 23: 25672568.
4. Fernndez, D., Ouinten, M., Tantaoui, A., Geiger, JP, Daboussi, MJ, y Langin, T.
1998. Fot 1 inserciones en el Fusarium ox- ysporum f. sp. albedinis genoma proporcionar
diagnsticos objetivos de PCR diag- para la deteccin del patgeno palmera datilera. Appl.
Environ. Microbiol.
64: 633-636.
5. Frederick, RD, Snyder, KE, Tooley, PE, Berthier-Schaad, Y., Peterson, GB, Bonde, MR,
Schaad, NW, y Knorr, DA 2000. Identificacin y
diferenciacin de dica Tilletia dentro y T. walkeri utilizando la reaccin en cadena de la
polimerasa. Fitopatologa 90: 951-960.
6. Goodwin, DC, y Lee, SB 1993. Micro onda miniprep de ADN genmico total de hongos,
plantas, protistas y animales para la PCR. Biotechniques 15: 438-444.
7. Iacomi-Vasilescu, B., Avenot, H., Bataill- Simoneau, N., Laurent, E., Gunard, M., y
Simoneau, P. In vitro fungicida sensibilidad de las especies de Alternaria patgeno para
crucferas y la identificacin de campo brassicicola Alternaria aislados altamente resistentes a
ambos dicarboximidas y fenilpirroles. Crop Prot. En prensa.
Ensayo de diagnstico 8. Iacomi-Vasilescu, B., Blancard, D., Gunard, M., Molinero-Demilly,
V., Laurent, E., y Simoneau, P. 2002. Desarrollo de una PCR basada en
detectar las especies de Alternaria patgenas en semillas crucferas. Seed Sci. Technol. 30: 8795.
9. Jobes, DV, Hurley, DL, y Thien, LB
1995. Aislamiento de ADN de la planta: un mtodo para eliminar eficientemente polifenoles,
polisacridos y ARN. Taxn 44: 379-386.
10. Johnson, RD, Johnson, L., Kohomoto, K., Otani, H., Lane, C; R., y Kodama, M. 2000. Un
mtodo basado en la reaccin en cadena de polimerasa para detectar especficamente
Alternaria alternata ple AP- patotipo ( A. mali ), el agente causal de Al- ternaria mancha de
manzana. Fitopatologa
90: 973-976.
11. Joly, P. 1964. Le gnero Alternaria . (El gnero
Alternaria ). P. Lechevalier Press, Pars.
12. Konstantinova, P., Bonants, PJM, Van Gent- Pelzer, MPE, Van der Zouwen, P., y Van den a
granel, R. 2002. Desarrollo de cebadores especficos para la deteccin y
identificacin de Al- ternaria spp. en el material de zanahoria por PCR y la comparacin con
los ensayos de papel secante y galvanoplastia. Mycol. Res. 106: 23-33.
13. Lees, AK, Cullen, DW, Sullivan, L., y Nicolson, MJ 2002. Desarrollo de la convencional y
ensayos de PCR en tiempo real para la deteccin e identificacin de
Rhizoctonia solani AG-3 en la papa en el suelo. Pathol Planta. 51: 293302.
14. Li, KN, Rouse, DI, y el alemn, TL
1994. Los cebadores de PCR que permiten la diferenciacin intergenrica de ascomicetos y de
su aplicacin a Verticillium spp. Appl. Environ. Biol Micro. 60: 4324-4331.
15. McKay, GJ, Brown, AE, Bjourson, AJ, y Mercer, PC 1999. Molecular cin charaterisade Alternaria linicola y su deteccin en las semillas de lino. Eur. J. Plant
22. Smith, OP, Peterson, GL, Beck, RJ, Schaad, NW, y Bonde, MR 1996. el Desarrollo de un
mtodo basado en PCR para la identificacin de Tilletia indica , causal
agente del carbn parcial del trigo. Fitopatologa 86: 115-122.
23. Taylor, E., Bates, J., Kenyon, D., Maccaferri, M., y Thomas, J. 2001. mtodos moleculares
modernos para la caracterizacin y diagnstico de hongos transmitidos por la semilla
patgenos. J. Plant Pathol.
83: 75-81.
24. Taylor, JL 1993. Un mtodo simple, sensible y rpido para la deteccin de semillas
contaminadas con altamente virulentas maculans Leptosphaeria . Appl. Environ.
Microbiol. 59: desde 3.681 hasta 3.685.
25. Tewari, JP 1991. bases estructurales y bioqumicos de la enfermedad mancha negra de las
crucferas. Adv. Struct. Biol. 1: 325-349.
26. Verma, PR, y al sur del Sahara, GS 1994. mono- grfico de Alternaria enfermedades de las
crucferas. En: Saskatoon Research Centre Boletn Tcnico
1994-6E. Agricultura y Agroalimentacin de Canad, Saskatoon, SK, Canad.
27. Walton, JD 1996. toxinas en host selectiva: Agentes de compatibilidad. Plant Cell 8: 17231733.
28. Blanco, TJ, Bruns, T., Lee, S. y Taylor, J.
1990. La amplificacin y secuenciacin directa de los genes ribosomales hongos para la
filogentica. En: protocolos de PCR: Una gua de los mtodos y aplicaciones. Academic Press.
San Diego, CA.
29. Winton, LM, Piedra, JK, Watrud, LS, y Hansen, EM 2002. simultnea de un tubo de
cuantificacin de acogida y el ADN patgeno con la polimerasa en tiempo real
reaccin en cadena. Phytopa- tologa 92: 112-116.
30. Wu, WS, y Chen, 1999. TW