INTRODUCTION

Enzymes are biological molecules that belong to the family of proteins. They
have an important role in several biochemical functions, serving as natural catalysts that
act to lower the activation energy of specific reactions so that important metabolic
processes can occur at rates sufficient to sustain life (Brocklehurst). Dihydrofolate
reductase (DHFR) is an enzyme that catalyzes the reduction of 7,8-dihydrofolate to
5,6,7,8-tetrahydrofolate (THF). THF, the product of this metabolic pathway, is vital for
the synthesis of certain amino acids, purines and pyrimidines, which are precursors to
macromolecules such as proteins and nucleic acids (Schnell). Therefore, DHFR has an
indispensable role in the growth and proliferation of cells.
The inhibition of DHFR prevents deoxyribonucleic acid (DNA) synthesis by
depleting the building blocks required for their production (purines, pyrimidines)
(Mohebbi). Another result of DHFR inhibition, which leads to cell necrosis, is uracil
accumulation in mitochondrial DNA (mtDNA) (Anderson). Due to these results, DHFR is
an ideal target for antibiotic and anticancer drugs. Anticancer drugs such as metrotrexate
(MTX) and benzamine riboside, and antimicrobial agents such as trimethoprim act as
competitive inhibitors of DHFR(Martorell, Rousell), resulting in the inhibition of DNA
biosynthesis and eventually, cell death. Therefore, further study of the structure and
function of these inhibitors and their interactions with DHFR may lead to the discovery
of new antibiotic/anticancer drugs as well as increased knowledge and improved
efficiency of existing ones. Due to the promising results of DHFR inhibition, it has been
widely described as the 'enzyme of choice for all seasons and almost all
reasons'(Sharma).

Although promising, DHFR inhibition has a major setback. The clinical efficacy
of normally successful compounds can be compromised by resistance arising through
mutations at various sites on the enzyme. Certain mutations of DHFR can therefore
render several anticancer/antimicrobial compounds useless (Yuthavong).
The objective of this research project is to over-express, purify and crystallize
DHFR in order to screen for new inhibitor compounds to discover new marketable
anticancer/antimicrobial compounds (Vulcu). Techniques required for the overexpression, purification, characterization and finally crystallization of DHFR will be
described, as they will be vital towards producing large amounts of functional DHFR.
High quantities of high-quality DHFR can enable the use of screening methods (eg. highthroughput screening of compound collections) for inhibitors that may be novel and
increasingly effective antibiotics or anticancer drugs (Vulcu). Increased knowledge of
effective DHFR-inhibitor compounds would be invaluable to the field of oncology and
humankinds ongoing battle with cancer.

Flowchart of Experiments

Polymerase Chain Reaction (PCR) amplification of

Escherischia coli (E. coli) folA (1)
Restriction digest of PCR amplicon and pET28b vector with
NdeI and XhoI and Agarose Gel Electrophoresis (1)
DNA gel extraction and DNA ligation of folA into pET28b (1)

Transform ligation reactions into E. coli DH5 cells (1)

Isolate DNA via alkaline lysis (Minipreparations) (1)

Restriction digest of isolated vector with PvuI, NdeI & XhoI

and Agarose Gel Electrophoresis (2)
Grow E. coli BL21-DE3 cells (3) transformed with pET28bfolA on kanamycin medium (4)
Induce cells with Isopropyl -D-1-thiogalactopyranoside
(IPTG) at mid-log phase (5)
Lyse cells with Bugbuster (6)

Centrifuge sample and collect supernatant (7)

Perform Nickel-Nitrilotriacetic Acid (Ni-NTA) affinity column

chromatography with supernatant and buffer at pH=8 (8)
Determine protein concentration using Bradford Assay (9)

Determine relative purity of protein sample via

Sodium Dodecyl Sulfate Polyacrylamide Agarose Gel
Electrophoresis (SDS-PAGE) (10)
Crystallize His(6)-DHFR using broad crystallization screen (11)

Screen Canadian Compound Collection for compounds that

inhibit wild-type DHFR (12)
Perform Comparative Molecular Field Analysis (CoMFA) on
successful inhibitors (13)
High-Throughput Screening (HTS) of derived compounds on
His(6)-DHFR (14)
Clinical trial process on effective inhibitors (15)

Figure 1. Flow chart of experiments involved in the determination of novel inhibitors of DHFR. (1) Gene
cloning was performed on folA to generate a population of Escherichia coli BL21-DE3 cells containing a
pET28b vector including the gene of interest. (2) Restriction digests with PvuI (single) and NdeI & XhoI
(double) were performed to test for the presence of folA within the pET28b vector. (3) BL21-DE3 cells are
utilized because of lon- and omp-protease deficiency, protecting expressed DHFR from proteolytic
cleavage. (4) A Kanamycin medium is utilized to select for kanamycin-resistant cells that were successfully
transformed with pET28b-folA, which confers kanamycin resistance. (5) Induction with IPTG removes the
lac repressor from the lac operon and allow for translation of T7 RNA Polymerase, which will transcribe
folA. (6) Cells are lysed to extract expressed DHFR. (7) DHFR is present in the supernatant because it is a
cytosolic protein. (8) The His(6)-tag creates high affinity to the Ni-NTA column (purification), therefore
DHFR elutes last when an imidazole-based buffer is used. (9) (10) Determination of protein concentration
and relative purity of protein sample in elution fractions. (11) The Sitting Drop Method was employed for
the generation of crystals via precipitation out of solution using salt. (12) Screening performed to create a
collection of successful wild-type DHFR inhibitors. (13) Comparative Molecular Field Analysis (CoMFA)
can optimize the inhibitory efficiency of molecules based on successful DHFR inhibitors. (14) HighThroughput Screening of derived compounds on crystallized DHFR to determine strongest inhibitors. Other
factors (ie. Lipinskis* Rule of 5) taken into consideration to determine most useful compounds. (15) Most
suitable inhibitors are administered as drugs in clinical trials.

MATERIALS AND METHODS

Unless stated otherwise stated, all chemicals were obtained from Fermentas (ThermoLife Scientific). All centrifugations were done with the Eppendorf Microcentrifuge model
5415D. Water bath incubations were done using the PrecisionTM Scientific Water Bath.
All shaker incubations were done with the Lab-Line Environ Orbital Shaker.

PCR Amplification of E. coli folA

pMAC1-folA DNA sample, containing the gene of interest folA, was obtained from the
McMaster University Department of Biochemistry. pMAC1-folA was PCR amplified
using a forward primer from Mobix containing a NdeI restriction site (5
CGGCAGCCATATGATCAGTCTGATTGCGGC 3) and a reverse primer containing
XhoI restriction site (5 GTGCTCGAGCCGCCGCTCCAGAATCT 3). A PCR
amplification mixture was made to 50L in 200L thin walled sterile PCR tubes with
concentrations of: 10% V/V 10X Taq DNA polymerase buffer, 0.4mM dNTPs, 1M
forward primer, 1M reverse primer, 0.016g/L pMAC1-folA, 0.05U/L Taq DNA
Polymerase. Samples were then cycled for denaturation in an Eppendorf Master Cycler at
95 C for 30s, annealing at 62 C for 30s and elongation at 72 C for 60s, repeated 26
times, followed by a final elongation at 72 C for 10 minutes.
Digestion of folA and pET28b plasmid
Three samples were incubated for 45 minutes at 37C: 10L of folA PCR product with
restriction enzymes, 0.0791g/L pET28b with restriction enzymes, and 0.0791g/L
pET28b negative control without restriction enzymes. Samples were digested in a
mixture of total volume 25L containing working concentrations of: 1X Buffer O
(Thermo Scientific), and 0.4U/L Nde1 and 0.2U/L Xho1 when appropriate.
Agarose Gel Electrophoresis
Agarose gels were prepared (Voytas, 2001)1 under the following conditions: 1% Agarose,
1X TAE buffer, 1X GelRed (Biotium). Wells were loaded with 10L of digestion
products and 6X DNA loading buffer with a 1kb DNA ladder (GeneRuler) for reference.
Gels were run at 125V using a Sub-cell GT agarose gel electrophoresis system from BioRad for 40 minutes and then visualized using Kodak Gel Logic 100.

pET28b and folA Purification and Ligation

Digestion products of pET28b plasmid and folA from above were purified using
PureLink PCR Purification Kit described by PureLink PCR Purification Kit
(Invitrogen)2. Two ligation reactions were conducted with pET28b: one with and one
without purified folA to a total volume of 15L in H2O: 4L purified pET28b, 4L
purified folA (where appropriate), 1X T4 DNA ligase buffer, 0.033U/L T4 DNA
Ligase. Reactions were incubated overnight at 22C.
Transformation of Ligation Reactions
Chemically competent Escherichia coli DH5 cells were obtained from Invitrogen. 5L
of pET28b-folA and a folA -/- pET28b plasmids from above were added to 50L of
DH5 E. coli cells and incubated on ice for 30 minutes. Cell mixtures were then heat
shocked for 20s in a 42C water bath, and returned to ice. 450L of LB media was added
to each cell mixture and incubated in a cell shaker at 37C for 30 minutes. 100L of
transformation products were spread on LB agar plates with 50g/mL kanamycin for 10
minutes upright before overnight incubation at 37C. Colonies were then plated in new
LB+Kanamycin plates3.
Characterization of Transformed Plasmids
pET28b-folA plasmid was isolated and purified from transformed E. coli DH5 cells
using PureLink Quick Plasmid Miniprep Kits (Invitrogen)4 with Eppendorf Centrifuge
5415D. Plasmids were characterized using restriction enzyme mapping in either a double
digest, containing NdeI and Xho1, or a single digest with Pvu1 in a mixture of total
volume 50L. Double digests were incubated for 20 minutes at 37C with working
concentrations of: 10% V/V 10X Fast Digest Buffer (Invitrogen), 0.4U/L Xho1,
0.2U/L Nde1, 25L purified pET28b-folA. Single digests were incubated for 45 minutes
at 37C with working concentrations of: 10% V/V 10X Buffer R, 0.2U/L Pvu1, 25L
purified pET28b-folA. 20L of each digestion product + 4L of loading buffer, were
placed into agarose gel wells as prepared above and analyzed according to protocol
above.
Harvest of E. coli BL21-DE3 Cells
10 mL of LB media containing 0.05 mg/mL kanamycin (10 L of 50 mg/mL stock
solution) was inoculated with a single colony of E. coli BL21-DE3 cells harbouring the
pET28b-folA. This was allowed to grow in the incubators overnight at 37C, shaking at
200 rpm. 500 mL of the LB media containing 0.05 mg/mL of kanamycin was inoculated
with the 10 mL overnight starter culture the following morning. The cells were incubated
at 37C in the shaker at 200 rpm until O.D.600 reached 0.6. 3 mL of LB media containing
0.05 mg/mL of kanamycin media (reagent blank) was then placed in a Spec20 tube

(ThermoScientific). 3 mL of the inoculated culture was also placed in a Spec20 tube

ThermoScientific). The optical density of the E. coli cell was measured using the
Spectronic 20 spectrophotometer (Spec20) (ThermoScientific). The instrument was set to
zero absorbance with the previously prepared reagent blank. The culture was then
induced with 5 mL IPTG (0.1 M stock solution) to a final concentration of 1 mM when
the O.D.600 was between 0.6 and 0.8. The culture was incubated at 37C in the shaker at
200 rpm for 3.5 hours. 4 mL of the culture was then added to 4 labeled 1.5 mL
microcentrifuge tubes and centrifuged at 1000 rpm for 5 min. The medium was then
decanted and the supernatant discarded in a 50mL Falcon tubes for later disposal. The
4 mL transfer and decanting was then repeated. The cell pellets were then re-suspended
in 750 L/each of 0.85% V/V NaCl solution. The 1.5 mL microcentrifuge tubes were
then centrifuged at 13,500 rpm for 5 minutes. After centrifugation, the medium was then
carefully decanted and the pelleted cells were frozen at -20C for later use.

Bacterial Cell Lysis

After 7 days of harvesting, the frozen cell pellet was retrieved from the -20C freezer. 25
units/mL Benzoase 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1mM
benzamidine were added to the BugBuster reagent (Novagen), of which 500 L was
added to the cell pellet. The cell pellet was then re-suspended in the Bugbuster reagent
mixture using a micropipette. The re-suspended cells were then incubated at 22C for 20
minutes in the shaker at low speed. The lysed cells were then centrifuged at 16,000 x g
(13,131 rpm) for 10 minutes. The supernatant was transferred to a fresh microcentrifuge
tube, from which a sample was re-frozen at -20C. The remainder of the cell lysates were
placed in the -20C freezer for later use.
Purification of His(6)-DHFR
The top closure of the 1mL Nickel column was removed. 3 mL of water was pipetted
onto the side of the bed using a plastic transfer pipette to flush the storage solution (20%
ethanol). The column was drained into a waste beaker until approximately 1 mm of
buffer remained above the bed. 10 mL of the equilibration buffer (200 mM NaH2PO4, pH
8.0, 300 mM NaCl, 10 mM imidazole) was gently pipetted onto the side of the resin bed
using a plastic transfer pipette. The column was then drained into the waste beaker until
approximately 1 mm of buffer remained above the bed. The stopcock was closed. 20 L
of the cell lysate was kept aside and the remainder was applied onto the side of the resin
bed using a plastic transfer pipette. The waste beaker was placed under the column. The
stopcock was then opened. The flow rate was adjusted to approximately 1 mL/min. One 1
mL aliquot of the flow-through was collected in a 1.5 mL microcentrifuge tube. This tube
was labeled and frozen at -20C for future use. The column was drained and the flow
through was collected in the beaker until approximately 1 mm of buffer remained above

the bed. 3 mL of wash buffer (100 mM NaH2PO4, pH 8.0, 300 mM NaCl, 20mM
imidazole) was then gently pipetted onto the side of the resin bed using a plastic transfer
pipette. 3 mL of wash buffer was applied again, and each time one 1 mL aliquot of each
wash was collected in a 1.5 mL microcentrifuge tube which was labeled frozen at -20C
for future use. The column was then drained into the waste beaker until approximately 1
mm of buffer remained above the bed. 5 mL of elution buffer (100 mM NaH2PO4, pH
8.0, 300 mM NaCl, 250 mM imidazole) was added onto the centre of the column and five
1 mL fractions were collected into 1.5 mL microcentrifuge tubes, which was labeled and
frozen at -20C for future use.
Protein Quantification
Four 1 mL serial dilutions (1:2) were made from the stock Bovine Serum Albumin (BSA)
standard (1 mg/mL). 100 L of each dilution was added into clean, dry test tubes in
triplicate (15 tubes in total). 100 L of undiluted and 1:2 diluted flow-through solutions
respectively were added to two test tubes in triplicate (6 tubes in total). 100 L of
undiluted and 1:2 diluted elution fractions 1 and 2 respectively were added to 4 test tubes
in triplicate (12 tubes in total). 100 L of the dilution buffer was pipetted into a clean, dry
test tube (reagent blank). 5 mL of diluted protein-assay dye reagent (Bio-Rad) was added
to the sample tubes containing the BSA protein standards, flow-through, elution fractions,
and reagent blank respectively. After addition of the dye, the tubes were immediately
inverted to mix the contents. Tubes were then left undisturbed for 5 min. The absorbance
of the solution at 595 nm (A595) was then measured on the Spec20 (Thermoscientific),
using the reagent blank as a measure for zero absorbance. The A595 was then measured
for each tube, from lowest to highest protein concentration, using the Spec20. The
absorbencies of the aliquots of each sample were also measured. The Spec20 tubes were
then cleaned with water. Excess Bradford reagent and waste were collected in bottles.
Determination of Relative Protein Sample Purity
The Mini-PROTEANTGX pre-cast gel was prepared (via the protocol outlined in the
catalogue by Bio-Rad*) by McMaster University, Department of Biochemistry and
Biomedical Sciences. Protein samples were prepared while waiting for the gel to
polymerize. Using 1.5 mL Eppendorf tubes, 15 L of all samples obtained in last section
in addition to 15 L of 2X SDS-PAGE loading buffer (Bio-Rad: 2.96 mL distilled water,
40 L 0.5 M EDTA-Na2, 2 mL Glycerol, 770 mg DTT, 4 mL 10% SDS, 2 mg
bromophenol blue in total volume of 10mL) were aliquotted into each tube. Protein
fractions were kept on ice during use, then returned to the -20C freezer. The samples
were boiled for 2-3 minutes. The tubes were then centrifuged for approximately 2
seconds. The order of SDS-PAGE gel loading was recorded. Approximately 23 L of
sample was loaded per well. The gel running apparatus (Bio-Rad) was turned on to 175 V
and the gel was run for approximately one hour. When the dye front reached the very

bottom of the separating gel, the voltage was turned to zero and the power supply was
turned off. The electrode assembly was removed and unclamped, and the gel sandwich
was gently removed. The gel was removed using a gel releaser. The gels were then
placed in a Coomassie staining solution (Bio-Rad: 50% V/V methanol, 5% V/V acetic
acid, 0.1% V/V Coomassie Brilliant Blue G-250) in a fumehood and placed on a gel
rocker overnight. The gels were then destained using a destaining solution (10% V/V
acetic acid, 5% V/V methanol), dried and scanned by McMaster University, Department
of Biochemistry and Biomedical Sciences.
Crystallization of His(6)-DHFR
DHFR crystallization was accomplished utilizing a SaltRx protein crystallization
reagent incorporating the Sitting Drop Method (Hampton Research). 166.7 mg/mL
lysozyme dissolved in Buffer A (sodium acetate, pH 4) and SaltRx Reservoir Buffer
(0.1 M Sodium Acetate, pH 4.8, 6.5% W/V NaCl) were pipetted onto the sample wells on
unit 1 to 3 of the Intelli-Plate 24-4 well. Elution fractions 1, 2, and 3 (with reservoir
buffer and 0.17 M Buffer A) were added to the sample wells on unit 4, 5, 6 of the plate
respectively. Protein crystals were visualized by Nikon SMZ1500 microscope (1.5X
magnification), scanned by Lumenera Infinity 2 camera and Infinity Analyze camera
software.*

RESULTS

Characterization of pET28b and PCR-amplified folA via gel electrophoresis

kb

pET28b-fola

6000

pET28b

folA

500

Lane

Figure
2.
Agarose
Gel
Electrophoresis of Digested PCR
Amplicon and pET28b. Figure 2
contains a 1% agarose gel stained
with GelRed Nucleic Acid Gel
Stain containing the PCRamplified folA gene and pET28bfolA plasmid vector digested with
restriction enzymes NdeI and
XhoI. The gel was run at 150V at
22C. Lane 1 contains the 1
kilobase DNA ladder. Lane 2
contains the folA amplicon. Lane
3 contains the uncut pET28b-folA
plasmid. Lane 4 contains the
pET28b-folA plasmid cut with
restriction enzymes NdeI and
XhoI. The gel was visualized
under UV light and photographed
using the Kodak Gel Logic 100
camera.

Characterization of pET28b-folA ligation reactions via gel electrophoresis

kb

6000

pET28b
PvuI
Fragment 1
PvuI
Fragment 2

500
250
folA
RNA

Lane

Figure
3.
Agarose
Gel
Electrophoresis of single- and
double-digested
pET28b-folA
gene plasmid. Figure 3 contains
a 1% agarose gel stained with
GelRed Nucleic Acid Gel
Stain containing loaded samples
of the pET28b-folA plasmid
digested
with
restriction
enzymes PvuI and NdeI & XhoI
respectively. The gel was run at
150V at 22C. Lane 1 contains
the 1 kilobase DNA ladder. Lane
2 contains the uncut pET28bfolA plasmid. Lane 3 contains
the
pET28b-folA
plasmid
double-digested with restriction
enzymes NdeI and XhoI. Lane 4
contains
the
pET28b-folA
plasmid single-digested with
restriction enzyme PvuI. The gel
was visualized under UV light
and photographed using the
Kodak Gel Logic 100 camera.

Bacterial Growth of E. Coli BL21-DE3

Cells
1
Stationary phase
(onset)

Optical Density (600 nm)

0.9
0.8
0.7
0.6

Induction
with IPTG

Log (exponential
phase)

0.5
0.4
0.3
0.2

Lag phase

0.1
0
0

50

100

150
200
Time (minutes)

250

300

350

Figure 4. Bacterial Growth Curve of E. Coli BL21-DE3 Cells Induced with IPTG. Figure 4 displays a
growth curve of the harvested E. coli cells bearing the pET28b-folA plasmid. The Y-axis displays the
optical density of the sample at a wavelength of 600 nm (measured by Spec20 spectrophotometer). The Xaxis displays the time elapsed in minutes. An arrow indicates the point of induction with IPTG (230
minutes). The lag phase, log (exponential) phase, and onset of stationary phase are also labelled.

Standard Absorbance Curve for Bovine

Serine Albumin (BSA) Serial Dilutions
Absorbance Average

0.75
0.7

y = 0.1527x + 0.3465
R = 0.9933

0.65
0.6
0.55

Absorbance vs. Concentration

of BSA

0.5
0.45
0.4
0.35
0

0.5
1
1.5
2
Concentration of BSA (mg/mL)

2.5

Figure 5. Standard absorbance curve for Bovine Serum Albumin (BSA) at Varying Concentrations utilizing
the Bradford Assay technique. Figure 5 displays a curve reflecting the absorbance values of BSA standards

at 595 nm, at varying concentrations of BSA in a Bradford assay. The absorbance values were measured
using the Multiskan Ascent Plate Reader (Thermo-Scientific). The Y-axis denotes the absorbance average
of the BSA standard (measured in triplicate). The X-axis denotes the concentration of BSA measured in
mg/mL. The linear equation represents the relationship between BSA absorbance and BSA concentration.
The closeness of R2 value to 1 indicates the strength of the correlation between the linear equation and data
points, with a value of 1 representing perfect correlation. The standard deviation of each sample is
indicated by the error bars shown on the curve.

Dilution
Stock BSA
1
2
3
4

Absorbance 1
0.593
0.638
0.421
0.372
0.380

Absorbance 2
0.565
0.596
0.434
0.373
0.343

Absorbance 3
0.790
0.548
0.461
0.382
0.361

Average
0.649
0.594
0.439
0.376
0.361

Table 1. Absorbance values of serial dilutions of BSA. Table 1 displays the various absorbance values
measured for the stock BSA solution and each of the serial dilutions, measured using the Multiskan Ascent
Plate Reader (Thermo-Scientific). The absorbance of the blank sample was adjusted to 0 and all other
average absorbance values were adjusted relative to the absorbance of the blank sample.

Determination of Relative Protein Sample Purity via SDS-PAGE

kDA
245
180
135
100
75
63
48
35
25
20

DHFR

17
11

Lane

10

Figure 6. SDS-PAGE gel of Ni-NTA Affinity Column Elution Fractions. Sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE) was run for approximately 1 hour at 175 V, 22C after
eluted fractions were obtained from nickel affinity column chromatography. A protein molecular weight
marker (Gene DireX) is present in Lane 2 in order to measure the molecular weight (size) of protein
samples in other lanes. Lane 1 contains the cell lysate. Lane 3 was contains the flow through. Lanes 4 and 5
contain the first and second washes respectively. Lanes 6, 7, 8, 9, 10 contain elution fractions one, two
three, four and five respectively.

Crystallization of His(6)-DHFR using Broad Crystallization Screen

Figure 7. Photographs of (A) lysozyme crystals and (B) DHFR crystals formed via the SaltRxSitting
Drop method. Protein crystallization of both lysozyme (7a) and DHFR (7b) was accomplished utilizing the
SaltRxSitting Drop method at -4C for one week. The lysozyme was used as a positive control to which
DHFR crystallization could be compared. Photographs were taken of wells C3 (lysozyme) and C5 (DHFR)
of the Intelli-PlateTM using a Nikon SMZ1500 microscope (1.5X magnification), Lumenera Infinity 2
camera and Infinity Analyze camera software.