Sei sulla pagina 1di 57

UNIVERSIDADE ESTADUAL DE MARING

PROGRAMA DE PS-GRADUAO EM GENTICA E MELHORAMENTO







ALINE RIBEIRO BRONZATO















Amplificao heterloga e diversidade gentica em Tetragonisca
angustula (Latreille, 1811) e Tetragonisca fiebrigi (Schwarz, 1938)






















MARING
PARAN BRASIL
FEVEREIRO 2011

ALINE RIBEIRO BRONZATO



















Amplificao heterloga e diversidade gentica em Tetragonisca
angustula (Latreille, 1811) e Tetragonisca fiebrigi (Schwarz, 1938)


Dissertao apresentada Universidade
Estadual de Maring, como parte das
exigncias do Programa de Ps-Graduao
em Gentica e Melhoramento, para obteno
do ttulo de Mestre.

Orientadora: Prof
a
Dr
a
Maria Claudia Colla
Ruvolo Takasusuki.















MARING
PARAN BRASIL
FEVEREIRO 2011

iii





























Para realizar grandes conquistas, devemos
no apenas agir, mas tambm sonhar; no
apenas planejar, mas tambm acreditar.
(Anatole France).

iv














Aos meus pais, Maria das Graas Ribeiro Bronzato e Joo Vicente Bronzato,
pelo amor, dedicao, por serem pessoas to maravilhosas e pelo apoio
indispensvel em mais esta etapa da minha vida.
Dedico.

v
AGRADECIMENTOS

A Deus, pelo dom da vida e por sempre me guiar pelos melhores caminhos,
concedendo-me tantas graas e permitindo que eu pudesse alcanar mais este
objetivo.
Universidade Estadual de Maring (UEM) e ao Programa de Ps-
Graduao em Gentica e Melhoramento (PGM), pela estrutura oferecida para
elaborao dos experimentos.
Fundao Araucria pelo apoio financeiro cedido para elaborao desta
pesquisa.
Ao Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq),
pela bolsa de estudo concedida.
Em especial a minha orientadora, professora doutora Maria Claudia Colla
Ruvolo Takasusuki, pelo valioso trabalho de orientao, pelas oportunidades de
crescimento profissional e pessoal e pelos conhecimentos transmitidos.
s Coorientadoras, professora doutora Maria de Ftima Pires da Silva
Machado e professora doutora Claudete Aparecida Mangolin, pela pacincia e ajuda
durante os experimentos e principalmente pela dedicao aos alunos.
A todos os professores do Programa de Ps-Graduao em Gentica e
Melhoramento, pela valiosa contribuio em minha formao profissional.
Aos Secretrios do Programa de Ps Graduao em Gentica e
Melhoramento, Francisco Jos da Cruz e Maria Valquria Magro.
A todas as pessoas que contriburam com a coleta das abelhas,
principalmente as alunas Arielen Casagrande e Letcia Oliveira Claudino.
companheira de turma e amiga, Raquel Barel Matos, pelas conversas
construtivas e ajuda na organizao do trabalho.
Ao meu irmo, Leonardo Ribeiro Bronzato, pelos valiosos conselhos, pelas
longas conversas e principalmente pela amizade.
s minhas tias, madrinhas, padrinhos e primos. Em especial, Tia Alix
Antunes Ribeiro, Renata Imprio, Laura HeIena Imprio Alvim, Luana Imprio Alvim
e Adnia Gonalves, por sempre torcerem pelas minhas conquistas e pelos
momentos de descontrao e alegria.

vi
s minhas amigas-irms, Eliane Rodrigues Monteiro, Ana Clara Meirelles e
Laura Aparecida Carvalho, pela insubstituvel convivncia durante estes ltimos
anos e por me possibilitar os melhores momentos da minha vida em Maring.
s minhas grandes amigas, Juliana Martellozo, Gisuelma Rosseto, Danyelle
de Oliveira Claudino, Daniela Giacon, Silvia Torres e Carla Assis, que, apesar de
distantes, sempre me deram a certeza de poder contar com as suas amizades e por
simplesmente serem minhas melhores amigas.
Aos meus amigos, Davi Santos, Allan Lobato, Hugo Zeni Neto, Boris Briez,
Cinthya Maritza Pacheco e Lorena Lopes, pela amizade e pelos bons momentos que
passamos juntos.
famlia de colegas dos laboratrios 17 e 21 do Departamento de Biologia
Celular e Gentica da UEM, que tornaram mais fcil esta caminhada. Em especial,
amiga Simone Aparecida dos Santos, cuja ajuda e amizade foram indispensveis
para a finalizao deste trabalho.
s amigas de laboratrio, Juliana Mosconi Magro, Juliana Bueno Ruiz, Ana
Lcia Paz Barateiro Stuchi e Denise Alves Lopes, pela incrvel convivncia e troca
de conhecimentos.
A tantos outros amigos no listados aqui, mas dignos de minha homenagem.

vii
BIOGRAFIA


Aline Ribeiro Bronzato, filha de Maria das Graas Ribeiro Bronzato e Joo
Vicente Bronzato, nasceu na cidade de So Paulo, estado de So Paulo, no dia 28
de setembro de 1984.
Concluiu o Ensino Fundamental na Escola Estadual Professor Dr. Gensio
Boamorte, na cidade de So Paulo, estado de So Paulo, em 1999.
Finalizou, em 2002, o Ensino Mdio na Escola Tcnica Estadual Pedro Leme
Brisolla Sobrinho, tambm na cidade de So Paulo.
Em 2007, licenciou-se em Cincias Biolgicas, pelas Faculdades Integradas
de Ourinhos (FIO), em Ourinhos, estado de So Paulo.
Especializou-se em Biotecnologia Aplicada Agroindstria, pela
Universidade Estadual de Maring (UEM), em 2009.
Ainda em 2009, iniciou o Curso de Mestrado no Programa de Ps-
Graduao em Gentica e Melhoramento (PGM), da Universidade Estadual de
Maring (UEM), desenvolvendo linha de pesquisa em Gentica Animal (Gentica de
Insetos) e realizando estudos na rea de apicultura.


viii
SUMRIO


LISTA DE QUADROS ................................................................................................ ix
LISTA DE FIGURAS ................................................................................................... x
RESUMO.................................................................................................................... xi
ABSTRACT .............................................................................................................. xiii
1. INTRODUO ........................................................................................................ 1
2. REVISO DE LITERATURA .................................................................................. 4
2.1. Meliponneos Abelhas T. angustula ............................................................... 4
2.2. Importncia ecolgica e econmica das abelhas Jata ................................... 10
2.3. Gentica de populaes de T. angustula ........................................................ 11
2.4. Marcadores moleculares em T. angustula ...................................................... 13
3. MATERIAL E MTODOS ..................................................................................... 18
3.1. Coleta das abelhas T. angustula e T. fiebrigi .................................................. 18
3.2. Isolamento do DNA nuclear ............................................................................ 19
3.3. Amplificao dos locos microssatlites ........................................................... 20
3.4. Anlise dos dados .......................................................................................... 22
4. RESULTADOS E DISCUSSO ............................................................................ 24
5. CONCLUSES ..................................................................................................... 33
6. REFERNCIAS BIBLIOGRFICAS ..................................................................... 34

ix
LISTA DE QUADROS
Quadro 1 - Coordenadas geogrficas dos pontos de coleta de T. angustula e T.
fiebrigi, o tipo de ninho e a quantidade de ninhos amostrados para
caracterizao dos locos microssatlites.............................................19
Quadro 2 - Origem e sequncia dos primers microssatlites testados para
amplificao em T.angustula e T. fiebrig..............................................21
Quadro 3 Temperaturas de anelamento especficas (E), conforme recomendaes
do autor, e temperaturas testadas (T), para adaptao dos primers na
amplificao de DNA de T. angustula e T. fiebrigi...............................22
Quadro 4 - Reagentes utilizados na PCR para amplificao dos locos
microssatlites......................................................................................23
Quadro 5 Programa Touchdown-PCR com temperatura variando de 65C a
55C........................................................................................................23
Quadro 6 - Temperatura de anelamento satisfatria para amplificao dos cinco
primers escolhidos para T. angustula e T. fiebrigi................................25
Quadro 7 - Tamanho e frequncia dos alelos (F) microssatlites de T. fiebrigi e T.
angustula das populaes dos estados de So Paulo e
Paran...................................................................................................27
Quadro 8 - Valores de Heterozigosidades observada (Ho) e esperada (He) obtidas
com marcadores microssatlites para T. fiebrigi e T. angustula dos
estados de So Paulo e Paran...........................................................28
Quadro 9 - ndice de fixao (F
is
), grau de diferenciao (F
st
) e fluxo gnico (Nm)
obtidos com marcadores microssatlites em T. fiebrigi e T. angustula
dos estados de So Paulo e Paran.....................................................29
Quadro 1 - Valores da Identidade Gentica e Distncia Gentica de Nei (1978)
obtidos pelo programa Popgene 1.31 para as populaes de T.
angustula (T.a) e T. fiebrigi (T.f) analisadas com marcadores
microssatlites......................................................................................30

x
LISTA DE FIGURAS
Figura 1 Vista lateral de trax de T. angustula (jata). A: Mesepisterno preto de T.
a. angustula. B: Mesepisterno amarelo de T. a. fiebrigi. C: Mesepisterno
de operria hbrida. (Fotos: Dra. Maria Claudia Colla Ruvolo Takasusuki
e Aline Ribeiro Bronzato)..........................................................................7
Figura 2 - Vista da entrada do ninho de T. angustula (Freitas e Soares,
2004).........................................................................................................8
Figura 3 Favos de cria e a rainha de T. angustula (Kerr,1996)............................9
Figura 4 Mapa geogrfico do Brasil mostrando os pontos de coleta das abelhas T.
angustula e T. fiebrigi nos estados de So Paulo e Paran...................18
Figura 5 Amplificao do primer microssatlite T3-32 para T. fiebrigi (nmeros 1 a
10) e T. angustula (nmeros 11 a 20).....................................................24
Figura 6 Primer T7-5 e Mbi278, respectivamente exemplos de monomorfismo e
amplificao no satisfatria da transferabilidade..................................26
Figura 7 Dendrograma baseado no complemento aritmtico da distncia gentica
de Nei (1978), obtido por marcadores microssatlites. As populaes de
T. fiebrigi e T. angustula foram agrupadas pelo mtodo UPGMA,
utilizando o programa Popgene 1.31......................................................31

xi
RESUMO
BRONZATO, Aline R. MSc. Universidade Estadual de Maring, fevereiro de 2011.
Amplificao heterloga e diversidade gentica em Tetragonisca angustula
(Latreille, 1811) e Tetragonisca fiebrigi (Schwarz, 1938). Orientadora: Maria
Claudia Colla Ruvolo Takasusuki. Conselheiros: Claudete Aparecida Mangolin e
Maria de Ftima Pires da Silva Machado.


As abelhas nativas do Brasil tm papel importante na polinizao de espcies de
Angiospermas. Dentre estas abelhas destacamos o gnero Tetragonisca que
composto por quatro espcies de distribuio neotropical. Duas dessas espcies so
bastante conhecidas no Brasil: a T. angustula e a T. fiebrigi, popularmente
conhecidas como jata. Devido a caractersticas morfolgicas, em especial a
colorao do mesepisterno, elas podem ser classificadas como duas subespcies de
T. angustula. Poucos marcadores moleculares so descritos para essas abelhas,
mas recentemente esto sendo desenvolvidos marcadores microssatlites. A partir
dessa informao so avaliados e padronizados primers microssatlites,
denominados de heterlogos ou heteroespecficos para as Tetragonisca. A
transferabilidade desses primers facilita o desenvolvimento de estudos de gentica
de populaes e filogentica das abelhas nativas sem ferro. O objetivo desse
estudo foi o de investigar polimorfismos e a gentica de populaes para T. fiebrigi e
T. angustula. Para tanto foram coletadas operrias de ninhos localizados em
Maring PR; e nas localidades de Dracena, So Carlos e Santa Cruz do Rio Pardo
SP, num total de 20 ninhos. De cada ninho foram utilizadas 10 operrias adultas
para isolamento de DNA nuclear. Inicialmente foram realizados testes com sete
primers microssatlites heteroespecficos. Desse total foi obtido sucesso na
amplificao e presena de polimorfismo com cinco primers: T3-32, Mbi33, Mbi215,
Mbi254 e Mbi259. A transferabilidade desses primers contribui com o aumento do
banco de primers para estudos populacionais, filogenticos e evolutivos das abelhas
sem ferro. Para a espcie T. angustula foi observada a ocorrncia de um alelo
especfico para a populao de Santa Cruz do Rio Pardo, que poder ser utilizado
para diferenciar as T. angustula dessa localidade. Um alelo especfico de T. fiebrigi
foi obtido com o primer T3-32. A anlise da gentica de populaes mostrou que os
primers utilizados, apesar de polimrficos, no permitem separar as duas espcies

xii
de Tetragonisca, ocorrendo apenas subdiviso em populaes. Os valores de F
ST
mostraram que as populaes esto diferenciadas, mas foi observado excesso de
homozigotos, esse fato pode ser consequncia de consanguinidade, ou da
ocorrncia de alelos nulos pela utilizao de primers heterlogos. A anlise da
colorao do mesepisterno e os valores de distncia gentica indicam que
provavelmente houve hibridizao entre as T. fiebrigi e T. angustula em So Carlos.
As duas espcies de Tetragonisca analisadas provavelmente no esto
completamente separadas ainda, portanto novos estudos com maior nmero de
marcadores moleculares sero necessrios para compreender melhor os
mecanismos evolutivos dessas espcies de abelhas.

Palavras-chave: Marcadores moleculares; microssatlites; variabilidade gentica;
gentica de populaes.

xiii
ABSTRACT
BRONZATO, Aline Ribeiro. MSc. Universidade Estadual de Maring, february, 2011.
Heterologous amplification and genetic diversity in Tetragonisca angustula
(Latreille, 1811) and Tetragonisca fiebrigi (Schwarz, 1938). Adviser: Maria
Claudia Colla Ruvolo Takasusuki. Commitee Members: Claudete Aparecida
Mangolin e Maria de Ftima Pires da Silva Machado.


The native Brazilian stingless bees have an important role in pollination of
Angiosperms species. Tetragonisca genus, a stingless bee, is composed by four
species of neotropical distribution. Two of them are well known in Brazil, the T.
angustula and the T. fiebrigi, popularly known as jata. Due to their morphological
characteristics, especially the coloring of the mesepistern, they can be classified as
two sub-species of T. angustula. Few molecular markers are described for these
bees, but recently microsatellite markers are being developed. From this information
microsatellite primers, denominated heterologous or heterospecific for Tetragonisca,
are evaluated and standardized. The transferability of these primers facilitates the
development of population genetics and phylogenetic studies of native stingless
bees. The purpose of this study was to study polymorphisms and population genetics
to T. fiebrigi and T. angustula. Worker bees were collected from nests in Maring -
PR; Dracena, So Carlos and Santa Cruz do Rio Pardo SP, totaling 20 nests. From
each nest, 10 adult workers were used for isolation of nuclear DNA. Initially, seven
heterospecific microsatellite primers were tested. Of this total, successful
amplification and presence of polymorphisms were obtained in five primers: T3-32,
Mbi33, Mbi215, Mbi254 and Mbi259.The transferability of these primers contributes
for the primer bank increase for population, phylogenetic e evolutionary studies of
stingless bees. A specific allele was observed for T. angustula in Santa Cruz do Rio
Pardo population, which could be used as a marker to this population. A specific
allele of T. fiebrigi was obtained with T3-32 primer. Analysis of Population genetics
showed that used primers, although polymorphic, not were able to separate the two
Tetragonisca species, occurring only subdivision in populations. The values of F
ST

showed that the populations are differentiated, but an excess of homozygotes was
observed, a fact that can be a consequence of consanguinity or from the occurrence
of null alleles from the use of heterologous primers. Mesepistern coloring and the
values of genetic distance indicate that hybridization probably happened between the

xiv
T. fiebrigi and T. angustula from So Carlos. The two Tetragonisca species analyzed
are not completely separated yet; therefore, new studies with more molecular
markers will be necessary to better comprehension the evolutionary mechanisms of
these stingless bees.

Key words: Molecular markers; microsatellite; genetic variability; population
genetics.




1
1. INTRODUO
Dentre as espcies animais que compem a biodiversidade brasileira
encontramos inmeras espcies de insetos sociais, entre eles uma grande
variedade de abelhas tais como a T. angustula, uma abelha sem ferro, conhecida
popularmente como Jata (Nogueira-Neto, 1997).
As abelhas sem ferro esto entre os polinizadores mais comuns nos
ambientes tropicais (Macas-Macas et al., 2009). Estes insetos compem um grupo
diverso, o qual inclui mais de 400 espcies que mostram uma alta variabilidade na
fisiologia, morfologia e tamanho, indo de 0,2mm no gnero Tetragonisca a mais de
20 mm em algumas espcies de Melipona (Michener, 2000; Moure et al., 2008).
A importncia das abelhas jata est relacionada com a facilidade da criao
racional de abelhas que est ligada, principalmente, ao seu emprego como auxiliar
na agricultura e em projetos de reflorestamento, em que numerosas espcies
vegetais dependem de processo de polinizao cruzada (Proni, 2000).
Alm da polinizao, as abelhas nativas como a jata produzem mel de
sabor apreciado (Freitas e Soares, 2004) e de atribuies teraputicas nos
tratamentos de oftalmias e molstias dos pulmes (Imperatriz-Fonseca et al., 1984).
Em vrias partes do Brasil o mel das abelhas sem ferro tem maior procura e preo
mais alto em relao ao mel de Apis mellifera, como por exemplo, na regio de
Minas Gerais, So Paulo e Paran, onde h grande procura pelo mel de jata e
mandaaia Melipona quadrifasciata (Kerr et al., 1994; Alonso, 1998).
Entretanto, h uma grande preocupao acerca da sustentabilidade das
populaes destes meliponneos em relao fragmentao de reas de florestas
devido ao do homem, o que pode levar ao isolamento de subpopulaes e
consequentemente deriva gentica e endogamia, fatores que podem ser fatais
para essa espcie (Nogueira-Neto, 2002).
O uso de marcadores moleculares vem sendo empregado no estudo da
variabilidade e divergncia gentica fornecendo dados importantes principalmente
para a manipulao de insetos sociais, como as abelhas sem ferro (Oliveira et al.,
2004). Esses podem ser definidos como locos que apresentam variabilidade e ser
utilizados para detectar diferenas entre dois ou mais indivduos, duas ou mais
populaes. Eles apresentam altos nveis de polimorfismo, geralmente so

2
marcadores neutros em relao a efeitos fenotpicos e, na maioria das vezes, so
co-dominantes, contendo maior quantidade de informao gentica por loco
(Ferreira e Grattapaglia, 1998).
Nos ltimos anos, marcadores do tipo microssatlite tm sido uma
ferramenta molecular bastante utilizada em estudos ecolgicos e genticos. A
anlise de locos microssatlites realizada por meio da tcnica de PCR
(Polymerase Chain Reaction) utilizando-se iniciadores (primers) complementares (18
a 25 bases) s regies que os flanqueiam (Zane et al., 2002).
A caracterizao de marcadores microssatlites tem mostrado que estes so
bastante eficientes em separar espcies de abelhas sem ferro e no estudo de
evoluo desses insetos (Prez et al., 1998).
A utilizao desses marcadores poderia contribuir ainda com o melhor
entendimento sobre a taxonomia de T. angustula e T. fiebrigi, j que autores como
Castanheira e Contel (1995) consideram a ocorrncia de duas subespcies de T.
angustula.
Contudo, poucos estudos moleculares foram desenvolvidos com essas
abelhas nativas sem ferro. Castanheira e Contel (2005) encontraram correlao
significativa entre a cor do mesepisterno, com o alelo Hk
88
da isoenzima
hexoquinase. As autoras verificaram que esse alelo tem maior frequncia nas
abelhas T. a. fiebrigi que apresentam mesepisterno amarelo.
Oliveira et al. (2004), utilizando marcadores RAPD, separaram T. angustula
em dois grupos distintos de acordo com a distribuio geogrfica natural. Contudo,
Baitala et al. (2006), empregando este marcador molecular, mostraram grande
variabilidade gentica entre as populaes, e no foi possvel separar as
subespcies T. a. angustula e T. a. fiebrigi.
Uma biblioteca genmica enriquecida foi construda para T. angustula por
Brito et al. (2009). Nesse estudo a biblioteca foi selecionada por meio de sondas de
oligonucleotdeos de duas repeties simples e 21 pares de primers microssatlites
foram desenhados flanqueando sequncias repetitivas dentro de clones positivos.
Do total de 21 locos analisados, 15 se mostraram polimrficos. Esses primers
amplificaram microssatlites de outras espcies de abelhas sem ferro T. fiebrigi, T.
weyrauchi, Lestrimelitta maracaia e Schwarziana quadripunctata.
Koling e Moretto (2009) utilizaram o marcador molecular PCR/RFLP para
estudar o DNA mitocondrial de T. a. angustula e T. a. fiebrigi no estado de Santa

3
Catarina. Nesse estudo foram obtidos marcadores de DNA mitocondrial para as
duas subespcies dependendo da regio geogrfica, mostrando que h um fluxo
gnico restrito entre os dois grupos.
Devido ampla distribuio de T. angustula e mais restrita de T. fiebrigi e a
hibridao que provavelmente ocorre entre as duas espcies, o objetivo deste
trabalho foi de analisar a divergncia gentica entre populaes de T. angustula e T.
fiebrigi oriundas dos estados do Paran e So Paulo mediante utilizao de
marcadores microssatlites.

4
2. REVISO DE LITERATURA
2.1. Meliponneos Abelhas T. angustula
As abelhas sociais nativas do Brasil, conhecidas popularmente por abelhas
indgenas, apresentam o ferro atrofiado, o qual no pode ser usado como meio de
defesa. Por isso so denominadas popularmente de abelhas nativas sem ferro ou
stingless bees. Estudos demonstram que as abelhas sem ferro provm
evolutivamente de um grupo de vespas que deixaram de transmitir caracteres
genticos da formao do ferro a seus descendentes (Alonso, 1998).
No Brasil, os grupos mais importantes de abelhas eusociais (altamente
sociais) constroem seus ninhos em ocos de troncos de rvores, como as abelhas
nativas sem ferro (Silveira et al., 2002).
As abelhas sem ferro pertencem superfamlia Apoidea, que subdividida
em oito famlias: Colletidae, Andrenidae, Oxaeidae, Halictidae, Melittidae,
Megachilidae, Anthophoridae e Apidae. Os Apidae, por sua vez, se subdividem em
quatro subfamlias: Euglossinae, Bombinae, Apinae e Meliponinae (Proni, 2000).
As abelhas pertencentes subfamlia Meliponinae so distribudas na Zona
Tropical e subtropical, nas Amricas do Sul e Central, Malsia, ndia, Indonsia,
frica e Austrlia. Tais abelhas so conhecidas no meio cientfico como
meliponneos. Pertencem Ordem Hymenoptera e segundo Moure (1961), a
subfamlia Meliponinae ainda pode considerar duas tribos: Meliponini e Trigonini. Os
Meliponini se caracterizam por no construrem clulas reais, assim, rainhas,
operrias e machos nascem e desenvolvem-se at o estgio adulto em clulas de
cria de igual tamanho. Os Trigonini, por sua vez, constituem um grupo muito
diversificado, com dezenas de gneros, e constroem quase sempre clulas reais,
sendo estas maiores que as outras clulas da colmia, de onde emergem as futuras
rainhas (Nogueira-Neto, 1997).
Segundo Camargo e Menezes-Pedro (1992), os meliponneos tiveram
origem na parte oeste do continente Gondwana. Esta hiptese sustentada devido
aos registros fsseis encontrados e pela biogeografia do local.
Kerr et al. (1996) citam que um dos principais locais de ocorrncia dos
meliponneos o Brasil. Estes so de grande importncia para a ecologia de
diversos ecossistemas, j que tais insetos participam da polinizao de grande parte

5
da Mata Atlntica, pois essas abelhas so responsveis por 40% a 90% da
polinizao das rvores nativas, enquanto outros animais, como aves, borboletas e
alguns mamferos desempenham o papel polinizador restante.
No total so conhecidas cerca de 400 espcies de meliponneos distribudas
em aproximadamente 50 gneros (Velthuis, 1997). Tal nomenclatura se d devido
ao fato de terem sido inicialmente manipuladas por povos indgenas e primitivos,
como os maias pr-colombianos, que deixaram em seus cdices, explicaes sobre
como manejar estas abelhas, e os ndios kaiaps, que demonstraram um vasto
conhecimento sobre a anatomia e comportamento das espcies de abelhas sem
ferro (Alonso, 1998).
Estudos relativos ao comportamento dos meliponneos demonstram que
estes so capazes de defender suas colnias fechando a entrada do ninho quando
so atacados por outros insetos e, j que possuem ferro atrofiado, atacam os
invasores com as mandbulas, enrolando-se nos plos, envolvendo-os com
geoprpolis ou penetrando em orifcios dos inimigos de maior porte (Nogueira-Neto,
1997).
De acordo com Proni (2000), as abelhas indgenas sem ferro so
encontradas praticamente em todos os tipos de habitats, j que possuem diferentes
espcies com hbitos muito variados de nidificao e, consequentemente, com
grande variabilidade em sua biologia. Estas abelhas geralmente precisam de
cavidades grandes para abrigar uma colnia. A maioria das espcies faz seus
ninhos em buracos de rvores, entretanto algumas espcies ocupam ninhos
abandonados por formigas e trmitas e, tambm, cavidades subterrneas dentro de
razes de rvores, entre outros (Roubik, 1989).
Um exemplo de abelhas Trigonini (abelhas que utilizam cera) so as abelhas
T. angustula, que so conhecidas popularmente como jata (Moure, 1961),
destacando-se como uma das mais comuns entre as espcies de meliponneos.
Alguns estudos classificam a jata em diferentes nomenclaturas,
dependendo do autor investigado.
Moure (1961) classificou a jata como pertencente ordem Hymenoptera,
famlia Apidae, subfamlia Meliponinae, Tribo Trigonini, gnero Tetragonisca.
Contudo na literatura mais recente, que o catlogo de abelhas, Moure et al. (2008)
consideram que o gnero Tetragonisca faz parte da tribo Meliponini. Esse gnero
composto por quatro espcies T. buchwaldi, T. weyrauchi, T. angustula e T. fiebrigi

6
(Camargo e Pedro, 2008). Abelhas T. buchwaldi no ocorrem no Brasil, so
encontradas na Costa Rica, Equador e Panam; T. weyrauchi pode ser observada
na Bolvia, Peru e no Brasil esto restritas ao Acre, Mato Grosso e Rondnia
(Camargo e Pedro, 2008). No Brasil as T. angustula so facilmente encontradas em
todo o territrio, pois se adaptam bem s condies ambientais da regio
neotropical. Estas abelhas ocorrem ainda do Mxico at a Argentina (Camargo e
Menezes-Pedro, 1992). J as T. fiebrigi possuem uma distribuio mais restrita,
sendo encontradas em parte da Argentina, Bolivia, Brasil (Mato Grosso, Mato
Grosso do Sul, Paran, Rio Grande do Sul, So Paulo) e Paraguai (Camargo e
Pedro, 2008).
Castanheira e Contel (1995) sugerem que a espcie T. angustula seria
composta por duas subespcies: T. a. angustula e T. a. fiebrigi. Estas duas
subespcies podem ser separadas morfologicamente por meio da colorao do
mesepisterno, a subespcie T. a. angustula possui o mesepisterno preto (Figura 1A)
e T. a. fiebrigi possui o mesepisterno amarelo (Figura 1B). Castanheira e Contel
(1995) ainda identificaram hbridos que possuam o mesepisterno amarelo com
manchas pretas (Figura 1C) e mesepisterno preto com manchas amarelas.
Para Nogueira-Neto (1997) e Velthuis (1997), essas abelhas se alimentam
especificamente do plen e do nctar, fontes de protena e energia,
respectivamente.
A jata nidifica em cavidades de troncos vivos ou mortos, em paredes, no
cho e em tubulaes, sendo uma espcie encontrada frequentemente em reas
antrpicas, j que se adapta facilmente a diferentes condies de habitats (Freitas e
Soares, 2004). Possui ainda um nicho ecolgico muito peculiar e convive bem nas
Amricas com muitos meliponneos e com abelhas de outros grupos. Ela est bem
adaptada, inclusive nas grandes cidades como So Paulo, onde h poucas abelhas
nativas. Vive tambm, em lugares onde h muitas outras abelhas nativas e muitas
colnias de Apis mellifera, como na regio sudeste do Brasil (Nogueira-Neto, 1997).
O enxame de T. angustula constitudo por uma rainha responsvel pelo
desenvolvimento da colnia, que realiza uma postura de at 50 ovos por dia na
poca de boa florada, zanges que tm a funo de fecundar a rainha na poca de
procriao, e pelas operrias que realizam todo o trabalho da colnia, semelhante s
abelhas A. mellifera (Kerr et al., 1996).

7



Figura 1 Vista lateral de trax de T. angustula (jata). A: mesepisterno preto de T.
a. angustula. B: mesepisterno amarelo de T. a. fiebrigi. C: mesepisterno de operria
hbrida. (Fotos: Dra. Maria Claudia Colla Ruvolo Takasusuki e Aline Ribeiro
Bronzato).

O enxame de T. angustula constitudo por uma rainha responsvel pelo
desenvolvimento da colnia, que realiza uma postura de at 50 ovos por dia na
poca de boa florada, zanges que tm a funo de fecundar a rainha na poca de
procriao, e pelas operrias que realizam todo o trabalho da colnia, semelhante s
abelhas A. mellifera (Kerr et al., 1996).
O zango nasce de um ovo no fecundado, e tem como funo fecundar a
rainha na poca de procriao, sendo mortos ou expulsos da colmia pelas
operrias quando h falta de alimentos ou quando no mais so necessrios para a
fecundao. As operrias realizam todo o trabalho da colmia, desde nutrizes e
faxineiras at soldado e campeiras, semelhante a A. mellifera. As operrias de T.
angustula nascem de um ovo fecundado em uma clula comum (Kerr et al., 1996).

8
Na maioria das espcies de meliponneos, a entrada do ninho guardada
por abelhas sentinelas (Figura 2) que atacam inimigos quando estes tentam invadi-
la, especialmente, abelhas de outras colmias e formigas. A morfologia e
organizao do ninho de T. angustula so tpicas da espcie, a entrada do ninho
formada por um tubo de cerume marrom-amarelado de 3 a 4 centmetros de
comprimento, com pequenos orifcios na parede. A extremidade deste possui bordas
que permitem a sada de vrias abelhas ao mesmo tempo (Cortopassi-Laurino e
Nogueira-Neto, 2003). Em muitas espcies esta entrada circundada por uma
resina pegajosa que dificulta o acesso de invasores, enquanto outras espcies se
defendem fechando a entrada do ninho quando se sentem ameaadas por outros
insetos (Freitas e Soares, 2004).



Figura 2 Vista da entrada do ninho de T. angustula (Freitas e Soares, 2004).

A abelha jata possui favos horizontais e apresentam um invlucro de
cerume formado por vrias lamelas (Figura 3), que tem funo termorreguladora
(Kerr, 1996).
Quando prepara seu ninho para reproduo, este constitudo por uma
mistura de cera e resina, conhecida como batume j que tem consistncia
pegajosa. Esta mistura separa todo o ninho tanto na parte superior quanto na inferior


9
para formar uma proteo ao ncleo. Diferentemente do ocorrido nos ninhos de
Apis, as clulas ou favos so construdos no sentido horizontal formando camadas
sobrepostas. Dentro do ninho h uma sequncia na reproduo onde enquanto as
clulas da parte superior ainda esto com ovos, s outras clulas da parte inferior
eclodem para que as larvas possam conviver com as demais, formando assim um
ciclo reprodutivo (Fabichak, 1987).


















Figura 3 - Favos de cria e a rainha de T. angustula (Kerr,1996).

comum encontrar depsitos de prpolis dentro da colnia destas abelhas,
que so utilizados juntamente com a cera, para fechar buracos e para construir as
paredes das clulas do ninho no qual ficam os ovos e os potes de alimento (Kerr et
al., 1996). Na entrada da caixa ou ninho construdo um tubo de cera, que
fechado durante a noite deixando pequenos orifcios, como uma espcie de teia a
fim de permitir o arejamento interno (Fabichak, 1987).

10
De acordo com Wille (1979), essas abelhas tm o costume de visitar
frequentemente as flores nas altas copas, e na sua ausncia, as comunidades de
rvores da floresta tropical pluvial podem ser bastante modificadas.

2.2. Importncia ecolgica e econmica das abelhas Jata
Os meliponneos so considerados de importncia vital para o ecossistema,
devido sua eficincia como polinizadores. A criao da maioria das espcies de
abelhas est ligada, principalmente, ao seu emprego como auxiliar na agricultura e
em projetos de reflorestamento, onde numerosas espcies vegetais dependem de
processos de polinizao cruzada (Proni, 2000).
Estudos referentes associao inseto-planta, mais especificamente entre
meliponneos e vegetais nativos da regio de Manaus-AM, verificaram que a
extino de espcies nativas de abelhas acelera o processo de extino de espcies
vegetais, desequilibrando os ecossistemas (Keer et al., 1978; Absy et al., 1980).
A jata apresenta algumas vantagens sobre as africanizadas ou europias
pertencentes famlia Apidae, por ser uma abelha bastante rstica que tem grande
capacidade para fazer ninhos e sobreviver em diferentes ambientes, inclusive em
zonas urbanas (Cortopassi-Laurino, 2005). As abelhas indgenas, especialmente a
jata, so criadas em praticamente todo territrio nacional, principalmente pela
ausncia de agressividade, facilitando assim o seu manejo, bem como pelo fato de
produzirem um mel bastante apreciado e valorizado (Nogueira-Neto, 1997).
A jata possui destacada importncia econmica e ecolgica. O extrativismo
de mel, cerume e resinas dessas abelhas so amplamente disseminados,
principalmente no norte e nordeste do Brasil (Menezes-Pedro e Camargo, 2000).
A criao de abelhas jata (T. angustula) uma boa opo aos
meliponicultores. Imperatriz-Fonseca et al. (1984), coletaram amostras de mel e
plen de colnias de T. angustula mantidas no campus da USP de So Paulo e
concluram que estas abelhas visitaram 180 espcies vegetais pertencentes a 45
famlias distintas para a coleta do alimento. Malagodi-Braga e Kleinert (2004)
encontraram diferena significativa na produo de morangos sob efeito da
polinizao por jata, apresentando um aumento no nmero de vulos fecundados e
frutos com maior peso.
A jata T. angustula possui facilidade em ocupar lugares variados para

11
nidificao, adaptando-se s cidades, o que contribui para a manuteno da espcie
mesmo com desmatamentos e queimadas nas florestas. Elas conseguem nidificar
em buracos de muros, pedras, troncos ocos de rvores e caixas de luz (Freitas e
Soares, 2004).
A biologia, comportamento, aspectos morfolgicos e bioqumicos de T.
angustula tm sido estudados desde o incio do sculo vinte (Oliveira et al., 2004).
No Brasil existem inmeras espcies de abelhas sem ferro, havendo muito trabalho
de pesquisa a ser feito para conhecer essa diversidade. H aquelas que produzem
mel s para o consumo da colmia, enquanto outras produzem excedentes que
podem ser aproveitados para o consumo humano (Lopes et al., 2005).
Desta forma, toda e qualquer possibilidade de desenvolver estudos
destinados a conhecer a biologia bsica dos meliponneos, poder trazer solues
prticas na conservao e manejo dos ecossistemas atuais (Kerr et al., 1996).

2.3. Gentica de populaes de T. angustula
O sistema de diferenciao sexual haplodiplide constitui a maioria dos
Hymenoptera. Nesse caso os ovos fertilizados do origem a fmeas (diplides) e os
no fertilizados originam machos (haplides). Essa assimetria reprodutiva pode
causar a diminuio da variabilidade gentica nesses insetos. Tal afirmativa est
associada ao fato da haplodiploidia promover a diminuio do tamanho efetivo da
populao, aumento na fixao de alelos e preveno da produo de polimorfismos
estveis. O gnero Tetragonisca corresponde a um grupo de abelhas que possuem
haplodiploidia (Kerr, 1976).
Contudo, estudos com grupos de Hymenoptera como espcies de
Shymphyta (Sawflies) apresentam heterozigosidade similar a outros insetos
diplodiplides (Boraschi e Del Lama, 2004); assim, tem sido demonstrado que
somente a haplodiploidia no seria responsvel pela reduo da variabilidade
gentica.
Devido ao do homem que modifica o ambiente, fragmentando florestas,
as abelhas nativas tm sofrido isolamento de subpopulaes, o que resulta em
endogamia e deriva gentica (Nogueira-Neto, 2002). Tais fatores esto relacionados
com a estrutura social dos ninhos e afunilamentos populacionais contribuindo para
determinar os baixos ndices de variabilidade protica em Hymenoptera. A perda de

12
alelos por deriva gentica possivelmente definida por um nmero mnimo de
indivduos que se reproduziram durante um perodo de afunilamento demogrfico, e
estes alelos s podem ser recuperados por mutao, ou a partir de outras
populaes, por meio de migrao (Allendorf e Luikart, 2007).
Segundo o princpio da Deriva Gentica, uma populao pequena perde ao
acaso alelos, tornando-se assim possuidora de poucos alelos diferentes disponveis,
o que leva a um nvel baixo de variabilidade gentica, que pode determinar a
extino desta populao se as condies ambientais mudarem (Allendorf e Luikart,
2007). Com o isolamento de populaes de abelhas jata em uma determinada
regio, pode ocorrer o aumento da endogamia e como consequncia a produo de
machos diplides. Quando h a produo de machos diplides numa colnia de
meliponneo, a rainha eliminada pelas operrias e a colnia tende a morrer por
falta de operrias e de rainha. Isso acontece devido ao cruzamento da rainha com
zanges da mesma colnia, ou seja, cruzamentos consanguneos (Kerr, 1996).
Populaes desta abelha estudadas por Castanheira e Contel (2005),
apresentaram excesso de homozigose com relao a alelos relacionados enzima
hexoquinase. As autoras mencionam que as colnias de T. angustula formam
grupos ("clusters") distantes um do outro, o que pode explicar a homogeneidade
allica encontrada entre as colnias de um mesmo grupo.
A necessidade de conservao, manejo e recuperao de populaes
degradadas requerem uma abordagem que envolva no somente aspectos
demogrficos e ecolgicos, mas tambm a gentica de populaes. O enfoque
gentico, pela caracterizao da estrutura gentica e do tamanho efetivo, em
populaes com diferentes nveis de interveno antrpica, constitui uma
abordagem adequada para ser utilizada neste tipo de estudo (Kageyama, 1987;
Moran et al., 1989; Hall et al., 1996 e Nason e Hamrick, 1997).
Frente ao que j conhecemos sobre a estrutura de populao dos
meliponneos, seu nicho ecolgico e a frequente fragmentao de seus habitats
naturais, o uso de marcadores moleculares torna-se importante para o entendimento
da estrutura de populaes dessas abelhas contribuindo para o desenvolvimento de
melhores prticas de manejo e conservao.


13
2.4. Marcadores moleculares em T. angustula
Os marcadores moleculares so locos gnicos que apresentam variabilidade
e podem ser utilizados para detectar diferenas entre dois ou mais indivduos, duas
ou mais populaes. Eles apresentam altos nveis de polimorfismo e, na maioria das
vezes, so co-dominantes, contendo maior quantidade de informao gentica por
loco (Ferreira e Grattapaglia, 1998).
Os primeiros a serem desenvolvidos foram os marcadores embasados em
variantes allicos de isoenzimas, o que permitiu a ampliao do uso de marcadores
de pelo menos uma ordem de magnitude em relao aos marcadores morfolgicos
(Ferreira e Grattapaglia, 1998). O termo isoenzima define um grupo de mltiplas
formas moleculares da mesma enzima que ocorre em uma espcie, como resultado
da presena de mais de um gene codificando cada uma das enzimas (Moss, 1992).
Vrios estudos com marcadores bioqumicos foram realizados em T.
angustula. Estes estudos envolveram sistemas proticos como enzima mlica,
esterases, fosfoglicomutase, glicerol-3-fosfato desidrogenase, isocitrato
desidrogenase, malato desidrogenase, hexoquinase, peptidases, protenas totais e
superxido desmutase (Falco e Contel, 1990, 1991; Machado e Contel, 1991;
Castanheira e Contel, 1995, 2005).
A anlise dos polimorfismos isoenzimticos em T. angustula e T. fiebrigi em
duas localidades (Ivatuba e Altnia, PR) permitiram detectar a presena de um
marcador isoenzimtico para essas duas subespcies de jata, a EST-2. Essa
isoenzima est presente nas abelhas T. fiebrigi e no foi detectada nas T. angustula
(Ruiz, 2006; Stuchi, 2010).
Outras anlises de isoenzimas como as esterases tm demonstrado que T.
a. angustula possui duas regies de esterase. A EST-1 uma -esterase e a EST-2
-esterase. J em T. a. fiebrigi foram detectadas trs regies estersicas. A EST-
1 uma -esterase, mas no corresponde quela da T. a. angustula, uma EST-2 -
esterase e a EST-3 que uma -esterase e tem correspondncia com a mesma
regio da T.a. angustula. Esses resultados mostram que h diferenas importantes
entre essas duas abelhas (Ruvolo-Takasusuki et al., 2006).
Stuchi (2010) caracterizou bioquimicamente esterases e mostrou que
apenas a EST-4 comum s duas espcies. As EST-1 (T. fiebrigi) e EST-3 (T.
angustula) provavelmente se diferenciaram por mutaes ao longo da evoluo das

14
duas espcies, e a EST-2 (T. fiebrigi) pode ter se originado por duplicao e
mutaes posteriores.
O desenvolvimento e aprimoramento das tcnicas de marcadores
moleculares baseados em PCR tm possibilitado estudos de gentica quantitativa,
tais como a determinao do nmero de genes afetando um carter, a localizao e
o percentual da varincia explicada por tais genes, o tipo de ao gnica associada,
a importncia da epistasia e o efeito ambiental em cada gene (Severson et al.,
1993).
Os marcadores moleculares tiveram sua utilizao iniciada na dcada de
1980, e com o aprimoramento das tcnicas de Biologia Molecular, o DNA passou a
ser o foco para o desenvolvimento de novos marcadores que poderiam ser utilizados
como ferramentas de investigaes moleculares. A tcnica viabiliza a caracterizao
gentica de grande nmero de gentipos atravs de procedimentos relativamente
simples e rpidos, podendo ser executada em qualquer estgio do ciclo de vida de
um organismo (Oliveira et al., 2007). So capazes de detectar o polimorfismo
diretamente ao nvel do DNA, no sofrendo qualquer tipo de influncia ambiental
(Souza, 2001). Alm disso, so livres de efeitos epistticos e pleiotrpicos,
permitindo, dessa forma, que qualquer nmero de marcadores seja monitorado em
uma nica populao. Muitos marcadores de DNA apresentam expresso co-
dominante, permitindo que gentipos sejam determinados (Kumar, 1999).
Oliveira et al. (2004), utilizando marcadores RAPD, determinaram a distncia
gentica entre populaes de T. angustula de 25 localidades em trs pases
diferentes da Amrica Latina (Brasil, Argentina e Panam). Baseados na distncia
gentica, calculada pela porcentagem de dissimilaridade encontrada (14%), os
autores dividiram a populao de T. angustula em dois grupos: grupo 1 (oriental),
formado com a subespcie T. a. angustula e grupo 2 (ocidental), formado com a T.
a. fiebrigi. Dois primers utilizados nesta anlise geraram cinco fragmentos que foram
utilizados como marcadores moleculares especficos, permitindo diferenciar estas
subespcies.
Baitala et al. (2006) utilizaram marcadores RAPD para avaliar a estrutura
gentica em cinco populaes (14 colnias) de jata. Foram analisados 12 primers
que reproduziram 171 fragmentos dos quais 150 foram polimrficos (87,72%). A
estimativa da diversidade gentica pelo ndice de Shannon foi de 0,3929 ( 0,2329).
O fluxo gnico (Nm) observado foi de 1,4474 e o valor de G
ST
foi 0,2568. Com os

15
valores de distncia gentica, foi verificado um isolamento entre as populaes do
noroeste do Paran (Maring e Cianorte) da populao de Junqueirpolis (SP).
Foram identificados seis marcadores que diferenciaram as populaes de T.
angustula do estado de So Paulo e Paran, no entanto, esses marcadores no
conseguiram separar as T. a. angustula e T. a. fiebrigi.
Alves (2006) empregou RAPD para a anlise de trs populaes de jata no
noroeste do Paran, Ivatuba, Umuarama e Altnia, sendo que em Ivatuba foram
coletadas apenas T. a. angustula e em Umuarama e Altnia apenas T. a. fiebrigi.
Tais resultados mostraram que as duas espcies de abelhas esto separadas com
valores de distncia gentica que justificam a sua taxonomia, pois entre T. a.
angustula e T. a. fiebrigi o valor de distncia gentica de acordo com Nei (1978) foi
0,23 e entre as duas populaes de T. a. fiebrigi foi de 0, 0507.
Outro exemplo de marcador molecular baseado em tcnicas de PCR
descritos para estudos de estrutura de populaes, sistemtica, variabilidade
gentica e melhoramento gentico so os microssatlites. Regies microssatlites
so regies no genoma que apresentam seqncias repetitivas (em tandem) de
uma, duas, trs ou quatro seqncias de nucleotdeos, sendo a de duas sequncias
a mais comum. A funo destas regies ainda desconhecida, mas os
microssatlites se mostraram extremamente teis como marcadores moleculares no
mapeamento gentico de vrios organismos. Por ser um marcador co-dominante,
mostra-se bastante informativo para anlise de estrutura gentica de populaes
(Zane et al., 2002).
Os estudos genticos em abelhas com marcadores microssatlites foram
iniciados com Estoup et al. (1993, 1995a 1995b), que desenvolveram vrios primers
microssatlites para Apis mellifera e mamangava (Bombus terrestris).
Os primeiros 25 pares de primers microssatlites especficos para o gnero
Melipona foram desenhados por Peters et al. (1998) para a espcie Melipona
bicolor. Destes, 18 locos foram polimrficos para esta espcie.
Paxton et al. (1999) derrubaram a teoria de monandria no grupo dos
meliponneos quando desenvolveram 7 pares de primers para a espcie
Scaptotrigona postica. A anlise destes sete locos de microssatlites evidenciou
frequncias de acasalamento com um a trs machos para M. beecheii e de um a
seis machos para Scaptotrigona postica, demonstrando poliandria no grupo dos
meliponneos.

16
Contudo, a caracterizao de marcadores microssatlites tem demonstrado
que estes so bastante eficientes em separar espcies de abelhas sem ferro e no
estudo de evoluo dessas abelhas. No ano de 1998, foi realizado o primeiro
trabalho empregando microssatlites em abelhas da tribo Meliponini (Prez et al.,
1998), desenvolvendo primers para M. bicolor. Green et al. (2001), tambm
realizaram estudos para a obteno de marcadores microssatlites para Trigona
carbonaria, uma abelha sem ferro da Austrlia.
Francisco et al. (2006) caracterizou populaes de abelha Plebeia remota de
diferentes localidades do Brasil utilizando dois marcadores moleculares, o DNA
mitocondrial e microssatlites, com o objetivo de detectar aspectos evolutivos como
estruturao e fluxo gnico entre elas.
A importncia de marcadores microssatlites de abelhas sem ferro para
estudos de evoluo foi discutida por Arias et al. (2006). Outros estudos tm descrito
a importncia desses marcadores para o entendimento da sistemtica e evoluo de
abelhas sem ferro (Costa et al., 2003; Moretto e Arias, 2005; Quezada-Eun et al.,
2007).
Apesar de extremamente eficientes, o uso de marcadores microssatlites em
estudos de gentica populacional depende de uma etapa prvia, que consiste na
caracterizao e descrio destes locos no organismo que se deseja estudar.
Devido ao alto custo e tempo para o desenvolvimento de primers espcie-
especficos para locos microssatlites, muitos estudos vm utilizando cada vez mais
primers descritos para uma determinada espcie em outras espcies relacionadas
que ainda no possuem sequncias microssatlites descritas e validadas (Oliveira et
al., 2006).
Essa transferncia de primers microssatlite entre espcies relacionadas
uma vantagem para a utilizao desse marcador - esse processo denominado de
transferabilidade ou amplificao cruzada. Isso permite que outra espcie seja
avaliada com marcadores potentes, sem a necessidade de gastos com o
desenvolvimento de primers. Os primers que se comportam desta forma so
denominados heterlogos (Hoshino et al., 2002).
A transferabilidade de locos microssatlites pode ser extremamente alta
quando realizada em espcies ou gneros taxonomicamente relacionados.
Dependendo de sua localizao (se o loco est ou no presente em uma regio
codante do genoma) esta taxa pode ser ainda maior (Oliveira et al., 2006).

17
Os marcadores microssatlites permitem superar as deficincias dos outros
marcadores por apresentarem altos nveis de variabilidade em estado diplide e
serem altamente polimrficos (Tautz, 1989). Esses marcadores podero contribuir
para solucionar ou permitir entender a taxonomia de T. angustula.

18
3. MATERIAL E MTODOS
3.1. Coleta das abelhas T. angustula e T. fiebrigi
Operrias adultas de T. angustula e T. fiebrigi foram coletadas de ninhos
provenientes de quatro localidades (Figura 4; Quadro 1) dos estados de So Paulo e
Paran. De cada colnia foram coletadas, de forma aleatria, vinte abelhas na
entrada do ninho. Cinco indivduos de cada ninho foram analisados sob
estereomicroscpio Zeiss para verificar a colorao do mesepisterno. Os demais
indivduos foram estocados a -20C por duas semanas.


Figura 4 Mapa geogrfico do Brasil mostrando os pontos de coleta das abelhas T.
angustula e T. fiebrigi, nos estados de So Paulo e Paran.

19
Quadro 1 Coordenadas geogrficas dos pontos de coleta de T. angustula e T.
fiebrigi, o tipo de ninho e a quantidade de ninhos amostrados para caracterizao
dos locos microssatlites. N = nmero de indivduos coletados por ninho. C =
nmero de ninhos amostrados por localidade

Municpio/Estado
Coordenadas
Geogrficas
Tipo de Ninho
T. angustula
N (C)
T. fiebrigi
N (C)
Dracena (SP)
21 28' 57" S;
5131' 58" O
Natural 20 (1) 20 (4)
Maring (PR)
23 25' 30" S;
5156' 20" O
Natural/Racional 20 (4) 20 (1)
Santa Cruz do Rio Pardo (SP)
22 53' 56" S;
4937' 58" O
Natural 20 (5) -----
So Carlos (SP)
22 01' 04" S;
4753' 27" O
Natural 20 (3) 20 (2)
Total 20 260 (13) 140 (7)

3.2. Isolamento do DNA nuclear
O DNA foi isolado do trax de doze indivduos de cada ninho.
A extrao de DNA para o estudo de marcadores microssatlites foi
realizada como descrito por Yu et al. (1993) com algumas modificaes para T.
angustula e T. fiebrigi, como segue:
Os trax das operrias foram macerados individualmente em tubos de 1,5mL
contendo 300L de tampo de lise (EDTA 0,5M pH 8,0; NaCl 5M; SDS 0,5% [10%];
TrisHCl 1M pH 8,0) e 4L de Proteinase K. As amostras foram ento incubadas em
banho-maria por 1 hora a 65C, os tubos foram agitados ocasionalmente para
manter o substrato ressuspendido. Posteriormente as amostras foram centrifugadas
por 10 minutos a 12.000rpm, o sobrenadante foi transferido para outro tubo de
1,5mL, e adicionado igual volume de clorofrmio: lcool-isoamlico (24:1). As
amostras foram homogeneizadas invertendo os tubos delicadamente por trs
minutos e centrifugados novamente por 10 minutos a 12.000rpm - esta etapa foi
repetida duas vezes. O sobrenadante final foi transferido para outro tubo de 1,5mL e
adicionando-lhe 250L de isopropanol (gelado), invertendo os tubos delicadamente
por trs vezes para precipitao do DNA.
Os tubos foram acondicionados em freezer a -20C por toda a noite
(overnight). Posteriormente as amostras foram centrifugadas por 10 minutos a

20
12.000rpm, o sobrenadante foi descartado e o DNA lavado com etanol 70%
(gelado), centrifugado novamente nas mesmas condies. Aps isto, o
sobrenadante foi descartado e o DNA deixado para secar a temperatura ambiente
por aproximadamente 1 hora. Assim o DNA foi ressuspendido em 40L de TE (Tris-
HCl 1M pH 8,0; EDTA 0,5M pH 8,0) e mantido a temperatura ambiente por 2 horas,
posteriormente acondicionado em geladeira a -4C overnight. Aps esta etapa foi
adicionado ao ressuspendido 3L de RNAse e acondicionado em geladeira a -4C
por 3 dias.
A integridade e pureza dos DNAs extrados foram verificadas em gel de
agarose 0,8%, corados com brometo de etdeo e fotodocumentados no sistema
EDAS - Kodak 1 D Image Analysis 3.5. A quantificao foi baseada na intensidade
de banda quando comparadas com marcadores de peso molecular de DNA fago
Lambda de 50ng e 100ng.

3.3. Amplificao dos locos microssatlites
Inicialmente, utilizando cinco operrias de cada espcie provenientes de dois
ninhos localizados no campus da Universidade Estadual de Maring - UEM, foram
realizados testes para a amplificao de DNA empregando sete pares de primers
microssatlites, variando a temperatura de anelamento na Reao em Cadeia da
Polimerase (PCR). Dos primers escolhidos para teste, cinco foram desenvolvidos
para M. bicolor e dois para S. postica (Quadro 2).
As reaes do PCR foram realizadas em termocicladores Eppendorf, Applied
Biosystems e Techine, conforme o protocolo original descrito por Paxton et al.,
(1999), com modificaes de temperatura na etapa de desnaturao de 92C para
94C e tempo de extenso final de 30s para 45s. O processo de amplificao foi
iniciado por uma desnaturao inicial em 94C por 3 minutos, seguida por 40 ciclos
de 30 segundos a 94C, 1 minuto a temperatura especfica para cada primer
(Quadro 3), 45 segundos a 72C e 5 minutos a 72C para extenso final. As
concentraes timas dos reagentes para a PCR de todos os locos foram idnticas
para T. angustula e T. fiebrigi (Quadro 4), entretanto, alguns primers obedeceram a
diferentes temperaturas de anelamento. Tambm foi testado o programa
Touchdown-PCR para todos os primers (Quadro 5).


2
1

Quadro 2 Primers microssatlites testados para amplificao em T. angustula e T. fiebrigi. Espcie de origem, sequncia e
tamanho dos fragmentos gerados nas espcies para as quais os primers microssatlites foram desenvolvidos

Loco
Primer
(5 3)
Nmero de repeties
Tamanho dos
fragmentos
(em pb)
Espcie de origem do primer
T3-32
GCGGGAGGGAAAGTCCTCTCG
CGTCTTCGTCAGGCGTGC
(CT)21

125 Scaptotrigona postica
1

T7-5
GAGAGAGTCGGAGAAGAGGGC
TGGCGGAACCACTGGTCG
(CT)20 104 Scaptotrigona postica
1

Mbi259AAG
CGCGTTAACATTTCGCTA
CTGTTCGACTGTTCTCACTCT
(AGG)(AGA)5(GGA)2
GAA(GGA)2
183 Melipona bicolor
2

Mbi278AAG
GTTTAATCGCCCAAAGAGGC
GTTGCGAGAACTCTGACGAT
CTT(CTC)2CTTCTCTGCT
TCC(TCT)9CCTTCG(TCT)2
113 Melipona bicolor
2

Mbi254AAG
CAATCGTTGGAAGGAACGG
ACCTATACCCAAGTCCAT
(AAG)11 213 Melipona bicolor
2

Mbi215AAG
AGAGACGAAAAGTGGCGG
GATAGCGGCGGAGAGATT
(TTC)6

92 Melipona bicolor
2

Mbi33AAG
ATCACCTAACTTGGCATCCC
GATCAAGGGCCAAGAGGA
TTC(TCC)
2
TCTTC
(TCT)
2
(TCC)
3
140 Melipona bicolor
2

Paxton et al, 1999
1
; Peters et al., 1998
2



22
Os produtos das amplificaes foram submetidos eletroforese em gel de
agarose 4%, a 60v, utilizando o volume total da reao (20L) adicionado a 2L de
load (azul de bromofenol [0,25%] + glicerol [30%]).
Para determinao do tamanho dos fragmentos amplificados foi utilizado o
marcador de peso molecular Ladder 1Kb Invitrogen

. Os gis foram corados em


soluo de brometo de etdeo por 30 minutos para visualizao das bandas e
fotodocumentados em sistema EDAS - Kodak 1 D Image Analysis 3.5.

3.4. Anlise dos dados
As anlises dos dados moleculares envolveram a interpretao das bandas
de DNA genmico obtidas e a heterozigosidade gentica foi determinada pela
porcentagem de alelos polimrficos. Os coeficientes de diferenciao gentica foram
calculados utilizando o programa POPGENE 1.31 (Yeh et al., 1999).

Quadro 3 Temperaturas de anelamento especficas (E), conforme recomendaes
dos autores, e temperaturas testadas (T), para adaptao dos primers na
amplificao de DNA de T. angustula e T. fiebrigi

Primers
Temperaturas de anelamento
E T
T7-5 60C
1
Touchdown*/62C
T3-32 60C
1
Touchdown*
Mbi 33 60C
2
Touchdown*
Mbi 215 57.5C
2
Touchdown*/60C/62C/64C/67C
Mbi 254 55C
2
Touchdown*
Mbi 259 57.5C
2
Touchdown*
Mbi 278 60C
2
Touchdown*
1
Paxton et al., 1999;
2
Peters et al., 1998; Touchdown*- PCR Don et al., 1991.


23
Quadro 4 Reagentes utilizados na PCR para amplificao dos locos
microssatlites

Reagentes Concentrao
Enzima Taq Dna Polimerase (Platinum) 1u
Cloreto de Magnsio (MgCl
2
) 2,5mM
Tampo da enzima Taq Platinum 2,0L
Deoxinucleotdeos (dNTPs) 0,4mM
Primers (Foward e Reverse) 0,4M
DNA 10ng
Total da Reao (L) 20


Quadro 5 Programa Touchdown-PCR com temperatura variando de 65C a
55C

Passo Etapa Temperatura Programa Towchdown
1
1 Desnaturao inicial 94C 1min
2 Desnaturao 94C 1min
3 Anelamento 65C (-1C/ciclo) 1min
4 Extenso 72C 2min
5
Volta ao passo 2,
9 vezes

6 Desnaturao 94C 1min
7 Anelamento 55C 1min
8 Extenso 72C 2min
9
Volta ao passo 9,
17 vezes

10 Extenso final 72C 2min
11 Imerso 15C -
Don et al., 1991
1
.

24
4. RESULTADOS E DISCUSSO
Os sete pares de primers testados para T. angustula e T. fiebrigi foram
transferveis, j que resultaram em produtos amplificados. Entretanto apenas
cinco primers (T3-32, Mbi33, Mbi215, Mbi254 e Mbi259) foram escolhidos para
anlise destas espcies, pois demonstraram qualidade na amplificao dos
locos microssatlites. Na figura 5 so mostrados os resultados da amplificao
com o primer T3-32.
Para anlise de divergncia gentica foram utilizados um primer de S.
postica (T-32) e quatro primers de M. bicolor.



Figura 5 Amplificao com o loco microssatlite T3-32 para T. fiebrigi
(nmeros 1 a 10) e T. angustula (nmeros 11 a 20).

Cada primer obteve uma temperatura tima de anelamento durante as
reaes de amplificao nas populaes estudadas (Quadro 6). Entretanto
depois de definida as melhores temperaturas, estas foram idnticas tanto para
T. angustula quanto T. fiebrigi.
Carvalho-Zilse et al. (2009) obtiveram resultados positivos na
transferabilidade de primers de M. bicolor para M. scutellaris (conhecida
popularmente como Uruu, nome indgena que significa abelha grande). Nesse
estudo foram amplificados cinco. Resultados semelhantes foram obtidos por
Brito et al. (2009) que desenvolveram primers microssatlites para T. angustula
que foram transferveis para outras espcies de abelhas sem ferro como T.
fiebrigi, T. weyrauchi, Lestrimelitta maracaia e Schwarziana quadripunctata.
Nove locos microssatlites foram caracterizados em M. seminigra merrillae da

25
Amaznia Central os quais apresentaram transferabilidade para outras trs
espcies de Melipona (Francini et al., 2009).

Quadro 6 Temperatura de anelamento para amplificao dos cinco locos
microssatlites escolhidos para anlise de T. angustula e T. fiebrigi.

Loco Temperatura tima de anelamento
T3-32 Touchdown
Mbi 33 Touchdown
Mbi 215 64C
Mbi 254 55C
Mbi 259 57.5C

O desenvolvimento de primers microssatlites para uma espcie de
abelha sem ferro tem grande potencial para ser empregado em vrias
espcies como tem demonstrado os estudos desenvolvidos com esse
marcador molecular.
O sucesso de amplificao declina de acordo com a distncia gentica
entre os taxa (Primmer e Meril, 2000), ou seja, a proximidade filogentica o
principal fator no sucesso da transferncia para uso de primers heterlogos.
Porm, outros fatores como o tamanho e a complexidade do genoma e a
localizao do microssatlite (se est em regio codificante ou no) tambm
influenciam no processo de transferabilidade (Oliveira et al., 2006).
Alm disso, a utilizao de primers heteroespecficos pode produzir
alelos nulos, pois qualquer mutao que ocorra na sequncia de DNA
complementar ao primer pode inibir ou impedir a ligao destes, levando a uma
reduo ou perda completa do produto PCR (Callen et al., 1993).
Esses fatores poderiam explicar a amplificao no satisfatria dos
primers T7-5 e Mbi278, que apresentaram respectivamente monomorfismo e
bandas inespecficas (Figura 6), o que no permitiu a definio dos locos
microssatlites para anlise. A falta de compatibilidade no genoma para
transferncia de microssatlites ocorreu no estudo realizado por Francisco et
al. (2006) com o primer T7-5 com Plebeia remota, Partamona mulata e
Partamona helleri.

26
A utilizao de primers heterlogos pode resultar em amplificaes de
locos de sequncias com tamanho e/ou composio diferentes de bases entre
as espcies (Brito et al., 2009).














Figura 6 Locos T7-5 e Mbi278, respectivamente exemplos de monomorfismo
(A) e amplificao no satisfatria (B), a qual impediu a definio do loco

No quadro 7 pode ser observado que os cinco locos microssatlites
analisados para T. angustula e T. fiebrigi, apresentaram nmero de alelos que
variaram entre dois e quatro alelos, com tamanhos variando de 100pb a 500pb.
O alelo que apresentou a menor frequncia foi o Mbi215-A de T. fiebrigi e o de
maior frequncia foi o alelo Mbi33-A de T. angustula (Quadro 7).
No estudo realizado por Paxton et al. (1999) foi identificado apenas um
alelo para o loco T3-32 em T. nigra, enquanto em nosso estudo foram
identificados quatro alelos para T. fiebrigi. Francisco et al. (2006) tambm
encontraram um e dois alelos para o loco Mbi33 quando transferiram estes
para uso em P. remota e Tetragona clavipes, respectivamente. O mesmo
ocorreu com os locos Mbi215 e Mbi254, entretanto quando comparados os
resultados para o locos Mbi259, este apresentou maior nmero de alelos (6)
nas espcies estudadas por Francisco et al. (2006) do que para T. angustula
(4). Nas abelhas M. scutellaris foram identificados 31 alelos no total, variando
entre dois a 10 alelos por loco (Carvalho-Zilse et al., 2009).
A B

27
Quadro 7 Tamanho e frequncia dos alelos (F) microssatlites de T. fiebrigi e
T. angustula nas populaes dos estados de So Paulo e Paran. pb = pares
de bases

T. fiebrigi T. angustula
Loco Alelos (pb) F Alelos (pb) F
T3-32 A 0,3000 A 0,1792
B 0,4000 B 0,5917
C 0,2000 C 0,2292
D 0,1000
Mbi33 A 0,8063 A 0,9792
B 0,1938 B 0,0208
Mbi215 A 0,0063 A 0,0125
B 0,0437 B 0,0667
C 0,1000 C 0,0875
D 0,8500 D 0,8333
Mbi254 A 0,0625 A 0,1833
B 0,4250 B 0,5833
C 0,4000 C 0,1375
D 0,1125 D 0,0958
Mbi259 A 0,4430 A 0,2689
B 0,1962 B 0,2521
C 0,3228 C 0,3782
D 0,0380 D 0,1008

Lopes (2008), empregando os primers Mbi215, Mbi254 e 1 em M.
rufiventris e M. mondury, observou um menor nmero de alelos para estas
espcies quando comparadas com M. bicolor.
A anlise intrapopulacional de T. angustula permitiu verificar que o
alelo Mbi259-A especfico da populao de Santa Cruz do Rio Pardo e que o
alelo T3-32D foi detectado apenas em T. fiebrigi. Ser necessrio um estudo
populacional mais abrangente com maior nmero de populaes, mas
inicialmente podemos inferir que esses alelos podero ser utilizados como
marcadores para identificao de populaes ou de espcie na localidade
analisada.
Os menores valores de heterozigosidade observados foram estimados
para o loco Mbi33 de T. fiebrigi (0,0625) e T. angustula (0,0250) (Quadro 8).
Os maiores valores foram observados no loco T3-32 para T. fiebrigi (0,2750) e
Mbi215 para T. angustula (0,2333) (Quadro 8). Os valores de heterozigosidade

28
esperada maiores que os de heterozigosidade observada indicam que h falta
de heterozigotos (Quadro 8), esses resultados foram confirmados com os
valores de F
IS
(Quadro 9).

Quadro 8 Valores de heterozigosidade observada (Ho) e esperada (He)
obtidas com marcadores microssatlites para T. fiebrigi e T. angustula dos
estados de So Paulo e Paran

T. fiebrigi T. angustula

Loco Ho He Ho He
T3-32

0,2750 0,7044 0,0333 0,5677
Mbi33
0,0625 0,3144 0,0250 0,0410
Mbi215
0,2500 0,2672 0,2333 0,2945
Mbi254
0,1500 0,6469 0,1583 0,6005
Mbi259
0,0633 0,6638 0,0504 0,7140
Mdia 0,1602 0,5193 0,1001 0,4435
Desvio 0,1004 0,2103 0,0918 0,2727

Os valores positivos de F
IS
mostram que h excesso de homozigotos
nas populaes analisadas (Quadro 9), somente o loco Mbi215 de T. fiebrigi
apresentou F
IS
negativo, mas prximo zero (-0,0542). Nas duas espcies foi
observado que as populaes analisadas esto moderadamente diferenciadas
de acordo com os valores F
ST
mostrados no quadro 9. De acordo com Wright
(1984) valores F
ST
entre 0,15 e 0,25 indicam populaes moderadamente
diferenciadas. Nessa tabela pode ser observado tambm que no h fluxo
gnico entre as populaes, pois foram obtidos pequenos valores de Nm.
O maior valor de identidade gentica de acordo com Nei (1978) foi observado
entre as populaes de T. angustula e T. fiebrigi de So Carlos (0,9906)
(Quadro 10). Esses resultados tambm podem ser bem visualizados no
dendrograma da anlise UPGMA Figura 8.
A grande identidade gentica entre essas abelhas pode estar
relacionada com a provvel hibridizao entre as duas espcies de jata nessa

29
localidade, pois nas anlises morfolgicas de operrias coletadas, foram
observadas abelhas com mesepisterno marrom, amarelo e com as duas
coloraes ao mesmo tempo (Figura 1). A hibridizao entre as duas espcies
foi observada anteriormente por Castanheira e Contel (1995). Nesse estudo foi
sugerida a ocorrncia de duas subespcies de Tetragonisca ao invs de duas
espcies. Contudo, esse tipo de colorao no mesepisterno no foi observada
nas demais populaes analisadas. Mesmo em Maring, onde encontramos as
duas espcies, at o momento no foram observadas abelhas com colorao
hbrida do mesepisterno.

Quadro 9 ndice de fixao (F
IS
), grau de diferenciao (F
ST
) e fluxo gnico
(Nm) obtidos com marcadores microssatlites em T. fiebrigi e T. angustula dos
estados de So Paulo e Paran

T. fiebrigi T. angustula
Loco F
IS
F
IT
F
ST
Nm FI
S
F
IT
F
ST
Nm
T3-32 0, 2733 0, 3977 0, 1712 1, 2103 0, 9347 0, 9516 0, 1389 1, 5493
Mbi33 0, 7230 0, 7736 0, 1827 1, 1182 0, 0123 0, 1036 0, 0924 2, 4545
Mbi215 -0, 0542 -0, 0061 0, 0456 5.2270 0, 2660 0, 3390 0, 0995 2, 2621
Mbi254 0, 6746 0, 7158 0, 1265 1.7256 0, 5602 0, 6211 0, 1384 1, 5560
Mbi259 0, 8766 0, 9297 0, 4303 0, 3310 0, 8526 0, 8923 0, 2692 0, 6788
Mdia 0, 5121 0, 6169 0, 2148 0, 9140 0,6 922 0, 7460 0, 1746 1, 1816

Os maiores valores de distncias genticas foram obtidos entre as
populaes de T. fiebrigi de Maring e T. angustula de Dracena. Considerando
essas duas localidades as duas espcies estariam totalmente isoladas.
O agrupamento UPGMA mostrou que as duas espcies de
Tetragonisca ainda no esto totalmente diferenciadas, pois houve
agrupamento de T. fibebrigi e T. angustula das populaes de So Carlos,
Maring e Dracena, bem como Santa Cruz do Rio Pardo e Maring (Figura 7).
A populao de T. angustula de Dracena ficou mais prxima das
populaes de So Carlos (T. angustula e T. fiebrigi) e Maring (T. angustula).
A ocorrncia do alelo Mbi254-A nas populaes de T. angustula de
Santa Cruz do Rio Pardo pode ter influenciado a sua separao das

30
populaes de T. angustula de Maring, So Carlos e Dracena, bem como de
T. fiebrigi de So Carlos (Figura 7).

Quadro 10 Valores da identidade gentica (acima da diagonal) e distncia
gentica (abaixo da diagonal) de Nei (1978) obtidos pelo programa Popgene
1.31 para as populaes de T. angustula (T.a) e T. fiebrigi (T.f) analisadas com
marcadores microssatlites



O agrupamento de T. fiebrigi de Maring e T. angustula de Santa Cruz
Do Rio Pardo (Figura 7) mostra que ser necessrio aumentar a amostragem
para entender de forma mais completa a estruturao dessas populaes j
que as duas espcies apresentaram baixos valores de distncia gentica
(Quadro 10).
Oliveira et al. (2004), utilizando marcadores RAPD, conseguiram
separar T. angustula e T. fiebrigi em dois grupos. Estudo com o marcador
RAPD desenvolvido por Baitala et al. (2006) demonstrou que a populaes de
T. angustula e T. fiebrigi de Maring e Cianorte (PR) esto isoladas das
populaes de Junqueirpolis (SP), devido ao valor G
ST
de 0,2568. Nessa
pesquisa foram identificados seis marcadores RAPD que diferenciavam as
populaes de jata, contudo no foram capazes de separar as espcies.
Nesse estudo foi observado que as abelhas jata das duas localidades
no esto diferenciadas, formando uma nica populao, apesar da distncia
geogrfica entre elas.
Em P. mulata e P. helleri a anlise microssatlite mostrou que as
populaes dessas abelhas possuem baixo polimorfismo gentico e discreta

31
estruturao de populaes no relacionada com a distribuio geogrfica
(Brito et al., 2009). Nesse estudo foi considerado ainda que essas
caractersticas observadas poderiam estar relacionadas com a migrao de
machos, degradao ambiental que ocasionou fragmentao ambiental, ou
pela ocorrncia de alelos nulos decorrentes da utilizao de primers
heteroespecficos.

















Figura 7 Dendrograma baseado no complemento aritmtico da distncia
gentica de Nei (1978), obtido por marcadores microssatlites. As populaes
de T. fiebrigi e T. angustula foram agrupadas pelo mtodo UPGMA, utilizando
o programa Popgene 1.31.

Nas populaes de T. fiebrigi e T. angusutla estudadas foi observado
alto polimorfismo gentico, as populaes esto diferenciadas, mas com
excesso de homozigotos. Os resultados obtidos com os dois gneros de
Tetragonisca podem ser comparados com as consideraes feitas por Brito et
al. (2009) para Partamona, pois as regies de coleta possuem degradao da
mata original (atualmente so reas rurais ou urbanas), o que pode dificultar a
migrao de machos, alm disso, os primers utilizados no presente estudo
tambm so heterlogos o que pode ter ocasionado a ocorrncia de alelos
nulos, subestimando a variabilidade gentica.

32
Na pesquisa realizada por Carvalho-Zilse et al. (2009) com M.
scutellaris no nordeste brasileiro, foi verificada deficincia de heterozigotos.
Nesse caso foi discutido que o excesso de homozigotos poderia ser decorrente
de migrao no natural devido troca de abelhas entre meliponicultores dos
estados de Pernanbuco e Alagoas.
As abelhas jata sofrem forte influncia antrpica por serem de
pequeno porte e fcil manejo, j que o ferro atrofiado; os ninhos podem ser
levados para longas distncias e assim trocarem material gentico em regies
que naturalmente no chegariam.
Apesar do aparente isolamento de populaes como em Santa Cruz do
Rio Pardo e Dracena, as T. fiebrigi e T. angustula provavelmente no esto
totalmente isoladas reprodutivamente, pois as populaes de So Carlos
mostraram fortes indcios de que houve cruzamento entre as duas espcies de
jata.
Assim, o desenvolvimento de primers heteroespecficos ou
homoespecficos de grande importncia para o entendimento das relaes
intra/inter populacionais e evolutivas dessas abelhas.

33
5. CONCLUSES
a) O estabelecimento de primers microssatlites heteroespecficos para
T. fiebrigi e T. angustula pode ser utilizado com bons resultados, pois foi
observada ampla variabilidade gentica para os locos estudados;
b) Os locos analisados no permitiram separar as duas espcies de
Tetragonisca, sendo possvel apenas separar as populaes analisadas;
c) As populaes analisadas esto diferenciadas, contudo foi detectado
excesso de homozigotos que pode ser decorrncia de consanginidade entre
os ninhos de cada localidade, ou da presena de alelos nulos devido
utilizao de primers heterlogos;
d) Os valores de distncia gentica e caractersticas morfolgicas
indicam que houve hibridizao entre T. fiebrigi e T. angustula em So Carlos.

34
6. REFERNCIAS BIBLIOGRFICAS
ABSY, M.L.; BEZERRA, E.B.; KERR, W.E. Plantas nacterferas utilizadas por
duas espcies de Melpona da Amaznia. Acta Amazonica, 10:271-281, 1980.

ALLENDORF, F.W.; LUIKART, G. Conservation and the genetics of
populations. Blackwell Publishing, Australia, 2007. 642p.

ALONSO, W.J. As abelhas sem ferro: centenas de espcies para polinizao,
produo de mel, lazer e educao. Artigos tcnicos. Animais de criao -
abelhas, 626:30-33, 1998.

ALVES, D.J. Uso do marcador molecular RAPD para estudo de
polimorfismos em populaes de Tetragonisca angustula L. (Apidae:
Meliponinae). Maring: Universidade Estadual de Maring, 2006. 45p.
Dissertao (Mestrado em Gentica e Melhoramento).

ARIAS, M.C.; BRITO, R.M.; FRANCISCO, F.O.; MORETTO, G.; OLIVEIRA, F.
F.; SILVESTRE, D.; SHEPPARD, S. Molecular markers as a tool for population
and evolutionary studies of stingless bees. Apidologie, 37:259-274, 2006.

BAITALA, T.V.; MANGOLIN, C.A.; TOLEDO, V.A.A.; RUVOLO-TAKASUSUKI,
M.C.C. RAPD Polymorphism in Tetragonisca angustula (Hymenoptera;
Meliponinae, Trigonini) Populations. Sociobiology, 48:861-873, 2006.

BORASCHI, D.; DEL LAMA, M.A. Population genetic structure and sociogenetic
structure of cocoon masses of Digelasinus diversipes (Kirby, 1882)
(Hymenoptera: Symphyta: Argidae). Genetics and Molecular Biology, 27:385-
390, 2004.

BRITO, R.M.; FRANCISCO, F.O.; DOMINGUES-YAMADA, A.M.T.;
GONALVES, P.H.; PIOKER, P.F.C.; SOARES, A.E.E.; ARIAS, M.C.

35
Characterization of microsatellite loci of Tetragonisca angustula (Hymenoptera,
Apidae, Meliponini). Conservation Genetics Resources, 1:183187, 2009.

CALLEN, D.F.; THOMPSON A.D.; SHEN, Y.; PHILLIPS, H.A. RICHARDS, R.;
MULLEY, J.C.; SUTHERLAND, G.R. Incidence and Origin of "Null" Alleles in
the (AC)n Microsatellite Markers. American Journal of Human Genetics,
52:922-927, 1993.

CAMARGO, J.M.F.; MENEZES-PEDRO, S.R. Systematics, phylogeny and
biogeography of the Meliponinae (Hymenoptera, Apidae): a mini-review.
Apidologie, 23:509-522, 1992.

CAMARGO, J.M.F.; PEDRO, S.R.M. Meliponini Lepeletier, 1836, in: MOURE,
J.S.; URBAN, D.; MELO, G.A.R. (Orgs). Catalogue of Bees (Hymenoptera,
Apoidea) in the Neotropical Region - online version. Disponvel em:
http://www.moure.cria.org.br/catalogue. Acesso em: 12, fevereiro, 2011.

CARVALHO-ZILSE, G.A.; COSTA-PINTO, M.F.F.; NUNES-SILVA, C.G.;
KERR, W.E. Does beekeeping reduce genetic variability in Melipona scutellaris
(Apidae, Meliponini), Genetics and molecular research, 8:758-765, 2009.

CASTANHEIRA, E.B.; CONTEL, E.P. Isoenzymes related to flight activity in
Tetragonisca angustula (Hymenoptera: Apidae: Meliponinae): evidence of
postranslational modification of the hexokinase and detection of new glycerol-3-
phosphate dehydrogenase variants. Biochemical genetics, 33:365-375, 1995.

CASTANHEIRA E.B.; CONTEL E.P.B. Geographic variation in Tetragonisca
angustula (Hymenoptera, Apidae, Mliponinae), Journal of Apicultural
Research, 44:101-105, 2005.

CORTOPASSI-LAURINO, M.; NOGUEIRA-NETO, P. Notas sobre a bionomia
de Tetragonisca weyrauchi Schwarz, 1943 (Apidae, Meliponini). Acta
Amazonica, 33:643-650, 2003.

36
CORTOPASSI-LAURINO, M. A abelha jata: uma espcie bandeira?
Mensagem doce. 80. Disponvel em: http://www.apacame.org.br/
mensagemdoce/80/meliponicultura.htm. Acesso em: 12, outubro, 2010.

COSTA, R.G.; TAVARES, M.G.; DIAS, L.A.S.; CAMPOS, L.A.O. Isoenzyme
variation in Melpona rufiventris (Hymenoptera: Apidae, Meliponina) in Minas
Geral State, Brazil. Biochemical Genetics, 43:49-58, 2003.

DON, R.H.; COX, P.T.; WAINWRIGHT, B.J.; BAKER, K.; MATTICK, J.S.
Towchdown PCR to circumvent spurious priming during gene amplification.
Nucleic Acids Research, 19:4008-4008, 1991.

ESTOUP, A.; SOLIGNAC, M.; HARRY, M; COURNUET, J.M. Characterization
of (GT)n and (CT)n microsatellites in two insect species: Apis mellifera and
Bombus terrestris. Nucleic Acids Research, 21:1427-1431, 1993.

ESTOUP, A.; SCHOLL, P.A.; SOLIGNAC, M. Monondry and polyandry in
bumble bees (Hymenoptera: Bombinae) as evidence by highly variable
microsatellites. Molecular Ecology, 4:89-93, 1995a.

ESTOUP, A.; TAILLIEZ, C.; COURNET, J.M.; SOLIGNAC, M. Size homoplasy
and mutational processes of interrupted microsatellites in two species: Apis
mellifera and Bombus terrestris (Apidae). Molecular Biology Evolution,
12:1074-1084, 1995b.

FABICHAK, I. Abelhas indgenas sem ferro Jata. So Paulo: Nobel,
1987.53p.

FALCO, T.M.M.A.; CONTEL, E.P.B. Genetic variability in natural populations
of Brazilian social bees. Isozyme patterns and polymorphism for esterases and
total protein. Revista Brasileira de Gentica, 13:731-54, 1990.

FALCO, T.M.M.A.; CONTEL, E.P.B. Genetic variability in natural populations
of Brazilian social bees. I. Eletrophoretic data for PGM and MDH give evidence

37
for multiple fertilization in stingless bees. Revista Brasileira de Gentica,
14:47-59, 1991.

FERREIRA, M.E.; GRATTAPAGLIA, D. Introduo ao uso de marcadores
moleculares em anlise gentica. Braslia: Embrapa-Cenargen, 1998. 220p.

FRANCINI, I.B.; SFORA, D.A.; SOUSA, A.C.B.; CAMPOS, T.; CIDADE, F.W.;
ZUCCHI, M.I.; SOUZA, A.P.; NUNES-SILVA, C.G.; CARVALHO-ZILSE, G.A.
Microsatellite loci for an endemic stingless bee Melipona seminigra merrillae
(Apidae, Meliponini) from Amazon. Conservation Genetics Resources, 1:487-
490. 2009.

FRANCISCO, F.O.; BRITO, R.M.; ARIAS, M.C. Systematics, morphology and
physiology alelle number and heterozigosity for microsatellite loci in different
stingless bee species (Hymenoptera: Apidae, Meliponini). Neotropical
Entomology, 35:638-643, 2006.

FREITAS, G.S.; SOARES, A.E.E. Procurando Ir: um passeio ecolgico.
Ribeiro Preto: Faculdade de Filosofia, Cincias e Letras de Ribeiro Preto,
Faculdade de Medicina de Ribeiro Preto, 2004. 35p.

GREEN, C.L.; FRANCK, P.; OLDROYD, B.P. Characterization of microsatellite
loci for Trigona carbonaria, stingless bee endemic to Australia. Molecular
Ecology Notes, 1:89-92, 2001.

HALL, P.; WALKER, S.; BAWA, K. Effect of forest fragmentation on genetic
diversity and mating system in a tropical tree, Pithecellobium elegans.
Conservation Biology, 10:757-768, 1996.

HOSHINO, A.A.; PALMIERI, D.A.; BRAVO, J.P.; PEREIRA, T.E.B.; LOPES,
C.R.; GIMENES, M.A. Marcador microssatlite na conservao de
germoplasma vegetal. Biotecnologia, Cincia e Desenvolvimento, 29:146-
146, 2002.


38
IMPERATRIZ-FONSECA, V.L.; KLEINERT-GIOVANINI, A.; CORTOPASSI-
LAURINO, M.; RAMALHO, M. Hbitos de coleta de Tetragonisca angustula
Latreille (Hymenoptera, Apidae, Meliponinae). Boletim de Zoologia da
Universidade de So Paulo, 8:115-131, 1984.

KAGEYAMA, P.Y. Conservao in situ de recursos genticos de plantas.
Instituto de Pesquisas e Estudos Florestais, 12:65-70, 1987.

KERR, W.E. Population genetics studies in bees. II Sex-linked genes.
Evolution, 30:94-99, 1976.

KERR, W.E.; CUNHA, R.; PISANI, J.F. Gentica de determinao de sexo.
Aplicao de mtodos numricos para agrupar sexos e castas de Melipona
quadrifasciata anthidioides Lep. (Apidae). Revista Brasileira de Biologia,
38:319-394, 1978.

KERR, W.E.; NASCIMENTO, V.A.; CARVALHO, G.A. H salvao para os
Meliponneos? In: ENCONTRO SOBRE ABELHAS DE RIBEIRO PRETO.
Ribeiro Preto,1994. Resumos... Ribeiro Preto: Universidade de So Paulo,
Faculdade de Filosofia Cincias e Letras, 1994, p. 60-66.

KERR, W.E.; CARVALHO, G.A.; NASCIMENTO, V.A. Abelha Uruu: biologia,
manejo e conservao. Belo Horizonte: Acanga, 1996. 144p.

KOLING, D.F.; MORETTO, G. Mitochondrial discrimination of stingless bees
Tetragonisca angustula (Apidae: Meliponini) from Santa Catarina state, Brazil.
Apidologie, 41:454-462, 2009.

KUMAR, L.S. DNA markers in plant improvement: an overview. Biotechnology
Advances, 17:143-182, 1999.

LOPES, M.; FERREIRA, J.B.; SANTOS, G. Abelhas sem-ferro: a
biodiversidade invisvel. Agriculturas, 16:7-9, 2005.


39
LOPES, D.M. Anlises moleculares em Melipona rufiventris e Melipona
mondury (Hymenoptera: Apidae). Viosa: Universidade Federal de Viosa,
2008. 85p. Tese (Doutorado em Biologia Celular e Estrutural).

MACHADO, M.F.P.S.; CONTEL, E.P.B. Glycerol-3-phosphate dehydrogenase
isozyme vaiation in adult meliponids (Hymenoptera: Apidae). Biochemical
Genetics, 29:593-600, 1991.

MACAS-MACAS O.; CHUC, J.; ANCONA-XIU, P.; CAUICH O.; QUEZADA-
EUN, J.J.G. Contribution of native bees and africanized honey bees
(Hymenoptera: Apoidea) to solanaceae crop polinattion in tropical Mexico.
Journal of Applied Entomology, 133:456-465, 2009.

MALAGODI-BRAGA, K.S.; KLEINERT, A.M.P. Could Tetragonisca angustula
Latreille (Apinae, Meliponini) be used as strawberry pollinator in greenhouses?
Australian Journal of Agricultural Research, 55:771-773, 2004.

MENEZES-PEDRO S.R.; CAMARGO J.F.M. Biodiversidade do estado de So
Paulo: sntese do conhecimento ao final do sculo XX. Apoidea, Apiformes. In:
BRANDO, C.R.; CANCELLO, E.M. Invertebrados terrestres. So Paulo:
FAPESP, 2000, p. 193-211.

MICHENER, C.D. The bees of the world. Baltimore: The John Hopkins
University, 2000. 913p.

MORAN, G.F.; MUONA, O.; BELL, J.C. A tropical forest tree of the coastal
lowlands with low genetic diversity. Evolution, 43:231-235, 1989.

MORETTO, G.; ARIAS, M.C. Systematics, morphology and physiology
detection of mitochondrial dna restriction site differences between the
subspecies of Melipona quadrifasciata lepeletier (Hymenoptera: Apidae:
Meliponini). Neotropical Entomology, 34:381-385, 2005.


40
MOURE, J.S.A. Preliminary supra-especific classification of the old world
meliponine bees (Hymenoptera, Apoidae). Journal Studia Entomology, 4:181-
242, 1961.

MOURE, J.S.; URBAN, D.; MELO, G.A.R. (orgs). Catalogue of bees
(Hymenoptera, Apoidea) in the neotropical region. Disponvel em:
http://www.moure.cria.org.br/catalogue. acesso em: 12, fevereiro, 2011.

MOSS, D.W. Isoenzymes. London: Capman & Hall, 1992. 123p.

NASON, J.D.; HAMRICK, J.L. Reproductive and genetic consequences of
Forest fragmentation: Two case studies of neotropical canopy trees. Journal of
Heredity, 88:264-276, 1997.

NEI, M. Estimation of average heterozygosity and genetic distance from a small
number of individuals. Genetics, 89:583-590, 1978.

NOGUEIRA-NETO, P. Vida e criao de abelhas indgenas sem ferro. So
Paulo: Nogueirapis, 1997. 57p.

NOGUEIRA-NETO, P. Ainda a questo da viabilidade gentica e ecolgica das
pequenas populaes e dos fragmentos florestais. In: V ENCONTRO SOBRE
ABELHAS. Resumos... Ribeiro Preto, 2002. Ribeiro Preto: Universidade de
So Paulo, Faculdade de Filosofia Cincias e Letras, 2002, p.15-17.

OLIVEIRA R.C.; NUNES, F.M.F.; CAMPOS, A.P.S.; VASCONCELOS, S.M.;
ROUBIK, D.; GOULART, L.R.; KERR, W.E. Genetic divergence in Tetragonisca
angustula Latreille, 1811 (Hymenoptera, Meliponinae, Trigonini) based on
RAPD markers. Genetics and Molecular Biology, 27:181-186, 2004.

OLIVEIRA, E.J.; PDUA, J.G.; ZUCCHI, M.I.; VENCOVSKY, R.; VIEIRA,
M.L.C. Origin, evolution and genome distribution of microsatellites. Genetics
and Molecular Biology, 29:294-307, 2006.

41
OLIVEIRA, A.C.B.; CAIXETA, E.T.; ZAMBOLIM, E.M.; ZAMBOLIM, L.;
SAKIYAMA, N.S. Aplicao tcnica de marcadores moleculares no
melhoramento de plantas. Campinas: Instituto Agronmico, 2007.
(Documentos, 81).

PAXTON, R.J.; WEISCHUH, N.; QUEZADA-EUAN, J.J.G. Characterization of
dinucleotide microsatellite loci for stingless bees. Molecular Ecology, 8:690-
692, 1999.

PREZ, T.; ALBORNOZ, J.; DOMNGUEZ, A. An evaluation of RAPD fragment
reproducibility and nature. Molecular Ecology, 7:1347-1357, 1998.

PETERS, J.M.; QUELLER, D.C.; IMPERATRIZ-FONSECA, V.L.;
STRASSMANN, J.E. Microsatellite loci for stingless bees. Molecular Ecology,
7:784-787, 1998.

PRIMMER, C.R.; MERIL, J. A low rate of cross-species microsatellite
amplification success in Ranid frogs. Conservation Genetics, 3:445-449,
2000.

PRONI, E.A. Biodiversidade de abelhas indgenas sem ferro (Hymenoptera:
Apidae: Meliponinae) na bacia do rio Ribagi, estado do Paran, Brasil.
Arquivos de Cincias Veterinrias de Zoologia da UNIPAR, 3:145-150,
2000.

QUEZADA-EUN, J.J.G.; PAXTON, R.J.; PALMER, K.A.; ITZ, W.J.M.; TAY,
W.T.; OLDROYD, B.P. Morphological and molecular characters reveal
differentiation in a neotropical social bee, Melipona beecheii (Apidae:
Meliponini). Apidologie, 38:1-11, 2007.

ROUBIK, D.W. Ecology and natural history of tropical bees. Cambridge:
Cambridge University Press, 1989. 514p.


42
RUIZ, J.B. Anlise gentica de populaes em Tetragonisca angustula na
regio noroeste do Paran por meio de isoenzimas. Maring: Universidade
Estadual de Maring, 2006. 59p. Dissertao (Mestrado em Gentica e
Melhoramento).

RUVOLO-TAKASUSUKI, M.C.C.; VIANA, L.H.O.; BAITALA, T.V.; NICOLIN,
K.C.; TOLEDO, V.A.A. Characterization of esterases in Tetragonisca angustula
and Tetragonisca clavipes (Hymenoptera; Meliponinae). Brazilian Journal of
Morphological Sciences, 23:431-434, 2006.

SEVERSON, D.W.; MORI, A.; ZHANG, Y.; CHRISTENSEN, B.M. Linkage map
for Aedes aegypti using restriction fragment length polymorphisms. Journal of
Heredity, 84:241-247, 1993.

SILVEIRA, F.A.; MELO, G.A.R.; ALMEIDA, E.A.B. Abelhas brasileiras:
sistemtica e identificao. Belo Horizonte: F.A. Silveira, 2002. 253p.

SOUZA, A.P. Biologia molecular aplicada ao melhoramento. Recursos
Genticos e Melhoramento de Plantas. Rondonpolis: Fundao MT, 2001. p.
939-966.

STUCHI, A.L.P.B.; RUVOLO-TAKASUSUKI, M.C.C.; TOLEDO, V.A.A. Anlise
da Gentica de Populaes em Abelhas Jata (Tetragonisca angustula Latreille)
por meio de isoenzimas. Magistra, 20:68-77, 2008.

STUCHI, A.L.P.B. Avaliao da toxicidade e expresso gnica em abelhas
do gnero Tetragonisca aps a contaminao com agroqumicos. Maring:
Universidade Estadual de Maring, 2010. 93p. Tese (Doutorado em Zootecnia).

TAUTZ, D. Hypervariability of simple sequences as general source of
polymorphic DNA markers. Nucleic Acids Research, 17:6463-71, 1989.

VELTHUIS, H.W. Biologia das abelhas sem ferro. So Paulo: USP. 1997.
33p.

43
WILLE, A. Phylogeny and a relationships among the genera and subgenera of
the stingless bees (Meliponinae) of the world. Revista de Biologia Tropical,
27:241-277, 1979.

WRIGHT, S. Evolution and the genetics of populations, volume 4,
variability within and among natural populations. Chicago: The University of
Chicago Press, 1984. 580p.

YEH, F.C.; YANG, R.C.; BOYLE, T. Popgene version 1.32. Microsoft
Windows Based Freeware for Population Genetic Analysis. Canada:
University of Alberta, 1999.

YU, K.F.; DEYNZE A.V.; PAULUS, K.P. Random amplified polymorphic DNA
(RAPD) analysis. In: GLICK, BR. (ed.). Methods in plant molecular biology
and biotechnology. New York: Economic Botany, 1993, p. 287-301.

ZANE, L.; BARGELLONI, L.; PATERNELLO, T. Strategies for microsatellite
isolation: a review. Molecular Ecolology, 11:1-16, 2002.