Sei sulla pagina 1di 12

Genet Resour Crop Evol

DOI 10.1007/s10722-014-0128-z

RESEARCH ARTICLE

A comparative study of ancient DNA isolated from charred


pea (Pisum sativum L.) seeds from an Early Iron Age
settlement in southeast Serbia: inference for pea
domestication
Petr Smýkal • Živko Jovanović • Nemanja Stanisavljević •

Bojan Zlatković • Branko Ćupina • Vuk Ðord̄ević •


Aleksandar Mikić • Aleksandar Medović

Received: 5 November 2013 / Accepted: 2 May 2014


Ó Springer Science+Business Media Dordrecht 2014

Abstract The development of agriculture was a key 1,329 bp were successfully recovered in order to
turning point in human history, a central part of which distinguish between cultivated and wild gathered pea.
was the evolution of new plant forms, domesticated Based on identified mutations, the results showed that
crops. Grain legumes were domesticated in parallel genuine aDNA was analyzed. Moreover, DNA ana-
with cereals and formed important dietary components lysis resulted in placing the ancient sample at an
of early civilizations. First domesticated in the Near intermediate position between extant cultivated [Pi-
East, pea has been cultivated in Europe since the Stone sum sativum L. and wild P. sativum subsp. elatius
and Bronze Ages. In this study, we present a molecular (Steven ex M. Bieb.) Asch. et Graebn.]. Consequently,
analysis of ancient DNA (aDNA) extracted from based on a combination of morphological and molec-
carbonized pea seeds recovered from deposits at ular data, we concluded that the material represents an
Hissar, in southeast Serbia, that date to the eleventh early domesticated pea. We speculate that Iron Age
century B.C. Four selected chloroplast DNA loci pea would be of colored flower and pigmented testa,
(trnSG, trnK, matK and rbcL) amplified in six similar to today’s fodder pea (P. sativum subsp.
fragments of 128–340 bp with a total length of sativum var. arvense (L.) Poir.), possibly of winter
type. This is the first report of successful aDNA
extraction and analysis from any legume species thus
Electronic supplementary material The online version of far. The implications for pea domestication are
this article (doi:10.1007/s10722-014-0128-z) contains supple-
mentary material, which is available to authorized users. discussed here.

P. Smýkal (&) B. Ćupina


Department of Botany, Faculty of Science, Palacký Department of Field and Vegetable Crops, Faculty of
University in Olomouc, Šlechtitelů 11, 783 71 Olomouc, Agriculture, University of Novi Sad, Trg Dositeja
Czech Republic Obradovića 8, 21000 Novi Sad, Serbia
e-mail: petr.smykal@upol.cz
V. Ðord̄ević  A. Mikić
Ž. Jovanović  N. Stanisavljević Institute of Field and Vegetable Crops, Maksima Gorkog
Plant Molecular Biology Lab, Institute of Molecular 30, 21000 Novi Sad, Serbia
Genetics and Genetic Engineering, University of
Belgrade, P.O. Box 23, 11010 Belgrade, Serbia A. Medović
Museum of Vojvodina, Dunavska 35, 21000 Novi Sad,
B. Zlatković Serbia
Department of Biology and Ecology, Faculty of Sciences
and Mathematics, University of Niš, Višegradska 33,
18000 Niš, Serbia

123
Genet Resour Crop Evol

Keywords Ancient DNA  Archeogenetics  and to China (Makesheva 1979; Chimwamurombe and
Domestication  Early Iron Age  Legumes  Khulbe 2011; Zohary and Hopf 2000; Hancock 2012).
Pea Despite of the crucial position of legumes as protein
crops in the human diet, comparably little is known
about their domestication. The removal of seed dor-
Introduction mancy was by far the most important domestication
trait in legumes (Ladizinsky 1985; Abbo et al. 2013,
The development of agriculture was a key turning 2014). In the wild, many seeds exhibit dormancy and
point in human history, a central part of which was the will only germinate after exposure to certain environ-
evolution of new plant forms, domesticated crops. mental conditions or after the seed coat has been
Domestication occurs when cultivated plants consis- physically damaged. In contrast, seeds produced by
tently exhibit morphological (and genetic) changes not domesticated crops tend to germinate as soon as they
found in wild populations (Abbo et al. 2013, 2014). are imbibed and planted; meaning seed dormancy was a
These resulting changes represent adaptations to potentially unwanted trait. Moreover, seed imbibition
cultivation and human harvesting. Common sets of plays a crucial role in the ability to cook most grain
traits have been recorded in unrelated crops, which are legumes; it is often called hard-seededness due to the
said to display domestication syndrome (Hammer testa’s resistance to water permeability. Hence, reduc-
1984; Zohary and Hopf 2000). Similar human ing seed coat thickness led to a concurrent reduction of
demands led to similar adaptations of many domes- seed coat impermeability in all domesticated grain
tication traits over a wide range of plant species, legumes (Werker et al. 1979; Smartt 1990; Weeden
thereby providing numerous examples of convergent 2007). Seed dormancy was identified as a monogenic
phenotypic evolution (Lenser and Theißen 2013). trait in lentil (Lens culinaris Medik., Ladizinsky 1985),
These include two key traits: (1) loss of germination lupine (Lupinus angustifolius L., Forbes and Wells
inhibition (dormancy) and (2) loss of seed dispersal. 1968), yardlong (Vigna unguiculata (L.) Walp., Kon-
Members of the Fabaceae were domesticated as gjaimun et al. 2012), rice bean (V. umbellata (Thunb.)
grain legumes in parallel with cereals and formed Ohwi and Ohashi, Isemura et al. 2010), mungbean (V.
important dietary components of early civilizations radiata (L.) R. Wilczek, Isemura et al. 2012); associ-
(De Candolle 1884; Vavilov 1951; Hopf 1986; Smartt ated with one to two loci in common bean (Phaseolus
1990; Zohary and Hopf 2000; Abbo et al. 2014). vulgaris L., Koinange et al. 1996); and with two to three
Among the first legumes domesticated in the Fertile loci in pea (Pisum sativum L., Weeden 2007).
Crescent were members of the galegoid tribe: pea, Ladizinsky (1987) argued that the low germination
faba bean, lentil, grass pea and chickpea (Smýkal et al. rates in wild pulses, particularly Lens, would have
2014). Archaeological evidence of pea in the Near precluded successful cultivation due to their very low
East dates from 10,000 years before present (B.P.) yields from planted seeds. He therefore suggested that
(Baldev 1988; Zohary and Hopf 2000; Helbaek 1964, hunter–gatherers must have recognized favorable wild
1970; Fairbairn et al. 2002, 2005; Willcox et al. 2008) mutants with quick germination from which to begin
and suggests that the domestication of grain legumes cultivation. That germplasm could have been part of a
accompanied or possibly preceded that of cereals ‘pre-cultivation domestication’ process. Therefore,
(Baldev 1988; Kislev and Bar-Yosef 1988; Weiss et al. only after the seed dormancy-free mutation occurred
2006). Rich etymological evidence also supports the could lentils be cultivated (Ladizinsky 1979; Weiss
status of pea as one of the most ancient Eurasian crops et al. 2006). The experimental harvest of wild lentils by
(Mikić 2012). Later on, cultivation of pea spread from Abbo et al. (2008) provided strong support for Ladi-
the Fertile Crescent to southern Europe, where it has zinsky’s (1979, 1985, 1987, 1998) arguments. This also
been cultivated since the Stone and Bronze Ages holds true for pea, as intact wild pea seeds have a
(Zohary and Hopf 2000), and westward through the germination rate of only 2.6–7 % in a given year (Abbo
Balkans (Kroll 1991; Borojević 2006) to northern and et al. 2011, 2014). These results suggest that the free
western Europe. Pea cultivation also moved south- germination trait was a more important criterion for the
ward to Egypt and modern-day Sudan (7,000 years adoption of a wild pea, lentil and possibly chickpea than
B.P.), eastward to Persia and India (4,000 years B.P.), their seed dispersal mode.

123
Genet Resour Crop Evol

The second crucial domestication trait relates to the forms of P. sativum subsp. sativum L. (Jing et al. 2010;
loss of fruit shattering, which has been under selection Smýkal et al. 2011, 2013, 2014; Ellis 2011). The
in most seed crops and resulted in better seed harvesting current range of wild representatives of P. sativum
(Purugganan and Fuller 2009, Erskine 1985), whereas, extends from Iran and Turkmenistan through Anterior
shattering in wild plants is a fundamental trait to assure Asia, northern Africa, the Mediterranean region and
seed dispersal. The evolution of non-shattering would southern Europe (Vavilov 1951; Makasheva 1979;
have occurred as a result of particular methods of Maxted and Ambrose 2001; Smýkal et al. 2011, 2013,
harvesting that favored non-shattering mutants in 2014). However, due to the early cultivation of pea, it
harvested populations, which were then sown. Seed is difficult to identify the precise location of the center
dispersal in wild legumes normally occurs via pod of its diversity, especially considering that the large
dehiscence. Central to the ballistic mechanisms of seed parts of the Mediterranean region and Near East have
dispersal in pea is the dehiscent pod (single carpel fused been substantially modified by human activities and
along its edges), where the central pod suture undergoes changing climatic conditions since that time. Domes-
an explosive rupturing along a dehiscence zone ticated pea is thought to have originated from wild P.
(Ambrose and Ellis 2008). sativum subsp. elatius var. pumilio Meikle [formerly
Orthologous genes for seed shattering mechanisms P. humile Mill. (P. syriacum (A. Berger) C. O. Lehm.]
and functions were identified to be purposefully (Ben-Zéev and Zohary 1973; Ambrose 1995; Jing
conserved in mono and dicotyledonous plants (Koni- et al. 2010; Smýkal et al. 2011), native to herbaceous
shi et al. 2006; Lenser and Theißen 2013) but not yet in formations in the open forest and in steppe habitats of
legumes. Ladizinsky (1985) found that two different the eastern Mediterranean. Together with faba bean,
monogenic systems operated in crosses of Lens pea is the only legume species with robust growth
orientalis (Boiss.) Schmalh. and L. ervoides (Brign.) (Zohary and Hopf 2000). However, when encountered
Grande, to cultivated lentil L. culinaris Medic. In the in the wild, stands are extremely thin, comprising only
former, the allele for dormancy was dominant, while few individuals (Abbo et al. 2013; Zlatković et al.
in the latter it was recessive. Moreover, the gene for 2010).
dormancy in L. orientalis Popow appeared to be linked Archeobotanical remains of legumes consist of
to one controlling pod shattering. The concurrent charred seeds; therefore, in the absence of the remains
increase in the seed size of domesticates compared to of pods, pod indehiscence and seed dormancy are
that of their wild relatives is seen in almost all grains invisible (Abbo et al. 2014). However, the survival of
and even in forage legumes, and it has been suggested fragmentary DNA in archaeological tissue has been
that this resulted from greater planting depth in recognized, and the first successful extraction of
agricultural systems leading to the selection of larger ancient DNA (aDNA) occurred nearly 30 years ago
seeds that produced more vigorous seedlings, although (Higuchi et al. 1984). To recognize the historical
this was recently refuted by Kluyver et al. (2013). origin, the term aDNA was introduced, which denotes
Experimental in which wild peas and lentil were nucleic acid isolated from ancient specimens of plants,
grown have demonstrated that both seed dormancy animals and humans (reviewed in Schlumbaum et al.
and pod dehiscence cause poor crop establishment via 2008). aDNA was used in numerous studies devoted to
reduced germination, as well as dramatic yield losses the domestication of animals, including the origin of
via seed shattering (Abbo et al. 2011). These results humans, and, to a lesser extent, to the analysis of plant
were inconsistent with models suggesting the pro- material (Jones and Brown 2000). The aDNA has been
tracted domestication of Near Eastern grain legumes recovered from charred wheat grains from dating to
(Abbo et al. 2013). the Iron Age (Allaby et al. 1994), Neolithic dwellings
The genus Pisum contains the wild species P. (Schlumbaum et al. 2008), desiccated Egyptian barley
fulvum Sibth. & Sm. found in Jordan, Syria, Lebanon (Palmer et al. 2009) or olive stones (Elbaum et al.
and Israel; the cultivated species P. abyssinicum A. 2006) to name a few. One of the main reasons such
Braun from Yemen and Ethiopia, possibly indepen- studies tend to disproportionately focus on animals is
dently domesticated of P. sativum; and a large that while DNA in bones is relatively well preserved, it
aggregate of both wild [P. sativum L. subsp. elatius is less so in plant material, which is more prone to
(Steven ex M. Bieb.) Asch. et Graebn.] and cultivated decay, with the exception of seeds.

123
Genet Resour Crop Evol

Until now, crop domestication and plant archaeo- Ancient DNA extraction
logical studies focused largely on cereals, both due to
the abundance of material and genetic information Protocols for aDNA analysis were strictly followed
available (reviewed in Hancock 2012). Although (Gilbert et al. 2005). Extraction was carried out in
genes underlying domestication traits in legumes have dedicated laboratory, which had not been used previ-
not yet been identified, the analysis of plastid-encoded ously to extract DNA from modern pea samples,
genes can lead to inference on origin of plant material. physically isolated from PCR set up and post PCR
In this study, we present an analysis of chloroplast analyses (in separate institutes). Extraction and ampli-
encoded aDNA fragments to elucidate the identity of fication blanks were carried out in parallel, with each
charred pea seeds from the Early Iron Age in sample extraction and PCR analysis to ensure authen-
comparison to modern cultivated and wild peas. This ticity. All equipment was thoroughly cleaned with
is the first report of successful aDNA analysis of any 70 % ethanol and DNA away solution (Molecular
legume. Bioproducts, UK) before processing to reduce the risk
of contamination. The whole laboratory area, includ-
ing PCR setup boxes and equipment, was UV irradi-
Materials and methods ated before use. PCR setup was done in a forensic
laboratory, in which modern plant material had never
Archeobotany been analyzed. Protective clothing and gloves were
worn at all times, and rigorous cleaning procedures
The fortified hill fort settlement Hissar in Leskovac were carried out (treatment with bleach, UV-irradia-
is a multilevel settlement of the Brnjica cultural tion), including the use of sterile tips with filter
group, 1350–1000 B.C., Iron Age I in the Morava (Neptune, Schoeller) and dedicated chemicals and
valley at southern Serbia (Stojić et al. 2007). The instruments. Two independent extractions of DNA
earliest occupation at Hissar is believed to have been from ancient material (500 mg, e.g. about 250 of
by Neolithic cultures, Starčevo and Vinča. Moreover, charred seeds) were performed using a modified
Hissar was continuously inhabited throughout Eneo- cetyltrimethylammonium bromide (CTAB) protocol
lithic, Bronze Age, Iron Age, Roman, Byzantine, (Doyle and Doyle 1987). Seeds were ground to fine
Serbian medieval and Turkish periods, the providing powder in liquid nitrogen, with mortar and pestle, all
thus a continuous record of over 3,000 years of UV treated and not used previously for any pea
human activities. The hill (341 m alt.) is in a analysis. The powder was transferred to a 2 ml tube
strategic position at a crossroads along the Jablanica with preheated (65 °C) extraction buffer (2 % CTAB,
and Veternica river valleys and along the Morava 0.1 M Tris–HCl pH 8.0, 20 mM EDTA, 1.4 M NaCl
river valley. The site is very important for the precise and 1 % PVPP) and mixed thoroughly. The mixture
chronological determination of the transitional period was incubated for 3 days at 35 °C with agitation. After
from the Bronze to the Iron Age. In addition to incubation, the mixture was centrifuged at 14,000 rpm
classical archaeological remains, the site has been for 10 min. The supernatant was removed, placed in a
sampled for plant remains since 1999 (Medović new tube and mixed with 500 ll of chloroform:
2005, 2012; Medović et al. 2011). In 2005, a rich isoamyl alcohol (24:1). Two phases were separated by
charred seed sample was gathered from a storage pit centrifuging for 5 min at 14,000 rpm. The top layer
of the Brnjica II a-level (eleventh century B.C.). The was transferred into a new tube and centrifuged for
volume of the subjectively taken sample was 7 liters. 10 min at 14,000 rpm. The supernatant was trans-
Earth substrate was packed in the plastic bag and ferred into a new tube and mixed with five volumes of
transported to the Museum of Vojvodina, Novi Sad, AP3/E buffer (DNAeasy Mini Plant Kit, QIAGEN).
Serbia. The flotation took place in 2006. The sieve The mixture was incubated at room temperature
with mesh size of 0.25 mm was used for the hand overnight. After incubation, the mixture was applied
flotation. The sample was dried in shade and then to Qiagen mini-spin column and processed according
packed in a paper bag. The dried, charred material to the manufacturer’s protocol. Elution was performed
weighed 121 g. The identification work was done in with 100 ll of AE buffer, allowed to stand for more
2006 (Medović et al. 2011). than 1 h, and DNA was recovered by centrifuging at

123
Genet Resour Crop Evol

8,000 rpm for 1 min. Isolated DNA was quantified by template. PCR amplifications were run at 2 min
NanoVue Spectrophotometer (GE Healthcare). 98 °C initial denaturation, followed by 45 cycles of
98 °C for 30 s, 55 or 58 °C for 1 min and 72 °C for
Modern cultivated and wild pea material 1 min on a Gradient Master Cycler (Eppendorf,
Germany) machine. Two negative controls were
Several pea samples were included as comparative performed and included in each PCR run, one which
controls for sequencing analysis, namely wild col- contained all necessary PCR components except those
lected [P. sativum subsp. elatius (Steven ex M. Bieb.) of the template DNA, another with the template input
Asch. et Graebn.], from John Innes Centre, UK pea from the blank extraction procedure. In separate
germplasm (JI1794, JI3147, 3155); specimens from reactions at a different institute, PCR amplification
the valley of the river Pčinja in far southeastern Serbia, of extant pea material was performed, with amplifica-
near the Bulgarian and Macedonian borders (Zlatk- tion of entire fragments of respective genes. PCR
ović et al. 2010); and one sample of P. abyssinicum products were subjected to 1.5 % NuSieve agarose gel
A.Br. (JI1974), P. fulvum Sibth. et Sm. (JI1006), and electrophoresis in 19 TAE buffer, stained with
cultivated (L0100001, L0100530) P. sativum subsp. ethidium bromide and visualized by UV light. Frag-
sativum var. sativum L. or fodder pea (L0200201, ments of respective sizes were excised and purified
L0200206) P.s.s. var. arvense (L.) Poir. accessions using Invisorb Fragment CleanUp kit (Invitek, Ger-
(Smýkal et al. 2008, 2011). These accessions were many). Finally, fragments were either directly
purposely selected from a larger, ongoing biosyste- sequenced or cloned into pJET 2.1 (Fermentas, Czech
matics study of the Pisum genus (Smýkal et al. 2011) Republic) vector. Six clones per sample were
to represent diverse haplotypes. DNA was extracted sequenced using pJET 2.1 Forward and Reverse
from young seedlings by DNAeasy Mini Plant Kit primers and BigDye terminator sequencing kit
(QIAGEN, Germany) in accordance with the manu- (Applied Biosystems, UK) at the DNA sequencing
facturer’s instructions. facility of Charles University, Prague, Czech Repub-
lic. Sequence visualization and editing were per-
PCR amplification and sequencing analysis formed using Sequence Scanner version 1.0 (Applied
Biosystems) and BioEdit Sequence Alignment Editor
Four genetic loci of chloroplast DNA were analyzed to version 7.09.0 (Hall 1999) software. Sequences
capture informative single nucleotide polymorphic obtained from aDNA have been deposited in GenBank
(SNP) sites. To assure amplification from fragmented under accession numbers JX677840–JX677844,
aDNA, several short fragments of trnS(GCU)– JX677866-67, and sequences of extant pea samples
trnG(UCC) intergenic spacer, tRNA-Lys (trnK)—ma- under accession numbers JX677845–JX677862.
turase K (matK), ribulose-1,5-bisphosphate carboxyl- BLAST (Altschul et al. 1990) search and CLUSTAL
ase/oxygenase large subunit (rbcL) partial gene alignment (Thompson et al. 1994) were performed to
regions (128–333 bp) were amplified using specific identify homologies. MEGA 5.05 software was used
primers (Generi Biotech, Czech Republic) in 20 ll to compute and construct maximum likelihood (with
PCR reaction (Table 1). In modern pea samples, larger Tamura-Nei model) and UPGMA trees using Maxi-
(537–2,394 bp) fragments of respective genes were mum Composite Likelihood model (Tamura et al.
amplified (Table 1). These phylogenetically informa- 2007).
tive fragments were selected based on previous
analysis of wild and cultivated pea samples, including
related Vicieae tribe (Lathyrus, Vicia, Lens and Results and discussion
Vavilovia) species (Kenicer et al. 2005; Smýkal
et al. 2011, unpublished; Schaefer et al. 2012; Mikić Morphological analysis of charred pea seeds
et al. 2013). Each reaction consisted of 1 unit of Phire
Hot Start II polymerase (Finnzymes, Czech Republic), The flotation yielded a total of 3,002 charred seeds and
19 supplier PCR buffer, 0.25 lM of each dNTP one-seeded fruits (Medović et al. 2011). Small,
(Fermentas, Czech Republic), 0.5 lM of forward and rounded, ca. 3–4 mm large pulse seeds comprised
reverse primers and 5 ll (about 5 ng) of aDNA almost 87 % of all charred plant items. Five hundred

123
Genet Resour Crop Evol

Table 1 Primer sequences, amplified regions and primer annealing temperature (Tm) used for the ancient and extant DNA analysis
cpDNA marker NCBI Forward primer sequence Reverse primer sequence Tm Fragment
accession (°C) length (bp)
number

Ancient DNA
tRNA-Lys (trnK) gene JX677840 matK1L: matK340R: 58 340
ctcaatggtagagtactcggc gtataattagatgtggtaatcattc
Maturase K (matK) gene JX677841 matK760F: matK1050R: 58 333
cgatctagatctcgccaacaggac gaggatttctgcctcctcgaagg
trnS–trnG intergenic spacer JX677842 trnSGF1: trnSG128R: 55 128
caaaaccgaacgtgaaacttttg cattaattgtattcataccgaaagg
trnS–trnG intergenic spacer JX677843 trnSG530F: trnSG758R: 55 253
ribulose-1,5-bisphosphate ggattcttgatccaattgcaaaaac caataatggtattgtagcgggt
Carboxylase/oxygenase (rbcL) JX677844 rbcLF: rbcLR1: 55 275
gene atgtcaccacaaacagagactaaag ccaggaacaggctcgatctcgtagc

Modern pea DNA


Maturase K (matK) gene matK1L: trnK2R: 55 2,394
ctcaatggtagagtactcggc aactagtcggatggagta
trnS–trnG intergenic spacer trnSF: trnGR: 58 1,562
ribulose-1,5-bisphosphate catcgcccttagcttgggcgt ctttagtccactcagccatctctc
Carboxylase/oxygenase (rbcL) rbcLF: rbcLR2: 55 537
gene atgtcaccacaaacagagactaaag gtaaaatcaagtccaccacg

seeds maintained pea-like hilum. The pea sample from seeds were wider than they were long. The ‘‘naked’’
Hissar was fairly free of admixtures of other pulses. pea seeds had almost the same values: 2.8–4.5 mm
Only 32 seeds of lentil (L. culinaris Medik.), bitter long, 2.5–4.2 mm wide, broad ellipsoid (85.29 %) and
vetch (Vicia ervilia (L.) Willd.) and faba bean (Vicia sometimes globose (14.71 %). Among broad ellipsoid
faba L.) were observed and their identity clearly ‘‘naked’’ seeds, L/W-index was above 1 in 75.53 % of
determined (Medović et al. 2011). There are three cases and under 1 in 11.76 % of cases. The seeds of
Pisum subspecies or varieties expected to grow in the cultivated fodder pea, P. s. var. arvense (L.) Poir., are
area. They differ in the shape and size of their hilum, also ellipsoid, but mostly globose to angular, while
although some overlap exists. The hilum of P. s. subsp. seeds of wild pea, P. sativum subsp. elatius (Steven ex
sativum var. arvense (L.) Poir. is ovoid or oval, and is M. Bieb.) Asch. et Graebn., are globose (Bojňanský
the smallest among these three subspecies. The hilum and Fargašová 2007). Generally, the seed shape of
of P. s. subsp. sativum L. makes up 1/14-1/10 of the peas depends on their position and space within a pod
seed’s circumference, while the elliptic hilum of P. s. (Kroll 1983); however, this characteristic is not
subsp. elatius (Steven ex M. Bieb.) Asch. et Graebn., reliable in charred pea seeds, nor can seed size be
makes up 1/8-1/6 of the seed’s circumference used as a determining factor in distinguishing the three
(Bojňanský and Fargašová 2007). The ‘‘coffee-bean- specimens of pea. In early finds, there was consider-
shaped hilum’’ (Kroll 1983) of the Early Iron Age able overlapping in the dimensions of wild and
seeds at Hissar match the description of the second domesticated forms (Weiss and Zohary 2011). Con-
subspecies listed above, cultivated P. s. subsp. sativum sequently, the most reliable morphological indication
L. However, the bulk of the pulse seeds in material had of domestication in peas was provided by the surface
no hilum. Charred pea seeds with preserved hilum of the seed coat (Weeden 2007). Wild peas are
were 3–4 mm long and 2.5–3.8 mm wide. They were characterized by a rough or granular surface, while
broad ellipsoid (84.38 %) to globose (15.63 %). domesticated varieties have smooth seed coats (Hel-
Length/Width (L/W) index of broad ellipsoid seeds baek 1970; Weiss and Zohary 2011). However, only
was above 1 in 78.13 % cases, and only 6.25 % of few pea seeds at Hissar displayed preserved, intact

123
Genet Resour Crop Evol

smooth-surfaced testa, as the cultivated-type seed coat and the phylogenetically informative internal tran-
was retained in small fragments on less than one fifth scribed spacer (ITS) of rDNA (Polans and Saars
of the recovered seeds. Seed coat was preserved 2002), we failed to amplify any of these regions
mostly in the embryonic axis area and occasionally irrespective of fragment size. This likely indicates
inside the concavities of the seeds. both extensive DNA degradation of extracted aDNA
and/or minor quantity, which, together with single- or
Comparative DNA analysis with wild Pisum low-copy number (except of ITS, which is present in
species and cultivated pea thousands of copies in genomes), prevented successful
PCR amplification. This contrasts the preliminary
The extraction procedure of approximately 250 seeds study on the same material performed by Jovanović
(500 mg) yielded 80 and 120 ng of isolated nucleic et al. (2010), which obtained a 26S DNA fragment,
acids, as estimated spectrophotometrically. This although it was not sequenced. We also commonly
amount likely included DNA that had been subject experienced such failures on herbarium vouchers older
to microbial and fungal contamination. The extrac- than 40–50 years (not shown). This contrasts to results
tions had to be performed from bulk rather than single obtained in cereals (Banerjee and Brown 2002).
seeds, considering the age, damage and presumed Whether this reflects the differences between legumes
amount of DNA preserved in the sample. The use of and cereals in genome size and ploidy is a question for
bulk samples is well documented and has been used in further study. Generally, in the case of charred and
numerous paleogenetic studies (Vahdati Nasab 2010; aged archaeological material, extensive DNA damage
Allaby et al. 1994, 1999; Li et al. 2011). Consequently, often prevents single-copy gene amplification.
we assume that several seeds contributed to the Selected chloroplast DNA regions are sufficiently
obtained results. As described in the archaeological phylogenetically informative (Palmer et al. 1985;
section, seeds have been carefully identified to prevent Kosterin and Bogdanova 2008) and more successful in
admixture of any other legume species. Even so, any amplification, likely due to the greater number of
of the amplified DNA fragments were sufficient to copies and the circular character of the plastid DNA
identify the sample with a given species, so we could molecule. There was no difference between the six
exclude any Vicia or Lathyrus sp. We have not been sequenced clones from the respective independently
able to systematically test amplification success or amplified regions in SNP sites. BLAST search and
amplicon length, since only a limited amount of DNA CLUSTAL alignment confirmed homologies to
was available. Three to four independent amplifica- expected regions of Pisum. There were five informa-
tions from two independent extractions were per- tive SNPs in trnK, matK sequences, four SNPs in
formed for each marker, and the results of trnSG, and one SNP in rbcL (Fig. 1, Electronic
amplification success are summarized in Supplemen- Supplementary material S1). There were several
tary Table 1. These indicate that with the increasing additional substitutions (12 or 14 SNP in trnSG, 1
length of amplicon there was a decrease in amplifica- SNP in trnK, matK, 2 SNPs in rbcL fragment) likely
tion, with failures from 290 bp. This result supports attributed to damaged DNA or to polymerase errors
our assertion that we have analyzed genuine aDNA. (Binladen et al. 2006). Since the majority (12) of these
Two regions of 340 and 333 bp lengths were success- 16 substitutions in 1,329 bp sequence were of type two
fully amplified from the matK-trnH gene, 128 and transitions (C to T, G to A), it supports the evidence of
253 bp of trnS-G gene and 275 bp fragment of rbcL amplification of truly ancient and not modern pea
gene, from two extractions, while negative controls DNA. Such substitutions result from deamination of
did not yield any detectable product. In order to cytosine (and 5-methyl cytosine) to uracil (and
authenticate aDNA results, the products of indepen- thymine), which have been shown previously to be
dent amplifications from each DNA extraction were associated with post mortem damage (Binladen et al.
cloned and sequenced. Although we attempted to 2006; Ho et al. 2007). The regions containing these
amplify selected nuclear encoded gene fragments, unique mutations were excluded from the MEGA
including part of bHLH (Mendels A) gene for pea clustering analysis, since these 16 extra SNPs would
flower color (Hellens et al. 2010), the convicilin gene result in a severe distortion of the results. This
for seed storage protein (Sáenz de Miera et al. 2008) approach is justified, as we have not attempted any

123
Genet Resour Crop Evol

Fig. 1 Fragments alignment of amplified ancient and extant indicated polymorphic sites. Numbers indicate position of the
(John Innes germplasm and sample from Serbia, Pčinja river) fragments with reference to modern pea DNA
pea chloroplast trnK, matK, trnSG and rbcL genes with

phylogenetic study; we instead seek to infer on the and long peduncles (2–49 longer than stipules) with 2
origin of the pea seeds. flowers per node and producing large pods
Data showed that extant [P. sativum subsp. elatius (50–80 9 10–12 mm). Leaflets are (1) 2–4 paired,
(Steven ex M. Bieb.) Asch. & Graebn.] is composed of ovate-elliptic, and subdentate. This subspecies has a
two groups (Smýkal et al. 2011, 2013), one repre- chromosomal translocation difference from cultivated
sented by JI1794 of P. sativum subsp. elatius var. P. sativum, but it is inter-fertile, although some
pumilio Meikle (syn. Pisum humile Mill.), which is nucleo-cytoplasmatic conflict has been reported in
hypothesized to belong to the group of the putative specific crosses (Bogdanova et al. 2009, 2012). The
ancestor of cultivated pea (Ben-Zéev and Zohary second wild subspecies, P. sativum subsp. elatius var.
1973; Ambrose 1995; Smýkal et al. 2011, 2013, 2014), pumilio Meikle, formerly P. humile Mill., in our
while another, represented by JI3151, is identical to analysis, represented by JI1794, has shorter internodes
cultivated pea P. sativum subsp. sativum L. (Figure 2). (20–40 cm stem length), shorter peduncles, smaller
Two other species, P. abyssinicum A.Br. and P. fulvum (40–45 9 7–10 mm) and often pigmented pods, and
Sibth. & Sm., are clearly separated (Fig. 2). The small flowers (15–18 mm). This is the presumed
discrimination between wild and domesticated mate- ancestor of cultivated pea. According to the ‘lost’
rial is complicated, as there is currently no known crops rationale, the Israeli southern P. humile Mill.
single-marker (gene) to do so. Without an identified populations may serve as evidence for a past pea
gene underlying domestication traits in legumes, domestication center (Abbo et al. 2013). Although it
including pea, we may only speculate about its origins. displays traits typical of wild pea (e.g. fully dehiscent
Moreover, there is a continuum among domesticated pods, camouflage seed coloration, and strong
and wild P. sativum subsp. elatius/sativum complex (*90 %) seed dormancy mediated by water-imper-
(Jing et al. 2010; Smýkal et al. 2011, 2014). All this meable seed coats), these southern P. humile Mill.
agrees with studies by Jing et al. (2010) and Kosterin never invade adjacent, less disturbed habitats (Abbo
and Bogdanova (2008) performed using various et al. 2013). It must be mentioned that extant wild P.
marker types. The additional P. sativum subsp. elatius sativum subsp. elatius (Bieb.) Aschers. and Graebn
JI3147 accession is distinct, with intermediate posi- collected in southern Serbia, around 70 km from the
tion. Interestingly, the aDNA sample is different both Hissar locality (Zlatkovic et al. 2010) has a cpDNA
from wild and cultivated peas, even when only haplotype identical to that of the JI3151 accession. On
phylogenetically informative sites are considered the other hand, owing to the high substitution rate in
(e.g. with excluded SNPs related to post mortem the trnSG region, we might speculate on a closer
damage). This makes ancient pea samples closer to affinity to cultigen rather than to wild peas.
wild than to modern cultivated pea (Fig. 2). Fragments In the ongoing study of the Pisum genus biogeog-
of trnSG and rbcL were the most informative, and, in raphy (Smýkal unpublished), the wild P. sativum L.
both analyzed aDNA samples, these sequences were complex falls into two main groups, while P.
identical (except in extra SNPs) to P. sativum subsp. abyssinicum A.Br. and P. fulvum Sibth. & Sm. were
elatius JI3147, which is true wild tall pea. It has large separated. Importantly, all tested cultivated pea
(20–30 mm), bicolor flowers with dark violet keels accessions showed only one cpDNA haplotype,

123
Genet Resour Crop Evol

P elatius-JI3151
Cultigen
P sativum(humile)JI1794
Ancient
P elatius-JI3147
P abyssinicum-JI1974
P fulvum-JI1006

0.025 0.020 0.015 0.010 0.005 0.000

Fig. 2 UPGMA dendrogram for composed trnSG, trnK, matK arvense (fodder pee, colored flower and pigmented testa) and
and rbcL data. Real seed testa pigmentation and flower color are var. sativum (dry seed pea, white flowering, and no pigmented
shown for extant and hypothesized for ancient pea sample. In testa) are shown. (Color figure online)
case of cultivated Pisum sativum subsp. sativum both varieties:

suggesting a single domestication origin (Kosterin and assumed that the seeds could have been gathered in the
Bogdanova 2008; Smýkal unpublished). Moreover, wild rather than cultivated. However, even when
there is substantial difference from any Vicia, Lathy- collected in sufficient quantities, seed testa perme-
rus or Lens sequences in each of the amplified ability will prevent proper imbibition of wild peas,
fragments (Kenicer et al. 2005; Schaefer et al. 2012; resulting in impaired cooking ability, palatability and
Mikić et al. 2013); thus, any seed heterogeneity can be digestibility. Based on a molecular analysis of recov-
excluded or would be under the detection limit. ered aDNA, we found that the material used in our
Finally, although included in the analysis, it was study was not wild pea; rather, it represents early pea
obvious that charred seeds should not be P. fulvum domesticates. We speculate that Iron Age pea would
Sibth. & Sm., which was never used for human feed or be of colored flower and pigmented testa, similar to
animal feed and does not grow in the Balkans, and today’s fodder pea [P. sativum subsp. sativum var.
DNA analysis confirmed that. Similarly, P. abyssin- arvense (L.) Poir.], possibly of winter type. Although
icum A.Br. is not considered to be found in that given charred pea seeds were found in many archeological
area. Taken together, aDNA analysis suggests that our sites previously, this is the first report of ancient pea
ancient pea seeds might represent an early domesti- seeds DNA analysis.
cated form distinct from extant wild and cultivated
peas. Acknowledgments This work was supported by the projects
173005, 173030, 31016 and 31024 of the Ministry of Education
and Science of the Republic of Serbia, and SEELEGUMES-168
within the EU programme SEE-ERA.NET. P.S. acknowledges
funding from Grant Agency of Palacký University in Olomouc,
Conclusion IGA PrF-2013-003. The authors cordially thank Noel Ellis,
Gérard Duc for useful suggestions, Milorad Stojić for providing
Although pea served as one of the founding crops of archeobotanical material and Clarice Coyne for manuscript style
Neolithic agriculture, a lucky find of 2,572 pea seeds improvement.
in the Hissar settlement is unique in southeastern
Europe. Pea from Hissar was a distinct crop, stored
separately from others. Archeobotanically, the bulk of
the peas recovered at eleventh century B.C. settlement References
at Hissar belongs to cultivated pea. Several morpho-
Abbo S, Zezak I, Schwartz E, Lev-Yadun S, Gopher A (2008)
logical characteristics indicate this: the smooth surface Experimental harvesting of wild peas in Israel: implica-
of the seed coat, the ‘‘coffee-bean-shaped’’ hilum, the tions for the origins of Near East farming. J Arch Sci
broad ellipsoid seed shape, the small size difference 35:922–929. doi:10.1016/j.jas.2007.06.016
Abbo S, Rachamim E, Zehavi Y, Zezak I, Lev-Yadun S, Gopher
between seeds and the high 1,000-grain weight of
A (2011) Experimental growing of wild pea in Israel and its
charred seeds. However, since wild or semi-wild pea bearing on Near Eastern plant domestication. Ann Bot
species can be found today in the area, it could be 107:1399–1404. doi:10.1093/aob/mcr081

123
Genet Resour Crop Evol

Abbo S, Lev-Yadun S, Heun M, Gopher A (2013) On the ‘lost’ Erskine W (1985) Selection for pod retention and pod dehis-
crops of the neolithic Near East. J Exp Bot 64:815–822. cence in lentils. Euphytica 34:105–112. doi:10.1007/
doi:10.1093/jxb/ers373 BF00022869
Abbo S, Pinhasi van-Oss R, Gopher A, Saranga Y, Ofner I, Fairbairn A, Asouti E, Near J, Martinoli D (2002) Macro-
Peleg Z (2014) Plant domestication versus crop evolution: botanical evidence for plant use at Neolithic Çatalhöyük
a conceptual framework for cereals and grain legumes. south-central Anatolia, Turkey. Veget Hist Archaeobot
Trends Plant Sci. doi:10.1016/j.tplants.2013.12.002 11:41–54. doi:10.1007/s003340200005
Allaby RG, Jones MK, Brown TA (1994) DNA in charred wheat Fairbairn A, Near J, Martinoli D (2005) Macrobotanical inves-
grains from the Iron Age hillfort at Danebury, England. tigations of the north, south and KOPAL areas at Çat-
Antiquity 68:126–132 alhöyük. In: Hodder I (ed) Inhabiting Çatalhöyük: reports
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) from the 1995–1999 seasons. Cambridge/Ankara:
Basic local alignment search tool. J Mol Biol 215:403–410. McDonald Institute for Archaeological Research, Cam-
doi:10.1016/S0022-2836(05)80360-2 bridge, pp 137–201
Ambrose MJ (1995) From Near East centre of origin the prized Forbes I, Wells HD (1968) Hard and soft seededness in Blue
pea migrates throughout world. Diversity 11:118–119 Lupine, Lupinus angustifolius L.: inheritance and pheno-
Ambrose MJ, Ellis THN (2008) Ballistic seed dispersal and type classification. Crop Sci 8:195–197. doi:10.2135/
associated seed shadow in wild Pisum germplasm. Pisum cropsci1968.0011183X000800020018x
Genet 40:5–10 Gilbert MTP, Bandelt HJ, Hofreiter M, Barnes I (2005)
Baldev B (1988) Origin, distribution, taxonomy, and morphol- Assessing ancient DNA studies. Trends Ecol Evol
ogy. In: Baldev B, Ramanujam S, Jain HK (eds) Pulse 20:541–544. doi:10.1016/j.tree.2005.07.005
crops. Oxford and IBH, New Delhi, pp 3–51 Hall TA (1999) BioEdit: a user-friendly biological sequence
Banerjee M, Brown TA (2002) Preservation of nuclear but not alignment editor and analysis program for Windows 95/98/
chloroplast DNA in archaeological assemblages of charred NT. Nucleic Acids Sci 41:95–98
wheat grains. Anc Biomol 4:59–63. doi:10.1080/ Hammer K (1984) Das Domestikationssyndrom. [The domes-
1358612021000010659 tication syndrome]. Kulturpflanze 32:11–34
Ben-Zéev N, Zohary D (1973) Species relationship in the genus Hancock JF (2012) Plant evolution and origin of species, 3rd
Pisum L. Israel J Bot 22:73–91 edn. CABI, Wallingford
Binladen J, Wiuf C, Gilbert TP, Bunce M, Barnett R, Larson G, Helbaek H (1964) First impressions of the Çatal Hüyük plant
Greenwood AD, Haile J, Ho SYW, Hansen AJ, Willerslev husbandry. Anatol Stud 14:121–123
E (2006) Assessing the fidelity of ancient DNA sequences Helbaek H (1970) The plant husbandry of Haçilar. In: Mellaart J
amplified from nuclear genes. Genetics 172:733–741. (ed) Excavations at Haçilar. Edinburgh University Press,
doi:10.1534/genetics.105.049718 Edinburgh, pp 189–244
Bogdanova VS, Galieva ER, Kosterin OE (2009) Genetic ana- Hellens RP, Moreau C, Lin-Wang K, Schwinn KE (2010)
lysis of nuclear-cytoplasmic incompatibility in pea asso- Identification of Mendel’s white flower character. PLoS
ciated with cytoplasm of an accession of wild subspecies One 5:e13230. doi:10.1371/journal.pone.0013230
Pisum sativum subsp. elatius (Bieb.) Schmahl. Theor Appl Higuchi R, Bowman B, Freiberger M, Ryder OA, Wilson AC
Genet 118:801–809. doi:10.1007/s00122-008-0940-y (1984) DNA sequences from the quagga, an extinct
Bogdanova VS, Galieva ER, Kosterin OE (2012) Inheritance member of the horse family. Nature 312:282–284. doi:10.
and genetic mapping of two nuclear genes involved in 1038/312282a0
nuclear-cytoplasmic incompatibility in peas (Pisum sati- Ho SY, Heupnik TH, Rambaut A, Shapiro B (2007) Bayesian
vum L.). Theor Appl Genet 124:1503–1512. doi:10.1007/ estimation of sequence damage in ancient DNA. Mol Biol
s00122-012-1804-z Evol 24:1416–1422. doi:10.1093/molbev/msm113
Bojňanský V, Fargašová A (2007) Atlas of seeds and fruits of Hopf M (1986) Archaeological evidence of the spread and use of
central and East-European Flora: the Carpathian Moun- some members of the Leguminosae family. In: Barigozzi C
tains region. Springer, Dordrecht (ed) The original and domestication of cultivated plants.
Borojević K (2006) Terra and Silva in the Pannonian plain. Opovo Oxford, Elsevier, pp 35–60
agro-gathering in the late neolithic. Archaeopress, Oxford Jing R, Vershinin A, Grzebyta J, Shaw P, Smýkal P, Marshall D,
Chimwamurombe PM, Khulbe RK (2011) Domestication of Ambrose MJ, Ellis THN, Flavell AJ (2010) The genetic
food legumes. In: Aditya P (ed) Food legumes. CABI. diversity and evolution of field pea (Pisum) studied by high
ISBN:9781845937669 throughput retrotransposon based insertion polymorphism
De Candolle A (1884) The origin of cutlivated plants. London, (RBIP) marker analysis. BMC Evol Biol 10:44. doi:10.
K. Paul, Trench 1186/1471-2148-10-44
Doyle JJ, Doyle JL (1987) Rapid DNA isolation procedure for small Jones M, Brown T (2000) Agricultural origins: the evidence of
quantities of fresh leaf tissue. Phytochem Bull 19:11–15 modern and ancient DNA. Holocene 10:769–776. doi:10.
Elbaum R, Melamed-Bassudo C, Boareto E, Galili E, Lev-Ya- 1191/09596830095024
dun S, Levy AA, Weiner S (2006) Ancient olive DNA in Jovanović Ž, Stanisavljević N, Nikolić A, Medović A, Mikić
pits: preservation, amplification and sequence analysis. A, Radović S, Ðord̄ević V (2010) Pisum and Ervilia
J Archeol Sci 33:77–88. doi:10.1016/j.jas.2005.06.011 Tetovac—made in Early Iron Age Leskovac. Part two:
Ellis THN (2011) Pisum. In: Kole C (ed) Wild crop relatives: extraction of the ancient DNA from CHARRED SEEDS
genomic and breeding resources. Springer, Berlin, FROM the site of Hissar in South Serbia. Ratar Povrt
pp 237–248 48:227–232

123
Genet Resour Crop Evol

Kenicer GJ, Kajita T, Pennington RT, Murata J (2005) Sys- Mikić A, Smýkal P, Kenicer G et al (2013) The bicentenary of
tematics and biogeography of Lathyrus (Leguminosae) the research on ‘beautiful’ vavilovia (Vavilovia formosa), a
based on internal transcribed spacer and cpDNA sequence legume crop wild relative with taxonomic and agronomic
data. Am J Bot 92:1199–1209. doi:10.3732/ajb.92.7.1199 potential. Bot J Linn Soc 172:524–531. doi:10.1111/boj.
Kislev ME, Bar-Yosef O (1988) The legumes: the earliest 12060
domesticated plants in the Near East? Curr Anthropol Palmer JD, Jorgensen RA, Thompson WF (1985) Chloroplast
29:175–179 DNA variation and evolution in Pisum: patterns of change
Konishi S, Izawa T, Lin S-Y, Ebana K, Fukuta Y, Sasaki T, and phylogenetic analysis. Genetics 109:195–213
Yano M (2006) An SNP caused loss of seed shattering Palmer S, Moore JD, Clapham AJ, Rose P, Allby RG (2009)
during rice domestication. Science 312:1392–1396. doi:10. Archelogical evidence of ancient nubian barley evolution
1126/science.1126410 from six to two-row indicates local adaptation. PLoS One
Kosterin OE, Bogdanova VS (2008) Relationship of wild and 4:e6301. doi:10.1371/journal.pone.0006301
cultivated forms of Pisum L. as inferred from an analysis of Polans NO, Saar DE (2002) ITS sequence variation in wild
three markers, of the plastid, mitochondrial and nuclear species and cultivars of pea. Pisum Genet 34:9–13
genomes. Genet Res Crop Evol 55:735–755. doi:10.1007/ Purugganan MD, Fuller DQ (2009) The nature of selection
s10722-007-9281-y during plant domestication. Nature 457:843–848. doi:10.
Kluyver TA, Charles M, Jones G, Rees M, Osborne CP (2013) 1038/nature07895
Did greater burial depth increase the seed size of domes- Sáenz de Miera LE, Ramos J, Pérez de la Vega M (2008) A
ticated legumes? J Exp Bot doi:10.1093/jxb/ert304 comparative study of convicilin storage protein gene
Kroll H (1983) Kastanas. Ausgrabungen in einem Sied- sequences in species of the tribe Vicieae. Genome
lungshügel der Bronze- und Eisenzeit Makedoniens 7:511–523. doi:10.1139/G08-036
1975–1979. Die Pflanzenfunde. Verlag Volker Spiess, Schaefer H, Hechenleitner P, Santos-Guerra A, de Sequeira MM
Berlin et al (2012) Systematics, biogeography, and character
Kroll H (1991) Southeast Europe. In: van Zeist, Wasylikowa K, evolution of the legume tribe Fabeae with special focus on
Behre KE (eds) Progress in old world palaeoethnobotany. the middle-Atlantic island lineages. BMC Evol Biol
Balkema, Rotterdam, pp 161–177 12:250. doi:10.1186/1471-2148-12-250
Ladizinsky G (1979) The genetics of several morphological Schlumbaum A, Tensen M, Jaenicke-Després V (2008) Ancient
traits in lentil. J Hered 70:135–137 plant DNA in archaeobotany. Veg Hist Archaeobot
Ladizinsky G (1985) The genetics of hard seed coat in the genus 17:233–244. doi:10.1007/s00334-007-0125-7
Lens. Euphytica 34:539–543. doi:10.1007/BF00022952 Smartt J (1990) Grain legumes: evolution and genetic resources.
Ladizinsky G (1987) Pulse domestication before cultivation. Cambridge University Press, Cambridge
Econ Bot 41:60–65. doi:10.1007/BF02859349 Smýkal P, Hýbl M, Corander J, Jarkovský J, Flavell AJ, Griga M
Ladizinsky G (1998) Plant evolution under domestication. (2008) Genetic diversity and population structure of pea
Kluwer Academic, Dordrecht (Pisum sativum L.) varieties derived from combined ret-
Lenser T, Theißen G (2013) Molecular mechanisms involved in rotransposon, microsatellite and morphological marker
convergent crop domestication. Trends Plant Sci analysis. Theor Appl Genet 117:413–424. doi:10.1007/
18:704–714. doi:10.1016/j.tplants.2013.08.007 s00122-008-0785-4
Li J, Fu C, Lei G (2011) Biogeographical consequences of Smýkal P, Kenicer G, Flavell AJ, Corander J, Kosterin O,
Cenozoic tectonic events within East Asian margins: a case Redden RJ, Ford R, Coyne CJ, Maxted N, Ambrose MJ,
study of Hynobius biogeography. PLoS One 6:1–10. Ellis THN (2011) Phylogeny, phylogeography and genetic
doi:10.1371/journal.pone.0021506 diversity of the Pisum genus. Plant Genet Res 9:4–18.
Makasheva RKH (1979) Flora of cultivated plants IV, grain doi:10.1017/S147926211000033X
legumes 1, pea. Kolos, St. Petersburg Smýkal P, Coyne C, Redden R, Maxted N (2013) Peas. In: Singh
Maxted N, Ambrose M (2001) Peas (Pisum L.). In: Maxted N, M, Upadhya H (eds) Genetic and genomic resources of
Bennett SJ (eds) Plant genetic resources of legumes in the grain legume improvement. Elsevier, The Netherlands
Mediterranean. Kluwer, Dordrecht, pp 181–190 Smýkal P, Coyne CJ, Ambrose MJ et al. (2014) Legume
Medović A (2005) Plant husbandry of fortified settlement Hisar crops phylogeny and genetic diversity for science and
near Leskovac southern Serbia (ca. 1350–1000 bc). Leskov breeding. Crit Rev Plant Sci. doi:10.1080/07352689.
Zb 45:201–209 (Serbian with English summary) 2014.897904
Medović A (2012) Late Bronze Age plant economy at the Early Stojić M, Pešić J, Jović S (2007) Cultural stratigraphy of
Iron Age hill fort settlement Hissar? Rad Muz Vojv archaeological site Hisar near Leskovac. Leskov Zb
54:105–118 47:29–40
Medović A, Mikić A, Ćupina B, Jovanović Ž, Radović S, Nik- Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4:
olić A, Stanisavljević N (2011) Pisum and Ervilia Tetovac: molecular evolutionary genetics analysis (MEGA) Soft-
made in Early Iron Age Leskovac. Part one. Two charred ware Version 4.0. Mol Biol Evol 24:1596–1599. doi:10.
pulse crop storages of the fortified hill fort settlement 1093/molbev/msm092
Hissar in Leskovac, south Serbia. Ratar Povrt 48:219–226 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W:
Mikić A (2012) Origin of the words denoting some of the most improving the sensitivity of progressive multiple sequence
ancient Old World pulse crops and their diversity in alignment through sequence weighting, position specific
modern European languages. PLoS One 7:e44512. doi:10. gap penalties and weight matrix choice. Nucleic Acids Res
1371/journal.pone.0044512 22:4673–4680. doi:10.1093/nar/22.22.4673

123
Genet Resour Crop Evol

Vahdati Nasab H (2010) The assessment of the prehistory of Weiss E, Kislev ME, Hartmann A (2006) Autonomous culti-
Southwestern Iran report (Hole and Flannery 1967). Int J vation before domestication. Science 12:1608–1610
Hum 17:1–12 Werker E, Marbach I, Mayer AM (1979) Relation between the
Vavilov NI (1951) The origin, variation, immunity and breeding anatomy of the testa, water permeability and the presence
of cultivated plants. Translated by Chester KS. The Ronald of phenolics in the genus Pisum. Ann Bot 43:765–771
Press Company, New York Willcox G, Fornite S, Herveux L (2008) Early Holocene culti-
Weeden NF (2007) Genetic changes accompanying the vation before domestication in northern Syria. Veg Hist
domestication of Pisum sativum: is there a common genetic Archaeobot 17:313–325. doi:10.1007/s00334-007-0121-y
basis to the ‘domestication syndrome’ for legumes? Ann Zlatković B, Mikić A, Smýkal P (2010) Distribution and new
Bot 100:1017–1025. doi:10.1093/aob/mcm122 records of Pisum sativum subsp. elatius in Serbia. Pisum
Weiss E, Zohary D (2011) The neolithic Southwest Asian Genet 42:15–18
founder crops: their biology and archaeobotany. Curr Zohary D, Hopf M (2000) Domestication of plants in the Old
Anthr 52:S237–S254. doi:10.1086/658367 World. Oxford University Press, Oxford

123