Sei sulla pagina 1di 45

TIMP

Tissue Inhibitors of Metalleoprotease

Struttura, Funzione, Evoluzione

La Matrice Extracellulare

La Matrice Extracellulare • Ambiente in cui vivono le cellule • Fornisce supporto strutturale • Fornisce

Ambiente in cui vivono le cellule

Fornisce supporto strutturale

Fornisce segnali e informazioni vitali alle cellule

Le componenti influenzano direttamente il comportamento delle cellule

Fondamentale nel coordinamento dei movimenti durante lo sviluppo

Le Metalloproteasi

Idrolizzano componenti della ECM

Coinvolte nel Turn-over e Omeostasi della ECM

Giocano un ruolo fondamentale in molti processi biologici

Giocano un ruolo fondamentale in molti processi biologici Collagene I II III Laminine Proteine di adesione
Giocano un ruolo fondamentale in molti processi biologici Collagene I II III Laminine Proteine di adesione

Collagene I II III

fondamentale in molti processi biologici Collagene I II III Laminine Proteine di adesione (Caderine, Integrine)

Laminine

Proteine di adesione (Caderine, Integrine)

in molti processi biologici Collagene I II III Laminine Proteine di adesione (Caderine, Integrine) Recettori di

Recettori di membrana

Ks

Tissue Inhibitors of MetalloProteinase
Tissue Inhibitors of MetalloProteinase
• 4 TIMP nei Mammiferi 40% di Identità fra loro Omologhi nei Vertebrati • P.M.=
• 4 TIMP nei Mammiferi
40% di Identità fra loro
Omologhi nei Vertebrati
• P.M.= 21 – 28 Kda
• Glicosilate nel RE
Golgi
Vescicole
Esocitosi

Secrete

Glicosilate nel RE Golgi Vescicole Esocitosi • Secrete Liberate nella ECM Ancorate alla membrana 50% tra
Glicosilate nel RE Golgi Vescicole Esocitosi • Secrete Liberate nella ECM Ancorate alla membrana 50% tra

Liberate nella ECM

Glicosilate nel RE Golgi Vescicole Esocitosi • Secrete Liberate nella ECM Ancorate alla membrana 50% tra

Ancorate alla membrana

Glicosilate nel RE Golgi Vescicole Esocitosi • Secrete Liberate nella ECM Ancorate alla membrana 50% tra

50% tra TIMP 2 e 4

Struttura

Dominio Carbossi terminale (CTD)

3 Ponti Disolfuro conservati

Non necessario nell’inibizione

Interazione stabilizzante con dominio Hemopexinico delle pro-MMPs e MT-MMP

con dominio Hemopexinico delle pro-MMPs e MT-MMP Dominio Ammino Terminale (NTD) • 3 Ponti disolfuro

Dominio Ammino Terminale (NTD)

delle pro-MMPs e MT-MMP Dominio Ammino Terminale (NTD) • 3 Ponti disolfuro conservati • Azione Inibente,

3 Ponti disolfuro conservati

Azione Inibente, indipendente da CTD

TIMP ricombinanti (N-TIMP) sono inibitori ad alta affinità

Importante nell’ininibizione delle ADAM

Il Dominio NTD

Il Motivo OB-fold

Le 6 Cys che formano 3 ponti disolfuro

Motivo OB-fold • Le 6 Cys che formano 3 ponti disolfuro Caratteristiche della NTR-like Superfamily Origine
Motivo OB-fold • Le 6 Cys che formano 3 ponti disolfuro Caratteristiche della NTR-like Superfamily Origine
Motivo OB-fold • Le 6 Cys che formano 3 ponti disolfuro Caratteristiche della NTR-like Superfamily Origine
Motivo OB-fold • Le 6 Cys che formano 3 ponti disolfuro Caratteristiche della NTR-like Superfamily Origine

Caratteristiche della NTR-like Superfamily

6 Cys che formano 3 ponti disolfuro Caratteristiche della NTR-like Superfamily Origine comune o convergenza strutturale?

Origine comune o convergenza strutturale?

IL gene TIMP

IL gene TIMP • I TIMP sono inseriti all’interno degli introni delle Sinapsine (SYN) con direzionalità

I TIMP sono inseriti all’interno degli introni delle Sinapsine (SYN) con direzionalità inversa.

Eccezione: TIMP2 non è contenuto in una sinapsina ma contiene nel suo primo introne il gene DDC8 (Differential Dysplay Clone 8)

Sinapsine

non è contenuto in una sinapsina ma contiene nel suo primo introne il gene DDC8 (Differential
è contenuto in una sinapsina ma contiene nel suo primo introne il gene DDC8 (Differential Dysplay

Un Ruolo inatteso

I Timp formano complessi Specifici con MT-MMPs

Questi complessi possono comunque funzionare da inibitori di MMP

Il Complesso TIMP2- MT1-MMP favorisce l’attivazione proteolitica di pro-MMP2

Non solo TIMP

Molte delle azioni biologiche dei TIMP non sono riconducibili all’azione inibente delle MMP:

TIMP 1 e 2:

Tutti i TIMP hanno attività Antiangiogenica

TIMP1 e 2: Promuovono la crescita cellulare in alcuni tipi cellulari ed hanno attività antiapoptotica.

TIMP 3: induce Apoptosi

Erythroid potentiating activity (EPA)

3: induce Apoptosi Erythroid potentiating activity (EPA) Arresta la crescità dei tumori Tramite inibizione di ADAM

Arresta la crescità dei tumori

Tramite inibizione di ADAM 17 (Tumor Necrosis Factor Converting Enzime)

Inibizione di ADAM10 (attivatore di HER-2)

TIMP 1 e 2: sono tra i candidati

dei geni coinvolti nella plasticità sinaptica

TIMP: an Ancient Family 2 TIMP 4 TIMP 1 TIMP 10 TIMP 1 TIMP 2
TIMP: an Ancient Family
2 TIMP
4 TIMP
1 TIMP
10 TIMP
1 TIMP
2 TIMP
1 TIMP (NTD)
3 TIMP
4 TIMP

TIMP sono presenti in tutto il regno animale

La struttura si è conservata

2 Domini (NTD e CTD) Posizioni delle Cys Dominio NTR-like

2 Domini (NTD e CTD) Posizioni delle Cys Dominio NTR-like • Maggiori variazioni tra TIMP degli
2 Domini (NTD e CTD) Posizioni delle Cys Dominio NTR-like • Maggiori variazioni tra TIMP degli

Maggiori variazioni tra TIMP degli Invertebrati che tra quelli dei Vertebrati

Non c’é corrispondenza tra il numero di TIMP e la complessità dell’organismo

I Nematodi presentano un TIMP a singolo dominio

corrispondente all’NTD dei Vertebrati

a singolo dominio corrispondente all’NTD dei Vertebrati Il TIMP ancestrale poteva essere a singolo dominio? No

Il TIMP ancestrale poteva essere

a singolo dominio?

Il TIMP ancestrale poteva essere a singolo dominio? No L’Hydra presenta TIMPs a due domini Stesso

No

Il TIMP ancestrale poteva essere a singolo dominio? No L’Hydra presenta TIMPs a due domini Stesso

L’Hydra presenta TIMPs a due domini

Stesso pattern di Cys

dominio? No L’Hydra presenta TIMPs a due domini Stesso pattern di Cys II aa atipico Forse

II aa atipicoessere a singolo dominio? No L’Hydra presenta TIMPs a due domini Stesso pattern di Cys Forse

dominio? No L’Hydra presenta TIMPs a due domini Stesso pattern di Cys II aa atipico Forse

Forse non è inibitore di MMP

L’evoluzione nei Vertebrati

I 4 TIMP dei Vertebrati sono derivati da duplicazioni di un TIMP ancestrale comune a quello degli Artropodi

I 4 TIMP sono derivati da 3 duplicazioni, avvenute dopo la separazione tra Artropodi e Deuterostomi.

, avvenute dopo la separazione tra Artropodi e Deuterostomi. (K. Brew et al.) • I Mammiferi

(K. Brew et al.)

I Mammiferi hanno ereditato tutte e 4 le isoforme

TIMP3 ha preservato maggiormente le funzioni ancestrali

Drosophila TIMP: modello degli invertebrati

Drosophila:

Drosophila TIMP : modello degli invertebrati • Drosophila: 2 MMP 1 TIMP • Il Timp di

2 MMP

1 TIMP

Il Timp di Drosophila è sempre inserito nel gene della Sinapsina

di Drosophila è sempre inserito nel gene della Sinapsina • Manca un ponte disolfuro • D-TIMP

Manca un ponte disolfuro

D-TIMP è simile al TIMP3

D-TIMP inibisce entrambe le MMP di Drosophila ed anche quelle Umane

Presenta una bassa attività sulla Collagenase (MMP1)

Funzioni del TIMP in Drosophila

TIMP è fortemente espresso durante Sviluppo embrionale

La sottoespressione di TIMP è necessaria durante la metamorfosi per permettere:

di TIMP è necessaria durante la metamorfosi per permettere: Autolisi dei tessuti durante la metamorfosi Migrazione

Autolisi dei tessuti durante la metamorfosi

la metamorfosi per permettere: Autolisi dei tessuti durante la metamorfosi Migrazione Assonica Rimodellamento dendritico

Migrazione Assonica

la metamorfosi per permettere: Autolisi dei tessuti durante la metamorfosi Migrazione Assonica Rimodellamento dendritico

Rimodellamento dendritico

la metamorfosi per permettere: Autolisi dei tessuti durante la metamorfosi Migrazione Assonica Rimodellamento dendritico

Mutanti TIMP

Mutanti TIMP • Creati tramite Transgenesi sito specifica nel locus della Sinapsina • I mutanti sono

Creati tramite Transgenesi

sito specifica nel locus della Sinapsina

I mutanti sono Subletali

con penetranza temperatura- sensibile

Solo il 62% dei mutanti raggiunge

lo stadio adulto

(A. Godenschwege et al. 2000)

Vitalità e Fertilità degli adulti sono drasticamente ridotte

32% presenta ali malformate

degli adulti sono drasticamente ridotte • 32% presenta ali malformate Stesso fenotipo dei mutanti per le

Stesso fenotipo dei mutanti per le Integrine

Alcuni mutanti presentano Fenotipi simili ai mutanti dei Mammiferi

Distruzione della Funzione intestinale:

dei Mammiferi • Distruzione della Funzione intestinale: • Alterazione dell’espressione di MMPs e TIMP nei
dei Mammiferi • Distruzione della Funzione intestinale: • Alterazione dell’espressione di MMPs e TIMP nei
dei Mammiferi • Distruzione della Funzione intestinale: • Alterazione dell’espressione di MMPs e TIMP nei

Alterazione dell’espressione di MMPs e TIMP nei mammiferi è associata alla celiachia

Difetti nello sviluppo delle Trachee durante la Metamorfosi

•

Topi Mutanti TIMP 3 mostrano dilatazione degli spazi aerei polmonari

Compromessa risposta fototattica

spazi aerei polmonari • Compromessa risposta fototattica • Topi mutanti TIMP2 non rispondo al Condizionamento da
spazi aerei polmonari • Compromessa risposta fototattica • Topi mutanti TIMP2 non rispondo al Condizionamento da

Topi mutanti TIMP2

non rispondo al Condizionamento da paura

Topi mutanti TIMP1 hanno problemi di memoria e apprendimento

Il TIMP di Ancylostoma • Presenta le due Cys conservate • Un solo dominio (NTD)

Il TIMP di Ancylostoma

Presenta le due Cys conservate

Un solo dominio (NTD)

33% di identità e 50% di similarità con N-TIMP2,

Una delle proteine più abbondanti nelle secrezioni del parassita

Potrebbe modulare le MMP nell’ospite

La Planaria Shmidtea mediterranea Gastrovascul ar system Retractable pharynx BBBB Blastema Neoblasti (marcatore

La Planaria

Shmidtea mediterranea
Shmidtea mediterranea

Gastrovascul

ar system

Retractable

pharynx

BBBB Blastema
BBBB Blastema

Neoblasti

(marcatore Smedwi-1)

pharynx BBBB Blastema Neoblasti (marcatore Smedwi-1) • Organizzazione del corpo a livello di organi e sistemi
pharynx BBBB Blastema Neoblasti (marcatore Smedwi-1) • Organizzazione del corpo a livello di organi e sistemi

Organizzazione del corpo a livello di organi e sistemi

I Neoblasti all’interno del parenchima sono circondati da una ECM e migrano attraverso di essa

sono circondati da una ECM e migrano attraverso di essa • 4 MMP: MMP1, MMP2, MT-MMPa,
sono circondati da una ECM e migrano attraverso di essa • 4 MMP: MMP1, MMP2, MT-MMPa,

4 MMP: MMP1, MMP2, MT-MMPa,

MT-MMPb (Isolani et al, 2013)

Un solo TIMP

da una ECM e migrano attraverso di essa • 4 MMP: MMP1, MMP2, MT-MMPa, MT-MMPb (Isolani

Analisi Bioinformatica sulla sequenza del TIMP di Planaria

Analisi Bioinformatica sulla sequenza del TIMP di Planaria mRNA-TIMP Traduzione Sequenza amminoacidica Identificazione
mRNA-TIMP

mRNA-TIMP

mRNA-TIMP
mRNA-TIMP

Traduzione

Sequenza amminoacidica Identificazione della Sequenza proteica Sequenza Proteica matura
Sequenza amminoacidica
Identificazione della
Sequenza proteica
Sequenza Proteica matura
Ricerca di domini conservati Sequenza Proteica Modello tridimensionale Allineamenti con altri TIMP
Ricerca di domini conservati Sequenza Proteica Modello tridimensionale Allineamenti con altri TIMP

Ricerca di domini conservati

Ricerca di domini conservati Sequenza Proteica Modello tridimensionale Allineamenti con altri TIMP
Sequenza Proteica Modello tridimensionale
Sequenza Proteica
Modello tridimensionale

Allineamenti con altri TIMP

Ricerca di domini conservati Sequenza Proteica Modello tridimensionale Allineamenti con altri TIMP

Allineamento con i TIMP mammaliani

TIMP2_

TIMP4_

TIMP3_

TIMP1_

Planaria

TIMP2_

TIMP4_

TIMP3_

TIMP1_

Planaria

TIMP2_

TIMP4_

TIMP3_

TIMP1_

Planaria

TIMP2_

TIMP4_

TIMP3_

TIMP1_

Planaria

C S C SPVH P QQ A F C NA DVVIRAK AVS C S C
C
S
C
SPVH
P
QQ
A
F C
NA
DVVIRAK
AVS
C
S
C
APA
H
P
QQ
H
I C
HSA
LVIRAK
IS
S
C
T
C
SPS
H
P
Q
DA
F
C
NS
D
IVIRAKVVG
C
T
CVPP
H
P
Q
TA
F
C
NS
D
LVIRAK
FVG
C
E
C
KIE
N
F
QQ
K
F
C
SH
D
FVI
I
AK
RVN
* * : * :*
*
*
:
*
:*

EKEVDSGNDI--YGN

EKVVPASADP---AD

KKLVKE--------G

TPEVNQ---------

SVMKLETFQSGLHNE

P IKRIQYE I K QIKM FKG E- T EKM L RYE I K QIKM FKGF
P
IKRIQYE
I
K
QIKM
FKG
E-
T
EKM
L
RYE
I
K
QIKM
FKGF
EK
P
FGT
LVYT
I
K
QMKM
YR
GF
TK
T
TLYQRYE
I
K
MTKM
Y
KGF
QA
T
FFS
L
QIK
M
K
IMYN
FKGF
YS
.
:*
::*
.** ** .
.** **
.
---- K D IEFI Y V--- K DVQYI Y M---P HVQYI H LGDAA D IRFVY
----
K
D
IEFI
Y
V---
K
DVQYI
Y
M---P
HVQYI
H
LGDAA
D
IRFVY
DLT-
K
DNVKY
Y

TAPSS

TPFDS

TEASE

TPAME

ISFMY

AVC GVS L DVGG S L C GVK L EANS S L C G LK
AVC
GVS
L
DVGG
S
L
C
GVK
L
EANS
S
L
C
G
LK
L
EVN-
SVC
G
YFHRSHN
G
P
C
G
SS
L
QLKR
K KE YLI A G Q KQ YLLT G K YQ YLLT G R SEE
K
KE
YLI
A
G
Q
KQ
YLLT
G
K
YQ
YLLT
G
R
SEE
FL
I
A
H
RL
YLIT
G
:
::
.

KAEG

QVLS

RVY-

GKLQ

YIF-

D GK M HITL D GKVFIHL D GK M YTGL D GL L HITT N
D
GK
M
HITL
D
GKVFIHL
D
GK
M
YTGL
D
GL
L
HITT
N
KQ
MVVTS
:
:
C D F IVPW D T L S C N Y I EPW E D
C
D
F
IVPW
D
T
L
S
C
N
Y
I
EPW
E
D
L
S
C
N
FVERW
D
Q
L
T
C
S
FVAPW
N
S
L
S
C
N
KVISVN
E
L
N
*.
:
: *.

TT

LV

LS

LA

PL

. : . ** Q KK S L NHR Y QM G C E- C
. :
. **
Q
KK
S
L
NHR
Y
QM
G
C
E-
C
KITR
C
PMIP
Q
RE
S
L
NHH
Y
HL
N
C
G-
C
QITT
C
YTVP
Q
RK
G
L
NYR
Y
HL
G
C
N-
C
KIKS
C
YYLP
Q
RR
G
F
TKT
Y
TVG
C
EE
C
TVFP
C
LSIP
Q
AI
G
L
FRQ
F
YS
N
H
C
YFQNQ
C
KKKNF
*
.:
.
NTD <--!--> CTD
:
GS
C A
WYRGAAPPKQEFLDIEDP
GT
C S
WYRGHLPLRKEFVDIVQP
GY
C S
WYRGWAPPDKSIINATDP
GL
C T
WQSLRSQIA---------
IFH
S
DLRKMPRILRKKIKYSHN
:

*

GL C T WQSLRSQIA--------- IFH S DLRKMPRILRKKIKYSHN : * C L WM D C L WT
C L WM D C L WT D C L WT D C L WT
C
L
WM
D
C
L
WT
D
C
L
WT
D
C
L
WT
D
S
C
L
D
K

WVTEKNIN

WLLERKLY

MLSNFGYP

QLLQGSEK YGI C APTM
QLLQGSEK
YGI
C
APTM
C L D K WVTEKNIN WLLERKLY MLSNFGYP QLLQGSEK YGI C APTM G H Q AKFFA C
G H Q AKFFA C I K R SD G Y Q AQHYV C M
G
H
Q
AKFFA
C
I
K
R
SD
G
Y
Q
AQHYV
C
M
K
HVD
G
Y
Q
SKHYA
C
I
R
Q
KG
G
F
Q
SRHLA
C
L
P
R
EP
S
E
N
EVK
C
EL
I
Q
R
LV

:

:

:

C L P R EP S E N EVK C EL I Q R LV :
C YI SSPDE C TI SAPNE C FVTSKNE C KL QSGTH C PI KLRSM
C
YI
SSPDE
C
TI
SAPNE
C
FVTSKNE
C
KL
QSGTH
C
PI
KLRSM

:

.
.

. C TI SAPNE C FVTSKNE C KL QSGTH C PI KLRSM : . Cisteine aa identici

Cisteine

aa identici

aa simili

foglietti β α eliche β α eliche

Regioni diC PI KLRSM : . . Cisteine aa identici aa simili foglietti β α eliche interazione

interazione con MMP

(B. Zahan et al,

2002)

40 35 30 25 20 15 10 5 0 Similarità con Smed-TIMP (%)
40
35
30
25
20
15
10
5
0
Similarità con Smed-TIMP (%)

*Con C.Elegans il confronto è stato eseguito considerando soltanto il dominio NTD di Planaria

Tra i TIMP umani, il TIMP3 è

il più simile a Smed-TIMP.

Tra i TIMP umani, il TIMP3 è il più simile a Smed-TIMP. In accordo con la

In accordo con la teoria evolutiva

Tra gli invertebrati il TIMP dell’Hydra è il più vicino a Smed-TIMP: simili anche nel dominio CTD

Hydra_

Planaria

Hydra_

Planaria

Hydra_

Planaria

Hydra_

Planaria

C M C MPVH P Q S A L C K A EYI I K
C
M
C
MPVH
P
Q
S
A
L
C
K
A
EYI
I
K R----VLS
A N
K
I
IKVN
NT
D
E
N
F
L
N
L
G
I
P
L PHHTV
Y
K
I
L
I
N
C
E
C
KIE
N
F
Q
Q
K
F
C
S
H
DFVI
I KRVNSVMK
A L
E
T
FQ
S
G
LH
N
E
T
F
FS
L
Q
I
K
M KIMYN
F
K
G
F
Y
S
*
*
: *. :*. :::* *:
*:. :
::
.
:*.*:.* * :
:*
:
.
SVL
K
N
ANPS
Y
RFNLQQ
I HS
LH
I
P
AAE S
N C
G
I QL
E IG
K
LYL
L TG
K
F D
E C
HSKL
Q
M
T
N
FH LK
DL
T
K
D
NVKY
Y
------
I SF
MY
G
P
C GS
S
---
L QL
K RH
R
LYL
I TG
Y
I N
F C
NKQMVVT
S
KVIS
.: *:
*
*
:: *
*
:**:
:***:** : :.:: :*.*:
:.
W
HQ
L
TIDMID
G
I
NG
KY
D---
C S
C
Q
IAT
C
M
DGY
C
DN
E
NA
C
KWN
L
S
-
WD
K
S
FED
C
A
Y
KHLN
C
V
NE
L
NPLQAI
G
L
FR
QF
YSNH
C
YF
Q
NQ
C
KK
KNF
C
PI
K
LR
S
MS
C
L
D
K
YG
I
C
APTM
S
E
NEVK
C
::*.
*:
*
NTD <--!--> CTD
::
*
:*
:
.
*. :.
.
: :.::*
E RS N R KVC QW NQ KS S YK Q C L LA E
E
RS
N
R
KVC
QW
NQ
KS
S
YK
Q
C
L
LA
E
KL
FNDV
E
LI
Q
R
LVIFH
SD
LR
K
MP
R
I
L
RK
K
IK
YSH
N
*
:* *
.:
.
:
*
:
:

Il TIMP di Planaria

NH 2

1 32 162 239 SP NTR COOH
1 32
162
239
SP
NTR
COOH

Presenta il dominio NTR-like conservato (E-value: 2,08x10 -10 )

Ha le due Cisteine (Cys1 e Cys3) che formano ponti disofuro

SP

NTR-like conservato (E-value: 2,08x10 - 1 0 ) • Ha le due Cisteine (Cys1 e Cys3)

IL Dominio NTD contiene il sito di Inibizione

Le due Cys1 e Cys3 sono altamente conservate

Il secondo residuo (Thr2) interagisce con il Glu scalzando l’H 2 0

Il IV residuo Val4 contatta la tasca S1

• Il secondo residuo (Thr2) interagisce con il Glu scalzando l’H 2 0 • Il IV
5’ 3’ 5’
5’
3’
5’

Clonaggio

Estrazione del mRNA

Sintesi del cDNA (Trascrittasi inversa)

PCR
PCR
del mRNA Sintesi del cDNA (Trascrittasi inversa) PCR Primer Antisenso CT TT TACGGTTCTTAAGACTC

Primer Antisenso

CT TT TACGGTTCTTAAGACTC GAAAATGCCAAGAATTCTGAG CT TT TACGGTTCTTAAGACTC

5’

Random Primers

CGTGTTAACTCAGTTATGAAATT

GCACAATTGAGTCAATACTTTAA

CGTGTTAACTCAGTTATGAAATT

GCACAATTGAGTCAATACTTTAA CGTGTTAACTCAGTTATGAAATT Primer Senso Denaturation (94°C) and anneal (55°C) (72°C)
GCACAATTGAGTCAATACTTTAA CGTGTTAACTCAGTTATGAAATT Primer Senso Denaturation (94°C) and anneal (55°C) (72°C)
GCACAATTGAGTCAATACTTTAA CGTGTTAACTCAGTTATGAAATT Primer Senso Denaturation (94°C) and anneal (55°C) (72°C)

Primer Senso

Denaturation (94°C) and anneal (55°C)

(72°C)

Denaturation

and anneal

3’

5’

Smed TIMP

Smed TIMP Estrazione dal Gel e Purificazione

Smed TIMP

Smed TIMP Estrazione dal Gel e Purificazione

Estrazione dal Gel e Purificazione

Vettore plasmidico pGem-T Easy Smed TIMP + Trasformazione Batterica Cellula batterica di E.Coli Selezione Crescita

Vettore plasmidico pGem-T Easy

Vettore plasmidico pGem-T Easy Smed TIMP + Trasformazione Batterica Cellula batterica di E.Coli Selezione Crescita

Smed TIMP

+

Vettore plasmidico pGem-T Easy Smed TIMP + Trasformazione Batterica Cellula batterica di E.Coli Selezione Crescita
Vettore plasmidico pGem-T Easy Smed TIMP + Trasformazione Batterica Cellula batterica di E.Coli Selezione Crescita

Trasformazione Batterica

plasmidico pGem-T Easy Smed TIMP + Trasformazione Batterica Cellula batterica di E.Coli Selezione Crescita Batterica

Cellula batterica di E.Coli

SelezioneVettore plasmidico pGem-T Easy Smed TIMP + Trasformazione Batterica Cellula batterica di E.Coli Crescita Batterica

plasmidico pGem-T Easy Smed TIMP + Trasformazione Batterica Cellula batterica di E.Coli Selezione Crescita Batterica
plasmidico pGem-T Easy Smed TIMP + Trasformazione Batterica Cellula batterica di E.Coli Selezione Crescita Batterica
plasmidico pGem-T Easy Smed TIMP + Trasformazione Batterica Cellula batterica di E.Coli Selezione Crescita Batterica

Crescita

Batterica

Estrazione del DNA plasmidico

1. Lisi della cellula

EDTA Glucosio 50mM NaOH SDS
EDTA
Glucosio 50mM
NaOH
SDS
Estrazione del DNA plasmidico 1. Lisi della cellula EDTA Glucosio 50mM NaOH SDS

Estrazione del DNA plasmidico

2. Neutralizzazione e Precipitazione

Potassio Acetato

Estrazione del DNA plasmidico 2. Neutralizzazione e Precipitazione Potassio Acetato 3. Filtrazione

3. Filtrazione

Estrazione del DNA plasmidico 2. Neutralizzazione e Precipitazione Potassio Acetato 3. Filtrazione
Estrazione del DNA plasmidico 2. Neutralizzazione e Precipitazione Potassio Acetato 3. Filtrazione
Estrazione del DNA plasmidico 2. Neutralizzazione e Precipitazione Potassio Acetato 3. Filtrazione

Digestione del DNA

TIMP
TIMP
Digestione del DNA TIMP Direzione del filamento Senso TIMP

Direzione del filamento Senso

TIMP
TIMP

Digestione del DNA

TIMP TIMP TIMP
TIMP
TIMP TIMP

Digestione del DNA

Buffer Apa I
Buffer Apa I
Digestione del DNA Buffer Apa I TIMP Plasmide Enzima di restrizione (Apa I) Overnight a 37°C
TIMP
TIMP

Plasmide

Digestione del DNA Buffer Apa I TIMP Plasmide Enzima di restrizione (Apa I) Overnight a 37°C

Enzima di restrizione (Apa I)

Overnight a 37°C

TIMP
TIMP

Plasmide linearizzato

Digestione del DNA Buffer Apa I TIMP Plasmide Enzima di restrizione (Apa I) Overnight a 37°C

Trascrizione dell’RNA Sonda in vitro

Trascrizione dell’RNA Sonda in vitro RNA Sonda RNA marcata TIMP GTP ATP CTP UTP marcata con
Trascrizione dell’RNA Sonda in vitro RNA Sonda RNA marcata TIMP GTP ATP CTP UTP marcata con

RNA

Sonda RNA marcata

Trascrizione dell’RNA Sonda in vitro RNA Sonda RNA marcata TIMP GTP ATP CTP UTP marcata con
Trascrizione dell’RNA Sonda in vitro RNA Sonda RNA marcata TIMP GTP ATP CTP UTP marcata con
TIMP GTP ATP
TIMP
GTP
ATP

CTP

UTP marcata con Digossigenina

Trascrizione dell’RNA Sonda in vitro

TIMP
TIMP
Trascrizione dell’RNA Sonda in vitro TIMP RNA Polimerasi SP6 Buffer SP6 Inibitore Rnasi Plasmide linearizzato DIG

RNA Polimerasi SP6

Buffer SP6

Sonda in vitro TIMP RNA Polimerasi SP6 Buffer SP6 Inibitore Rnasi Plasmide linearizzato DIG RNA labeling
Sonda in vitro TIMP RNA Polimerasi SP6 Buffer SP6 Inibitore Rnasi Plasmide linearizzato DIG RNA labeling

Inibitore Rnasi

in vitro TIMP RNA Polimerasi SP6 Buffer SP6 Inibitore Rnasi Plasmide linearizzato DIG RNA labeling Mix
in vitro TIMP RNA Polimerasi SP6 Buffer SP6 Inibitore Rnasi Plasmide linearizzato DIG RNA labeling Mix

Plasmide linearizzato

DIG RNA labeling Mix

2h a 37°CInibitore Rnasi Plasmide linearizzato DIG RNA labeling Mix Sonda RNA TIMP Digestione del DNA con DNasi

Sonda RNA TIMP

linearizzato DIG RNA labeling Mix 2h a 37°C Sonda RNA TIMP Digestione del DNA con DNasi

Digestione del DNA con DNasi

DIG RNA labeling Mix 2h a 37°C Sonda RNA TIMP Digestione del DNA con DNasi Precipitazione

Precipitazione dell’RNA

DIG RNA labeling Mix 2h a 37°C Sonda RNA TIMP Digestione del DNA con DNasi Precipitazione

EDTA

LiCl

Etanolo

Ibridazione in situ Whole mount

1. Scelta degli animali

2. Scelta del gene di controllo

3. Rimozione del muco e uccisione degli animali

4. Fissazione

5. Permeabilizazione

6. Sbiancamento

animali 4. Fissazione 5. Permeabilizazione 6. Sbiancamento NAC (N-acetil-cisteina) Formaldeide S D S , D T

NAC (N-acetil-cisteina)

Formaldeide

SDS, DTT

Proteinasi K

H 2 O 2 in Metanolo (O.N) oppure Formammide (poche ore)

Formaldeide S D S , D T T Proteinasi K H 2 O 2 in Metanolo

7. IBRIDAZIONE:

fattori che influenzano il processo

Temperatura: T m dipende dal contenuto in GC della sequenza

pH: valori di pH elevati sono più stringenti

[Cationi monovalenti]: basse concentrazioni (0,01-0,2 M) sono più stringenti T m = 16,6 log[NaCl] + 0,41(GC) + 81,5

più stringenti T m = 16,6 log[NaCl] + 0,41(GC) + 81,5 • [Cationi bivalenti]: stabilizzano fortemente

[Cationi bivalenti]: stabilizzano fortemente il duplex RNA, devono essere rimossi con agenti chelanti (EDTA)

Solventi organici (Formammide): diminuisce la stabilità del duplex RNA, permettendo all’ibridazione di avvenire a Temperature inferiori. T m = 16,6 log[NaCl] + 0,41(GC) + 81,5 – 0,72(% formammide)

Dextran solfato: aumento apparente della [Probe]

Lunghezza del probe

+ 0,41(GC) + 81,5 – 0,72(% formammide) • Dextran solfato: aumento apparente della [Probe] • Lunghezza
+ 0,41(GC) + 81,5 – 0,72(% formammide) • Dextran solfato: aumento apparente della [Probe] • Lunghezza

8. Lavaggi di stringenza:

9. Anticorpo anti-DIG:

10. Rivelazione:

Formammide, basse [NaCl], alte Temperature; Per rimuovere le sonde non appaiate o che hanno formato appaiamenti errati

In Blocking Solution, per saturare i siti aspecifici con cui potrebbe interagire l’anticorpo. Aumenta la specificità del segnale.

Buffer e substrato(NBT/BCIP) per la Fosfatasi alcalina

11. Lavaggi e Post-fissazione

Formaldeide

12: Disidratazione

Etanolo e Glicerolo (80%)

Risultati

Intatte

Intatte D o r s a l e Ventrale

Dorsale

Intatte D o r s a l e Ventrale

Ventrale

Risultati

Testa 2d Rigeneranti Blastema Tronco 2d Coda 2d Tronco 5d Blastema

Testa 2d

Rigeneranti

Blastema

Testa 2d Rigeneranti Blastema Tronco 2d Coda 2d Tronco 5d Blastema
Testa 2d Rigeneranti Blastema Tronco 2d Coda 2d Tronco 5d Blastema
Testa 2d Rigeneranti Blastema Tronco 2d Coda 2d Tronco 5d Blastema

Tronco 2d

Coda 2d

Testa 2d Rigeneranti Blastema Tronco 2d Coda 2d Tronco 5d Blastema

Tronco 5d

Blastema

Cinetica di Legame

I TIMP sono ‘’lenti’’ Inbitori Tight-Binding

Modello di inibizione non competitiva a 2 Stadi

Inibizione Reversibile

Ks

Kcat

E + S

ESE + S E + P E + S E + P

E + S ES E + P

E + P

+

+

I

I

Ki
Ki

EI

Ki’ EIS
Ki’
EIS

Modello cinetico in contraddizione con il modello strutturale

Costante di dissociazione del complesso: Ki = pM

Inibizione Tight Binding

I Stadio II Stadio Ki #
I Stadio
II Stadio
Ki #

EI*

L’emivita del Complesso TIMP- MMP (EI*) è stata stimata essere di 1 Anno!!

Energia di Legame

Per la formazione del Complesso TIMP-MMP:

ΔH >0 (sfavorevole), ΔS>>0 (favorevole)

Non risulta un aumento ΔS H2O (ΔCp = 0)

Aumento dinamicità del TIMP