Sei sulla pagina 1di 21

SOFTWARE Radionico

1 )Digital radionics

Questa applicazione consente la generazione di rata radionica da un insieme di parole che contengono un desiderio o un qualsiasi file binario; tono associato in ottava 0 e il colore calcolato a partire tasso principale. Animato spirali logaritmiche vengono utilizzate come risorsa energetica espansione per diffondere le informazioni radionica contenute nella tariffa. L'uso semplice: Caricare la foto del soggetto che si desidera lavorare con la radionica. Scrivere il desiderio o aprire qualsiasi tipo di file (testo, immagine, suono, ecc) che si desidera associare al soggetto e cliccare sul pulsante 'Vai' (freccia sinistra), il tasso di radionico calcolata e anche ottava 0 tono e il colore visualizzati. etichetta Quando il desiderio scritto 'testo' appare nella barra degli strumenti, nel caso in cui aperto un file 'file' etichetta viene visualizzata. forma di carico opzionale (alcuni esempi frattali sono in dotazione) per migliorare le prestazioni radionico anche se la forma d'onda. Per avviare l'applicazione radionica riprodurre il tono per diversi minuti.

2) La versione multiradionics incluso nel pacchetto stesso, questa versione consente di lavorare contemporaneamente con un massimo di quattro diverse sessioni radionica. Operazioni equivalente alla versione singola sessione, ma delle caratteristiche

del file disattivata e il suono viene generato solo per la prima sessione (riga). Lavorare su un multisessione radionico aumenta le prestazioni complessive.

3) Radionic Card

Ampiamente usato nella terapia radionica, questa scheda radionico una implementazione stile libero delle carte noto Malcolm, ma compresi scala musicale generata ellissi di colore e ulteriori risorse grafiche, generato carte possono essere copiati e incollati in qualsiasi applicazione grafica, questo consente di realizzare radionico documento multimediale che pu essere utilizzato da terapeuta, all'avvio del programma visualizza un motivo casuale che pu essere modificato, copiato / incollato e integrati in un documento, programma include controlli per il cerchio, l'angolo e la selezione dei colori, trascinando dentro il quadro genera schemi casuali, rappresentazione del contorno pu essere abilitata per la visualizzazione del modello pi preciso. Tasso calcolato in base alla forma geometrica, cliccando su di esso per copiare negli appunti ed utilizzarlo in altre applicazioni come la radionica digitale.

4 )Fiori di Bach radionica Questo software visualizza un elenco di applicazioni di Bach 38 rimedi floreali e calcola per ognuno di essi il proprio codice radionico, passo e frequenza degli impulsi. Questo suono udibile pu essere ascoltato a volume selezionabili. indicazioni fiore principale dotato. .

5) TONES Contiene diverse centinaia di toni radionici-scalati a ottava 0 - rappresentano gli elementi pi comuni e le malattie, secondo le pratiche radioniche possibile ascoltare i toni o per preparare rimedi omeopatici. Esso genera un segnale binaurale del canale sinistro l'unico tavolo di frequenza e il diritto, pi un offset scalata a -8 ottava del tono di base.

6 )Radionic rate Calcolo delle rate radioniche

7 )Sound Harmonizing Studio Questo programma consente di armonizzare la vostra vita quotidiana migliorare la vostra concentrazione, la creativit el'aggiunta di pi la coscienza di intelligenza emotiva (EI). Esso utilizza una combinazione di risorse generate visive, sonore e musicali. Usalo ogni giorno in brevi sessioni di cinque minuti sufficiente,seguendo questi quattro semplici passi: 1. Visualizza animato spirali con binaurale suoni rilassanti. 2. Analizza la tua voce e ascoltare la voice2voice bilanciamento(V2V) suoni. 3. Esplora accordi musicali e li identificano con le emozioni. 4. Ascoltare corde emotive contenute nella tua voce. Chi dovrebbe utilizzare? Chiunque, da 4 a 99 anni, che vuole migliorare la creativit e l'intelligenza emotiva. Come usarlo. Questo programma richiede l'uso quotidiano, una dedica pochiminuti sufficiente per sentire i suoi benefici, iniziare con brevi sessioni e aumentare progressivamente la sua durata.

Animato spirali logaritmiche

Voice spettro radiale

Musical accordi tavola

VBS Voice Balancing System Analisi VBS la tua voce e genera voice2voice (V2V) i toni di bilanciamento opzionalmente mescolati con la vostra musicapreferita, possibile utilizzare sia la registrazione diretta o aprirefile. wav. Esso offre una grafica dettagliata per l'analisi dello spettro e la voce di matching musica. Musical griglia di frequenze matrice voce di corrispondenza con le note musicali (scala temperata) PHI e le relazioni di musica armonica tra le frequenze vocali. 5 ottava a spettro completo con ottava scala locale e la griglia dinota. Spiral spettro

VBS Voice Balancing System Download Installabili, aiuto Versione 1.2 Data di uscita Mar, 10/2002 425KB Dimensioni (1'30 "modem 56Kb) Analisi VBS la tua voce e genera voice2voice (V2V) i toni di bilanciamento opzionalmente mescolati con la vostra musicapreferita, possibile utilizzare sia la registrazione diretta o aprirefile. wav. Esso offre una grafica dettagliata per l'analisi dello spettro e la voce di matching musica.

Musical griglia di frequenze matrice voce di corrispondenza con le note musicali (scala temperata) PHI e le relazioni di musica armonica tra le frequenze vocali. 5 ottava a spettro completo con ottava scala locale e la griglia dinota. Spiral spettro

Ruota armonica fornisce il peso delle banconote e delle relazioniarmoniche (terze, ottave, quinti)

Spettro radiale Formanti Octave pesi ogni nota in un grafico 5 spettro di ottavaradiale. Ruota armonica relazioni armoniche (terze, ottave, quinti)

Spettro radiale Formanti Octave pesi ogni nota in un grafico 5 spettro di ottava radiale.

8 )MultiFreq

MultiFreq genera toni di frequenza pi basato sulle composizioni di forme d'onda diverse. I toni sono generati in un suono stereo, il canale di sinistra contiene l'onda generata e canale destro pu essere spostata in una certa quantit di Hz completare l'espressione R = (differenzaHz) + L. Da sinistra a destra canale offset viene sottratto dal nostro cervellodi bilanciamento per l'effetto corrispondente, vale a direl'alfa-meditazione, beta-creativit ... Include un semplice foglio di lavoro in cui possibile calcolare ivalori delle onde e copia da / per pannello dell'onda definizione.

9 )BowlXplorer

Campane di cristallo sono strumenti semplice ma tuttavia straordinarie, sono ampiamente utilizzati per la riproduzione di musica sacra in diverse culture come tibetano (metallo bocce), le tecnologie di recentecostruzione permesso di quarzo puro ciotola ricca di suoni armonici. Rilassa suono Bowl e solleva la concentrazione. BowlXplorer un simulatore di ciotola, principali parametri del suono possono essere cambiati eseguire diversi effetti sonori. 10 )Logaritmica Spirali

Spirali logaritmiche sono la rappresentazione grafica della legge di crescita di base della natura, messa a punto i loro principali parametri e l'animazione, questo programma fornisce un unico esperienza interattiva geometriche cos vicino alla

natura che si pu vedere e sentire. Sequenza di istantanee possono essere salvate in formato. GIF di animazione per la costruzione di ulteriori. 11 )Planet Toni

Planet Toni. Riproduce il suono in ottava 0 scala associata con il pianeta corrispondente (tra cui la Sun & Moon) periodo dirotazione, onde cerebrali ottava differenza basata sulla principalepianeta tono pu essere aggiunto. Tono generati possono esseresalvati in un file wav a 44100 frequenza di campionamento.Spettacoli pannello con frequenza di mappatura del colore. Varie.caratteristiche: controllo del volume, controllo di durata in sec,effetto descrizione pianeta tabella e selezionare Autoplay su..Maggiori info rmazioni sul sito web Hans vale la pena di visitare! 12 )Healing Vibrations Guarigione Vibrazioni

Questo programma contiene una serie di 14 combinazioni di frequenze applicabile ad un elenco selezionabile di oltre 400 malattie. Audizione periodicamente queste combinazioni di frequenze pu aiutare il processo di guarigione.

13 ) Star Sound

Legge 161 spettro stelle di 161 stelle di tipo spettrale O attraverso classi M e la luminosit io, le stelle maggior parte III e V. sono di metallicit solare, anche se due sono stati appositamente scelti per la bassa metallicit. I dati sono stati ottenuti con il Reticon intensificato scanner sul telescopio # 1 91 cm a Kitt Peak National Observatory. Il suono viene generato direttamente da questi dati spettri digitali, apparendo antichi ritmi del tamburo di diversi tipi, ottava distribuzione e il volume pu essere controllato tramite i cursori.

14 ) Spettro infrarosso generatore di suoni

Ingressi file a-JCAMP DX da pulsata di neutroni ISIS & Muon Source Strumenti & Support Spettroscopia molecolare genera un suono di composti a base di spettro sostanza

15 ) Farmaci Suoni

Genera un tono composto da binaurale peso atomico di ogni farmaco. Pi che 1.800 farmaci vengono caricati da un file JCAMP incluso. Ricerca per struttura di nome anche attuato.

16 )Genoma suoni

Genera da nucleotide (ATCG) sequenze genetiche in formato FAST disponibile da www.ncbi.nlm.nih.gov a 8 bit, mono, 8000 samp. / risoluzione sec. Scarica una sequenza del genoma umano da questo sito in formato FAST (estensione fcgi) e aprirlo da questo programma. Il suono creato codifica ogni ATGC nucleotide a una coppia di binari con combinazione selezionabili, ovvero A = 00, T = 01, G = 10, C = 11. Non aspettatevi qualcosa di udienza armonico, il suono generato direttamente dal informazione genetica ' come' questo produce un rumore abbastanza progetto. Alcuni esempi dal cromosoma umano # 3 sono inclusi nel file zip. genoma umano contiene 24 coppie di cromosomi 22 + X + Y. Formato di file di FAST abbastanza semplice, un file di testo con un colpo di testa riga seguendo la sequenza nucleotidica in 70 blocchi di char, cio

ATACGGGAGAACTAAGGCTGAAACCTCGGAGGAACAACCACTTTTGAAGTGACTTCG CGGCGTGCGTTGG

17 ) Solidi Platonici

L'esperienza di animazione 3D dei solidi platonici con profondit selezionabile e l'angolo. Deve avere OpenGL installati nel sistema (questo dovrebbe essere abbastanza usuale).

18 ) Mineral Suoni

Genera risonante tre toni composti ottava da una lista di pi di 3000 minerali. I toni sono generati utilizzando polvere di parametri di diffrazione di raggi X. Questa una delle principali tecniche utilizzate dai mineralogisti e chimici allo stato solido per esaminare le propriet fisico-chimiche make-up di solidi sconosciuto. Questi dati vengono rappresentati

in una collezione di modelli in polvere monofase diffrazione dei raggi X per le tre distanze interplanare pi intenso.

19 ) Sistema Solare Suoni

Sentire il suono del sistema solare in una data selezionata, comprende i controlli per cambiare facilmente data reale, fornisce una mappa semplificata traccia di pianeti. Fornisce la posizione di una griglia di dati con i pianeti effettivi in eliocentrico coordinate (eclittica loc.) E la distanza di sole in au. Il suono generato da dati fisici e orbitali. Il funzionamento semplice: basta selezionare il giorno e cliccare sul tasto play (alterna play / stop), gli altri controlli sono auto esplicative.

20 ) Molecolare suoni

Questo programma genera toni complesso da atomi molecolare e la geometria, tenendo come uno degli input dei mille. File PDB da banca dati di proteine, genera un suono come

un ascoltatore sentirebbe situato di fronte alla molecola, essendo gli atomi punti di risonanza alla frequenza di massa atomica spostato a cero ottava. L'effetto finale come ascoltare la vibrazione della molecola. Sono le propriet della molecola contenuta nella vibrazione del suono? Uso: 1. Scarica da proteine banca dati della molecola si desidera generare, importante: utilizzare il formato PDB per il download.. 2. Aprire il file. Pdb nel programma. 3. Selezionare il numero di atomi, in un computer da 1 GHz a meno di 400 atomi possono essere elaborati in tempo reale, quando il computer saturo questioni programma un beep-beep e si blocca-up, valore di default di 300 atomi. 4. Generare il suono molecola completa con la scrittura. Opzione WAV, il suono di rendering molecola un processo estremamente alta intensit di calcolo, questa opzione genera 10 "di atomi selezionato, nessuna limitazione si applica qui solo l'importo sul tempo necessario. Tassi tipici sono 1 minuto di rendering al secondo di suono.

21 ) Note e colori

Vedere i colori delle dodici note musicali e ascoltarli in ottave diverse

22 )Bilanciamento V2V Chat.

Abilita una (Voice2Voice) V2V dialogo, solo parlare e ascoltare i toni v2v generato bilanciamento, o semplicemente tenere in silenzio e ascoltare e generer modelli tono casuale. figure di Lissajous VoiceRings e sono generate dinamicamente durante la conversazione.

23 )

Voice Params.

i parametri della voce analisi principali, tra cui Shimmer (variazioni di volume), Jitter (freq. Variazioni) e N2H (Noise di armonica). studi approfonditi pu essere trovato collegando le misure e variazione di questi parametri con stati emotivi e fisici.

24 )

Voce 2 Voce (V2V).

voice forma Misure con il 30% dei toni totale frequenza potenza generatrice in base al suo specchio (max-v (i)), questi toni sono ricchi di frequenze disavanzo e suono simile ad ambienti natura, difficile da credere fino a che non li sento!. Traccia delle relazioni PHI in voce e il ritmo anche previsto.

25 )

Spettrogramma vocale.

Visualizza freq. evoluzione nel tempo e le misure della gamma che contiene il 50% della potenza vocale, utile per lo studio del ritmo vocale e 'vedere' con il tempo prospettiva

26 ) Generatore di toni.

Problemi di onde cerebrali freq. a differenza di toni stereo, le grandi sintesi accordi in evoluzione verso una ottava pi alta, si sentono 3D rilassante e armonizzando i suoni.Anche associati a colori visualizza tono richiesto e il valore RGB in esadecimale.

27 )

PHI Analyzer.

Conta il numero di relazioni PHI in formanti frequenza vocale e viene visualizzato un grafico con la sua evoluzione nel tempo. PHI appare in manifestazioni pi la natura, sentire e vedere con la tua voce e imparare a controllarlo.

28 )

spettrografo radiale.

Visualizza accumulato frequenze vocali in un formato radiale fornisce una depicture conveniente di freq voce. distribuzione, freq accumulato. 'Forma' di distribuzione in grado di fornire informazioni dettagliate sul diffusore. Vedi la differenza tra queste forme a seconda del tuo stato emotivo. dati di spettro pu essere copiato negli appunti in una tabella a due colonne contenenti (Hz, Potenza 0 .. 100), consentendo incolla da MS-Excel o qualsiasi editor di testo.

29) Harrison Scala.

John Harrison, questo gentiluomo straordinario (1693-1776) ha avuto l'idea affascinante di definire una scala musicale con sede a numero PI, pi precisamente a (2 ^ (1 / (2 * PI))),

invece di 2 ^ (1 / 12 ) in uno temperato, la definizione di due costanti per il quinto musicale (1,494,41151 milioni) e quarta (1,338,319457 millions). scala temperata sembra essere nel mezzo di Harrison il quinto e quarto, essendo un compromesso tra di loro. Fu J. S. Bach (1698-1750) a conoscenza di questa scala? e le sue conseguenze in armonia musica moderna? Charles EH Lucy ha progettato una chitarra con sede a queste scale, con risultati sorprendenti possibile controllare nel suo sito web. Potrebbe questo nuovo modo di armonia comprensione cambiare la nostra concezione della musica? In questa applicazione possibile selezionare una nota suonata come un singolo tono o di un accordo maggiore (tono + quinto + terzi), entrambe le scale Harrison sembrano suonare meglio e pi armonicamente, potrebbe essere difficile da apprezzare all'inizio, ma dopo un breve periodo si pu sentire.

30 )VoiceRings.

Parlare e vedere animato a colori degli anelli concentrici seguito la vostra voce, i colori e il numero di anelli sono calcolati dalla frequenza e il numero di formanti vocali.

31 ) GEOSTAR.

Genera stelle geometrica con tre tipi di connessioni (stella, poligono, all2all), numero di vertici 3-200, il risultato pu essere copiato a clip.