Sei sulla pagina 1di 30

The Plant Cell, Vol. 20: 2989–3005, November 2008, www.plantcell.org ã 2008 American Society of Plant Biologists

Arbuscular Mycorrhiza–Specific Signaling in Rice Transcends

the Common Symbiosis Signaling Pathway

W
W

Caroline Gutjahr, a Mari Banba, b Vincent Croset, a Kyungsook An, c Akio Miyao, d Gynheung An, c Hirohiko Hirochika, d Haruko Imaizumi-Anraku, b and Uta Paszkowski a,1

a Department of Plant Molecular Biology, Unive rsity of Lausanne, 1015 Lausanne, Switzerland b Division of Plant Sciences, National Institute of Agro biological Sciences, Tsuku ba, Ibaraki 305-8602, Japan c National Research Laboratory of Plant Functional Genomics, Pohang University of Science and Technology, Pohang 790-784, Korea d Division of Genome and Biodiversity Research, National Insti tute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602, Japan

Knowledge about signaling in arbuscular mycorrhizal (AM) symbioses is currently restricted to the common symbiosis (SYM) signaling pathway discovered in legumes. This pathway includes calcium as a second messenger and regulates both AM and rhizobial symbioses. Both monocotyledons and dicotyledons form symbiotic associations with AM fungi, and although they differ markedly in the organization of their root systems, the morphology of colonization is similar. To identify and dissect AM-specific signaling in rice (Oryza sativa ), we developed molecular phenotyping tools based on gene expression patterns that monitor various steps of AM colonization. These tools were used to distinguish common SYM- dependent and -independent signaling by examining rice mutants of selected putative legume signaling orthologs predicted to be perturbed both upstream ( CASTOR and POLLUX ) and downstream (CCAMK and CYCLOPS ) of the central, calcium- spiking signal. All four mutants displayed impaired AM interactions and altered AM-specific gene expression patterns, therefore demonstrating functional conservation of SYM signaling between distant plant species. In addition, differential gene expression patterns in the mutants provided evidence for AM-specific but SYM-independent signaling in rice and furthermore for unexpected deviations from the SYM pathway downstream of calcium spiking.

INTRODUCTION

The arbuscular mycorrhizal (AM) symbiosis occurs in all plant lineages, including angiosperm dicotyledons and monocotyle- dons, and thus also in important crop grasses such as maize ( Zea mays ), wheat (Triticum aestivum ), and rice ( Oryza sativa ). The first step in the development of AM symbiosis (reviewed in Smith and Read, 1997; Harrison, 2005; Paszkowski, 2006) is a molecular dialogue prior to contact. At the root surface, the fungal hypha differentiates into a hyphopodium from which a penetration peg enters the rhizodermis. The fungus progresses through the outer into the inner root cortex and spreads intercellularly along the longitudinal axis of the root, forming highly ramified structures, termed arbuscules, inside cortex cells. At the whole root level, development of the AM symbiosis is asynchronous, with various stages of colonization being present simultaneously. Thus, sig- naling between the symbiotic partners occurs, at least partly, cell autonomously with fine-tuned stage specificity. Despite the progress made in past years, knowledge of the molecular events and components involved in these signaling

1 Address correspondence to uta.paszkowski@unil.ch. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantcell.org) is: Uta Paszkowski (uta.paszkowski@unil.ch).

W
W

Online version contains Web-only data.

www.plantcell.org/cgi/doi/10.1105/tpc.108.062414

processes is still limited and mostly derived from studies in legumes, in which forward genetic screens uncovered a major signaling pathway, the common symbiosis (SYM) pathway, which is nonspecifically required for the formation of both rhizo- bial and AM symbioses (for a recent review, see Parniske, 2008). To date, the components identified are a symbiosis Leu-rich repeat receptor kinase (SYMRK), DOES NOT MAKE INFEC- TION2 (DMI2); two predicted cation channels, CASTOR and POLLUX (DMI1); two nuclear porins, NUP85 and NUP133, which are all necessary for the induction of Ca 2+ spiking (Figure 1) (Kosuta et al., 2008); and the calcium/calmodulin-dependent protein kinase CCAMK (DMI3), which acts downstream of Ca 2+ spiking (Figure 1) and is thought to transduce the calcium signals. CCAMK physically interacts with and phosphorylates CYCLOPS (INTERACTING PROTEIN OF DMI3 [IPD3]), a protein of unknown function (Messinese et al., 2007; Parniske, 2008). A better understanding of the molecular events governing the development and function of the AM symbiosis is needed, particularly in grasses, including major crops, to aid agricultural exploitation of the symbiosis. Rice is an attractive model crop for studying AM signaling because the genome sequence is avail- able and there are extensive mutant collections for reverse- genetics screens (Hirochika et al., 2004). Candidates for ortho- logs of all seven common SYM genes have been computationally predicted to be present in the genomes of a number of dicotyl- edons and monocotyledons (Zhu et al., 2006; Messinese et al., 2007). Although roots perform equivalent functions in both

2990 The Plant Cell

2990 The Plant Cell Figure 1. Components of the Legume SYM Signaling Pathway. The SYM pathway

Figure 1. Components of the Legume SYM Signaling Pathway.

The SYM pathway shared between AM and rhizobial symbioses consists of seven proteins: a receptor-like kinase encoded by S YMRK / DMI2 (Endre et al., 2002; Stracke et al., 2002); putative cation channels encoded by the highly homologous genes CASTOR and POLLUX/ DMI1 (Ane et al., 2004; Imaizumi-Anraku et al., 2005); nuclear porins, encoded by NUP85 and NUP133 (Kanamori et al., 2006; Saito et al., 2007); a calcium/calmodulin-dependent kinase encoded by CCAMK/ DMI3 (Levy et al., 2004; Mitra et al., 2004); and a protein encoded by CYCLOPS (IPD3 ) (Chen et al., 2008; Parniske, 2008). SYMRK, CASTOR, POLLUX, NUP85, and NUP133 are required for Ca 2+ spiking, an early response of root hairs to Nod factor application and to approaching AM fungi (Kosuta et al., 2008). The calcium/calmodulin-dependent kinase CCAMK/DMI3 is thought to decipher the calcium signals (DMI3) (Levy et al., 2004; Mitra et al., 2004; Kosuta et al., 2008). CYCLOPS (IPD3) interacts with CCAMK, serves as a phosphorylation substrate for CCAMK (Messinese et al., 2007; Parniske, 2008), and is required for mycorrhizal colonization (Chen et al., 2008). The proteins shown in boldface were investigated in this study.

angiosperm classes and the cytological appearance of AM symbioses is similar, the architecture of the root system and cellular patterning differ considerably (Hochholdinger and Zimmermann, 2008). The extent to which cereal roots utilize the same SYM signaling pathway for the interaction with AM fungi has been addressed for CCAMK (Chen et al., 2007) and CYCLOPS (IPD3) (Chen et al., 2008), the two signaling compo- nents operating downstream of the Ca 2+ response. In rice, mutation of either the CCAMK or the CYCLOPS gene leads to a mycorrhizal mutant phenotype similar to that described for legumes, and rice CCAMK was able to restore full mycorrhizal and rhizobial colonization in the Medicago truncatula (barrel medic) dmi3 mutant (Godfroy et al., 2006; Chen et al., 2007, 2008). The function of CCAMK and CYCLOPS, therefore, ap- pears to be conserved between rice and legumes. Transcriptional outputs associated with specific physiological processes can be used as diagnostic tools to identify the signaling pathways involved (Glazebrook et al., 2003; Bari et al., 2006; Sato et al., 2007). To unravel the signaling cues that uniquely affect the AM symbiosis demands the careful selection of AM-specific indicator transcripts. Over the past years, a number of transcriptome analyses have illustrated the dramatic changes that occur in plant roots upon mycorrhizal colonization (Liu et al., 2003; Gu¨ imil et al., 2005; Hohnjec et al., 2005). A set of genes specifically expressed during the AM symbiosis have been identified from M. truncatula (reviewed in Krajinski and Frenzel, 2007), but their utility as diagnostic tools for signaling has not been assessed. The dependence of transcrip- tional induction on common SYM signaling components has been demonstrated in Lotus japonicus and M. truncatula , and the

existence of additional AM signaling cues has been suggested (Weidmann et al., 2004; Kistner et al., 2005; Massoumou et al., 2007; Siciliano et al., 2007). However, to date, it has been difficult

to exclude symbiosis-independent influences on the induction of

these gene sets, since developmental, nutritional, and patho- genic responses were not characterized. Thus, the relevance of the common SYM pathway and the existence of additional signaling cues for AM-specific processes are currently not known for legumes or other mycorrhizal plant species. Here, we have used rice to investigate functional conservation

of the SYM pathway and to determine additional signaling cues

for the AM symbiosis. We selected rice lines (rice sym mutants) with insertions into signaling components upstream ( CASTOR

and POLLUX ) and downstream ( CCAMK and CYCLOPS ) of Ca 2+ spiking and demonstrated that all of these genes are required for AM colonization of rice, thus illustrating broad evolutionary conservation of symbiotic signaling. Genome-wide transcrip- tome profiling of mycorrhizal rice roots had previously predicted

a group of genes to be exclusively AM-induced (Gu¨ imil et al.,

2005). Here, we characterized and subsequently used these genes as molecular indicators of AM-specific signaling. Their application to the study of rice sym mutants reveals that although the common SYM signaling pathway is of central importance for

successful AM symbiosis in rice, it is supported by additional symbiotic signaling cues that act in parallel to, or depart from, common SYM signaling.

RESULTS

AM-Specific Marker Genes in Rice

Gene transcripts that accumulate exclusively in mycorrhizal roots provide valuable readouts for the analysis of specificity in AM signaling. We selected 18 rice genes previously identified by whole genome transcriptome analysis as being strongly induced during the development of AM symbiosis but silent in response to mock treatments, root pathogen inoculation, or the application of different phosphate regimes (Gu¨ imil et al., 2005) (see Supple- mental Table 1 online).

Corroborating the Specificity of Marker Gene Induction

To further corroborate the AM-specific expression of these genes, we examined the effect of root colonization by another beneficial fungus, Piriformospora indica, on marker gene expres- sion. P. indica has been reported to promote the growth of a wide variety of plant species, including cereal crops (Varma et al., 1999; Waller et al., 2005). Similar to AM fungi, root colonization by P. indica is strictly confined to the cortex, where the fungus develops intracellular coils that are different from the arbuscules formed by AM fungi (Varma et al., 1999). Root colonization by P. indica is accompanied by the production of pear-shaped chlamydospores that are easy to detect (see Supplemental Figures 1A and 1B online) (Varma et al., 1999; Waller et al., 2005). At 5 weeks postinoculation (wpi), we found 50 6 8% (SE) of rice root length colonized by P. indica; however, none of the 18 gene transcripts was detected (see Supplemental Figures 2A and 2B online).

To investigate the expression of the 18 genes in other parts of the plant, RT-PCR was performed on cDNA from rice root, shoot, stem, leaf, panicle, embryo, and callus. Since transcripts of four genes ( ARBUSCULAR MYCORRHIZA18 [ AM18 ], AM20 , AM29, and AM42 ) were too low to be detected by RT-PCR, their expression was analyzed by real-time RT-PCR. All 18 genes were expressed in AM roots but not in other plant tissue or callus cultures (see Supplemental Figures 2A and 2B online). We conclude, therefore, that expression of this particular set of genes is, most likely, AM-specific.

Temporal Expression of Marker Genes

Coordinated signaling pathways must underlie the consecutive steps leading to the establishment of an AM symbiosis. Although mycorrhizal colonization at the whole root level is asynchronous, temporal expression studies permit enrichment for early (pre- symbiotic molecular crosstalk, hyphopodia formation, and rhi- zodermal penetration) and late (cortex invasion, cortical spread, and arbuscule formation) stages of the interaction. To monitor possible transcriptional responses at particular stages, we ex- amined the temporal expression of our gene set at 3, 5, 7, and 9 wpi with Glomus intraradices . A low titer of fungal inoculum was used to enhance resolution at early time points. Fungal coloni- zation was microscopically inspected (Figure 2A) and quantified (Figure 2B). At 3 wpi, no intraradical colonization was found, and colonization was low at 5 wpi, with 1.5 6 0.2% of the total root length containing arbuscules. The amount of intraradical hyphae and arbuscules rose sharply between 5 and 7 wpi and remained high without significant further elevation at 9 wpi. By contrast, the number of vesicles increased continuously throughout the time course. In mycorrhizal rice roots, activation of the mycorrhiza-specific phosphate transporter PT11 (Paszkowski et al., 2002) was detected at 7 and 9 wpi (Figure 2C), indicating arbuscule forma- tion, in a manner similar to that observed for the putatively orthologous genes Mt PT4 , St PT4 , and Le PT4 from M. truncatula , potato ( Solanum tuberosum ), and tomato ( Solanum lycopersicum ), respectively (Harrison et al., 2002; Nagy et al., 2005). Transcripts of four rice genes ( AM1 , AM2 , AM3 , and AM11 ) appeared very early (at 3 wpi) and their expression increased sharply between 5 and 7 wpi, remaining high through- out the course of the experiments (Figure 2C). Transcripts of the other 14 genes were first detected at 7 wpi, in parallel with PT11 (Figure 2C). While some transcript levels reached maximal ex- pression at 7 wpi, others increased further at 9 wpi. None of the marker genes was expressed in mock-inoculated roots at any time point. In summary, we observed two distinct expression patterns that reflect signaling operating at early or later devel- opmental stages of the AM association. It has been well documented that expression of mycorrhiza- specific phosphate transporter genes is restricted to arbuscu- lated cells (Harrison et al., 2002; Nagy et al., 2005). According to a recent report, such transporters are induced by lysophosphati- dylcholine (LPC) in potato hairy roots and tomato cell cultures in the absence of AM colonization (Drissner et al., 2007). Therefore, use of LPC could distinguish arbuscule-expressed late genes that are induced along with PT11 . However, PT11 was not

AM-Specific Signaling in Rice

2991

expressed in roots treated with LPC, although CYCLOPHILIN2 transcripts could be visualized, thus indicating live roots after LPC infiltration (see Supplemental Figure 3 online).

Robustness of the Marker Genes

Different AM isolates have been reported to stimulate different transcriptional responses in their hosts (Hohnjec et al., 2005). To determine the suitability of our gene set as universal AM-specific markers, we characterized transcript accumulation in rice roots inoculated with Gigaspora rosea, an AM fungus phylogenetically distant from G. intraradices (Schu¨ ssler et al., 2001). Interestingly, while G. intraradices produced finely branched arbuscules in rice (Figure 2A), Gi. rosea formed predominantly coils and coarse arbuscular coils (Figure 2D). At 7 wpi, total root length coloniza- tion had reached 32 6 14%, with frequent occurrence of arbuscular coils (Figure 2E). Vesicles were absent from Gi. rosea –colonized roots, as is typical for members of Gigaspor- aceae. All marker gene transcripts were detected in roots col- onized by Gi. rosea (Figure 2F), exhibiting expression levels comparable to roots colonized by G. intraradices (Figure 2C), but were absent in mock controls. Taken together, the transcripts of all 18 genes could be correlated with the degree of fungal root invasion by two distantly related AM fungi, corroborating the robustness and universal character of the marker gene set for monitoring AM symbioses.

Systemic Induction of Marker Genes

Transcriptional plant responses to interaction with AM fungi can be cell autonomous, restricted to specific cell types, or systemic (Chabaud et al., 2002; Harrison et al., 2002; Kosuta et al., 2003; Liu et al., 2003, 2007; Nagy et al., 2005). To examine whether any of the 18 rice marker genes can be activated by systemic signals, we studied their transcription in split-root experiments. In this experimental setup, only half of the root system was inoculated (mycorrhizal part). At 6 wpi, G. intraradices had colonized the mycorrhizal part to 33 6 10% and was absent in the non- inoculated part, reflected by the absence of fungal structures (Figure 3A). Transcripts of all 18 marker genes were present in the mycorrhizal part of the roots and, with the exception of two genes, absent in the noninoculated part of the roots (Figure 3B). AM3 and AM34 were expressed in both the inoculated and noninoculated halves of the root system (Figure 3B), suggesting activation by systemic signals elicited by and/or transmitted from the mycorrhizal half of the root system. AM3 belongs to the group of early and continuously highly expressed genes (Figure 2C). By contrast, transcripts of AM34 were only detected at later stages of the interaction (Figure 2C). None of the 18 genes was system- ically induced in shoots of mycorrhizal plants (see Supplemental Figures 2A and 2B, online).

Spatial Expression of Rice AM Marker Genes

To investigate gene expression at cellular resolution, we selected a subset of strongly induced marker genes from rice representing particular expression profiles and examined the accumulation of their transcripts using in situ hybridization. AM1 was chosen as

2992 The Plant Cell

2992 The Plant Cell Figure 2. Expression Analysis of Rice Marker Genes during Colonization by G.

Figure 2. Expression Analysis of Rice Marker Genes during Colonization by G. intraradices and Gi. rosea .

(A) Trypan blue staining of wild-type roots at 6 wpi with G. intraradices . G. intraradices formed highly branched arbuscules. A, arbuscule; IH, intraradical

hypha. Bar = 50 mm.

(B) Percentage root length colonization by G. intraradices during a time-course experiment determined by a modified grid-line intersect method.

Harvest time points are indicated (wpi). Means 6 SE of five plants represented by two replicate samples are shown. ext hyphae, extraradical hyphae; int hyphae, intraradical hyphae.

(C) Real-time RT-PCR–based expression analysis of marker genes during a time-course experiment of rice roots inoculated with G. intraradices .

Expression levels are shown relative to the constitutively expressed CYCLOPHILIN2 gene. Error bars indicate SD from three technical replicates.

(D) Trypan blue staining of wild-type roots at 7 wpi with Gi. rosea . Gi. rosea formed arbuscular coils but no arbuscules or vesicles. AC, arbuscular coil; C,

coil; EC, epidermal coil. Bar = 50 m m; bar in inset = 20 m m.

(E) Percentage root length colonization by Gi. rosea (Gr) at 7 wpi determined by a modified grid-line intersect method. Means 6 SE of five plants

represented by two replicate samples are shown.

(F) Real-time RT-PCR–based expression analysis of mock-inoculated and Gi. rosea –inoculated rice roots at 7 wpi. The experiment was repeated four

times with similar results. Expression levels are shown relative to the constitutively expressed rice CYCLOPHILIN2 gene. Error bars indicate SD from

three technical replicates.

Figure 3. Analysis of the Systemic Expression of Rice Marker Genes. (A) Percentage root length

Figure 3. Analysis of the Systemic Expression of Rice Marker Genes.

(A) Percentage root length colonization by G. intraradices of the inocu-

lated halves of the split roots at 6 wpi, determined by a modified grid-line intersect method. ext hyphae, extraradical hyphae; int hyphae, intra- radical hyphae.

(B) Real-time RT-PCR–based expression of marker genes in the mycor-

rhizal half (+ G.i .) and the noninoculated half ( G.i .) of a split root and a mock-inoculated control. Gene expression levels are shown relative to the expression of the constitutive rice CYCLOPHILIN2 gene. Error bars

represent SD for three technical replicates. The experiment was repeated twice with similar results.

an early expressed gene, AM3 as an early and systemically expressed gene, and PT11 as a late expressed gene. The digoxigenin-labeled PT11 antisense probe revealed signals re- stricted to arbusculated cells (Figure 4A). No signal was detected when the sense probe was applied to sections from AM roots (Figure 4B) or when antisense probe was applied to tissue sections from mock-inoculated roots (Figure 4C). Thus, the localization of PT11 expression corresponds to that of its predicted orthologs Mt PT4 (Harrison et al., 2002), Le PT4 , and St PT4 (Nagy et al., 2005). Expression of AM1 was detected in rice cells colonized by small arbuscules and in cortex cells flanking intercellularly grow- ing hyphae (Figure 4D). Due to resolution constraints, it was not possible to distinguish the small arbuscules from developing or senescing arbuscules. However, the early expression of AM1 is consistent with transcript accumulation in developing arbus- cules, and this is further supported by the observation that cells with fully developed arbuscules did not produce signals with the

AM-Specific Signaling in Rice

2993

same AM1 antisense probe (Figure 4E). Sections from mycor- rhizal roots hybridized to the AM1 sense probe (Figure 4F), and sections from mock-inoculated roots treated with the AM1 antisense probe (Figure 4G) had no signals. AM3 transcripts were visualized in arbusculated cells only (Figure 4H). According to the results of the split-root experiment (Figure 3B), a systemically induced AM3 expression was ex- pected; but it was not detected. This, however, may result from transcript accumulation below the limit of detection, but in a high number of cells. No signal was observed using the sense probe (Figure 4I) or hybridizing mock-inoculated root sections with antisense probe (Figure 4J). In summary, the variety of transcript accumulation patterns found suggested the existence of cell-autonomous signaling events operating selectively in certain cell types during the colonization of rice by G. intraradices . As in M. truncatula , the rice mycorrhiza-specific phosphate transporter PT11 is strictly induced in arbusculated cells (Figure 4A). By contrast, AM1 is transcribed in two types of cortex cells, those adjacent to intercellularly growing hyphae and those containing small

to intercellularly growing hyphae and those containing small Figure 4. Spatial Expression of Three AM Marker

Figure 4. Spatial Expression of Three AM Marker Genes.

In situ hybridization of PT11 ( [A] to [C] ), AM1 ( [D] to [G] ), and AM3 ([H] to [J]). (A) , (D) , (E) , and (H) Sections from rice roots colonized by G. intraradices and probed with antisense probes. (B) , (F) , and (I) Sections from rice roots colonized by G. intraradices and probed with sense probes. (C) , (G) , and (J) Sections from mock-inoculated rice roots probed with antisense probes. In situ hybridizations were repeated at least twice with equivalent results. Black arrowheads, fully grown arbuscules; red arrowheads, small arbus- cules; blue arrowheads, apoplastic intraradical hyphae. Bars = 30 m m.

2994 The Plant Cell

arbuscules (Figure 4D). The spatial expression is consistent with the observed early and progressive gene induction associated with fungal spread within the host root (Figure 2C). In addition to being expressed systemically (Figure 3B), AM3 showed arbuscule-specific transcript accumulation (Figure 4H).

Identification of AM-Specific Signaling in Rice

To examine the dependence of marker gene expression on the nonspecific common SYM signaling pathway in rice, we first determined the functional conservation of the pathway between legumes and rice. Putative rice orthologs of legume SYMRK, CASTOR, POLLUX, NUP85, NUP133, CCAMK, and CYCLOPS have previously been identified computationally (Kanamori et al., 2006; Zhu et al., 2006; Messinese et al., 2007; Saito et al., 2007), and the requirement of CCAMK and CYCLOPS (the two signaling proteins downstream of the Ca 2+ response) for AM development in rice was recently reported (Chen et al., 2007, 2008).

Expression of Common SYM Genes in Rice

To compare expression patterns of the common SYM genes between rice and legumes, RT-PCR was performed on cDNA from different organs of the rice plant as well as from mycorrhizal roots and callus (see Supplemental Figure 4 online). SYMRK , CASTOR , and POLLUX were expressed in almost all of the tissues tested. High transcript levels of both genes encoding nucleoporins were found in all samples tested. As reported previously (Chen et al., 2007, 2008), RNA levels of rice CCAMK ( DMI3 ) were highest in roots and panicles (see Supplemental Figure 4 online) and those of CYCLOPS ( IPD3 ) (Messinese et al., 2007) were highest in roots; however, only low levels could be detected in other plant organs and callus. Interestingly, none of the genes was differentially expressed in roots upon colonization by G. intraradices. In general, all putative rice orthologs of legume SYM pathway genes exhibited root expression, and where available data permit comparison, expression patterns were similar to those in legumes (Imaizumi-Anraku et al., 2005; Kanamori et al., 2006; Saito et al., 2007). Exceptions were (1) CCAMK , which was only weakly expressed in M. truncatula flowers (Levy et al., 2004) but highly expressed in rice panicles, and (2) POLLUX , which was expressed mainly in roots, but not in any other organ, of M. truncatula (Ane et al., 2004) but in rice showed broad expression with high RNA levels in panicles.

Identification and Characterization of Rice Common SYM Mutations

To study the conservation of common SYM signaling in rice, we screened for mutant lines with insertions in putative SYM orthologs encoding signaling components upstream and down- stream of Ca 2+ spiking. Rice lines with insertions into CASTOR and POLLUX (upstream) and into CCAMK and CYCLOPS (down- stream) (Figure 1) were selected from public databases (http:// orygenesdb.cirad.fr/, http://signal.salk.edu/) and from PCR- based screens of the retrotransposon Tos17-induced rice mutant collection (Hirochika et al., 2004) (Figure 5; see Supple- mental Table 2 online).

For each of the rice SYM genes, a full-length cDNA is available that allows determination of the gene structure (http://cdna01. dna.affrc.go.jp/cDNA/). Analogous to L. japonicus (Imaizumi- Anraku et al., 2005), rice CASTOR and POLLUX consist of 12 exons and 11 introns, with CASTOR having longer introns than POLLUX (Figure 5A). Rice CCAMK consists of seven exons and six introns and is similar in structure to CCAMK of M. truncatula (Chen et al., 2007). Rice CYCLOPS ( IPD3 ) has 11 exons and a similar structure to M. truncatula IPD3 (Figure 5A) (Messinese et al., 2007; Chen et al., 2008). Thus, gene structure is highly conserved. For CASTOR , two lines predicted to contain T-DNA insertions in the second exon (1B-08643 and 3D-50377) were retrieved from mutant collections. PCR analysis confirmed the presence of the T-DNA for line 1B-08643 (castor-1 ) (Figure 5A; see Supple- mental Table 2 online) but not for 3D-50377. In the case of POLLUX , three lines were identified: 1C-03411 ( pollux-1 ) con- tained a T-DNA insertion in the first intron; NC6423 ( pollux-2 ) and ND5050 (pollux-3 ) had Tos17 insertions in the third and fourth exons, respectively (Figure 5A; see Supplemental Table 2 online). Four insertion lines were identified for CCAMK: the three lines NF8513, NG2508, and NE1115 carry Tos17 insertions, and line 2B-50404 contains a T-DNA insertion. While NF8513 and NG2508 have been characterized previously (Chen et al., 2007), NE1115 represents a novel allele containing a Tos17 insertion within the fourth exon. NE1115 and NF8513 were used in our studies as rice ccamk-1 and ccamk-2 , respectively (Figure 5A; see Supplemental Table 2 online). The fourth line, 2B-50404, was not considered due to reduced germination frequency. We identified 54 insertions in the region of CYCLOPS . We chose three Tos17 insertion lines, NG0782, NC2415, and NC2713, for characterization. In each of these lines, the retrotransposon is inserted in the sixth exon. We refer to these lines as cyclops-1 , cyclops-2 , and cyclops-3 , respectively (Figure 5A; see Supple- mental Table 2 online). To confirm the location of each insertion relative to the given gene structure, sequencing across both the 5 9 and 3 9 gene-insertion boundaries was performed. The posi- tions of all insertions were as reported in the databases of the respective mutant collection (Figure 5A). Therefore, this study included multiple mutant alleles of POLLUX , CCAMK , and CY- CLOPS and one of CASTOR . To quantify transcript accumulation in the mutant lines, RT-PCR was performed using one primer pair flanking the insertion and two other primer pairs targeting the regions up- stream and downstream of the insertions corresponding to the 5 9 and the 3 9 ends of the cDNA, respectively (Figure 5A; see Supplemental Table 3 online). CASTOR transcripts were not detected in castor-1 , suggesting that this is a null allele (Figure 5B). No RT-PCR products were obtained using primers spanning the transposon insertion site for any of the three pollux , the ccamk-2 , and the three cyclops alleles; however, transcripts of the respective genes were detected in each of the lines with primer pairs targeting the 59 end of the transcript (Figure 5B). For ccamk-2 and the three cyclops mutants, transcripts correspond- ing to the 5 9 and 3 9 regions of the insertions were monitored (Figure 5). Although still partially transcribed, the genes are likely compromised due to the several kilobases of T-DNA or retro- transposon inserted within central exons (Figure 5A). In line

AM-Specific Signaling in Rice

2995

AM-Specific Signaling in Rice 2995 Figure 5. Rice Common SYM Genes and Characterization of SYM Loci.

Figure 5. Rice Common SYM Genes and Characterization of SYM Loci.

(A) Gene structures and positions of insertions in rice CASTOR , POLLUX , CCAMK , and CYCLOPS drawn to scale. The A of each ATG designates

nucleotide 1. Black boxes represent exons separated by introns (solid lines). Mutant line names and positions (in nucleotides) of the respective insertions are indicated. The mutants castor-1 and pollux-1 carry T-DNA (LB, left border; RB, right border); the other mutants carry Tos17 retrotransposon insertions. Arrows indicate primers used in (B).

(B) Analysis of CASTOR , POLLUX , CCAMK , and CYCLOPS transcripts in mutant and wild-type rice by RT-PCR using primer pairs located 5 9 (black

arrows) or 39 (light gray arrows) of the insertion and flanking the insertion (IF, insertion flank; dark gray arrows). For castor-1 and pollux-1 , cultivars Dongjin and Hwayoung were used as wild-type controls, respectively. For all other mutants, Nipponbare was employed as the wild type. Amplification of the wild-type control band corresponding to the 59 and 39 flanks of the pollux-2 and pollux-3 alleles was performed with the same primer pairs.

NF8513 ( ccamk-2 ), retrotransposon insertion into the third intron of CCAMK led to missplicing of the third exon and an in-frame fusion of the second and fourth exons (Chen et al., 2007). The deletion of the third exon removes a putative Ca 2+ -dependent autophosphorylation domain (Gleason et al., 2006; Tirichine et al., 2006) and is predicted to disrupt CCAMK function.

CASTOR, POLLUX, CCAMK, and CYCLOPS Are Required for AM Colonization in Rice

To define and compare the roles of CASTOR, POLLUX, CCAMK, and CYCLOPS in AM colonization, siblings from segregating T1

families of each mutant line were used for phenotypic charac- terization, enabling the direct comparison of mutant and wild- type alleles in the heterozygous and homozygous state for each locus under the same experimental setting. The sizes of the T1 families depended on seed availability and varied between 30 and 60 siblings. The genotypes of individual plants were deter- mined, and at least seven plants from each genotype were selected for microscopic inspection at 6 wpi. Since the insertion mutants were generated in three different rice japonica cultivars, Dongjin, Hwayoung, and Nipponbare, we quantitatively and qualitatively examined colonization by G. intraradices of each variety. Heterozygous and homozygous

2996 The Plant Cell

wild-type segregants as well as nonsegregating individuals of the parental varieties exhibited 69 6 9% of total root length coloni- zation, which was accompanied by abundant production of arbuscules and vesicles (Figures 6A to 6C and 7A). Root colo- nization of the sym mutants exhibited a patchy pattern of hyphopodia clusters accompanied by attempted penetration of rhizodermal cells (Figures 6D to 6O). Each of the homozygous mutants lacked cortex colonization and, therefore, arbuscules and vesicles (Figures 6D to 6O; see Supplemental Table 2 online). Total root length colonization was low and reached 4 to 14% (Figure 7B), including 1 to 10% of hyphopodia colonization of the different mutants, respectively. Fungal morphology in colonized homozygous mutant plants was similar for mutant alleles of the same gene and across all mutant lines, with occasional formation of hyphopodia (Figures 6D to 6L) or groups of twisted hyphae on the root surface (Figures 6D, 6I, 6L, and 6O). The fungus regularly penetrated individual rhizodermal cells, accompanied by either hyphal branching (Figures 6E to 6K) or coil formation (Figure 6E). Sometimes extensive hyphal growth into neighboring rhizodermal cells was observed, with cells almost entirely filled with deformed fungal structures (Figure 6M). Rarely, fungal hyphae were observed to grow through several cells of a file, branching inside cells, as shown for pollux-1 (Figure 6N).

In summary, the morphological AM phenotypes were very

similar for all mutant lines. The phenotypes of the rice castor ,

pollux , ccamk, and cyclops mutants resembled those of legume mutants (Kistner et al., 2005; Parniske, 2008), thus suggesting evolutionary conservation of these signaling components across distant angiosperms.

Molecular Phenotyping of the Rice SYM Pathway Mutants

To account for the irregular distribution of hyphopodial clusters on sym mutants, we performed molecular quantification of fungal DNA to precisely estimate the total amount of fungus present in each sample that could contribute to the elicitation of the host root. For this purpose, we first confirmed the previously reported (Isayenkov et al., 2005; Alkan et al., 2006) correlation between

microscopically and molecularly quantified colonization levels (see Supplemental Figure 5 online). In a time-course experiment, the kinetics of the relative amounts of fungal DNA matched those of the microscopically determined degree of fungal root coloni- zation (i.e., both Gi ITS1 DNA levels and the amount of fungal colonization structures were low at 3 wpi, increased slightly at 5 wpi, rose dramatically between 5 and 7 wpi, and were further enhanced at 9 wpi) (see Supplemental Figure 5 online). In wild- type and sym mutant rice, molecular determination of coloniza- tion levels mirrored the microscopic data, with comparably high amounts of fungal DNA for the wild type (Figures 7A and 7C) and much lower amounts for the sym mutants (Figures 7B and 7D).

A subset of nine marker genes was selected for real-time

RT-PCR–based molecular phenotyping of rice sym mutants inoculated with G. intraradices . The castor-1 , pollux-1 and pollux-2 , ccamk-1 and ccamk-2 , and cyclops-1 and cyclops-2 mutant alleles were analyzed. The selected marker genes reflect particular expression patterns: four early expressed genes ( AM1 , AM2 , AM3 , and AM11 ), the systemically expressed genes ( AM3

and AM34), and the three highest accumulating, late expressed genes ( AM10, AM14, and AM15). Rice PT11 was used as a marker for arbusculated cells. To test the suitability of the real- time RT-PCR primers for all cultivars used, transcript levels of the nine marker genes were compared. All nine marker genes were monitored reliably and at equivalent levels in mycorrhizal roots of each of the three cultivars (Figure 7E). Expression of the nine marker genes was determined in mutants (Figure 7F). Transcript levels were normalized against fungal DNA present in identical samples to account for possible variation in inoculum strength (Figures 7G and 7H). Despite indistinguishable morphological phenotypes of AM interaction in all four mutants, the expression patterns of marker genes differed among the mutants (Figures 7G and 7H). The profile of gene expression was equivalent in castor-1 and the two pollux alleles, both proteins acting upstream of Ca 2+ spiking. The patterns were different in the two lines mutated in CYCLOPS and therefore perturbed downstream of the Ca 2+ response. Such profile specificity could not be attributed to differences in fungal presence (Figures 7B and 7D). Interestingly, while ccamk-1 dis- played an expression profile identical to those of castor-1 and the pollux alleles, which is consistent with a loss of Ca 2+ response, ccamk-2 exhibited a pattern equivalent to those of the cyclops mutants, which is in accordance with a defect in the interaction with CYCLOPS. Although mutations in CASTOR , POLLUX , CCAMK , and CYCLOPS blocked colonization of the root cortex, the two early marker genes, AM1 and AM2, were expressed in all seven mutants (Figures 7G and 7H). Elicitation of gene activity, therefore, occurred in the absence of functional common SYM signaling. Three additional genes were detected in ccamk-2 and the two cyclops lines: the two systemically induced genes, AM3 and AM34 , and the late induced gene, AM14 (Figures 7G and 7H). AM11 was the only one of the four genes induced at early symbiotic stages not to be expressed in any mutant (Figures 7G and 7H), indicating a dependence of gene activation on the intact common SYM signaling pathway. Transcripts of the other late and nonsystemically induced genes, such as AM10 , AM15, and PT11 , were absent in the mutants. Whereas the spatial expres- sion patterns of AM10 , AM11, and AM15 are not known, PT11 expression depends on arbuscule formation. Since arbuscules were not formed in the mutants, the absence of expression of late induced genes could be due to either the absence of the particular symbiotic structures or deficiencies in symbiotic sig- naling. It would have been informative to determine gene ex- pression at the cytological level in the mutant background, but in situ hybridization was not sensitive enough to detect low-level transcripts in inoculated mutant roots. The mutant-specific gene expression patterns, such as the lack of detectable mRNA encoding the early induced gene AM11 in all mutants, together with their deficient symbiotic phenotypes are consistent with a crucial role of the common SYM pathway in rice. By contrast, the detection of transcripts of early activated genes in all mutants suggests the existence of AM signaling operating independently of the common SYM pathway. Expres- sion of three additional genes, AM3 , AM14 , and AM34, required Ca 2+ spiking but was independent of CYCLOPS, suggesting signaling diverging from the common SYM pathway at the Ca 2+ response.

AM-Specific Signaling in Rice

2997

AM-Specific Signaling in Rice 2997 Figure 6. AM Phenotypes of Rice sym Mutants. Trypan blue staining

Figure 6. AM Phenotypes of Rice sym Mutants.

Trypan blue staining of mutant and wild-type rice roots at 6 wpi with G. intraradices is shown.

(A)

to (C) Roots of the three cultivars, Dongjin (A) , Hwayoung (B), and Nipponbare (C), show abundant arbuscules and vesicles.

(D)

castor-1 . The fungus formed a hyphopodium in a groove between two rhizodermal cells. Extraradical hyphae branching off the hyphopodium

showed septa formation.

(E)

pollux-1 . Arising from a hyphopodium, several penetration pegs entered a rhizodermal cell, but the fungus did not progress into the cortex.

(F)

pollux-2 . The fungus formed a hyphopodium from which two penetration pegs entered two rhizodermal cells, where hyphae branched and formed

septa.

(G)

pollux-3 . Fungal hyphae branched inside a rhizodermal cell and formed septa.

(H)

ccamk-1 . Several fungal hyphae entered a rhizodermal cell, branched, and formed finger-like swellings.

(I) ccamk-2 . Penetration pegs from two small hyphopodia entered a rhizodermal cell and branched. Cortex colonization was not observed.

(J) cyclops-1 . Penetration pegs starting from a hyphopodium entered into different neighboring rhizodermal cells, branched inside the cells, and formed

septa. The fungus did not colonize the cortex.

(K)

cyclops-2 . A hypha branched inside a rhizodermal cell, growing back and forward inside the cell and forming septa.

(L)

cyclops-3 . A hypha formed a swollen hyphopodium and entered a rhizodermal cell, filling it with a large swelling.

(M)

castor-1. The fungus occupied several neighboring rhizodermal cells and formed branches and swellings.

(N)

pollux-1 . A hypha traveled intracellularly through rhizodermal cells, forming branches in the rhizodermis.

(O)

cyclops-3 . Fungal hyphae formed several swellings on the rhizodermal surface.

A, arbuscule; EH, extraradical hypha; HP, hyphopodium; HS, hyphal swelling; RB, rhizodermal branch (intracellular); RC, rhizodermal coil (intracellular); RS, rhizodermal hyphal swelling (intracellular); V, vesicle. Arrowheads indicate septa. Bars = 50 m m.

2998 The Plant Cell

2998 The Plant Cell Figure 7. Molecular Phenotypes of sym Mutants. (A) and (B) Percentage root

Figure 7. Molecular Phenotypes of sym Mutants.

(A) and (B) Percentage root length colonization of wild-type cultivars Donjin (DJ), Hwayoung (HY), and Nipponbare (N) (A) and common sym mutants (B) by G. intraradices at 6 wpi, determined by the grid-line intersect method. Means 6 SE of five plants represented by two replicate samples are shown.

DISCUSSION

Rice is the staple food for half of the global population; in addition

to being an important crop, it is also a powerful model system for

cereals. An improved understanding of the establishment and functioning of AM symbiosis in rice has the potential to directly impact management strategies for the optimization of sustain- able agricultural systems. The goal of this study has been to pave the way for investigations of AM-specific signaling in rice. In contrast with previous work, we studied a comprehensive list of genes specifically activated during AM symbiosis. This specific- ity was concluded from the absence of their mRNAs in non- mycorrhizal organs of the plant or in roots invaded by other beneficial (see Supplemental Figure 2 online) or pathogenic fungi

or in response to varying phosphate regimes (Gu¨ imil et al., 2005).

Thus, these genes are an invaluable tool to molecularly dissect signaling cascades specific to the AM symbiosis. Temporal expression analysis of rice roots colonized by G. intraradices distinguished early and late induced genes. Expres- sion of the previously characterized rice mycorrhiza-specific phosphate transporter PT11 (Paszkowski et al., 2002) served as

a marker for arbuscule formation, and in situ hybridization

confirmed specific expression in arbusculated cells, consistent with a role in symbiotic phosphate uptake at the periarbuscular

interface (Harrison et al., 2002; Javot et al., 2007). Activation of the genes AM1 , AM2 , AM3 , and AM11 prior to arbuscule development defined markers for early induction and

the existence of a signal acting at initial stages of the interaction corresponding to presymbiotic recognition, hyphopodia forma- tion, and early penetration. Transcription of these four genes remained high at later time points, as a result of systemic root elicitation, of continuously high but local induction, or of activa- tion by additional AM-specific signals. Evidence for the existence

of all three signaling alternatives was obtained from split-root

experiments (Figure 3) and in situ hybridization (Figure 4). Ex- pression of AM3 in both the colonized and noncolonized parts of

a split root indicated systemic induction (Figure 3B). Interest-

ingly, in situ hybridization revealed that mRNA of AM3 accumu- lated in cells with fully developed arbuscules (Figure 4H). Thus, activation of this gene is possibly regulated by two distinct

signaling pathways, the first operating systemically and the second operating arbuscule-specifically. Although it was to be expected that systemic induction would lead to hybridization signals in nonarbusculated cells, systemic expression might correspond to the relatively low amounts of mRNA per cell that are undetectable by in situ hybridization but, when induced in

AM-Specific Signaling in Rice

2999

most cells of the root, are detectable by real-time RT-PCR. Further support for a dual induction of AM3 is provided by expression values during split-root experiments. Consistent with the additive expression of systemic and arbuscule-associated induction, mRNA levels in mycorrhizal roots were higher than those in nonmycorrhizal roots, corresponding to only systemic values (Figure 3B). Interestingly, AM3 encodes a small secreted protein of only 98 amino acids containing a Lys motif (LysM) domain. LysM domains are known to bind N -acetylglucosamine, which is a component of rhizobial Nod factors, as well as of the fungal cell wall constituent chitin (reviewed in Buist et al., 2008). Intriguingly, legume receptor-like kinases that mediate percep- tion of the bacterial Nod factors contain LysM domains that physically interact with Nod factors (Radutoiu et al., 2007; reviewed in Buist et al., 2008). None of the other early induced genes exhibited systemic induction, but AM1 was found to have a distinct spatial expres- sion pattern. AM1 was expressed most strongly in cells neigh- boring intercellularly growing hyphae and in cells containing small arbuscules (Figure 4D) but was not detected in cells hosting fully developed arbuscules (Figure 4E). Arbuscules have a lifespan of only 4 to 10 d (reviewed in Hause and Fester, 2005), with different developmental stages simultaneously pres- ent in each root system. Although microscopic resolution of the in situ hybridization did not distinguish between developing and collapsing arbuscules, the early induction of AM1 argues for arbuscule formation rather than senescence. AM1 encodes the putative type III peroxidase PRX53 (Passardi et al., 2004), a secreted protein potentially involved in either the production or the scavenging of reactive oxygen species. Hydrogen perox- ide has been associated with mycorrhizal structures (Salzer et al., 1999; Fester and Hause, 2005), but as AM fungi them- selves produce hydrogen peroxide (Lanfranco et al., 2005), these results are difficult to interpret. Interestingly, peroxidase- generated hydroxyl radicals are involved in plant cell growth by nonenzymatic loosening of the cell wall (Liszkay et al., 2003, 2004). The remaining 14 genes exhibited the second major expres- sion pattern, typified by the absence of mRNA at early time points but having elevated transcript levels at later time points. The presence of PT11 within this group suggests that some genes followed arbuscule-specific induction and thus might be in- volved in arbuscule development and/or function. LPC was applied exogenously to determine which of the late induced genes are activated in parallel to PT11 and thus are related to the

Figure 7. (continued).

(C) and (D) Real-time RT-PCR–based measurement of G. intraradices ITS DNA relative to rice CYCLOPHILIN2 DNA in G. intraradices –inoculated (Gi)

and mock-inoculated (M) wild-type roots of the three wild-type rice cultivars (C) and the common sym mutants (D) at 6 wpi.

(E) and (F) Quantitative PCR-based expression analysis of nine marker genes relative to expression of the constitutive rice CYCLOPHILIN2 gene in the

three mock-inoculated and G. intraradices–inoculated wild-type cultivars (E) and the common sym mutants (F) . RNA for expression analysis was extracted from the same root samples used for the experiments shown in (C) and (D).

(G) and (H) Expression of nine marker genes in G. intraradices –inoculated wild-type cultivars (G) and common sym mutants (H) relative to G. intraradices

ITS DNA level (shown in [C] and [D] above). All experiment were repeated at least twice with similar results. For all real-time RT-PCR experiments, mean values of three technical replicates are displayed. Error bars indicate SD .

3000 The Plant Cell

same signaling pathway. LPC did not induce PT11 (see Supple- mental Figure 3 online), which may be due to technical short- comings or to the absence of this signaling pathway in rice. However, alternative expression patterns associated, for exam- ple, with progressive cortex colonization or late systemically activated genes may also be a feature of this group of genes. Indeed, 1 of the 14 genes, AM34 , was expressed in both halves of the split-root system, suggesting systemic induction (Figure 3B). In contrast with the early and systemically induced AM3 , the relative expression of AM34 was similar in the colonized and noncolonized parts of the root system, reflecting a single signal governing the late systemic transcription of AM34. The low levels of AM34 mRNA did not permit in situ hybridization. This gene is predicted to encode a UDP-glycosyltransferase, a class of enzymes that catalyze the transfer of glucose moieties to diverse substrates, including plant hormones, secondary metabolites, and xenobiotics, for their inactivation (Lim and Bowles, 2004). In transcript-profiling experiments, various glucosyltransferases were upregulated upon mycorrhizal colonization (Liu et al., 2003, 2007; Manthey et al., 2004; Hohnjec et al., 2005; Deguchi et al., 2007), consistent with the increased production of glyco- sylated secondary metabolites in mycorrhizal roots (Schliemann et al., 2008). The 18 selected genes proved robust as a universal marker set for AM symbioses in rice, since levels of their AM-induced transcripts were comparable during interaction with the phylo- genetically distant AM fungus Gi. rosea . This is particularly striking considering that the intracellular infection structures of Gi. rosea are rather coarse and simple arbusculated coils, compared with the highly ramified, finely branched arbuscules of G. intraradices . Moreover, the two fungi vary in symbiotic functions, since some plant species benefit considerably more from an association with G. intraradices than with Gi. rosea (Burleigh et al., 2002; Smith et al., 2003, 2004). Notably, a core set of plant genes was also found in M. truncatula to exhibit related expression patterns during interactions with three dis- tantly related AM fungi (Liu et al., 2007). Thus, AM signaling routes appear to be common to different AM symbioses despite morphological and nutritional differences. AM-specific signaling might in part occur dependently or independently of the unspecific common SYM signaling pathway discovered in legumes. We analyzed a set of rice mutants affected in genes coding for putative orthologs of legume pro- teins representing components of the common SYM pathway upstream and downstream of the Ca 2+ response. Inability of the mutants to establish mycorrhizal symbiosis demonstrated func- tional conservation of the encoded proteins and of the SYM signaling cascade across distant plant species. This finding is supported by previous reports that two individual proteins, CCAMK and IPD3 (CYCLOPS), are required for AM symbiosis in rice (Chen et al., 2007, 2008). Functional conservation of symbiotic signaling factors among dicotyledons and monocot- yledons is consistent with an evolutionary origin of AM symbiosis predating the divergence of the two main angiosperm classes. This evolutionary conservation possibly also extends beyond the angiosperms, but this remains to be demonstrated. Although our rice mutant selection did not include putative orthologs of all currently known legume SYM genes, it is likely that the complete

signaling pathway is conserved. This view is supported by the recent observation that rice SYMRK restores AM colonization in the L. japonicus symrk mutant (Markmann et al., 2008). Confirmation of the relevance of the common SYM pathway for AM development in rice led us to investigate the possibility of signaling routes operating independently of the known pathway. The similarly strong morphological and quantitative phenotypes of the rice common sym mutants (Figure 6) allowed for their dissection at the molecular level and the search for signaling routes in addition to the common SYM pathway in the absence of secondary effects perturbing the comparison. Nine markers corresponding to discrete signaling events reflected by their different spatial and temporal expression patterns were selected for molecular phenotyping. The absence of AM11 mRNA places the activation of this gene downstream of the common SYM pathway (Figure 8). Also, for the late markers AM10, AM15 , and Os PT11 , no transcript was detected in any of the mutants (Figure 8). However, PT11 expression was strictly dependent on arbus- cule formation, consistent with its absence in the mutants (Figure 8). The determination of whether induction of the two late genes AM10 and AM15 depends on arbuscules or intact common SYM proteins awaits spatial expression analysis. The activation of two early genes, AM1 and AM2 , in all mutants and three additional genes, the early systemic AM3 , the late systemic AM34, and the late induced AM14, in a subset of mutants indicated an induction independent of cortex colonization and arbuscule formation. While this was expected for the early systemic marker AM3 , it

this was expected for the early systemic marker AM3 , it Figure 8. AM-Specific Signaling Pathways

Figure 8. AM-Specific Signaling Pathways Including Bifurcation at the Ca 2+ Response.

The common SYM pathway displaying the components analyzed within this study consists of CASTOR and POLLUX upstream and CCAMK and CYCLOPS downstream of Ca 2+ spiking. Expression of AM11 is induced early and relies on an intact SYM pathway. Induction of systemically (S; gray arrows) induced genes, AM3 and AM34 , and the late (L; black arrows) induced gene, AM14 , relies on an intact Ca 2+ response and thus requires CASTOR, POLLUX, and CCAMK but is independent of CY- CLOPS. Expression of PT11 is dependent on arbuscule formation. The dependence of AM10 and AM15 on SYM pathway signaling or on arbuscule formation is not known (dashed arrows with question marks). AM1 and AM2 are induced early but do not require functional CASTOR, POLLUX, CCAMK, or CYCLOPS, demonstrating the existence of an alternative AM signaling pathway (AP).

suggested that late systemic induction of AM34 in wild-type roots, as well as late activation of AM14, does not require fungal penetration of the cortex. Interestingly, the seven mutants displayed two classes of expression patterns. The first pattern is defined by the expression of two of the four early genes, AM1 and AM2 , in all alleles of the four mutants, suggesting that their induction is independent of the common SYM pathway, but triggered by alternative signaling acting in parallel, either during presymbiotic recognition or hyphopodium formation, or both (Figure 8). The second pattern is characterized by the induction of three further genes, AM3 , AM14, and AM34, reliant on a functional Ca 2+ response but independent of CYCLOPS, thus suggesting deviation from the common SYM pathway down- stream of Ca 2+ spiking (Figure 8). Intriguingly, the expression pattern of the two mutant alleles of CCAMK differed, with ccamk-1 showing a similar pattern to that of the castor and pollux mutants and ccamk-2 having a pattern similar to that of the cyclops mutants (Figures 7F and 7H). The expression pattern of ccamk-1 can plausibly be explained by the lack of functional perception of Ca 2+ oscillations, which phenocopies the absence of Ca 2+ spiking. This is consistent with the transcriptional allele characterization that predicts CCAMK function to be compro- mised due to Tos17 insertion between the calmodulin binding domain and the three EF hands. By contrast, the transcription profile of ccamk-2 can be interpreted in different ways. In the first scenario, low amounts of wild-type transcript might still be produced for the induction of a subset of marker genes but might not be sufficient to restore symbiosis. Alternatively, since the ccamk-2 allele is predicted to encode a CCAMK derivative mutated within the kinase domain (Chen et al., 2007), expression of AM3 , AM14 , and AM34 appears reliant on CCAMK but might be independent of its kinase function. A recent publication reported that CCAMK phosphorylates CYCLOPS (Parniske, 2008). It is tempting, therefore, to speculate that the mutation in the kinase domain affected CYCLOPS phosphorylation in ccamk-2 . The expression profile of the ccamk-2 mutant is consistent with this interpretation, as it mimicked that of the three cyclops mutants. Further experimental evidence is re- quired to confirm the lack of kinase activity and thus CYCLOPS phosphorylation in ccamk-2 . In summary, the transcription of AM3 , AM14, and AM34 depended on functional CASTOR, POLLUX, and CCAMK but not on CYCLOPS, thus indicating the presence of novel AM-specific signaling components that mediate the induction of the three marker genes downstream of the Ca 2+ response (Figure 8). We conclude that AM-specific signaling in rice involves a complex network, including the evolutionarily conserved, and currently best defined, common SYM pathway. However, our results also suggest alternative signaling routes that either de- viate from, or are independent of, the common SYM pathway.

METHODS

Plant Material

Rice (Oryza sativa cv Nipponbare) was used for the characterization of rice marker genes. Rice lines carrying T-DNA insertions in CASTOR and POLLUX (lines 1B-08643 and 1C-03411, respectively) arose in the

AM-Specific Signaling in Rice

3001

japonica cultivars Dongjin and Hwayoung, respectively (Jeong et al., 2002, 2006). In the Nipponbare background, Tos17 (Miyao et al., 2003) insertions were identified in POLLUX (lines NC6423 and ND5050 for pollux-2 and pollux-3 , respectively), in CCAMK (lines NE1115 for ccamk-1 and NF8513 for ccamk-2 [Chen et al., 2007], respectively), and in CYCLOPS ( IPD3) (lines NG0782, NC2415, and NC2713 for cyclops-1 , c yclops-2 , and c yclops-3 , respectively). Segregating T1 individuals were used from each line in this study. T1 corresponds to progeny from the self-pollinated hemizygous or heterozygous primary T0 transformants (T-DNA–induced alleles) or regenerants (Tos17-induced alleles), respec- tively.

Plant Growth and Inoculation Conditions

Plants were grown in a phytochamber with a 12-h/12-h day/night cycle at 28/22 8 C and 60% humidity. They were watered every 2nd d for the first 2 wpi and thereafter fertilized every 2nd d with a mix of 0.005% (w/v) Hauert-Flory Typ A (Hauert) and 0.01% (w/v) Sequestren Rapid (Syngenta). These growth conditions were shown previously to maintain efficient and equal colonization.

Inoculation by AM Fungi

Rice seeds were surface-sterilized twice with 3.5% sodium hypochloride solution for 15 min, washed extensively with sterile water, and pregermi- nated in sterile water for 5 d at 25 8 C in the dark. Germlings were transplanted into washed and autoclaved quartz sand and inoculated upon planting with ; 1000 Glomus intraradices spores per plant from a commercially available inoculum (Biorize). Plants were harvested at 6 wpi or as indicated in the text. For time-course experiments, a low titer (100 spores per plant) of aseptically grown G. intraradices (Be´ card and Fortin, 1988) was used. Gigaspora rosea BEG9 inoculum was obtained from Biorize. Gi. rosea spores were collected with forceps and immersed in water, and 100 spores per plant were injected into the vicinity of the seedling root with a Pasteur pipette. Mock-inoculated plants received fungal growth medium or water.

Inoculation by Piriformospora indica

Cultures of P. indica were kindly provided by Phillip Franken (Institute for Ornamental and Vegetable Crops), and rice plants were inoculated according to Waller et al. (2005). P. indica –inoculated plants were harvested at 5 wpi.

Split-Root Experiment

Plants were pregerminated for 2 weeks on 0.4% water agar until the crown roots had reached a length of ; 10 cm. The roots were then divided into two pots, one of which was inoculated with G. intraradices and the other mock-inoculated. At 6 wpi, the inoculated and noninoculated parts of the root system were harvested separately.

Root Staining and Mycorrhizal Quantification

Roots were stained with trypan blue and mycorrhizal colonization was quantified with a modified grid-line intersect procedure as described previously (Paszkowski et al., 2006). Images were prepared with a Leica DM 5000 B microscope equipped with a Leica DFC420 camera. Briefly, total root length colonization, determined by the total amount of fungus and by the presence of specific structures, was scored microscopically at 100 random points per root sample. For reliable representation of root length colonization by specific mycorrhizal structures, all structures present at one random point were recorded separately.

3002 The Plant Cell

LPC Infiltration of Rice Roots

Plants were germinated for 10 d on 0.4% water agar. Roots were then infiltrated with LPC as described by Drissner et al. (2007) with minor modifications: roots were separated from shoots and immersed in 100 m M LPC (stock, 100 mM in methanol) in 10 mM sodium phosphate buffer, pH 6. The same buffer with equal amounts of methanol served as a control. Roots were infiltrated three times for 2 min followed by incubation in nutrient solution (0.005% [w/v] Hauert-Flory Typ A and 0.01% [w/v] Sequestren Rapid) for 3 h at 30 8 C. Roots were then shock-frozen in liquid nitrogen.

Identification of Homozygous Mutant Lines

DNA was extracted following Berendzen et al. (2005). Genotyping of segregating seedling populations was performed by PCR. Wild-type and mutated loci were distinguished by the use of specific primer pairs:

combining an insertion-specific primer with a gene-specific primer iden- tified the mutant allele, while two gene-specific primers spanning the insertion amplified the wild-type allele (see Supplemental Table 4 online). The amplicon diagnostic of the mutant allele was subsequently se- quenced following standard protocols.

RNA Extraction, cDNA Synthesis, RT-PCR, and Real-Time RT-PCR

RNA was extracted from 100 mg of ground root tissue using the NucleoSpin Plant RNA extraction kit according to the manufacturer’s instructions (Macherey-Nagel). cDNA synthesis and real-time RT-PCR were performed as described earlier (Gu¨ imil et al., 2005). Primer se- quences for real-time RT-PCR were adopted from Gu¨ imil et al. (2005) (see Supplemental Table 5 online). The absence of contaminating genomic DNA was confirmed by performing a control PCR on RNA not reverse- transcribed (2 RT). PCR amplification efficiencies were calculated with the program LinRegPCR (Ramakers et al., 2003). Expression values were calculated according to Gu¨ imil et al. (2005) and normalized to the geometric mean of amplification of four nearly constitutively expressed genes: ACTIN1 (The Institute for Genomic Research [TIGR] identifier, LOC_Os03g50890), CYCLOPHILIN2 (TIGR identifier, LOC_Os02g02890), GAPDH (TIGR identifier, LOC_Os08g03290), and POLYUBIQUITIN (TIGR identifier, LOC_Os06g46770). Normalized expression values were dis- played as a function of CYCLOPHILIN2 expression. Fungal colonization was quantified by real-time RT-PCR according to Isayenkov et al. (2004). Fungal DNA was extracted from the root homog- enate used for RNA extraction employing the DNeasy Plant DNA extrac- tion kit (Qiagen). Primer sequences to quantify G. intraradices were retrieved from Alkan et al. (2006) (see Supplemental Table 5 online). RT- PCR was performed according to standard PCR protocols using 35 PCR cycles and the indicated primers (see Supplemental Table 6 online). The rice CYCLOPHILIN2 transcript served as an internal constitutive control, and genomic DNA served as a technical control for amplification. Amplicons were visualized on a 1% agarose gel.

In Situ Hybridization

To generate probes for in situ hybridization, the primer pairs indicated (see Supplemental Table 4 online) were used to amplify a stretch of ;200 bp corresponding to gene-specific regions of PT11 , AM1 , and AM3. The amplicons were sequenced and cloned in the sense and antisense orientations into the pGEM-T Easy vector (Promega) with respect to the T7 promoter. Digoxigenin-labeled RNA probes were synthesized from linearized plasmids with T7 RNA polymerase (Promega) as described (Langdale, 1993). Root segments of ; 1 cm in length were fixed in 4% paraformaldehyde in PBS overnight at 4 8 C. The tissue was then dehydrated in a graded

ethanol series and subsequently in Rotihistol (Roth) in successive steps of 60-min duration. Finally, root pieces were embedded in Paraplast extra (Kendall), sectioned to 8-m m thickness on a rotary microtome (Leitz), and mounted on Superfrost Plus (Menzel) slides. In situ hybridization was performed as described (Langdale, 1993) with a modified washing buffer referred to as 0.2 3 SSC (13 SSC is 0.15 M NaCl and 0.015 M sodium citrate). Alkaline phosphatase activity was detected with Western Blue (Promega) supplemented with 1 mM Levamisole (Sigma-Aldrich).

Accession Numbers

Sequence data from this article can be found in the Oryza sativa Genome Initiative (TIGR; http://rice.plantbiology.msu.edu/) database with the following accession numbers: Os07g38070 ( SYMRK ), Os03g62650 ( CASTOR ), Os01g64980 ( POLLUX ), Os01g54240 (NUP85 ), Os03g12450 ( NUP133 ), Os05g41090 (CCAMK ), Os06g02520 ( CYCLOPS ), Os01g46860 (PT11 ), Os04g04750 ( AM1 ), Os08g34249 ( AM2 ), Os01g57400 (AM3 ), Os05g22300 (AM10 ), Os06g20120 (AM11 ), Os11g26140 (Os AM14), Os01g57390 (Os AM15 ), Os03g40080 (AM18 ), Os04g21160 ( AM20 ), Os02g03190 (AM24), Os06g35930 (AM25 ), Os12g30300 ( AM26 ), Os06g34470 (AM29), Os02g03150 (AM31 ), Os10g18510 ( AM34 ), Os04g13090 ( AM39 ), Os03g38600 (AM42).

Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure 1. Colonization of Rice Roots by P. indica .

Supplemental Figure 2. Expression Analysis of Marker Genes.

Supplemental Figure 3. Absence of PT11 Induction upon LPC Treatment of Rice Roots.

Supplemental Figure 4. Expression of Rice Common SYM Genes.

Supplemental Figure 5. Quantification of AM Colonization by Mi- croscopy and Real-Time RT-PCR.

Supplemental Table 1. Putative Functions of Proteins Encoded by Genes Exclusively Expressed in Mycorrhizal Roots.

Supplemental Table 2. Insertion Lines of Rice Common SYM Genes and Their Mycorrhizal Phenotypes.

Supplemental Table 3. Primers Used for SYM Transcript Analysis in sym Mutants.

Supplemental Table 4. Primers Used for Genotyping of Rice Inser- tion Lines.

Supplemental Table 5. Primers Used for Quantification of Fungal DNA and Gene Expression by Real-Time RT-PCR.

Supplemental Table 6. Primers Used for Detection of Rice Gene Expression by RT-PCR.

ACKNOWLEDGMENTS

We thank Patrick King and Ruairidh Sawers for editing the manuscript and also Jerzy Paszkowski for valuable comments on the manuscript. We are grateful to Manuel Bueno for his assistance with real-time RT- PCR, Jaqueline Gheyselinck and Roman Zimmermann for advice on in situ hybridization, Iva` n Fe´ lipe Acosta for assistance with computational programs, and Marcel Bucher for help with LPC infiltration. We thank Phillip Franken for providing P. indica inoculum and Martin Parniske for sharing unpublished information on CYCLOPS. This study was supported by Swiss National Foundation Grant 3100AD-104132, by a National

Centres of Competence in Research grant (Plant Survival), by a Ph.D. scholarship of the German Academic Merit Foundation to C.G., and by Swiss National Foundation Professeur Boursier Grant PP00A–110874 to U.P. H.I.-A. was supported by the Ministry of Agriculture, Forestry, and Fisheries of Japan (Rice Genome Project Grant PMI-0001), and G.A. was partly supported by the Biogreen 21 Program (Grant 20070401- 034-001) of the Rural Development Administration, Korea.

Received August 5, 2008; revised November 4, 2008; accepted Novem- ber 11, 2008; published November 25, 2008.

REFERENCES

Alkan, N., Gadkar, V., Yarden, O., and Kapulnik, Y. (2006). Analysis of quantitative interactions between two species of arbuscular mycor- rhizal fungi, Glomus mossae and G. intraradices , by real-time PCR. Appl. Environ. Microbiol. 72: 4192–4199. Ane, J.-M., et al. (2004). Medicago truncatula DMI1 required for bacterial and fungal symbioses in legumes. Science 303: 1364–1367. Bari, R., Datt Pant, B., Stitt, M., and Scheible, W.R. (2006). PHO2, microRNA399, and PHR1 define a phosphate-signaling pathway in plants. Plant Physiol. 141: 988–999.

Be´ card, G., and Fortin, J. (1988). Early events of vesicular-arbuscular mycorrhiza formation on Ri T-DNA transformed roots. New Phytol. 108: 211–218. Berendzen, K., Searle, I., Ravenscroft, D., Koncz, R., Batschauer, A.,

¨

Coupland, G., Somsich, I., and U lker, B. (2005). A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta . Plant Methods 1: 4. Buist, G., Steen, A., Kok, J., and Kuipers, O.P. (2008). LysM, a widely distributed protein motif for binding to (peptido)glycans. Mol. Micro- biol. 68: 838–847. Burleigh, S.H., Cavagnaro, T., and Jakobsen, I. (2002). Functional diversity of arbuscular mycorrhizas extends to the expression of plant genes involved in P nutrition. J. Exp. Bot. 53: 1593–1601. Chabaud, M., Venard, C., Defaux-Petras, A., Be´ card, G., and Barker, D. (2002). Targeted inoculation of Medicago truncatula in vitro root cultures reveals MtENOD11 expression during early stages of infec- tion by arbuscular mycorrhizal fungi. New Phytol. 156: 265–273. Chen, C., Ane, J.M., and Zhu, H. (2008). OsIPD3, an ortholog of the Medicago truncatula DMI3 interacting protein IPD3, is required for mycorrhizal symbiosis in rice. New Phytol. 180: 311–315. Chen, C., Gao, M., Liu, J., and Zhu, H. (2007). Fungal symbiosis in rice requires an ortholog of a legume common symbiosis gene encoding a

Ca + /calmodulin-dependent protein kinase. Plant Physiol. 145: 1619–

1628.

Deguchi, Y., et al. (2007). Transcriptome profiling of Lotus japonicus roots during arbuscular mycorrhiza development and comparison with that of nodulation. DNA Res. 14: 117–133. Drissner, D., Kunze, G., Callewaert, N., Gehrig, P., Tamasloukht, M.B., Boller, T., Felix, G., Amrhein, N., and Bucher, M. (2007). Lyso- phosphatidylcholine is a signal in the arbuscular mycorrhizal symbi- osis. Science 318: 265–268. Endre, G., Kereszt, A., Kevei, Z., Mihacea, S., Kalo, P., and Kiss, G.B. (2002). A receptor kinase gene regulating symbiotic nodule develop- ment. Nature 417: 962–966. Fester, T., and Hause, B. (2005). Accumulation of reactive oxygen species in arbuscular mycorrhizal roots. Mycorrhiza 15: 373–379. Glazebrook, J., Chen, W., Estes, B., Chang, H.-S., Nawrath, C., Metraux, J.-P., Zhu, T., and Katagiri, F. (2003). Topology of the

AM-Specific Signaling in Rice

3003

network integrating salicylate and jasmonate signal transduction derived from global expression phenotyping. Plant J. 34: 217–228. Gleason, C., Chaudhuri, S., Yang, T., Munoz, A., Poovaia, B., and Oldroyd, G. (2006). Nodulation independent of rhizobia induced by a calcium-activated kinase lacking autoinhibition. Nature 441: 1149–1152. Godfroy, O., Debelle, F., Timmer, T., and Rosenberg, C. (2006). A rice calcium-calmodulin dependent kinase restores nodulation to a le- gume mutant. Mol. Plant Microbe Interact. 19: 495–501. Gu¨ imil, S., Chang, H., Zhu, T., Sesma, A., Osbourn, A., Roux, C., Ioannidis, V., Oakely, E.J., Docquier, M., Descombes, P., Briggs, S.P., and Paszkowski, U. (2005). Comparative transcriptomics of rice reveals an ancient pattern of response to microbial colonization. Proc. Natl. Acad. Sci. USA 102: 8066–8070. Harrison, M. (2005). Signaling in the mycorrhizal symbiosis. Annu. Rev. Microbiol. 59: 19–42. Harrison, M., Dewbre, G., and Liu, J. (2002). A phosphate transporter of Medicago truncatula involved in the acquisition of phosphate released by arbuscular mycorrhizal fungi. Plant Cell 14: 2413–2429. Hause, B., and Fester, T. (2005). Molecular and cell biology of arbuscular mycorrhizal symbiosis. Planta 221: 184–196. Hirochika, H., Guiderdoni, E., An, G., Hsing, Y., Eun, M., Han, C., Upadhyaya, N., Ramachandran, S., Zhang, Q., Pereira, A., Sundaresan, V., and Leung, H. (2004). Rice mutant resources for gene discovery. Plant Mol. Biol. Rep. 54: 325–334. Hochholdinger, F., and Zimmermann, R. (2008). Conserved and diverse mechanisms in root development. Curr. Opin. Plant Biol. 11:

70–74.

Hohnjec, N., Vieweg, M., Pu¨ hler, A., Becker, A., and Ku¨ ster, H.

(2005). Overlaps in the transcriptional profiles of Medicago truncatula roots inoculated with two different Glomus fungi provide insights in the genetic program activated during arbuscular mycorrhiza. Plant Physiol. 137: 1283–1301. Imaizumi-Anraku, H., et al. (2005). Plastid proteins crucial for symbi- otic fungal and bacterial entry into plant roots. Nature 433: 527–531. Isayenkov, S., Fester, T., and Hause, B. (2004). Rapid determination of fungal colonization and arbuscule formation in roots of Medicago truncatula using real-time (RT) PCR. J. Plant Physiol. 161: 1379–1383 . Isayenkov, S., Mrosk, C., Stenzel, I., Strack, D., and Hause, B. (2005). Suppression of allene oxide cyclase in hairy roots of Medicago truncatula reduces jasmonate levels and the degree of mycorrhization with Glomus intraradices. Plant Physiol. 139: 1401–1410. Javot, H., Varma Penmetsa, R., Terzaghi, N., Cook, D.R., and Harrison, M.J. (2007). A Medicago truncatula phosphate transporter indispensable for the arbuscular mycorrhizal symbiosis. Proc. Natl. Acad. Sci. USA 104: 1720–1725. Jeong, D., An, S., Kang, H., Moon, S., Han, J., Park, S., Lee, H., An, K., and An, G. (2002). T-DNA insertional mutagenesis for activation tagging in rice. Plant Physiol. 130: 1636–1644. Jeong, D.H., et al. (2006). Generation of a flanking sequence-tag database for activation-tagging lines in japonica rice. Plant J. 45:

123–132.

Kanamori, N., et al. (2006). A nucleoporin is required for induction of Ca 2+ spiking in legume nodule development and essential for rhizobial and fungal symbiosis. Proc. Natl. Acad. Sci. USA 103: 359–364. Kistner, C., Winzer, T., Pitzschke, A., Mulder, L., Sato, S., Kaneko, T., Tabata, S., Sandal, N., Stougaard, J., Webb, K.J., Szczyglowski, K., and Parniske, M. (2005). Seven Lotus japonicus genes required for transcriptional reprogramming of the root during fungal and bacterial symbiosis. Plant Cell 17: 2217–2229. Kosuta, S., Chabaud, M., Lougnon, G., Gough, C., De´ narie´ , J., Barker, D., and Becard, G. (2003). A diffusible factor from arbuscular mycorrhizal fungi induces symbiosis-specific Mt ENOD11 expression in roots of Medicago truncatula . Plant Physiol. 131: 952–962.

3004 The Plant Cell

Kosuta, S., Hazledine, S., Sun, J., Miwa, H., Morris, R.J., Downie, J.A., and Oldroyd, G.E. (2008). Differential and chaotic calcium signatures in the symbiosis signaling pathway of legumes. Proc. Natl. Acad. Sci. USA 105: 9823–9828. Krajinski, F., and Frenzel, A. (2007). Towards the elucidation of AM- specific transcription in Medicago truncatula. Phytochemistry 68: 75–81. Lanfranco, L., Novero, M., and Bonfante, P. (2005). The mycorrhizal fungus Gigaspora margarita possesses a CuZn superoxide dismutase that is up-regulated during symbiosis with legume hosts. Plant Physiol. 137: 1319–1330. Langdale, J. (1993). In situ hybridization. In The Maize Handbook, M. Freeling and V. Walbot, eds (Berlin: Springer Verlag), pp. 165–180. Levy, J., et al. (2004). A putative Ca 2+ and calmodulin-dependent protein kinase required for bacterial and fungal symbioses. Science 303: 1361–1364. Lim, E.K., and Bowles, D.J. (2004). A class of plant glycosyltransfer- ases involved in cellular homeostasis. EMBO J. 23: 2915–2922. Liszkay, A., Kenk, B., and Schopfer, P. (2003). Evidence for the involvement of cell wall peroxidase in the generation of hydroxyl radicals mediating extension growth. Planta 217: 658–667. Liszkay, A., van der Zalm, E., and Schopfer, P. (2004). Production of reactive oxygen intermediates (O2 . 2 , H 2 O 2 and OH) by maize roots and their role in wall loosening and elongation growth. Plant Physiol. 136: 3114–3123. Liu, J., Blaylock, L., Endre, G., Cho, J., Town, C.D., VandenBosch, K. A., and Harrison, M.J. (2003). Transcript profiling coupled with spatial expression analysis reveals genes involved in distinct devel- opmental stages of the arbuscular mycorrhizal symbiosis. Plant Cell 15: 2106–2123. Liu, J., Maldonado-Mendoza, I., Lopez-Meyer, M., Cheung, F., Town, C.D., and Harrison, M.J. (2007). Arbuscular mycorrhizal symbiosis is accompanied by local and systemic alterations in gene expression and an increase in disease resistance in the shoots. Plant J. 50: 529–544. Manthey, K., Krajinski, F., Hohnjec, N., Firnhaber, C., Puhler, A., Perlick, A.M., and Kuster, H. (2004). Transcriptome profiling in root nodules and arbuscular mycorrhiza identifies a collection of novel genes induced during Medicago truncatula root endosymbioses. Mol. Plant Microbe Interact. 17: 1063–1077. Markmann, K., Giczey, G., and Parniske, M. (2008). Functional adap- tation of a plant receptor-kinase paved the way for the evolution of intracellular root symbioses with bacteria. PLoS Biol. 6: e68. Massoumou, M., van Tuinen, D., Chatagnier, O., Arnould, C., Brechenmacher, L., Sanchez, L., Selim, S., Gianinazzi, S., and Gianinazzi-Pearson, V. (2007). Medicago truncatula gene responses specific to arbuscular mycorrhiza interactions with different species and genera of Glomeromycota. Mycorrhiza 17: 223–234. Messinese, E., Mun, J., Yeun, L., Jayaraman, D., Rouge´ , P., Barre, A., Lougnon, G., Schornack, S., Bono, J., Cook, D., and Ane´ , J. (2007). A novel nuclear protein interacts with the symbiotic DMI3 calcium and calmodulin dependent protein kinase of Medicago truncatula . Mol. Plant Microbe Interact. 20: 912–921. Mitra, R.M., Gleason, C.A., Edwards, A., Hadfield, J., Downie, J.A., Oldroyd, G.E.D., and Long, S.R. (2004). From the cover. A Ca 2+ / calmodulin-dependent protein kinase required for symbiotic nodule development: Gene identification by transcript-based cloning. Proc. Natl. Acad. Sci. USA 101: 4701–4705. Miyao, A., Tanaka, K., Murata, K., Sawaki, H., Takeda, S., Abe, K., Shinozuka, Y., Onosato, K., and Hirochika, H. (2003). Target site specificity of the Tos17 retrotransposon shows a preference for insertion within genes and against insertion in retrotransposon-rich regions of the genome. Plant Cell 15: 1771–1780. Nagy, R., Karandashov, V., Chague, V., Kalinkevich, K., Tamasloukht, M., Xu, G., Jakobsen, I., Levy, A.A., Amrhein, N.,

and Bucher, M. (2005). The characterization of novel mycorrhiza- specific phosphate transporters from Lycopersicon esculentum and Solanum tuberosum uncovers functional redundancy in symbiotic phosphate transport in solanaceous species. Plant J. 42: 236–250. Parniske, M. (2008). Arbuscular mycorrhiza: The mother of plant root endosymbioses. Nat. Rev. Microbiol. 6: 763–775. Passardi, F., Longet, D., Penel, C., and Dunand, C. (2004). The class III peroxidase multigenic family in rice and its evolution in land plants. Phytochemistry 65: 1879–1893. Paszkowski, U. (2006). A journey through signalling in arbuscular mycorrhizal symbioses 2006. New Phytol. 172: 35–46. Paszkowski, U., Jakovleva, L., and Boller, T. (2006). Maize mutants affected at distinct stages of the arbuscular mycorrhizal symbiosis. Plant J. 47: 165–173. Paszkowski, U., Kroken, S., Roux, C., and Briggs, S. (2002). Rice phosphate transporters include an evolutionarily divergent gene spe- cifically activated in arbuscular mycorrhizal symbiosis. Proc. Natl. Acad. Sci. USA 99: 13324–13329. Radutoiu, S., Madsen, L.H., Madsen, E., Jurkiewicz, A., Fukai, E., Quistgaard, E.M.H., Albrektsen, A., James, E.K., Thirup, S., and Stougaard, J. (2007). LysM domains mediate lipochitin-oligosaccharide recognition and Nfr genes extend the symbiotic host range. EMBO J. 26: 3923–3935. Ramakers, C., Ruijter, J., Lekanne Deprez, R., and Moorman, A. (2003). Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 339: 62–66. Saito, K., et al. (2007). NUCLEOPORIN85 is required for calcium spiking, fungal and bacterial symbiosis and seed production in Lotus japonicus. Plant Cell 19: 610–624. Salzer, P., Corbiere, H., and Boller, T. (1999). Hydrogen peroxide accumulation in Medicago truncatula roots colonized by the arbus- cular mycorrhiza-forming fungus Glomus intraradices . Planta 208:

319–325.

Sato, M., Mitra, R.M., Coller, J., Wang, D., Spivey, N.W., Dewdney, J., Denoux, C., Glazebrook, J., and Katagiri, F. (2007). A high- performance, small-scale microarray for expression profiling of many samples in Arabidopsis-pathogen studies. Plant J. 49: 565–577. Schliemann, W., Ammer, C., and Strack, D. (2008). Metabolite profil- ing of mycorrhizal roots of Medicago truncatula . Phytochemistry 69:

112–146.

Schu¨ ssler, A., Schwarzott, D., and Walker, C. (2001). A new fungal phylum, the Glomeromycota: Phylogeny and evolution. Mycol. Res. 105: 1413–1421. Siciliano, V., Genre, A., Balestrini, R., Cappellazzo, G., deWit, P.J.G.M., and Bonfante, P. (2007). Transcriptome analysis of arbuscular mycor- rhizal roots during development of the prepenetration apparatus. Plant Physiol. 144: 1455–1466. Smith, S., and Read, D. (1997). Mycorrhizal Symbiosis. (London:

Academic Press). Smith, S., Smith, F., and Jakobsen, I. (2004). Functional diversity in arbuscular mycorrhizal (AM) symbioses: The contribution of the my- corrhizal P uptake pathway is not correlated with mycorrhizal re- sponses in growth or total P uptake. New Phytol. 162: 511–524. Smith, S.E., Smith, F.A., and Jakobsen, I. (2003). Mycorrhizal fungi can dominate phosphate supply to plants irrespective of growth re- sponses. Plant Physiol. 133: 16–20. Stracke, S., Kistner, C., Yoshida, S., Mulder, L., Sato, S., Kaneko, T., Tabata, S., Sandal, N., Stougaard, J., Szczyglowski, K., and Parniske, M. (2002). A plant receptor-like kinase required for both

bacterial and fungal symbiosis. Nature 417: 959–962. Tirichine, L., et al. (2006). Deregulation of a Ca 2+ /calmodulin dependent kinase leads to spontaneous nodule formation. Nature 441: 1153–

1156.

Varma, A., Savita, V., Sudha, Sahay, N., Butehorn, B., and Franken, P. (1999). Piriformospora indica , a cultivable plant-growth-promoting root endophyte. Appl. Environ. Microbiol. 65: 2741–2744. Waller, F., Achatz, B., Baltruschat, H., Fodor, J., Becker, K., Fischer, M., Heier, T., Hu¨ ckelhoven, R., Neumann, C., von Wettstein, D., Franken, P., and Kogel, K. (2005). The endophytic fungus Piriformo- spora indica reprograms barley to salt stress tolerance, disease resis- tance and higher yield. Proc. Natl. Acad. Sci. USA 102: 13386–13391. Weidmann, S., Sanchez, L., Descombin, J., Chatagnier, O., Gianinazzi, S., and Gianinazzi-Pearson, V. (2004). Fungal elicitation of signal transduction-related plant genes precedes mycorrhiza es- tablishment and requires the dmi3 gene in Medicago truncatula . Mol. Plant Microbe Interact. 17: 1385–1393. Zhu, H., Riely, B.K., Burns, N., and Ane´ , J. (2006). Tracing nonlegume orthologues of legume genes required for nodulation and arbuscular mycorrhizal symbiosis. Genetics 172: 2491–2499.

NOTE ADDED IN PROOF

AM-Specific Signaling in Rice

3005

During review of this article, confirmation of the functional conservation between legume and rice of common SYM signaling components oper- ating upstream of calcium spiking (CASTOR and POLUX) was provided by Banba et al. (2008) and Chen et al. (2008).

Banba, M., Gutjahr, C., Miyao, A., Hirochika, H., Paszkowski, U., Kouchi, H., and Imaizumi-Anraku, H. (2008). Divergence of evolu- tionary ways among common sym genes: CASTOR and CCaMK show functional conservation between two symbiosis systems and consti- tute the root fo a common signaling pathway. Plant Cell Physiol. 49:

1659–1671.

Chen, C., Fan, C., Gao, M., and Zhu, H. (2008). Antiquity and func- tion of CASTOR and POLLUX, the twin ion channel-encoding genes key to the evolution of root symbioses in plants. Plant Physiol., in press.

Supplemental Data. Gutjahr et al. (2008). Arbuscular mycorrhiza-specific signaling in rice transcends the common symbiosis signaling pathway.

A

H S S H
H
S
S
H

B

Pi Tef

CP2

P. i.

M

H 2 O

pathway. A H S S H B Pi Tef CP2 P. i. M H 2 O
pathway. A H S S H B Pi Tef CP2 P. i. M H 2 O

Supplemental Figure 1. Colonization of rice roots by Piriformpora indica (A) Roots inoculated with P. indica at 5 wpi stained with trypan blue.

H

= hyphae, S = zoospores, size bar = 50 µm. (B) Amplification of Pi Tef from cDNA

of

colonized roots. Rice CYCLOPHILIN2 (CP2) was used as an internal control.

Gi M (Gi)

) Leaf

(Pi)

Gi M (Gi

Pi gDNA

Embryo

M

Panicle

Shoot

Shoot

Callus

Root

Root

Root

Root

Stem

-RT

A

B

Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3
Panicle Shoot Shoot Callus Root Root Root Root Stem -RT A B PT11 AM1 AM2 AM3

PT11

AM1

AM2

AM3

AM10

AM11

AM14

AM15

AM24

AM25

AM26

AM31

AM34

AM39

CP2

1,E+00 AM18 AM20 1,E-01 AM29 AM42 1,E-02 1,E-03 1,E-04 relative expression Root Gi Root M
1,E+00
AM18
AM20
1,E-01
AM29
AM42
1,E-02
1,E-03
1,E-04
relative expression
Root Gi
Root M (Gi)
Shoot Gi
Shoot M (Gi)
Embryo
Stem
Leaf
Panicle
Root Pi
Root M (Pi)
Callus

Supplemental Figure 2: Expression analysis of marker genes (A) RT-PCR-based expression analysis of 14 genes in different rice organs and callus, in roots and shoots of plants colonized by G. intraradices (Gi) and in roots colonized by P. indica (Pi). Genomic DNA (gDNA) was used as technical control for RT-PCR and rice CYCLOPHILIN2 (CP2) served as a constitutively expressed control gene. (B) Real-time RT-PCR-based expression analysis of low-abundant transcripts. Error bars represent S.D. for three technical replicates. The experiment was repeated twice with similar results.

control gDNA -RT

LPC

PT11

CP2

con tro l gDNA -RT LPC PT11 CP2 Supplemental Figure 3. Absence of PT11 induction upon
con tro l gDNA -RT LPC PT11 CP2 Supplemental Figure 3. Absence of PT11 induction upon

Supplemental Figure 3. Absence of PT11 induction upon LPC treatment of rice roots RT-PCR-based expression analysis of PT11 in roots treated with lysophphatidylcholine (LPC). Solvent treated roots were used as a control. Genomic DNA (gDNA) was used as a technical control for PCR and rice CYCLOPHILIN2 (CP2) served as a constitutively expressed control gene. -RT, control PCR reaction on RNA not reverse transcribed. The experiment was repeated twice with similar results.

Gi Embryo

Leaf Panicle

M Stem

gDNA

Callus

Root

Root

-RT

Embryo Leaf Panicle M Stem gDNA Callus R o o t Root -RT SYMRK CASTOR POLLUX
Embryo Leaf Panicle M Stem gDNA Callus R o o t Root -RT SYMRK CASTOR POLLUX
Embryo Leaf Panicle M Stem gDNA Callus R o o t Root -RT SYMRK CASTOR POLLUX
Embryo Leaf Panicle M Stem gDNA Callus R o o t Root -RT SYMRK CASTOR POLLUX
Embryo Leaf Panicle M Stem gDNA Callus R o o t Root -RT SYMRK CASTOR POLLUX
Embryo Leaf Panicle M Stem gDNA Callus R o o t Root -RT SYMRK CASTOR POLLUX
Embryo Leaf Panicle M Stem gDNA Callus R o o t Root -RT SYMRK CASTOR POLLUX

SYMRK

CASTOR

POLLUX

NUP85

NUP133

CCAMK

CYCLOPS

CP2

Supplemental Figure 4: Expression of rice common SYM genes Expression of rice SYMRK, CASTOR, POLLUX, NUP85, NUP133, CCAMK and CYCLOPS in mycorrhizal (Gi) and mock-inoculated (M) roots and other organs or callus of rice. Genomic DNA (gDNA) was used as a technical control for PCR. Rice CYCLOPHILIN2 (CP2) served as a constitutively expressed control gene. The experiment was repeated twice with similar results.

A

90 total 80 ext hyphae hyphopodia 70 int hyphae 60 arbuscules vesicles 50 40 30
90
total
80
ext hyphae
hyphopodia
70
int hyphae
60
arbuscules
vesicles
50
40
30
20
10
0
root length colonization [%]

B

3579

wpi

1,E+00 1,E-01 1,E-02 1,E-03 1,E-04 Gi ITSrelative DNA level
1,E+00
1,E-01
1,E-02
1,E-03
1,E-04
Gi ITSrelative
DNA level

3579

wpi

Supplemental Figure 5. Quantification of AM colonization by microscopy and real-time RT-PCR. (A) Percent (%) root colonization of different structures of G. intraradices. The mean ± S.E. are displayed (n = 5). (B) Quantity of G. intraradices ITS-DNA relative to rice CYCLOPHILIN 2 (CP2) at each indicated time-point. The mean ± S.D. for three technical replicates is shown.

Supplemental Table 1. Putative function of proteins encoded by genes exclusively expressed in mycorrhizal roots

TIGR –ID

Gene-ID

Putative Function

LOC_01g46860

PT11

PT11 ph

phate transporter

LOC_04g04750

AM1

putative class III peroxidase (Prx53) hypothetical protein (O. s.), proteinase inhibitor I13 in potato 1 contains peptidoglycan binding LysM domain 1 similarity to putative hypersensitivity-related (Hsr) protein hypothetical protein, similarity to nucleoid DNA-binding protein cnd41 serine-threonine kinase like contains peptidoglycan binding LysM domain 2 putative scarecrow-like gene regulator similar to AB-hydrolase associated lipase region putative cDNA putative MIP aquaporin, nodulin 26-like serine-threonine kinase, calcium dependent (EF hand) similar to Ring-H2 zinc finger protein-like hypothetical protein (O. s.), proteinase inhibitor I13 in potato 2

LOC_08g34249

AM2

LOC_01g57400

AM3

LOC_05g22300

AM10

LOC_06g20120

AM11

LOC_11g26140

AM14

LOC_01g57390

AM15

LOC_03g40080

AM18

LOC_04g21160

AM20

LOC_02g03190

AM24

LOC_06g35930

AM25

LOC_12g30300

AM26

LOC_06g34470

AM29

LOC_02g03150

AM31

LOC_10g18510

AM34

putative UDP-glucuronyl/UDP-glucyltransferase cysteine peptidase, protease family C1 putative secretory carrier membrane protein

LOC_04g13090

AM39

LOC_03g38600

AM42

Supplemental Table 2. Insertion lines of rice common SYM signaling genes and their mycorrhizal phenotypes

Mycorrhizal Structure

 

Rhizodermal

Cortex

SYM gene

TIGR ID

RAP ID

Insertion line

Hyphopodia

Coils/Branches/

Hyphae

Vesicles

Arbuscules

 

Swellings

 

wild-type Dongjin (DJ) wild-type Hwayoung (HY) wild-type Nipponbare (N)

+

+

+

++

++

+

+

+

++

++

+

+

+

++

++

SYMRK

LOC_07g38070

07g0568100

no insertion line 1B-08643 (DJ) 1C-03411 (HY) NC6423 (N) ND5050 (N) no insertion line no insertion line NE1115 (N) NF8513 (N) a NG0782 (N) NC2415 (N) NC2713 (N) b

 

CASTOR

LOC_03g62650

03g0843600

+

+

-

-

-

POLLUX LOC_01g64980

01g0870100

+

+

-

-

-

 

+

+

-

-

-

+

+

-

-

-

NUP85

LOC_01g54240

01g0746200

 

NUP133

LOC_03g12450

03g0225500

CCAMK

LOC_05g41090

05g0489900

+

+

-

-

-

 

+

+

--

-

CYCLOPS

LOC_06g02520

06g0115600

+

+

-

-

-

 

+

+

-

-

-

+

+

--

-

a Previously described by Chen et al., 2007. b Previously described by Chen et al., 2008.

Supplemental Table 3: Primers used for SYM transcript analysis in sym mutants.

Gene

Primer Sequences

CASTOR

Forward:

GAGCAGCAGAAGCAGCAGCAG

5’

Reverse:

CGGATACCATCCCTGACCATCG

castor-1

Forward:

CGATGGTCAGGGATGGTATCCG

insertion flanking

Reverse:

GTTACAAGCCCAAGCATCATGG

CASTOR

Forward:

GGGAACGAGATGCAAATACG

3’

Reverse:

TCCGCCTTGAAACTTTGTCT

POLLUX

Forward:

GACAGATGGGGCACCAGCAAC

5’

Reverse:

GAAGAGCCTCGCTTCCGTGG

pollux-1

Forward:

GGAGGAGAAGAGCCTCGCTTCC

insertion flanking

Reverse:

GGAAGCTAAATTCCAGTCCGCG

pollux-2

Forward:

GGAGGAGAAGAGCCTCGCTTCC

insertion flanking

Reverse:

CACAAGCCCAAGCATTGTGGC

pollux-3

Forward:

GCCACAATGCTTGGGCTTGTG

insertion flanking

Reverse:

CTCCACATGGAACAGCGTCAGG

POLLUX

Forward:

GCGGCACTTAGAAAGTTTGC

3’

Reverse:

ATGCCATGCTGACAAGTTCA

CCAMK

Forward:

AAGGAGGGGAGTGAGCAAGT

5’

Reverse:

CGTCGGAGATCGATACCTGT

ccamk-1

Forward:

GATCTCATGGATGCAGAGGTCGTC

Insertion flanking

Reverse:

TGATGCAGCCTGACCGATCAG

CCAMK

Forward:

TTTGAGCAGGTGCTGAGAGC

3’

Reverse:

TGATGCAGCCTGACCGATCAG

CYCLOPS

Forward:

GCGATGATGGAGAACTCGATGG

5’

Reverse:

CTGCATTCCTGTCATGGGAGAC

cyclops-1,2,3

Forward:

CTGATTCCGCAGAATTTGGC

insertion flanking

Reverse:

ATGCTGTACCAAGCCAAACC

CYCLOPS

Forward:

GGCAGAAGCAAAGGAAAGAA

3’

Reverse:

CGCTCTTTTTCTTCCACCAG

Supplemental Table 4: Primers used for genotyping of rice insertion lines.

Gene

Primer Sequences

CASTOR

1B-08643

Castor.genot.F

CGATGGTCAGGGATGGTATCCG

WT

Castor.genot.R

GCCAACCGCTTGTTTATGGG

CASTOR

1B-08643

Castor.genot.F

CGATGGTCAGGGATGGTATCCG

mutant

p2717_2364.R

CGCGTCGGCAGTTTGCTGC

POLLUX

1C-03411

Pollux.genot.F1

GGAGGAGAAGAGCCTCGCTTCC

WT

Pollux.genot.R1

GGAAGCTAAATTCCAGTCCGCG

POLLUX

1C-03411

GUS1 RB GCCGTAATGAGTGACCGCATCG

mutant Pollux.genot.R1 GGAAGCTAAATTCCAGTCCGCG

POLLUX

NC6423

Pollux.genot.F2

GCAGCTAGCTATAGCAAACAAGAG

WT

Pollux.genot.R2

TTTCATCGGATGCTAAAACAATAA

POLLUX

NC6423

Pollux.genot.F2

GCAGCTAGCTATAGCAAACAAGAG

mutant

T17_left

ATTGTTAGGTTGCAAGTTAGTTAAGA

POLLUX

ND5050

Pollux.genot.F3

AGCTGCTGTGCTATATATGTTTGG

WT

Pollux.genot.R2

TTTCATCGGATGCTAAAACAATAA

POLLUX

ND5050

Pollux.genot.F3

AGCTGCTGTGCTATATATGTTTGG

mutant

T17_left

ATTGTTAGGTTGCAAGTTAGTTAAGA

CCAMK

NE1115

CcamK.genot.F1

TGTTCTCTTCCACAAAAGACACAT

WT

CcamK.genot.R1

GAGGTTTTAGGCTGATCAAGTCAT

CCAMK

NE1115

CcamK.genot.F1

TGTTCTCTTCCACAAAAGACACAT

mutant

T17_right

CAGCAACGATGTAGATGGTCAAGC

CCAMK

NF8513

CcamK.genot.F2

GCTCTCAGCACCTGCTCAAAC

WT

CcamK.genot.R2

CTGAAGAATTATGGGTTCCATTATC

CCAMK

NF8513

CcamK.genot.F2

GCTCTCAGCACCTGCTCAAAC

mutant

T17_left

ATTGTTAGGTTGCAAGTTAGTTAAGA

CYCLOPS

NG0782

WT

CYCLOPS

NG0782

Cyclops.genot.F1

Cyclops.genot.R1

Cyclops.genot.F2

CACCCAGTCAGACTCCAACA

ATGCTGTACCAAGCCAAACC

AGGCATTTTCATCACCCATC

mutant

T17_left

ATTGTTAGGTTGCAAGTTAGTTAAGA

CYCLOPS

NC2415

WT

CYCLOPS

NC2415

Cyclops.genot.F1

Cyclops.genot.R1

Cyclops.genot.F2

CACCCAGTCAGACTCCAACA

ATGCTGTACCAAGCCAAACC

AGGCATTTTCATCACCCATC

mutant

T17_left

ATTGTTAGGTTGCAAGTTAGTTAAGA

CYCLOPS

NC1713

WT

Cyclops.genot.F1

Cyclops.genot.R1

T17_left

Cyclops.genot.R1

CACCCAGTCAGACTCCAACA

ATGCTGTACCAAGCCAAACC

CYCLOPS

NC2713

mutant

ATTGTTAGGTTGCAAGTTAGTTAAGA

ATGCTGTACCAAGCCAAACC

Supplemental Table 5 : Primers used for quantification of fungal DNA and gene expression by real-time RT - PCR.

Gene

Primer Sequences

 

Forward:

GAGACCATGATCAGAGGTCAGGT

Gi ITS1

Reverse:

GGTCATTTAGAGGAAGTAAAAGTCGTAAC

 

Forward:

GATGTTACGGATCTGGGTATATCGA

Gr ITS2

Reverse:

CGGCTATAATTAGTACGCTTCACATT

 

Forward:

GAGAAGTTCCCTGCTTCAAGCA

PT11

Reverse:

CATATCCCAGATGAGCGTATCATG

 

Forward:

ACCTCGCCAAAATATATGTATGCTATT

AM1

Reverse:

TTTGCTTGCCACACGTTTTAA

 

Forward:

ATGCCGTTGTCGTCCATGA

AM2

Reverse:

CCCTCACGCCGGATTTC

 

Forward:

CTGTTGTTACATCTACGAATAAGGAGAAG

AM3

Reverse:

CAACTCTGGCCGGCAAGT

 

Forward:

AGAACACTTGTGGCCGTACTATAAGA

AM10

Reverse:

CCTCTCGACGAAAGTACGGACTA

 

Forward:

TGAACGAAGACAGCAATACATCAA

AM11

Reverse:

CGATCGATGGATTCATACTTCAGT

 

Forward:

CCAACACCGTTGCAAGTACAATAC

AM14

Reverse:

GCACTTTGAAATTGGACTGTAAGAAA

 

Forward:

TCCGGCGCCACATAGTG

AM15

Reverse:

TCCGTCGCACACGAGAAG

 

Forward:

TGCCATGTGGATGATGCATAG

AM18

Reverse:

CGACGAGGAAGATCAATGGTTAGT

 

Forward:

TTTGGAAGGAACACTACTGGAGAAT

AM20

Reverse:

CCGAAATCTAGTTTCGACAATGATT

 

Forward:

TCTTCATCACCGCCGACAT

AM24

Reverse:

CGGCGAGATAGTGAGCATAAAGA

 

Forward:

CTTGCTGCCTTCCTCTATGGA

AM25

Reverse:

CGAGAAGTCGACGACTCCTACAC

 

Forward:

GGTTGTTGCGGCATGTGTAC

AM26

Reverse:

AGCCATGTCCCTAGCGAGGTA

 

Forward:

TGCGACGTGATCAGCCAC

Os AM29

Reverse:

TGCACGCACCTGTTCCAC

 

Forward:

CGATGAAGTTGTTGTCCACGAA

AM31

Reverse:

CGTCTCGCCGGAGTTCAA

 

Forward:

TTGCCAAAAATAGAAGCATCACA

AM34

Reverse:

CATAGTACTTAAAGTGAAAGGGCAAGGT

 

Forward:

CCGAATCTCAAGCAGGATGTG

AM39

Reverse:

AAATTGTCGTTTGTGTACCCTGACT

 

Forward:

ATTTGTTGAACGAGCACAATCG

AM42

Reverse:

ACATCAACACTCTTACACTCACACACA

 

Forward:

TCTAATTCTTCGGACCCAAGAATG

ACTIN1

Reverse:

AGCAGGAGGACGGCGATAA

 

Forward:

GTGGTGTTAGTCTTTTTATGAGTTCGT

CYCLOPHILIN2

Reverse:

ACCAAACCATGGGCGATCT

 

Forward:

CTGATGATATGGACCTGAGTCTACTTTT

Os GAPDH

Reverse:

CAACTGCACTGGACGGCTTA

 

Forward:

CATGGAGCTGCTGCTGTTCTAG

Os UBIQUITIN

Reverse:

CAGACAACCATAGCTCCATTGG

Supplemental Table 6: Primers for detection of rice gene expression by RT-PCR. For AM1, AM3 and PT11 the same primers were used to generate probes for in situ hybridization.

Gene

Primer Sequences

 

Forward:

AGCTCTCCTAGATCTGTGCTG

CYCLOPHILIN 2

Reverse:

GCGATATCATAGAACGAGCGAC

 

Forward:

CCTGGCATAAAAGGGCAATA

SYM RK

Reverse:

GTGCTTTCGATGGACCTCAT

 

Forward:

GGGAACGAGATGCAAATACG

CASTOR

Reverse:

TCCGCCTTGAAACTTTGTCT

 

Forward:

GCGGCACTTAGAAAGTTTGC

POLLUX

Reverse:

ATGCCATGCTGACAAGTTCA

 

Forward:

GCACAAGAAGGAAGGACTGG

NUP85

Reverse:

GCATGGCTTGGTAGGTGAAT

 

Forward:

CTGATCGAGATGTGCCTGAA

NUP133

Reverse:

AGGACAGTGCCCTGAAGAGA

 

Forward:

GATCTCATGGATGCAGAGGTCGTC GCTCTCAGCAC CTGCTCAAAC

CCAM K

Reverse:

 

Forward:

GGCAGAAGCAAAGGAAAGAA

CYCLOPS

Reverse:

CGCTCTTTTTCTTCCACCAG

 

Forward:

CATCACCAACATGCTCGGCTTC

PT11

Reverse:

GTATGCATATCCCAGATGAGC

 

Forward:

CACCAAGAGCTGCAGGG

CTACCAAC

AM1

Reverse:

TTTGCTTGCCACACGTTTTAA

 

Forward:

ATGAGCCAGAAGTCGT

CGTG

AM2

Reverse: TATTTCGCGATGACGGGAAT

 

Forward:

GTTACGTGGTGGTGGAGGAT

AM3

Reverse:

GTCGAGGCAGACCCACTG

 

Forward:

GAGGAGGGGTATGTGCAGTC

AM10

Reverse:

CCCCTTGTTCACCTCCTGTA

 

Forward:

ACTTCAGTTTCGTCGCGATT

AM11

Reverse:

GGCAAAATCTGCTTCAATCC

 

Forward:

GATTCAAAGGTTGGCAGAGC

AM14

Reverse:

CCAACACCGTTGCAAGTACA

 

Forward:

CGAGAAGTTCCACGGAGACG

AM15

Reverse:

AGTTGATGTTCGGGTTGAGG

 

Forward:

CGGCGAGATAGTGAGCATAA

AM24

Reverse:

GTCGTTGAGGAAGACGAGGA

 

Forward:

TCGTCATCGAGTTCGTCATC

AM25

Reverse:

TCCCAAGATGTACACCCACA

 

Forward:

CAACCAAATCATGCGAAACA

AM26

Reverse:

TGAATGCCATTTAGCCCATT

 

Forward:

TGGAGAAGAAGAAGGTGAGGTG

AM31

Reverse:

TAACTGATGACGGGGACCTT

 

Forward:

AAAGTGAAAGGGCAAGGTGA

AM34

Reverse:

CTCAAGAGGGGAGGTTGGAT

 

Forward:

TAGCATTGACACGCTTCCAGC

AM39

Reverse:

TGCCGCTGTGTATGGGTACTTAG

Arbuscular Mycorrhiza Specific Signaling in Rice Transcends the Common Symbiosis Signaling Pathway Caroline Gutjahr, Mari Banba, Vincent Croset, Kyungsook An, Akio Miyao, Gynheung An, Hirohiko Hirochika, Haruko Imaizumi-Anraku and Uta Paszkowski Plant Cell 2008;20;2989-3005; originally published online November 25, 2008; DOI 10.1105/tpc.108.062414

This information is current as of February 5, 2014

© American Society of Plant Biologists

ADVANCING THE SCIENCE OF PLANT BIOLOGY