Volume 27 No.

3
 International Buffalo Information Center BUFFALO BULLETIN
ISSN : 0125-6726
(IBIC)

Aims Buffalo Bulletin is published quarterly in March,

IBIC is a specialized information center on
water buffalo. Established in 1981 by Kasetsart
University (Thailand) with an initial financial
support from the International Development
Research Center (IDRC) of Canada. IBIC aims at
being the buffalo information center of buffalo
research community through out the world.
June, September and December. Contributions on
any aspect of research or development, progress
reports of projects and news on buffalo will be
considered for publication in the bulletin. Manu-
scripts must be written in English and follow the
instruction for authors which describe at inside of
the back cover.

Main Objectives Editor

1. To be world source on buffalo
information
2. To provide literature search and
photocopy services
3. To disseminate information in
newsletter
4. To publish occasional publications
such as an inventory of ongoing
research projects
S. Sophon
Publisher
International Buffalo Information Centre,
Main Library, Kasetsart University
Online availible:
http://ibic.lib.ku.ac.th/e-Bulletin

BUFFALO BULLEITN
IBIC, KASETSART UNIVERSITY, P.O. BOX 1084
BANGKOK 10903, THAILAND
URL : http://ibic.lib.ku.ac.th
E-mail : libibic@ku.ac.th
Tel : 66-2-9428616 ext. 344
Fax : 66-2-9406688

AN INVESTIGATION INTO COMPARATIVE MORTALITY RATES OF NEONATAL BUFFALO
CALVES VERSUS COW CALVES
A.K. Jain1, I.J. Sharma2, A. Dixit2, R.G. Agrawal3, and Y.P.S. Malik4
ABSTRACT
A survey was conducted in 25 organized
dairy farms of Jabalpur, Madhya Pradesh to explore
the cause of heavy mortality of neonatal buffalo
calves. The population of crossbred cows in the
selected area was only 10% of buffalo population.
The number of breeding cow bulls per dairy were
also less than that of buffalo bulls. The cow and
buffalo calves were fed nearly 1.0 to 1.5 litres
colostrum daily followed by milk in gradually
decreasing quantity up to 30 days before introduction
of calf starter. To find out the cause of heavy toll of
neonates of buffaloes and cows, colostrum and blood
samples of newly calved dams and blood samples
of the neonatal calves were collected for immu-
noglobulin estimation. The immunoglobulin level in
the sera samples of pre-parturient cows and buffaloes
were 92.0 ± 16.0 and 126.0 ± 10.7 mg/ml,
respectively, whereas, the serum levels of
immunoglobulin levels in the sera samples of post-
parturient cows and buffaloes were 149.0 ± 28.0
and 201.7 ± 10.72 mg/ml, respectively. Though the
feeding and managemental conditions appeared to
be almost identical for the cow calves and the buffalo
calves, on average the mortality rate of buffalo
calves was reported to be higher than that of cow
calves due to incompatible concentration of
immunoglobulins in the colostrum and their
absorption from the gastro-intestinal tract of the
buffalo calves leading to their poor defense.
Keywords: mortality, immunity, colostrum, bovine
dam, neonatal calf
1
NDRI, Karnal, Haryana, India; 2 Department of Veterinary Physiology; 3 Department of AROG;
4
Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry,
Jabalpur-482001 (M.P.), India
215
Buffalo Bulletin (September 2008) Vol.27 No.3
INTRODUCTION
Buffaloes make a backbone of the Indian
dairy industry, where they contribute nearly 60% of
the total milk produced (Govt. of India, 2002).
Buffaloes, though anatomically very close to cattle,
are physiologically different in many respects
including early embryonic loss and high neonatal
mortality (Banerjee, 1998). A heavy toll of neonates
has been reported in buffalo calves, particularly
during first three months of their postnatal life (Jain,
2005). In cattle rearing, good dairy herds are raised
rather than purchased (Maslyanko and Maslyanko,
1975). Thus, it is prudent to reduce the mortality of
neonatal buffalo calves.
The Second World Buffalo Congress
strongly suggested that scientists become involved
in buffalo research to find out the causes of the high
mortality of neonatal buffalo calves and devise
remedies (Acharya, 1988). The average calf
mortality rate reported in cattle was 29.1% while
that in buffaloes was 38.85% up to 3 months of age
(Acharya, 1988). Though, the buffalo is a native
Indian dairy animal, it has been little studied and data
available on cattle are being taken and used in the
treatment of buffaloes. Hence, the present survey
work was undertaken to study the mortality rate of
buffalo calves vis a vis cattle calves and to explore
possible reasons for differences between the two.
MATERIALS AND METHODS
A survey was conducted on 25 organized
dairy farms of Jabalpur to explore the causes of
high mortality of neonatal buffalo calves. In order
Buffalo Bulletin (September 2008) Vol.27 No.3
to assess the status of the mortality rate of buffalo
calves in comparison to the cow calves, a total of
more than 9,000 cattle and buffaloes of all age groups
(viz; calves, heifers, pregnant, lactating and dry
animals) were included. Information about the
number of breeding bulls was also collected. Data
on the feeding of the animals in terms of the amount
of concentrate mixture and roughage or green fed
to each category of animal were collected from dairy
owners. Feeding of colostrum and milk to the calves
and duration of such feeding to each category of
the calves was also noted. The birth weight, age at
maturity and status of vaccination and administration
of deworming agents were recorded. Status of the
calf mortality in different age groups of calves and
age at mortality was also noted. Management,
particularly housing status for newly born calves as
well as growing calves, was recorded.
The data collected by questionnaire were
analyzed for mean and standard error as per
standard procedures.
RESULTS AND DISCUSSION
The present investigation (Tables 1-3)
revealed that population of crossbred cows (718)
was nearly 10 percent of the buffalo population
(7062) which indicates preference of the local
consumers for buffalo milk. The number of breeding
cow bulls was 1-2 per farm whereas that of buffalo
bulls ranged between 2 and 6 per dairy farm. Both
cow calves and buffalo calves were fed nearly 1.0
to 1.5 liters of colostrum daily followed by milk in a
gradual decreasing quantity up to 30 days before
introduction of calf starter.
The buffalo calves were reported to have
had intolerance to higher amounts of colostrum and
to have developed diarrhoea after feeding excess
colostrum (Banerjee, 1998). The tolerance of buffalo
calves for cow colostrum was reported to be higher,
and buffalo calves did not develop diarrhoea when
fed cow colostrum. The management conditions
were not optimum for the calves in commercial
dairies, and separate calf pens were not seen in any
of the dairy farms, except in the Dairy Unit of
Composite Livestock Farm, Adhartal, Jabalpur. The
216
dairy owners appeared not to be interested in rearing
the calves for economic reasons.
The immunoglobulin levels in the sera
samples of pre-parturient buffaloes and cows were
92.0 ± 16.0 and 126.0 ± 10.7 mg/ml, respectively,
and that in post-parturient cows and buffaloes were
149.0 ± 28.0 and 201.7 ± 10.72 mg/ml, respectively.
The immunoglobulin content in the colostrum of the
post-parturient buffaloes was 244.0 ± 32.0 mg/ml.
Immunoglobulin levels in the calves of both species
before colostrum feeding were much less (Table 4).
Six hours after colostrum feeding, the serum
immunoglobulin levels in the calves of both the
species increased significantly (P<0.05) to the levels
of 153.0 ± 34.0 in cow calves and to 122.0 ± 3.0
mg/ml in buffalo calves (Table 5). In the present
study, levels of immunoglobulin fell during about three
days of post-colostral feeding, and thereafter, they
started increasing slowly and reached maximum
levels of 115.0 ± 25.0 and 107.0 ± 25.0 mg/ml for
cow calves and buffalo calves, respectively.
Though the feeding and managemental
conditions appeared to be almost identical for the
cow calves and the buffalo calves, on average, the
mortality rate of buffalo calves was reported to be
more than 75% (inclusive of forced death or disposal
to Kasaimandi) and that too before 1.0 to 1.5 months
of age, whereas it was only nearly 20% in case of
cow calves.
An earlier study found that the cow
colostrum fed to the buffalo calves is beneficial to
them, which indicates the presence of some
unidentified immunoglobulin absorptive accelerators
in the cow colostrum (Filteau, 2003). There appears
to be a calf-to-calf variation in the efficiency of
colostral immunoglobulin absorption, which also
varies with the presence of inhibitors in the colostrum
(Filteau, 2003). The most probable reason for
mortality of the buffalo calves may be an unidentified
deficiency in their internal defense mechanism
(Gupta et al., 1990). It is a well established fact that
the internal defense (immunity) of the animals is built
up jointly by the blood cells, particularly the
leucocytes, immunoglobulins and certain other
essential elemental factors. The maternal transfer
of immunoglobulin through syndesmochorial
placenta is very low (Gupta et al., 1990). The
concentration of immunoglobulins in the colostrum
 Buffalo Bulletin (September 2008) Vol.27 No.3

Table 1. Total surveyed population of cows and buffaloes.

CATTLE BUFFALOES
Total surveyed population 718 7062
Bulls 1-2 / herd 2-6 / farm
Colostrum fed to the calves 1-1.5 lit. 1-1.5 lit.

Table 2. Profile of total immunoglobulin pre and post parturient cows and buffaloes.

Stage Animals Total Immunoglobulin

Prepartum Cows 92.42±16.0
Buffaloes 126.63±10.7
Postpartum Cows 149.29±28
Buffaloes 201.75±10.72

Table 3. Profile of total immunoglobulin of neonatal cow calves and buffalo calves before
colostrum feeding and six hours after colostrum feeding.

Pre colostrum 6 h. post colostrum

Parameters Animals
feeding feeding
Total Cc 4.1±1.0 153±34
immunoglobulin
(mg/ml) Bc 5.8±0.6 122±30

217
Buffalo Bulletin (September 2008) Vol.27 No.3

Table 4. Profile of total immunoglobulin (mg/ml) in neonatal buffalo calves and cow calves in
relation to their mortality.

N e o n a ta l
T im e in te r v a ls T o ta l I m m u n o g lo b u lin s
c a lv e s
Bc 5 .8 ± 0 .6
P re -c o lo s tra l fee d in g
Cc 4 .1 ± 1 .0
Bc 122±30*
6 h rs p o st-c o lo s tra l fe ed in g
Cc 153±34
Bc 6 5 ± 9 .3
1 st D ay P o s tn ata l
Cc 96±25
Bc 91±13
2 n d D ay P o s tn ata l
Cc 95±19
Bc 98±18
3 rd D ay P o stn a ta l
Cc 103±21
Bc 119±13
4 th D ay P o stn a tal
Cc 104±19
Bc 123±22
5 th D ay P o stn a tal
Cc 134±29
Bc 103±27
6 th D ay P o stn a tal
Cc 113±11
Bc 101±22
1 4 th D ay P o stn a ta l
Cc 110±21
Bc 109±10
2 1 st D ay P o stn a tal
Cc 115±26
Bc 125±12
2 8 th D ay P o stn a ta l
Cc 104±11
Bc 129±15
3 5 th D ay P o stn a ta l
Cc 140±35
Bc 90±24*
4 2 n d D ay P o stn a tal
Cc 148±60
Bc 184±32
4 9 th D ay P o stn a ta l
Cc 142±32
Bc 104±26
5 6 th D ay P o stn a ta l
Cc 139±16
Bc 123±22
6 3 rd D ay P o s tn ata l
Cc 114±20
Bc 95±13*
7 0 th D ay P o stn a ta l
Cc 174±32
Bc 126±10
7 7 th D ay P o stn a ta l
Cc 115±26
Bc 115±15
8 4 th D ay P o stn a ta l
Cc 104±12
Bc 107±25
9 1 st D ay P o stn a tal
Cc 115±25

218

Table 5. Mortality Pattern of Calves.
Overall
Animal
Mortality (%) Summer (%)
Cow calves 10 - 10
Buffalo calves 30 20
and their absorption from the gastro-intestinal tract
of the buffalo calves are quite different from that of
the cow calves. Such phenomena are suspected to
result in poor defense in buffalo calves leading to
heavy mortality in the early stage of their life.
CONCLUSION
This surveillance study indicated that certain
adversaries do exist in the buffalo colostrum and
gastrointestinal tract of buffalo calves which are
responsible for poor immune status and higher
mortality rate leading to severe depletion of the best
milch genotype and to a huge economic loss to Indian
farmers.
ACKNOWLEDGEMENTS
The authors duly acknowledge the financial
help of ICAR, New Delhi, under P-326 project and
dairy farmers of Jabalpur for their cooperation.
Buffalo Bulletin (September 2008) Vol.27 No.3
Season wise Sex wise
Winter (%) Male (%) Female (%)
5 5
41 12.5 4.1
REFERENCES
Acharya, R.M. 1988. The buffalo: dairy, draught and
meat animal of Asia, p. 1– 17. In Proceedings
of the Second World Buffalo Congress , vol.
I, 12–17 December, New Delhi, India.
Banerjee, G.C. 1998. A Text Book of Animal
Husbandry, 8th ed. Oxford and IBM Publishing
Co. Pvt. Ltd., New Delhi. 715p.
Filteau, V. 2003. Health status and risk factor
associated with failure of passive transfer of
immunity in new born beef calves. Can. Vet.
J., 44 (11): 907-913.
Govt. of India. 2002. Economic Survey 2001-2002.
Delhi Economic Division. Ministry of Finance.
Gupta, V.K., G.C. Ram and M.P. Bansal. 1990.
Preliminary studies in immunoglobulin levels
of Indian buffaloes. Indian Vet. J., 67: 883-
884.
Jain, A.K. 2005. Assessment of immunocompetence
of buffalo and cow calves and role of neem
oil as immunomodulator. M.V.Sc. Thesis,
JNKVV, Jabalpur.
Maslyanko, R. P. and N. F. Maslyanko. 1975.
Ukrainskii Biokhimchnii Zhurnal, 47: 90.
219
Buffalo Bulletin (September 2008) Vol.27 No.3
DYSTOCIA DUE TO FETAL ARTHROGRYPOSIS IN A SHE BUFFALO
S.P. Shukla, S.P. Nema, S.S. Mahor, K.P. Gupta and U.K. Garg
ABSTRACT
In the present study, dystocia due to fetal
arthrogryposis in a she buffalo was recorded. In the
present case of fetal arthrogryposis delivery of a
calf with manual correction and forced traction was
achieved successfully without any post-operative
complication to the dam.
Keywords: dystocia, arthrogryposis, buffalo
INTRODUCTION
Fetal anomalies and monstrocities of various
kind causing dystocia in catlle (Arthur et al., 1989,
Shukla and Chauhan 2004) and buffaloes
(Kumaresan et al., 2003 and Shukla et al., 2006)
have been recorded. The fetal anomalies are believed
to occur due to adverse factors affecting the fetus
in early stages of development. These include
physical, chemical and viral factors. The present
paper places on record a case of fetal arthrogryposis
causing dystocia in a she buffalo.
CASE HISTORY AND DIAGNOSIS
A four-year-old murrah buffalo heifer at her
full term of gestation was presented to the Teaching
Veterinary Clinical Service Complex, College of
Veterinary Science and Animal Husbandry, Mhow
with history of dystocia. Water bags had been
ruptured 20 h before the case was presented in the
Teaching Veterinary Clinical Service Complex. The
buffalo was straining. Clinical examination revealed
Department of Animal Reproduction, Gynaecology & Obstetrics, College of Veterinary Science and Animal
Husbandry, J.N.K.V.V. Campus Mhow (M.P.) -453446 India
220
that the buffalo was alert and was straining. There
was complete letdown of milk and the pelvic
ligaments were relaxed. The vulva was slightly
edematous. Per vaginal examination revealed
complete relaxation of the cervix. The birth canal
was dry due lack of fetal fluids. The fetus was in
anterior longitudinal presentation, dorso-sacral
position, right lateral deviation of head and neck and
flexion of fore limbs from knee joint. The fetus was
diagnosed dead.
TREATMENT, CLINICAL
OBSERVATIONS AND DISCUSSION
The obstetrical management was started
under posterior epidural anesthesia (7 ml, 2%
Xylocaine hydrochloride). The dried up birth canal
was thoroughly lubricated with sweet oil. A snare
was applied on both flexed fore limbs. To create
working space the fetus was manually repelled into
deep abdominal cavity. To correct the deviation of
head, eye hook was applied in the eye socket and
traction was applied. Then a judious forced traction
was applied at the fore limbs and head by two persons
with the help of the snare. Thus with some difficulty,
the dead fetus, weighing 16 kg, was extracted. The
dam was normal and shed placenta within 7 h.
On gross examination, the fetus was a dead
male calf weighing 16 kg. The lower mandible of
the fetus was underdeveloped and the tail was
smaller than the normal (Figure 1). There was
knuckling of the hind limbs. All the limbs were
ankylosed showing joint contracture. Both hind limbs
were much longer than the normal and curved
anteriorly. There were no testes in the scrotal sac.

The neck and spinal cord was contracted (Figure
2). The lumbar vertebrae were underdeveloped. A
near scapula bony mass was observed.
On postmortem examination, the trachea
was found to be diverted, the thoracic cavity was
not fully developed, the heart was enlarged
(cardiomegaly), the lungs were underdeveloped, and
diaphragm was not fully developed.
Congenital anomalies causing obstetrical
problems have been well documented in cattle (Sloss
and Dyfty, 1980, Shukla and Chauhan, 2004) and in
Figure 1.
Figure 2.
221
Buffalo Bulletin (September 2008) Vol.27 No.3
buffaloes (Shukla et al., 2006 and Mahajan et al.,
2006). Arthrogryposis is one of the musculo-skeletal
deformities frequently encountered congenital
disease (Leipold et al., 1996) in farm animals and
pets. In this condition, there is permanent joint
contractures. Its associated effects include
pelatoschimiasis and kyphoscoliasis (Morrow, 1986).
In the present case of fetal arthrogryposis,
delivery of the calf with manual correction and
forced traction was achieved successfully without
any post operative complication to the dam.
*Continued on page 230
Buffalo Bulletin (September 2008) Vol.27 No.3
MOLECULAR CLONING AND CHARACTERIZATION OF THE BETA-CASEIN GENE
IN AN INDIAN RIVERINE BUFFALO (BUBALUS BUBALIS)
Tarun K. Bhattacharya1, Pushpendra Kumar2 and Arjava Sharma2
ABSTRACT
The present study was carried out to
characterize beta-casein cDNA of Indian riverine
buffalo. This gene was cloned in plasmid vector and
sequenced for molecular characterization of the
cDNA. The whole buffalo beta-casein cDNA was
675 bp in length. We have submitted the buffalo
cDNA sequences to the NCBI GenBank with the
accession number DQ631829. This gene was
composed of 23.85% A, 20.59% G, 24.89% T and
30.67% C indicating 48.74% as AT and 51.26% as
GC. The similarity of the buffalo cDNA sequence
with that of cattle was estimated as 98.08% while
with the sequences of other species like sheep, pig,
camel, human, rat and rabbit, it was 96.60%. As far
as protein sequence is concerned, the similarity of
buffalo sequence with its cattle counter part was
estimated as 97.30% and with the sequences of all
other species studied here, it was calculated as
93.30%. The molecular weight of buffalo beta-
casein protein was estimated as 25.105 kDa. The
secondary structure composition of buffalo beta-
casein protein was prediced as having 14.3% helix
(H), 1.3% strand (E) and 83.9% loop (L) whereas
solvent accessibility composition was 79.02 % of
“e” type (residues exposed with more than 16% of
their surface) and 20.98 % of “b” type (others).
Keywords: buffalo, beta-casein, homology,
nucleotide, sequence
1
Project Directorate on Poultry, Rajendranagar, Hyderabad, Andhra Pradesh-500030, India
e-mail: bhattacharyatk@gmail.com
2
Animal Genetics Division, Indian Veterinary Research Institute, Izatnagar, Bareilly, UP - 243122, India
222
INTRODUCTION
The buffalo is famous for production of high
milk fat and protein and high total solid content in
milk. Besides, it is well known that buffaloes have a
unique feed conversion efficiency using low grade
roughages and are able to thrive under harsh climatic
conditions with resistance to many diseases. Despite
its huge potential and superiority to cows in many
aspects, the buffalo has remained generally
neglected. In ruminants, caseins are the major milk
proteins, which constitute 80% of the total protein
in milk (Dalgleish, 1993). There are four types of
caseins, namely alpha s1-, alpha s2-, beta- and
kappa-casein present in milk of which beta-casein
constitutes about 36% of total casein (Davies and
Law, 1980).
Beta-casein protein is a calcium sensitive
protein and is insoluble in milk, and its concentration
is 9.3 gm/litre (Eigel et al., 1984). Beta-casein
increases the firmness of curd from enzymically
coagulated milk (Jimenez-Flores and Richardson,
1988). Mariani (1983) reported that the beta-casein
B variant was superior to A variant in cheese making.
Beta-casein helps in the absorption of minerals like
Fe and Zn in the intestinal tract, besides, Fe
complexed to beta-casein displayed a better
bioavailability than gluconate Fe (Bouhallab et al.,
2002). It has been found that the binding of Zn to
beta-casein improved Zn absorption and prevented
Fe from inhibiting its absorption (Peres et al., 1998).
Various studies have been found with
respect to correlation between beta-casein variants
and type I diabetes. (A1 and B) variants of beta-
casein have correlation (r = +0.982) with type I insulin

dependent diabetes mellitus. They yield a bioactive
peptide beta-casomorphin-7 after in vitro digestion,
which has an immunosuppression property which
could account for diabetes incidence (Elliott et al.,
1999). A significantly increased level of antibodies
to beta-casein is found in patients with type I
diabetes (Moretini et al., 2002).
The primary protein sequence of beta-casein
has been elucidated by Ridadeau Dumas et al.
(1972) and Grosclaude et al. (1972). It is the most
hydrophobic among all casein proteins and consists
of more proline residues than any other casein
residue.
The polymorphism of beta-casein gene has
been studied by several workers in various species
like cattle (Pinder et al., 1991; Lein et al., 1992;
Damiani et al.,1992; Janno et al., 2002), goat (Mahe
and Grosclaude, 1993; Langley-Danysz, 1993;
Pappalardo et al., 1996; Pappalardo et al., 1997;
Bonifacio, 2001), and sheep (Serrano et al., 1999).
Bovenhuis et al. (1992) reported that in Holstein-
Fresian cattle the beta-casein phenotypes ranked in
the order of decreasing milk production as follows:
A 2B > A 1A 3, A 1A 2, A 1A 1 > A 1B > BB. In the
Ayrshire breed of cattle, 305 days of the first
lactation yield for A2 variant of beta-casein was 6077
kg, compared to 5838 kg for A1 variant (Kim et al.,
1996). The A1 variant of beta-casein was associated
with higher milk protein than the A 2 variant
(Bovenhuis et al., 1992; Ng-kwai-Hang et al.,
1986). Various studies have found differences in fat
content among the different phenotypes of beta-
casein (Ng-Kwai-Hang et al., 1986; McLean et al.,
1984). But, to date, this important gene has not been
characterized in buffaloes in detail. Therefore, the
present study was carried out to characterize this
gene in buffalo at the molecular level.
MATERIALS AND METHODS
Sample
Mammary tissue (100 mg) of a Murrah
buffalo was collected from the Municipal
Corporation slaughterhouse, Bareilly, Uttar Pradesh,
India, and carried to the laboratory on ice. The sample
was stored at -70 0C till further use.
223
Buffalo Bulletin (September 2008) Vol.27 No.3
Isolation of mRNA
The total RNA was extracted following the
method described by Sambrook and Russel (2001).
The RNA was stored at -70 0C for further use. The
purity of the RNA was verified by measuring
absorbance of the RNA solution in UV-
Spectrophotometer at 260 nm and 280 nm. The RNA
sample showing the OD260 : OD280 value between
1.9-2.2 was of good quality. The integrity of the
extracted RNA was checked using 2.2 M
formaldehyde denatured agarose gel electrophoresis
(Sambrooke and Russel, 2001). The mRNA was
purified from total RNA using an oligotex mRNA
isolation kit (Qiagen, Germany).
Designing of primer
For the amplification of the beta-casein gene
of buffalo, the primers were designed from the
published cattle, sheep, pig and human sequences
available from the NCBI GenBank (Acc. No.
NM_181008, X16482, NM214434 and NM001891)
with the help of DNASIS MAX software (Hitachi
Miraibio Inc., USA). The Primer sequences were
Forward, 5' ATGAAGGTCCTCATCCTTGCCTG
3 ' and reverse, 5 ' TTAGACAATAATAGGG
AAGGGTC 3'.
RT-PCR
The total RNA was reverse transcribed
using murine reverse transcriptase enzyme to
synthesize single strand cDNA. About 2 μg (2 μl)
of total RNA was taken in a 0.2 ml PCR tube and
incubated at 700C for 10 minutes and immediately
snapped in ice. Then the master mix (MgCl2, 25 mM;
Reverse Transcription 10x buffer; dNTP mixture,
10 mM; Rnasin; AMV Reverse Transcriptase,15u;
Oligo (dT)15 primer and Nuclease free water to
make a final volume of 20 μl ) was added to the
PCR tube. The reaction mix with RNA was
incubated at 420C for 15-20 minutes for reverse
transcription. Then the sample was heated to 950C
for 5 minutes and incubated at 50C for 5 minutes.
The synthesized cDNA was stored at -200C for
further use. The cDNA was purified following the
method described by Sambrook and Russel (2001).
PCR was carried out to amplify 675 bp fragment of
beta-casein cDNA from single strand cDNA using
forward and reverse primers. The final volume of
25 μl PCR reaction mixture was composed of 100
Buffalo Bulletin (September 2008) Vol.27 No.3
ng cDNA, 100 μM of each dNTP, 50 ng of F1 and
R1 primer, 2.0 mM MgCl2, 1U Taq DNA polymerase
and assay buffer (Imperial Biomedics, India). The
amplification conditions were 950C for 2 minutes
followed by 35 cycles of 940C for 45 seconds, 640C
for 1 minute and 72 0C for 1 minute and final
extension of 720C for 5 minutes.
Elution of PCR product
The amplified products of beta-casein genes
were run in 0.8% agarose gel having a long combed
well. The products were visualized under a trans-
illuminator, the gels having DNA fragments of
interest were cut using a scalpel, and the DNA was
isolated from gel using a MinElute Gel Extraction
Kit (Qiagen) following the manufacturer ’s
instructions.
Cloning of cDNA
Beta-casein cDNA amplified from the
Murrah buffalo was cloned using the principle of
UA ligation. The amplified products were ligated
with the pDRIVE Cloning Vector following the
manufacturer’s instructions (Qiagen) and it was
transformed into E.coli DH5α strain. The ligation
reaction was set up in a 0.5 ml PCR tube with 2X
Rapid Ligation buffer, pDRIVE-cloning Vector (50
ng/μl), A- tailed PCR product (template DNA) and
T4 DNA Ligase (3 units/μl). The ligation mix was
briefly mixed and incubated at 190C for 3 h. The
competent cells were prepared following the
instructions of Sambrook and Russel (2001). The
ligation mix (1.0 μl) was added to freshly thawed
competent cells (200 μl) using a pre-chilled pipette
tip and mixed gently. Then the transformation was
carried out following the method described by
Sambrook and Russel (2001). After transformation,
the plates were screened for the presence of blue/
white colonies. The recombinant clones were
identified by white color on indicator plates. In order
to minimize the number of clones to be handled,
clones were initially checked by colony PCR and
later confirmed by plasmid-PCR. The positive
samples were reconfirmed by restriction enzyme
digestion of the plasmid DNA with EcoR1 enzyme
as EcoRI enzyme has cutting sites on either side of
multiple cloning site in pDRIVE cloning vector.
224
Sequencing
Sequencing was performed by an
automated sequencer (ABI prism) using Sanger’s
dideoxy chain termination method. The cloned PCR
products from the Murrah buffalo were submitted
in the form of the stab culture. The T7F and SP6R
primers (position of T7F and SP6R primers binding
site in pDRIVE cloning vector are 239-258 and 400-
418 respectively) were used for the sequencing of
the clones.
Analysis
The sequence obtained was first blasted
(www.ncbi.nlm.nih.gov/BLAST) to ascertain that
the sequence was of beta-casein. Nucleotides as
well as derived amino acid sequences were then
aligned with those of the reported beta-casein gene
sequences of different species using the cluster
method of MegAlign Programme of Lasergene
Software (DNASTAR). Secondary structure of
protein was predicted (Rost and Sander, 1993) and
solvent accessibilities were determined (Rost et al.,
1996).
RESULTS AND DISCUSSION
The whole cDNA of buffalo beta-casein
gene was cloned in plasmid vector and sequenced
to determine the nucleotide sequence of the gene.
Sequence analysis
The whole buffalo beta-casein cDNA was
675 bp in length whereas the length of its cattle
counterpart was similar in length. The sheep, pig,
human, camel, rat and rabbit beta-casein cDNA was
669 bp in length. We used beta-casein sequence of
cattle, sheep, pig, camel, human, rat and rabbit
available at NCBI data bank. We submitted the
buffalo cDNA sequences to the NCBI GenBank
and the accession number was obtained as
DQ631829. While analyzing buffalo cDNA, it was
observed that the percentage of A, G, T and C in the
gene itself were 23.85, 20.59, 24.89 and 30.67%
showing 48.74% as AT and 51.26% as GC. In cattle,
the nucleotide organization revealed that the AT and
GC% in the gene were 49.04 and 50.96, respectively,
whereas in sheep, pig, camel, human, rat and rabbit,
the AT and GC% were 48.88 and 51.12, respectively.

Bovine cDNA sequence of beta-casein gene was
first reported by Stewart et al. (1987). The Davis,
Botstein, Roth melting temperature of this gene in
buffalo was calculated as 85.18; which was found
to be slightly higher than that of cattle, where it was
85.050C. In other species like sheep, pig, camel,
human, rat and rabbit, the temperatures were found
as 85.10C.
Sequence homology
Our buffalo sequence was subjected to
BLAST analysis at the NCBI website to retrieve
similar sequences of mammalian origin. The multiple
alignment study revealed that the similarity of buffalo
cDNA sequence with that of cattle was estimated
as 98.08% while with other sequences like sheep,
pig, camel, human, rat and rabbit, it was 96.60%.
When protein sequence was considered, the
similarity of buffalo sequence with its cattle counter
part was estimated as 97.30%. The similarity of
buffalo protein with that of all other species studied
here was calculated as 93.30%. When comparing
sequence of sheep with that of other species like
pig, camel, human, rat and rabbit, all the species were
found to be 100% similar at both nucleotide and
amino acid level.
Sequence variability
A number of changes of nucleotides were
observed between buffalo and other species, and
they have been depicted in Figure 1. When
comparing the buffalo sequence with that of cattle,
nucleotide changes were detected at several
locations of which some changes at position 119th,
168th, 249th, 319th, 363rd and 488th showed functional
changes while others remained as silent in nature.
The sequence alignment study revealed that a block
of six nucleotides, viz ATC CCC was deleted from
position 584-589th of buffalo cDNA compared to
other species, such as sheep, pig, camel, human, rat
and rabbit.
The molecular weight of buffalo beta-casein
protein was estimated as 25.105 kDa whereas cattle
protein was 25.097 kDa. In other species, it was
quite a bit less: approximately 24.874 kDa. Both
buffalo and cattle proteins were composed of 224
amino acids whereas sheep, pig, camel, human, rat
and rabbit protein was constituted of 222 amino
acids. In the buffalo protein, we found 16 strongly
basic, 23 strongly acidic, 78 hydrophobic, 53 polar
225
Buffalo Bulletin (September 2008) Vol.27 No.3
and 54 neutral amino acids. In cattle, 16 strongly
basic, 23 strongly acidic, 78 hydrophobic, 56 polar
and 51 neutral amino acids were found, which was
quite different from its buffalo counterpart. The
sheep, pig, camel, human, rat and rabbit proteins were
composed of 16 strongly basic, 23 strongly acidic,
78 hydrophobic, 54 polar and 51 neutral amino acids.
The differences of polar and neutral amino acids
between the buffalo and other species suggest that
this protein in several species will have its own unique
structure for conferring differential biological
activities. The primary protein sequence in cattle
was elucidated by Ridadeau-Dumas et al. (1972)
and Grosclaude et al. (1972). However, the
differences of amino acids between buffalo and
cattle were determined at 4th (H/R), 56th (M/T), 83rd
(K/N), 107th (I/V), 121st (H/Q) and 163 rd (P/H)
locations (Figure 2). The variability of amino acids
between buffalo and cattle were observed from
neutral to strongly basic at 40th, neutral to polar at
56th, strongly basic to polar at 83rd and neutral to
polar at 121st position of the polypeptide. The amino
acid changes between buffalo and other species like
sheep, pig, camel, human, rat and rabbit were
detected at 18th(L/Q), 24th(P/V), 27th(I/T), 56th(M/
T), 70 th (T/A), 78 th(P/T), 83 rd(K/N), 90 th (P/L),
111 th(S/P), 116th (A/T), 118th(A/V), 147 th(N/K),
155th(L/V) and 183rd(S/P) position of the polypeptide
chain. While comparing the amino acid profiles
among sheep, pig, camel, human, rat and rabbit, there
were no differences found in the protein. But, due
to deletion of a block of nucleotides from the position
584-589th of buffalo sequence, the amino acids
proline and tyrosine were lacking from the position
195th and 196th of polypeptide chain of sheep, pig,
camel, human, rat and rabbit beta-casein protein.
Protein parameters
The isoelectric point of buffalo and all other
species except cattle were observed as 5.264 while
its magnitude in cattle was 5.118. The charge of
this protein in buffalo was -6.256 at pH 7.0 while in
cattle it was found as -6.421 at neutral pH. In sheep,
pig, camel, human, rat and rabbit, the charge of this
protein was observed as -6.255 at pH 7.0. Predicted
secondary structure composition of buffalo beta-
casein protein showed 14.3% helix (H), 1.3% strand
(E) and 83.9% loop (L). Predicted solvent
accessibility composition of buffalo beta-casein
protein showed 79.02% of “e” type (residues
Buffalo Bulletin (September 2008) Vol.27 No.3

exposed with more than 16% of their surface) and

REFERENCES
20.98% of “b” type (others). In the case of cattle,
predicted secondary structure was composed of
Bonifacio, C., I.C. Santos, C. Belo and A. Cravador.
14.29% helix, 0.89% strand, 84.82% loop and the
2001. SSCP analysis of alpha S1 casein, b-
predicted solvent accessibility was determined as
casein and k-casein genes in charnequeira
20.09% b and 79.91% e . In sheep, pig, camel, human,
portuguese indigenous goat breed. Sociedal
rat and rabbit, the predicted structure was composed
Espanolapasadis Recusses Geneticos
of 16.22% helix, 0.90% strand and 82.88% loop,
Animales (SER GIA). Jercu Congreso
and the predicted solvent accessibility was estimated
Nacional Lugo, Spain, 11-13 Nov. 1999.
as 20.72% as b and 79.28% as e.
Archivos-de-Zootechnia, 5: 189-190.
Bouhallab, S., V. Ginga, N. Ait-Oukhatar, F. Burean,
Phylogenetic tree
D. Neuville, P. Arhan, J.A. Maubois, D.
Figures 3 and 4 depict the phylogenetic tree
Bougle. 2002. Influence of various
constructed on the basis of nucleotide and amino
phosphopeptides of caseins on iron absorption.
acid sequence of the beta-casein protein. The trends
J. Agr. Food Chem., 20: 127-130.
of evolutionary relationship among different
Bovenhuis, H., A.M. Johan, Van Arendonk, S.
mammalian species were the similar in nature.
Korver. 1992. Association between milk
Buffalo and cattle form one cluster having closest
protein polymorphism and milk production
relationship while maintaining a certain distant
traits. J. Dairy Sci., 75: 2549-2559.
relation with sheep. The rabbit was to some extent
Dalgleish, D.G. 1993. Bovine milk protein properties
related with this group but maintained a distant
and the manufacturing quality of milk. Livest.
relationship from camel and pig which formed
Prod. Sci., 35: 75-93.
another cluster. The rat and human were the most
Damiani, G., F. Pilla, P. Leone, S. Caccio. 1992.
distant ones from buffalo and were located in
Direct sequencing of bidirectional allele
separate branches. As the buffalo and cattle fall
specific polymerase chain reaction of the
under the same Bovidae family, they were expected
bovine b-casein B-variant. Anim. Genet., 23:
to have the closest relationship in the evolutionary
561-566.
pathway. But other species, although they were
Davies, D.T. and A.J.R. Law. 1980. The content
mammals, fall in different family or genera and
and composition of protein in creamery milks
consequently, formed separate clusters. Our study
in south-west Scotland. J. Dairy Res., 47: 83-
suggests that various mammalian species although
90.
secreting beta-casein protein in their milk, have
Eigel, W.N., J.E. Butter, C.A. Ernstrom, H.M.
different nucleotide/amino acid combinations in their
Farrell, V.R. Harwalkar, R. Jenness, R.M.L.
genes, which was reflected in this dendogram.
Whitney. 1984. Nomenclature of proteins of
Thus, in the present study, the organization
cow’s milk: 5th revision. J. Dairy Sci., 67:
of cDNA of buffalo beta-casein gene and predicted
1599-1631.
protein has been presented and compared with other
Eliott, R.B., D.P. Harris, J.P. Hill, N.J. Bibby and
species, which not only enables dairy scientists to
H.E. Wasmuth. 1999. Type I (insulin
understand the characteristics and property of this
dependent) diabetes mellitus and cow milk:
protein, but also helps scientists to explore
casein variant consumption. Diabet., 42: 292-
biochemical dynamics of the protein.
296.
Grosclaude, F., M.F. Mahe, J.C. Mercier and B.
Robadeau-Dumas. 1972. Localisation des
ACKNOWLEDGEMENT substitutions d’acides amines differnetiant les
variants A at B de la caseine k bovine.
The authors are thankful to ADG (Animal Annual Genetical Selection Animal, 4: 515-
Breeding and Production), ICAR for providing 521.
financial help to carry out research work under Janno, O., G. Ceriotti, A. Casoli and G. Erhardt. 2002.
ICAR Ad-hoc scheme. A new variant in exon 7 of bovine beta casein

226

gene and its distribution among European
cattle breeds. J. Anim. Breed. Genet., 119:
65-68.
Jimenez-Flores, R. and T. Richardson. 1988. Genetic
engineering of the caseins to modify the
behaviour of milk during processing: a review.
J. Dairy Sci., 71: 2646-2654.
Kim, S., K.F. Ng-Kwai-Hang and J.F. Hayes. 1996.
The relationship between milk protein
phenotypes and lactation traits in Ayrshires and
Jerseys. J. Anim. Sci., 79: 685-693.
Langley-Danysz. 1993. Goat milk : a profusion of
caseins. Revue Laitiere Franchise, 531: 24-
25.
Lien, S., P. Alestrom, H. Klungland and S. Rogne.
1992. Detection of multiple b-casein (CASB)
alleles by amplification created restriction sites
(ACRS). Anim. Genet., 23: 333-338.
Mahe, M.F. and F. Grosclaude. 1993. Polymorphism
of beta casein in creole goat of guadeloupe:
evidence for a null allele. Genet. Sel. Evol.,
25: 403-408.
Mariani, P. 1983. Genetics and quality of milk used
in cheesemaking. Obiettivi-e-Documenti-
Veterinari, 9: 25-30.
McLean, D.M., E.R.B. Graham, R.W. Ponzoni and
H.A. McKenzie. 1984. Effects of milk protein
genetic variants on milk yield and composition.
J. Dairy Res., 51: 531-546.
Moretini, L., M.G. Cavallo, S. Manfrini, L. Stefanini,
A. Picarelli, M. Ditola, A. Petrone, M. Bianchi,
M. La Presa, G. Di Giulio, M.G. Baroni, R.
Thorpe, B.K. Walker and P. Pozzilli. 2002.
Antibodies to bovine beta-casein in diabetes
and other antiimmune diseases. Horm.
Metab. Res., 34: 455-459.
Ng-Kwai-Hang, K.F., J.F. Hayes, J.E. Moxley and
H.G. Monardes. 1986. Relationships between
milk protein polymorphisms and major milk
constituents in Holstein-Friesian cows. J.
Dairy Sci., 69: 22-26.
Pappalardo, M., A. Rando, P. Gregorio, P. Masina
and L. Rmunno. 1997. A Mse I RFLP in the
5' DNA region of the goat b-casein gene.
Anim. Genet., 28: 242.
Papparardo, M., A. Rando, G. Cosenza, M. Capuano
and L. Ramuno. 1996. A Bal I RFLP at the
227
Buffalo Bulletin (September 2008) Vol.27 No.3
goat beta casein gene. Animal Genetics, 27:
123-124.
Peres, J.M., S. Bouhallab, C. Petit, F. Bureau, J.L.
Maubois, P. Arhaw and D. Bougle. 1998.
Improvement of Zn intestinal absorption and
reduction of zinc/iron interaction using metal
bound to the caseinophosphopeptide 1-25 of
beta-casein. Reprod. Nutr. Dev., 38: 465-472.
Pinder, S.J., B.N. Perry, C.J. Skidmore and D. Sarua.
1991. Analysis of polymorphism in the bovine
casein genes by use of PCR. Anim. Genet.,
22: 11-20.
Ribadeau-Dumas, B., G. Brignon, F. Grosclaude and
J.C. Mercier. 1972. Structure primaire de la
caseine b bovine sequence complete. Eur. J.
Biochem., 25: 505-514.
Rost, B. and C. Sander. 1993. Prediction of protein
secondary structure at better than 70 percent
accuracy. J. Mol. Biol., 232: 584-599.
Rost, B., P. Fariselli and R. Casadio. 1996. Topology
prediction for helical transmembrane proteins
at 86 percent accuracy. Protein Sci., 5: 1704-
1718.
Sambrook, J. and D.W. Russell. 2001. Molecular
cloning: A Laboratory Manual, 3rd ed. Cold
Spring Harbor Laboratory Press, New York,
USA.
Serrano, M.B., A.I. Garzon-Sigler, G. Garro, L.
Chianese, J. Martinez-Henz, B.S. Moyano,
A.I.G. Sigler and J.M. Hens. 1999. Casein
genetic variants in merino sheep breed.
Archivos-de-Zootecnia, 48: 197-206.
Stewart, A.F., J. Bonsing, C.W. Beattie, F. Shah,
I.M. Willis and A.G. MacKinlay. 1987.
Complete nucleotide sequences of bovine
αs1-, αs2- and β-casein cDNAs: Com-
parisons with related sequences in other
species. Mol. Biol. Evol., 4: 231-241.
 A T G A A G G T C C T C A T C C T T G C C T G T C T G G T G G C T C T G G C C C T T G C A A G A G A G C A G G A A G A A C T C A A T G T A G T C G G T G A G A C T G T G G A A A G C C T T T C A A G C A Majority

10 20 30 40 50 60 70 80 90 100
1 . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . C C . . . . . . . . T . . . . . . . . . . . . . . . . . . . . buffalo.SEQ
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . camel.SEQ
1 . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . C C T . . . . . . . T . . . . . . . . . . . . . . . . . . . . cattle.SEQ
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . human.SEQ
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . pig.SEQ
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rabbit.SEQ
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rat.SEQ
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . sheep.SEQ

G T G A G G A A T C T A T T A C A C A C A T C A A T A A G A A A A T T G A G A A G T T T C A A A G T G A G G A A C A A C A G C A A A C A G A G G A T G A A C T C C A G G A T A A A A T C C A C C C C T T Majority

110 120 130 140 150 160 170 180 190 200
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . G . . . . . . . T G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . buffalo.SEQ
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . camel.SEQ
101 . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . cattle.SEQ
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . human.SEQ
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . pig.SEQ
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rabbit.SEQ
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rat.SEQ
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . sheep.SEQ

T G C C C A G G C A C A G T C T C T A G T C T A T C C C T T C A C T G G G C C C A T C C C T A A C A G C C T C C C A C A A A A C A T C C T G C C T C T T A C T C A A A C C C C T G T G G T G G T G C C G Majority

210 220 230 240 250 260 270 280 290 300
201 . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . buffalo.SEQ
201 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . camel.SEQ
201 . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . cattle.SEQ
201 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . human.SEQ
201 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . pig.SEQ
201 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rabbit.SEQ
201 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rat.SEQ
201 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . sheep.SEQ

C C T T T C C T T C A G C C T G A A A T A A T G G G A G T C C C C A A A G T G A A G G A G A C T A T G G T T C C T A A G C A C A A G G A A A T G C C C T T C C C T A A A T A T C C A G T T G A G C C C T Majority

310 320 330 340 350 360 370 380 390 400
301 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . G . . . . . . C . . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . buffalo.SEQ
301 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . camel.SEQ
Buffalo Bulletin (September 2008) Vol.27 No.3

301 . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . T . . . . . . . . . . . . . . G . . . . . . C . . . . . . . . . A . . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . cattle.SEQ
301 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . human.SEQ
301 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . pig.SEQ
301 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rabbit.SEQ
301 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rat.SEQ

228
301 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . sheep.SEQ

T T A C T G A A A G C C A G A G C C T G A C T C T C A C T G A T G T T G A A A A G C T G C A C C T T C C T C T G C C T C T G G T C C A G T C T T G G A T G C A C C A G C C T C C C C A G C C T C T T C C Majority

410 420 430 440 450 460 470 480 490 500
401 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . buffalo.SEQ
401 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . camel.SEQ
401 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . cattle.SEQ
401 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . human.SEQ
401 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . pig.SEQ
401 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rabbit.SEQ
401 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rat.SEQ
401 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . sheep.SEQ

T C C A A C C G T C A T G T T T C C T C C T C A G T C C G T G C T G T C C C T T T C T C A G C C C A A A G T T C T G C C T G T T C C C C A G A A A G C A G T G C C C C A G A G A G A T A T G C C C A T C Majority

510 520 530 540 550 560 570 580 590 600
501 . . . . . . T . . . . . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . T C C C C . G . G A G A T . . G buffalo.SEQ
501 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . camel.SEQ
501 . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . T . T C C C C . G . G A G A T . . G cattle.SEQ
501 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . human.SEQ
501 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . pig.SEQ
501 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rabbit.SEQ
501 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rat.SEQ
501 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . sheep.SEQ

C A G G C C T T T C T G C T G T A C C A G G A G C C T G T A C T T G G T C C T G T C C G G G G A C C C T T C C C T A T T C T T G T C T A A X X X X X X Majority

610 620 630 640 650 660 670

601 . C C A T T C A G G C C T . T C T G . T . T . C . A G . A G . C . . T A . T . . G T . C T . T C . G G G G A . . C T . C . C . A . T A T T G T C T A A buffalo.SEQ
601 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . camel.SEQ
601 . C C A T T C A G G C C T . T C T G . T . T . C . A G . A G . C . . T A . T C . G T . C T . T C . G G G G A . . C T . C . C . A . T A T T G T C T A A cattle.SEQ
601 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . human.SEQ
601 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . pig.SEQ
601 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rabbit.SEQ
601 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rat.SEQ
601 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . sheep.SEQ

Decoration 'Decoration #1': Hide (as '.') residues that match the Consensus exactly.

Figure 1. Nucleotide sequence based multiple alignment profile of beta-casein gene among various species.
 M K V L I L A C L V A L A L A R E Q E E L N V V G E T V E S L S S S E E S I T H I N K K I E K F Q S E E Q Q Q T E D E L Q D K I H P F A Q A Q S L V Y P F T G P I P N S L P Q N I L P L T Q T P V V V P Majority

10 20 30 40 50 60 70 80 90 100
1 . . . . . . . . . . . . . . . . . L . . . . . P . . I . . . . . . . . . . . . . . . . . . . . . . . . . . . . M . . . . . . . . . . . . . T . . . . . . . P . . . . K . . . . . . P . . . . . . . . . . buffalo.PRO
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Camel.PRO
1 . . . . . . . . . . . . . . . . . L . . . . . P . . I . . . . . . . . . . . . R . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . P . . . . . . . . . . . P . . . . . . . . . . cattle.PRO
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . human.PRO
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . pig.PRO
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rabbit.PRO
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rat.PRO
1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . sheep.PRO

P F L Q P E I M G V P K V K E T M V P K H K E M P F P K Y P V E P F T E S Q S L T L T D V E K L H L P L P L V Q S W M H Q P P Q P L P P T V M F P P Q S V L S L S Q P K V L P V P Q K A V P Q R D M P I Majority

110 120 130 140 150 160 170 180 190 200
101 . . . . . . . . . . S . . . . A . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . N . . . . . . . L . . . . . . . . . . . . . . . . . . . . . . . . . . . S . . . . . . . . . . . Y P Q R D M buffalo.PRO
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Camel.PRO
101 . . . . . . V . . . S . . . . A . A . . Q . . . . . . . . . . . . . . . . . . . . . . . . . N . . . . . . . L . . . . . . . H . . . . . . . . . . . . . . . . . . . S . . . . . . . . . . . Y P Q R D M cattle.PRO
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . human.PRO
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . pig.PRO
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rabbit.PRO

229
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rat.PRO
101 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . sheep.PRO

Q A F L L Y Q E P V L G P V R G P F P I L V - - - Majority

210 220
201 P I Q A F L L Y Q E P V L G P V R G . F P I I V . buffalo.PRO
201 . . . . . . . . . . . . . . . . . . . . . . . Camel.PRO
201 P I Q A F L L Y Q E P V L G P V R G . F P I I V . cattle.PRO
201 . . . . . . . . . . . . . . . . . . . . . . . human.PRO
201 . . . . . . . . . . . . . . . . . . . . . . . pig.PRO
201 . . . . . . . . . . . . . . . . . . . . . . . rabbit.PRO
201 . . . . . . . . . . . . . . . . . . . . . . . rat.PRO
201 . . . . . . . . . . . . . . . . . . . . . . . sheep.PRO

Decoration 'Decoration #1': Hide (as '.') residues that match the Consensus exactly.

Figure 2. Protein sequence based multiple alignment analysis of beta-casein among various mammalian species.
Buffalo Bulletin (September 2008) Vol.27 No.3
Buffalo Bulletin (Sebtember 2008) Vol.27 No.3

Buffalo
Cattle
Sheep
Rabbit
Camel
Pig
Rat

79.6
Human
70 60 50 40 30 20 10 0
Nucleotide Substitutions (x100)

Figure 3. Phylogenetic tree constructed based on the nucleotide sequence of beta-casein gene.

Buffalo
Cattle
Sheep
Rabbit
Camel
Pig
Rat

155.4
Human
140 120 100 80 60 40 20 0

Figure 4. Phylogenetic tree constructed based on the amino acid sequence of beta-casein gene.

*Continued from page 219

REFERENCES calf causing dystocia. Indian J. Anim.

Arthur, G.H., D.E. Noakes and H. Pearson. 1989.
Veterinary Reproduction and Obstetrics, 6th
ed. Bailliere Tindall, London, 120p.
Kumaresan, A., A. Garg and S. K. Agrawal. 2003.
Dystocia due to hydrocephalus calf in a
buffalo cow. Indian J. Anim. Reprod., 24:
82.
Leipold, H.W., G. Saperstein and K. Huston. 1996.
Large Animal Internal Medicine, 2nd ed. St.
Louis. Moshy. 1719-1722.
Mahajan, A., A. Sathya, P. Singh and S. Prabhakar.
2006. A case of arthrogryposis in a buffalo
Reprod., 27(1): 86.
Morrow, D.A. 1986. Current Therapy in
Theriogenolog.W.B., Saunders, Philadelphia.
178p.
Shukla, S.P. and R.A.S. Chauhan. 2004.
Schistosomus reflexus in a Jersy cross bred
cow. Indian Vet. Med. J., 28: 391-392.
Shukla, S.P., S.P. Nema, A.K. Pandey and U.K.
Garg. 2007. Dystocia due to bull dog calf in a
she buffalo. Buffalo Bulletin, 26(3): 104.
Sloss, V. and J.H. Dufly. 1980. Handbook of Bovine
Obstetrics. Williams and Wilkins, Baltimore.

230

A DICEPHALUS MONSTER IN MURRAH BUFFALO
Sushant Srivastava, Amit Kumar, S.K. Maurya, A. Singh and V. K. Singh
ABSTRACT
A double-headed monster foetus was
delivered by per-vaginum in a pluriparus Murrah
buffalo, which was presented with acute labor and
dystocia. The foetus was a fully developed female
calf with two heads joined with single neck, four
eyes, four ears, two oral cavities, a single
oesophagus, a single thorax and abdomen, two fore
and two hind limb, which can be classified as
dicephalus dipus dibrachious monster.
Keywords: dicephalus monster, Murrah buffalo,
congenital anomaly
INTRODUCTION
An interesting anomaly unique to multiple
pregnancies is conjoint twins. This is a rare disorder
affecting 1:200 monozygotic twin pregnancies, 1:900
twin pregnancies and 1:25,000 to 100,000 births.
Conjoint twins develop when incomplete separation
occurs after the development of the embryonic plate
at 8 days. Depending upon the site of fusion or
nonseparation, the types of the twins may differ.
Varying degrees of fusion occur but anterior
duplication is more often seen in ruminants and swine
(Arthur, 1989). Common varieties are the
thoracopagus (40%), omphalopagus (35%),
cephalopagus (2%), pyopagus (18%), and
ischiopagus (2%) (Fernando,1993). The
management of such twins if diagnosed early is
termination of the pregnancy. If diagnosed late at
term or during labor, delivery by cesarean section is
usually undertaken.
College of Veterinary science & A.H., N.D. university of Ag. & Tech, Kumarganj, Faizabad, India
231
Buffalo Bulletin (September 2008) Vol.27 No.3
Case history
A Murrah buffalo aged about 7 years with
history of full term pregnancy was brought to the
Veterinary Hospital Bhojipura, Bareilly, with a
complaint that in spite of acute labour pain, the animal
had failed to deliver the calf. The animal was
straining for the last eight hours after the expulsion
of the first water bag. Per vaginal examination
revealed a fully dilated cervix and a dead fetus in
anterior longitudinal presentation which appeared to
be double headed in the birth canal at the pelvic
brim. This caused the pastural problem and revealed
obstruction.
After epidural anesthesiaing 2% lignocaine
HCL, both the fore limbs were repelled into the
uterus. A long obstetritical hook was applied in the
right inner canthus and traction was applied after
lubricating the birth canal with obstretrical gel. Both
the heads were brought outside the vulva , both the
fore limbs were extended towards the vulva, by
traction on fetal head and fore limbs simultaneously
on forward and downward direction, the dead female
monster fetus was delivered . Mahajan et al. (2002)
also reported a monster delivered by cesarean section
having two heads with a single neck, a single body
and two fore and lower limbs in a crossbred cattle.
Etiology
Conjoined twins may be caused by any
number of factors, being influenced by genetic and
environmental conditions. It is presently thought that
these factors are responsible for the failure of twins
to separate after the 13th day after fertilization.
Assisted conception techniques such as IVF and
ICSI may be a factor (Romero et al., 1988).
Conjoined twins can be artificially generated in
amphibians by constricting the embryo so that two
embryos form, one on each side of the constriction.
Buffalo Bulletin (September 2008) Vol.27 No.3
Embryology
Four days after fertilization the trophoblast (chorion)
differentiates. If the split occurs before this time
the monozygotic twins will implant as separate
blastocysts each with their own chorion and amnion.
Eight days after fertilization the amnion
differentiates. If the split occurs between the 4th
and 8th days, then the twins will share the same
chorion but have separate amnions. If a split occurs
after the 8th day and before the 13th day, then twins
will share the same chorion and amnion. This is a
very rare condition and accounts for 1-2% of
monozygotic twins. The embryonic disk starts to
differentiate on the 13th day. If the split occurs after
day 13, then the twins will share body parts in
Figure. Dicephalus dipus dibrachious monster calf.
REFERENCES
Arthur, G.H., D.E. Noakes and H. Pearson. 1989.
Veterinary Reproduction and Obstetrics, 6th
ed. ELBS, Bailliere Tindal, London, 109p.
Fernando, Arias. 1993. Practical Guide to High
Risk Pregnancy and Delivery, 2 nd ed.
Baltimore, Mosby Year Book. 139p.
Finberg, H.J. 1994. Ultrasound evaluation in mul-
tiple gestation, p. 121-124. In Callen’s
232
addition to sharing their chorion and amnion. (Finberg
et al., 1994). However, some studies provide
convincing evidence that they all result from the
secondary union of two originally separate
monovular embryonic discs. This fusion theory
seems to be confirmed by the adjustments to union
and the pattern and incidence of specific anomalies
at the proposed sites of conjunction. No theoretical
fission of the vertebrate embryo at any stage of
development, in any plane, in any direction can
explain the selection of the observed sites of fusion,
the details of the union, or the limitation to the specific
areas in which the twins are found to be jointly
separate monovular embryonic discs (Fer-nando,
1993).
Ultrasonography in Obstetrics and
Gynecology, 3rd ed. Harcourt Publishers.
Mahajan, D.C., M.B. Amle, A.N. Zope and
Salunkhe. 2002. Dystocia due to dicephalus
monster in acrossbred cow. Indian J. Anim.
Reprod., 23(1): 89-90.
Romero, R., G. Pilu and P. Jeanty. 1988. Prenatal
Diagnosis of Congenital Anomalies.
Norwalk, CT, Appleton and Lange, pp. 405-
409.
 Buffalo Bulletin (September 2008) Vol.27 No.3

RESTRICTED SELECTION INDEX FOR GENETIC IMPROVEMENT

IN INDIAN BUFFALOES

Sunil Kumar1, M. C. Yadav2 and R.B. Prasad3

ABSTRACT INTRODUCTION

Records on 1753 buffaloes belonging to
three genetic groups i.e. Murrah, graded Murrah
and Nili Ravi from six military dairy farms of north
India were used for the study. Variables considered
for construction of restricted selection index were
AFC (age at first calving in months), WFC (weight
at first calving in kg), FLP (first lactation period in
days), FCI (first calving interval in days), FLMY
(first lactation milk yield in kg), AFLMY (average
milk yield per day of first calving interval in kg),
PFL (profit in first lactation in Rs.) and APFL
(average profit per day of first calving interval in
Rs.). Restriction was done in two different indices:
one for AFC and WFC and other for AFC, WFC
and FCI. In all, two restricted selection indices were
constructed. Maximum genetic improvement in
FLMY (9.866 kg) was very much less than the index
incorporating all the eight traits. Based on expected
genetic economic gain it was concluded that the
selection index for buffaloes could be -117.64 AFC
+3.21 WFC +26.60 FLP +118.50 FCI - 4.88 FLMY
-26180.0 AFLMY +0.066 PFL +31782.0 APFL
instead of the restricted index of 1.799AFC +0.219
WFC +0.043 FLP -2.155 FCI +0.77FLMY +137.51
AFLMY +0.012 PFL -269.27 APFL.
Keywords: profit, restriction, selection, index,
economic gain, intensity
1
Department of Animal Sciences, Hill Campus, G.B. Pant University of Agriculture and Technology
P.O. Ranichauri - 249 199, Distt. Tehri Garhwal, Uttaranchal, India
2
Department of Animal Husbandry and Dairying, Raja Balwant Singh College, Bichpuri, Agra,283105,U.P.
India
3
Animal Breeding, Deptt. of A. R. Sc., A.C.A., Hawassa University, PO box no. 05, Awassa, Ethiopia.
e-mail: dr_rbprasadbm@yahoo.com
The importance of Murrah among the Indian
breeds is clearly evident from the fact that this breed
has been used an improver breed for upgrading low
milk producing breeds throughout the country as well
as other countries of Asia. It is the only breed
maintained in large numbers at organized and military
dairy farms. Thus selection is the only tool available
for bringing about genetic improvement in this breed.
Profitability from dairy animals is a combination of
many traits, viz., bodyweight, age at first calving,
calving intervals, breeding efficiency, milk
production, number of calves produced etc. But
multi-trait selection may lead to increased cost of
production by delayed maturity and return of income.
Therefore, restrictions can be imposed on AFC,
WFC and FCI so that the return in terms of milk
starts earlier. Chakravarty et al. (1988), while
studying the complete restricted index selection for
the genetic improvement of Indian buffaloes, reported
that restriction on age at first calving and first service
period was most efficient for improving first lactation
milk yield. Ghajbhiya and Tripathi (1991) reported
that in 412 Murrah buffaloes maintained at NDRI,
Karnal, the greatest reduction occurred in aggregate
genetic gain when restriction was imposed on highly
heritable and economically important traits, such as
age at first calving. They recommended a restricted
selection index combining age at first calving, first
lactation length, first dry period, first service period,
and milk yield per day of first calving interval to
keep first lactation length constant.

233
Buffalo Bulletin (September 2008) Vol.27 No.3
Therefore, efforts were made a put complete
restriction on AFC and WFC in an index and AFC,
WFC and FCI in a second index with the idea that
these three traits are economically highly important
for estimation of profit for buffaloes.
MATERIALS AND METHODS
Records on 1,753 buffaloes belonging to
three genetic groups i.e. Murrah, Graded Murrah
and Nili Ravi from six military dairy farms located
in north India were used for the study. All the animals
were maintained under standered managemental
conditions. Variables considered for each buffalo
were first lactation traits like AFC (age at first
calving in months), WFC (weight at first calving in
kg), FLP (first lactation period in days), FCI (first
calving interval in days), FLMY (first lactation milk
yield in kg), AFLMY (average milk yield per day of
first calving interval in kg), PFL (profit in first
lactation in Rs) and APFL (average profit per day
of first calving interval in Rs) .
In order to obtain adequate data sets for
statistical analysis, records used in the study were
edited as follows: buffalo producing milk for more
than 150 days and drying under normal physiological
condition were included. Abortions and other
pathological causes which affected the first lactation
data were not included in the study.
The profit characters (PFL and APFL) were
calculated as per Sunil Kumar et al., 2006
The restricted selection index introduced by
Kempthorne and Nordskog (1959) was used to
construct the index.
In order to find the most suitable and efficient
selection index, the following criteria were used:
The change in aggregate genetic economic gain:
ΔH = ΣA Δ Pi
Accuracy of selection
r TI = σ T I/(σ T σ I)
Heritability estimate of index:
h2I = s2 g/ s2 P = [(b/ G b)/ (b/ P b)]
where Δ Pi = expected genetic gain in ith trait due
to unit change in index in standard deviation form
= (Σbi Gij / σ I) i,
A = relative economic value of the ith trait
included in the index, which was taken as 1.00,
bi = column vector of coefficient of index,
234
Gij = genetic value of the ith trait,
σ T = standard deviation of the index =
√(b/ P b)
i = intensity of selection (0.497 if 70% of
buffaloes to be retained for further breeding in each
generation,
σ T I = covariance between index and
aggregate genotypic value,
σ I = standard deviation of aggregate
genotypic value = √(b/ G b)
RESULTS AND DISCUSSION
Least square means of the traits used for
the selection index in the herd are given in Table 1.
A total of two restricted selection indices were
constructed using complete restriction on AFC and
WFC in the first and AFC, WFC and FCI in the
second index. Selection indices along with index
coefficients (b i) and expected genetic gain in
individual trait in buffaloes are presented in Table 2.
The results of Table 2 indicated that the expected
genetic gain for the traits under restriction were very
small ranging from -0.138x10-6 to -0.423x 10-6 in
the first index and -0.183x10-4 to -0.712 x 10-5 in
the second index. But the genetic gain in first
lactation milk yield (9.866 kg) greatly reduced as
compared to the standard selection index
incorporating all these characters (433.67 kg in I23).
The first restricted selection index was better than
the second (rTI 0.151 vs 0.088).
The expected aggregate genetic gain was
more (Rs. 89.76) by the first restricted selection
index than by the second index (Rs. 51.57). The
accuracy of selection (rTI = 0.151) and heritability
were also for use in the first index. The present
findings did not agree with the results of Chakravarty
et al. (1988) who suggested that restriction of age
and first service period is most efficient for
improvement in FLMY. Whereas they were in
agreement with the results of Gajbhiya and Tripathi
(1991) who reported that there was the greatest
reduction in aggregate genetic gain if there is
restriction on highly heritable and economically
important traits like age at first calving and weight
at first calving for improving FLMY or aggregate
genetic gain per generation.
 Buffalo Bulletin (September 2008) Vol.27 No.3

Table 1. Least squares mean and standard error of the traits under study.

S. Standard
Traits Mean
no. error
1 Age at first calving (months) 41.12 0.35
2 Weight at first calving (kg) 483.588 2.962
3 First lactation period (days) 302.75 2.66
4 First calving interval (day) 471.99 5.74
5 First lactation milk yield (kg) 1818.41 21.26
6 Average milk yield per day of first calving interval (kg) 3.95 0.07
7 Profit in first lactation (Rs.) 1992.02 370.79
8 Average profit per day of first calving interval (Rs.) 5.43 0.08

Table 2. Restricted selection index coefficients along with accuracy, heritability and expected
genetic gain in aggregate genotype.
I1 I2
(restriction on (restriction on
AFC & WFC) AFC,WFC & FCI)
Accuracy of selection 0.151 0.088
Heritability 0.036 0.013
Expected aggregate genetic gain (Rs.) 89.760 51.57
Index coefficients (b)
AFC 1.799 4.400
WFC 0.219 0.687
FLP 0.043 0.261
FCI -2.155 -2.187
FLMY 0.770 0.537
AFLMY 137.510 4.214
PFL 0.012 0.001
APFL -269.270 -182.583
Dummy(AFC constant) -44.504 362.698
Dummy(WFC constant) 2.988 -40.475
Dummy(FCI constant) - -78.798
Expected genetic gain on the trait
AFC -0.138x10-6 -0.283x10-5
WFC -0.423x10-6 -0.712x10-5
FLP -0.348 -0.049
FCI -1.516 -0.183x10-4
FLMY 9.866 1.479
AFLMY 0.026 -0.131x10-3
PFL 169.523 102.342
APFL 0.037 -0.004

*Continued on page 239

235
Buffalo Bulletin (September 2008) Vol.27 No.3
HAEMATOLOGY OF GRADED MURRAH BUFFALOES IN THE COASTAL REGION
OF ANDHRA PRADESH (INDIA)
K. Naveen Chandra, V.G.N.V. Prasad, CH.E. Narasimha Reddy, V.Bhaskar,
Guru D.V. Pandiyan and E. Muralinath
ABSTRACT
Various haematological parameters like total
erythrocyte count (TEC), total leukocyte count
(TLC), packed cell volume (PCV), haemoglobin
(Hb), mean corpuscular haemoglobin (MCH), mean
corpuscular haemoglobin concentration (MCHC)
were determined in 77 female graded Murrah
buffaloes of different ages (2-10 years) from the
coastal region of Andhra Pradesh in India under field
conditions. Comparatively lower mean values than
the standard for estimated haematological
parameters were obtained in the graded Murrah
buffaloes. A significant increase (P<0.05) in the
mean value of TEC was observed in 2-3-years-old
buffaloes (5.90 ± 0.44 millions/ml) when compared
to buffaloes of 3-10 years and above age, in which
the mean values are in the range 4.24 ± 0.18 to 4.83
± 0.24 millions/ml. This report is asupplement to a
basal data on haematological parameters in graded
Murrah buffaloes.
Keywords: age, coastal, graded, haematology,
Murrah buffaloes
INTRODUCTION
Native buffaloes that have been crossed and
graded with Murrah breed buffaloes constitute a
sizeable buffalo population in the coastal region of
Andhra Pradesh state in India. They have attained
considerable economic importance for the small and
marginal farmers due to their productivity and
tolerance to the hot and humid climate of coastal
area. Knowledge of normal physiological values of
blood may help in the diagnosis of many disease
Department of Physiology, NTR College of Veterinary Science, Sri Venkateswara Veterinary University,
Gannavaram-521 102, Andhra Pradesh, India
236
conditions in buffaloes. Further it was reported that
the physiological variation in the blood parameters
is of great significance for clinical haematology and
animal production as blood constituents are indicative
of heat tolerance and environmental stress in cattle
and buffaloes of tropical regions (Blincoe and Brody,
1951; Sastry and Thomas, 1973).
Ranawana et al. (1989) determined
haematological parameters in indigenous buffaloes
of Sri Lanka. Haematological parameters of certain
native buffaloes in Iran have also been documented
(Khadjeh and Papahn 2002). Despite the sizeable
population of graded Murrah buffaloes in the coastal
area of Andhra Pradesh, there are very few reports
on the basal data of haematological parameters and
hence, an attempt was made in the present study to
estimate the haematological parameters in 77 female
graded Murrah buffaloes of different ages from 2
to 10 years and above under field conditions.
MATERIALS AND METHODS
Blood samples were collected from the
jugular veins of 77 apparently healthy female Murrah
graded buffaloes in and around Gannavaram,
Krishna district of Andhra Pradesh, during the
months of August and September when day
temperatures (Mean ± S.E.) of minimum and
maximum vary between 25.0 ± 0.20C and 32.6 ±
0.360C. Mean ± S.E. relative humidity is 86.39 ±
1.31%. Blood was collected into a clean sterile tube
containing E.D.T.A. as an anticoagulant at a
concentration of 1-2 mg/ml. Haematological
parameters like total erythrocyte count (TEC), total
leukocyte count (TLC), packed cell volume (PCV),
haemoglobin (Hb), mean corpuscular volume

(MCV), mean corpuscular haemoglobin (MCH) and
mean corpuscular haemoglobin concentration
(MCHC) were estimated (Feldman et al., 2000).
All estimated values were expressed as mean ± S.E.
and arranged and grouped according to age of
animal. The data pertaining to all age groups were
subjected to one-way analysis of ANOVA and
comparisons of mean values between different age
groups were made using Tukey’s multiple range test.
P<0.05 was the value considered significant
(Snedecor and Cochran, 1994).
RESULTS AND DISCUSSION
Haematological parameters estimated in 77
female buffaloes were arranged in different groups
according to the age of the animals and presented
in Table 1. The overall means of all the parameters
is also presented in Table 2. The overall mean total
erythrocyte count (TEC) obtained in the present
study was 4.70 ± 0.11 millions/mm3, which was
comparatively lower than the reported values in
Murrah buffaloes (6.77 ± 0.08 millions/mm3; Patil
et al., 1992a) and in Iranian native female buffaloes
(7.37 ± 1.86 millions/mm3; Khadjeh and Papahn,
2002). The reason for the lower TEC may be due
to an increased size of the erythrocytes of buffaloes
in this region, as mean corpuscular volume (MCV,
58.44 ± 1.16 fl) was higher compared to the values
of MCV reported in Murrah buffaloes (45.63 ± 0.50
fl; Patil et al., 1992a). Total erythrocyte count of 2-
3-year-old buffaloes was significantly higher
compared to other age group buffaloes except the
6-7-year-old buffaloes. A significant decrease in
TEC with increase in age was due to decrease in
erythropoiesis and build up of sex hormones (Sharma
et al., 1985; Jain, 1993; Feldman et al., 2000;
Khadjeh and Papahn, 2002).
Overall mean of total leukocyte count
(TLC) obtained in the present study was low (3.15
± 0.18 thousands/mm3) when compared to the value
reported in Murrah buffaloes (7.96 ± 0.29 thousands/
mm3; Patil et al., 1992b). However, there is a decline
in leukocyte count with age from 4.54 ± 0.57
237
Buffalo Bulletin (September 2008) Vol.27 No.3
thousands/mm3 in 2-3-year old buffaloes to 2.51 ±
0.28 thousands/mm3 in over 10-year-old buffaloes.
This may be an age related phenomenon.
The packed cell volume (PCV) obtained in
the present study (27 ± 0.55%) is comparable with
the value of Murrah buffaloes (30.58 ± 0.25%; Patil
et al., 1992a). A higher PCV was reported in native
Iranian buffaloes (35.65 ± 6.19%; Khadjeh and
Papahn, 2002). The probable reason for the lower
values of PCV observed may be due to the Wintrobe
method used in the present study and other factors
like breed, weather, and feeding practices (Jain,
1993).
A haemoglobin concentration of 9.45 ± 0.22
g/dl was observed in the graded Murrah buffaloes.
A similar haemoglobin concentration was
documented in Indian buffaloes (10.3 ± 0.2g/dl;
Murthy, 1980). However, higher haemoglobin
concentration of 11.81 ± 0.15g/dl was reported in
Murrah buffaloes (Patil et al., 1992a). The lower
haemoglobin values may be due to poor nutrition
and lower TEC. The haemoglobin concentration was
highest in the 4-5 year age group (10.17 ± 0.76 g/
dl). There was a decrease in the concentration of
haemoglobin values in buffaloes above 5 years of
age. This may be due to the reduction of red bone
marrow and decreased erythropoiesis (Sharma et
al., 1985; Jain, 1993; Feldman et al., 2000; Khadjeh
and Papahn, 2002).
The overall mean of MCH was 20.52 ± 0.48
pg. This was higher than that reported in buffaloes
(18.07 ± 0.13 pg) by Murthy (1980). This indicates
there was an increase in average weight of
haemoglobin. The pattern of MCH variation with
age conforms to the report of Khadjeh and Papahn,
(2002).
The mean value of MCHC (35.36 ± 0.64%)
obtained was in the normal range of values reported
in clinically normal Indian Murrah buffaloes
(Feldman et al., 2000). The value of MCHC has a
reverse relationship with PCV. The present study
was an attempt to generate basal data on
haematological parameters to fill the knowledge gap,
as normal blood values of the graded Murrah
buffaloes had not yet been reported and the values
recorded may be of use like ready reckoning material
in clinical situations.
Buffalo Bulletin (September 2008) Vol.27 No.3

Table 1. Overall means of haematology of graded Murrah buffaloes in the coastal region of Andhra
Pradesh (India).

TEC TLC PCV Hb MCV MCH MCHC

(106/mm3) (103/mm3) (%) (g/dl) (fl) (pg) (%)
4.70±0.11 3.15±0.18 27±0.55 9.45±0.22 58.44±1.16 20.52±0.48 35.36±0.64

Table 2. Haematological parameters based on age of graded Murrah buffaloes in the present study.

TEC TLC PCV Hb MCV MCH MCHC

AGE NUMBER
(106/mm3) (103/mm3) (%) (g/dl) (fl) (pg) (%)

2 to 3 9 5.90a±0.43 4.54a±0.57 28.67±1.04 9.6±0.4 49.69±2.08 16.65±0.93 33.53±1.30

3 to 4 12 4.56b±0.25 3.67ab±0.67 26.58±1.19 9.47±0.5 59.35±3.06 21.31±1.44 35.91±1.64
b ab
4 to5 13 4.69 ±0.29 3.01 ±0.42 28.38±1.54 10.17±0.76 61.09±2.44 21.92±1.55 35.77±1.76
6 to7 14 4.83 ±0.24 2.83ab±0.30
ab
29±1.51 9.73±0.54 60.81±2.91 20.51±1.11 34.10±1.71
b ab
8 to 9 15 4.41 ±0.19 2.93 ±0.32 25.87±1.36 8.89±0.53 59.47±3.20 20.25±0.96 34.67±1.51
10 &
14 4.25b±0.17 2.51b±0.28 24.14±1.0 9.01±0.40 57.39±2.41 21.35±0.87 37.69±1.44
above

In a column, values with common superscript do not differ significantly. (P<0.05)

ACKNOWLEDGEMENTS Feldman, B.F., J.G. Zinkl and N.C. Jain. 2000.

The authors are thankful to the Head of the
Departments, Dr. G.S. Rao, Dr. Makkena Sreenu,
and Dr. P.V.S. Kishore, Departments of Veterinary
Pharmacology and Toxicology, Veterinary Surgery
and Radiology, Veterinary Anatomy and Histology
respectively. The authors are grateful to Dr. K.
Krishna Reddy and K. Prabhakar Associate Dean
of NTR College of Veterinary Science,
Gannavaram. The authors are also thankful to the
Meteorological Unit, Airport, Gannavaram.
REFERENCES
Blincoe, C. and S. Brody. 1951. The influence of
temperature on blood composition of cattle.
Res. Bull. Mo. Agric. Exp. Sta., No. 488.
Schalm’s Veterinary Haematology, 5th ed.
Lippincott Williams and Wilkins Publications,
Canada. 1085-1088.
Jain, N.C. 1993. Essentials of Veterinary Haemato-
logy. Lea and Febiger, Philadelphia. p.1-53.
Khadjeh, G.H. and A.A. Papahn. 2002. Some
haematological parameters in the Iranian
(Khuzestan native) buffaloes. Indian J. Anim.
Sci., 72(8): 671-673.
Murthy, T.S. 1980. A note on certain cellular
constituents of blood in buffaloes. Livestock
Advisor, Bangalore, India. 5:44-45 (Cited from
Feldman, B.F., J.G. Zinkl and N.C. Jain (2000).
Schalm’s Veterinary Haematology.)
Patil, M.D., B.A. Talvelkar, V.G. Joshi and B.T.
Deshmukh. 1992a. Haematalogical studies in
Murrah buffaloes. Indian Vet. J., 69: 661-663.

238

Patil, M.D., B.A. Talvelkar, V.G. Joshi and B.T.
Deshmukh. 1992b. Haematalogical studies in
Murrah buffaloes: TLC, DLC and micrometry
of leucocytes. Indian Vet. J., 69: 760-761.
Ranawana, S.S.E., A.A.J. Rajaratna, Kumari
Gunaratna and E.M.C. Ekanayaka. 1989.
Blood values of the indigenous Sri Lanka
buffalo, p. 231-233. Seminar on Buffalo
Genotypes for Small Farms in Asia, Serdang.
Bahga, G.S., P.C. Gangwar, R.K. Srivastava and
D.P. Dhingra. 1980. Effect of spray cooling
and wallowing on blood composition in
*Continued from page 235
On the basis of the restricted selection
index, it was suggested that restriction should not
be imposed on age and weight at first calving when
selecting buffaloes for aggregate genetic gain per
generation.
CONCLUSION
It was concluded that restriction should not
be imposed on age and weight at first calving while
selecting buffaloes for aggregate genetic gain per
generation.
ACKNOWLEDGEMENT
Thanks are due to in-charges of military
dairy farms for permission to use the data.
239
Buffalo Bulletin (September 2008) Vol.27 No.3
buffaloes during summer. Indian J. Dairy
Sci., 33(3): 294-298. (Cited by Sastry, N.S.R.
and C.K.Thomas. 1973.)
Sharma, M.C., N.N. Pathak, R.P. Verma, N.N.
Hung, N.V. Cu, N.H. Lien, D.T. An, H.V. Mai
and N.V. Vuc. 1985. Normal Haematology
of Murrah buffaloes of various ages in the
agro climatic condition in Viet Nam. Indian
Vet. J., 62: 383-386.
Snedecor, G.W. and W.B.Cochran. 1994. Stastical
Methods, 8th ed. Oxford and IBH Publishing
Co., Calcutta, India.
REFERENCES
Chakravarty, A.K. S.S. Rathi, D.S. Balaine and
V.D. Mudgal. 1988. Complete restricted index
selection for the genetic improvement of
Indian buffaloes, p. 88-94. In Proceedings
of 2nd World Buffalo Congress, India.
Gajbhiya, P.V. and V.N. Tripathi. 1991. Genetic
improvement of antagonistic traits in Murrah
buffaloes through restricted selection indices.
Buffalo J., 7(2): 155-163.
Kempthorne, O. and A.W. Nordskog. 1959.
Restricted selection indices. Biometrics, 15:
10-19.
Sunil, Kumar, M.C. Yadav, B.P. Singh and R.B.
Prasad. 2006. Genetic studies of profit traits
in Indian buffaloes. Buffalo Bull., 25(4): 83-
90.
Buffalo Bulletin (September 2008) Vol.27 No.3
MOLECULAR MARKER ASSISTED STUDY OF THE KAPPA-CASEIN GENE
IN THE NILI-RAVI BUFFALO BREED OF PAKISTAN
Muhammad N. Riaz1, Naveed A. Malik, F. Nasreen, S. Sadaf
and Javed A. Qureshi
ABSTRACT
Caseins constitute about 80% of the total
milk proteins that exist in different molecular forms
(αS1, αS2, β and κ). Kappa-casein (κ-CN), the most
important among these casein proteins, presents
polymorphism due to nucleotide sequence variation.
κ-CN exists commonly as A and B variants that are
important to the quality of milk.
The present study was conducted to
investigate the existence of polymorphism at κ-CN
locus. A PCR-RFLP method was used to distinguish
buffalo κ-CN alleles. This method can be used for
genotyping of animals of either sex and at an early
age. The genotypes were confirmed by checking
specific, clearly distinguishable DNA band patterns
resulting from digestion with the three selected
restriction enzymes (Hinf I, Hae III and Mae II).
Analysis of 163 animals revealed that all buffaloes
were monomorphic showing only the BB genotype.
κ-CN B allele which has a significant effect on milk
quality reported previously should be included in
breeding strategies for dairy animals.
The current study is the first report of DNA
based genotyping of κ-CN gene of the indigenous
buffalo breed of Pakistan. As the monomorphism
for κ-CN locus is observed in buffalo population,
this could lead to the development of a method to
identify mixtures of cow and buffalo milk in cheese
processing.
Keywords: κ-CN, milk protein polymorphism, PCR-
RFLP, genotype
1
Health Biotechnology Division, National Institute for Biotechnology and Genetic Engineering, (NIBGE),
Faisalabad, Pakistan. Email. dr_naeemr@yahoo.com
2
Livestock production and research Institute (LPRI), Okara. Pakistan
240
2
INTRODUCTION
Livestock is a major financial factor in the
economy of Pakistan accounting for 49.1% of
agriculture added and about 11.4% of GDP.
Pakistan, the fifth largest milk producing country of
the world, has an annual gross milk production of
about 27.8 million tons mainly from buffalo and cattle
contributing 71 and 24% respectively of the total
milk production. In a recent year, Pakistan possessed
27.335 million head of buffaloes (GOP, 2006-07). In
this context the most important dairy breeds are Nili-
Ravi buffalo and Sahiwal cattle, undoubtedly being
the most adaptable and versatile of all the
domesticated animals in Asia. But accurate selection
still has extreme importance to bringing stable
improvement in milk quantity and quality.
The Nili-Ravi buffalo is the main dairy breed
of Pakistan. These animals are important assets of
the country for the adaptive traits they have
developed over time, such as tolerance to large
fluctuations in the availability of fodder, quality of
feed resources and adaptation to low input
production system and poor management conditions.
In addition to providing milk they are also a source
of beef in Pakistan as the surplus male buffalo
calves are extensively used for beef. Therefore, the
buffalo occupies a key position in the rural economy
of Pakistan.
Selection on the basis of molecular markers
is more reliable than any other criterion. Adaptation
of such a selection depends on the identification of
candidate genes by determining the co-relationship
between a physiological or biochemical process and

the trait. Polymorphism of such genes has great
potential for use as a unique genetic marker. For
centuries, milk quality and quantity have always been
taken as a trait of supreme interest. Its importance
is clear from its wide use and composition especially
the protein profile. Variation in composition and
production due to certain genetic features involving
many genes and environmental factors such as
climate, management and stage of lactation etc make
it a multi factorial polygenic trait (Henderson, 1971).
Milk protein polymorphism has received
intensive research interest due to its importance in
breed selection. Different genomic variation in the
κ-CN locus has been strongly associated with the
difference in milk composition, and the processing
properties of milk and dairy products. Such variation
can be detected by restriction analysis through
electrophoresis. Some other variations, named
posttranscriptional variations, are also seen in the
casein molecule (McLean, 1987, Kemes et al.,
1999). Restricted expression of casein during
lactation limits the use of milk protein analysis for
genotypic evaluation but DNA based genotyping
through PCR-RFLP has made this evaluation
possible as well as simpler for a large number of
animals. Adopting such an evaluation method
broadens the selection process and its influence
regardless of sex, age or physiological stage of the
animals. This also lead to have an improved response
to selection (Medrano and Aguilar Cordova, 1990)
in relatively short time.
Bovine casein is encoded by a 200 kb DNA
fragment located at chromosome no. 6 arranged in
the order of αS1, αS2, β and κ. κ-CN fragment
spans the 13 kb DNA sequence divided into five
exons and intervening sequences and constitutes
about 25% of the casein fraction (Lien and Rogne,
1993).
κ-CN has been extensively studied for its
role of stabilizing the casein micelles and its influence
on the manufacturing properties of milk. For several
breeds the genetic variability in the κ-CN locus has
been reported, each with a different allelic frequency
based on genetic diversity among the breeds. Two
main variants of κ-CN have been identified in
different bovine breeds, that is, A and B, and the
Variant B is concerned with processing properties
of milk and has better lactodynographic properties
241
Buffalo Bulletin (September 2008) Vol.27 No.3
(Lin et al., 1992). In variant B, isoleucine substitutes
threonine and aspartic acid is substituted by alanine
(Pinder et al., 1991) these changes are due to a
single base mutation in the κ-CN locus.
In view, of the importance of milk quality in
the economy of Pakistan and to study the genetic
variability among buffalo breeds, the present study
was designed with the aims of first to optimize a
standard molecular method at DNA level then to
identify the occurrence of polymorphism at κ-CN
locus in the indigenous buffalo breed (Nili-Ravi).
MATERIALS AND METHODS
Animal blood sample collection and data
recording
One hundred and sixty three buffaloes from
of the Nili-Ravi breed were sampled during their
first lactation, both from government and private
farms maintained on standard balanced diet. Five
milliliters of blood was collected in K3-EDTA coated
sterile vaccutainers, and the tubes were maintained
at -200C until used for DNA extraction.
DNA Extraction
Genomic DNA was extracted from
leukocytes according to the methodology described
by Sambrook et al., 1989. The quality and
concentration of extracted DNA was assessed by
visualizing it on 0.8% agarose gel under UV light.
Polymerase Chain Reaction
The primers used for the amplification of
the κ-CN gene fragments were reported by Barroso
et al.,1998 with the following nucleotide sequence:
KF 5′-TGTGCTGAGTAGGTATCCTAGTTA
TGG-3′ KR 5′-GCGTTGTCTTCTTTGATGT
CTCCT-3′ . The amplification reaction was done in
a final volume of 25 μl, containing 100 ng DNA, 50
pico moles of each primer, 1X Taq polymerase buffer
(10 mM Tris HCl pH 9.0, 50 mM KCl, 0.1% Triton
X-100), 1.5 mM MgCl2, 0.2 mM dNTPs and 0.5U
Taq DNA polymerase. The amplification was carried
out in a thermal cycler with the following
amplification conditions: 940C for 5 minutes (initial
denaturation), 94 0C for 1 minutes, 650C for 1
minutes, and 72 0C for 2 minutes with a final
Buffalo Bulletin (September 2008) Vol.27 No.3
extension step of 720C for 10 minutes up to 35
cycles.
Positive and negative PCR controls
Reliability of the PCR products was further
confirmed through both positive and negative
controls. The positive control was the PCR product
resulting from amplification of an extracted DNA
sample with the same set of primers; this procedure
was repeated thrice. Negative control having no
DNA template was used to check for the presence
of any contamination in the PCR reagents.
RFLP (Restriction Fragment Length Polymor-
phism) technique
PCR products were subjected to digestion
by restriction enzymes. In reaction with a total
volume of 20 μl, 10 μl of the amplified fragment
was digested separately with 5U each of Hae III,
Mae II and Hinf I in three separate reaction tubes.
After incubation of the reaction mixture at 370C for
12-16 h, the digested fragments were subjected to
electrophoresis on 2% agarose gel stained with
ethidium bromide in 1X TBE as the running buffer
at 60V for approximately 120/minutes. Visualization
of the restricted DNA bands was done under UV
light, size of different DNA bands resulting from
restriction with each enzyme was confirmed through
standard DNA marker and the size of unrestricted
PCR product was taken as control.
Figure 1. Analysis of amplified product of κ-CN gene (Exon IV) on 1.8% agarose gel. Lane 1: 50 bp
DNA ladder (MBI, Fermentas). Lane 2: Negative control. Lane 3: Positive control. Lane 4-7:
amplified product of bovine κ-CN gene which resulted 453 bp bands.
242
RESULTS
Data Analysis for milk yield and its
constituents
The collected data for all the animals under
study regarding fat and protein in Nili-Ravi buffalo
revealed that the percentage values for each of fat
and protein were estimated as 6.3 + 0.28% and 3.52
+ 0.3%, respectively.
In the present study, we aimed to identify
the allelic variants in the exon-IV of κ-CN gene
fragments in the indigenous buffaloes.
Analysis of PCR Amplified κ-CN gene
fragment
PCR amplification using primers KF and KR
yielded a 453 bp DNA fragment of κ-CN gene.
Presence of a single band visible under UV light
removed the need for a PCR purification step before
restriction analysis (Figure 1).
RFLP analysis of amplified DNA fragment of
κ -CN
Amplified products from Nili-Ravi breed
buffalo, after being digested with HinfI generated
two DNA fragments (426 and 27 bps). Digestion of
the same PCR product with each of HaeIII and
MaeII yielded two separate DNA fragments of
different sizes, i.e. 223, 230 bps and 254, 199 bp,
respectively (Figure 2). Cumulative analysis of the
results depicted the existence of only B allele.

Figure 2. Restriction analysis of amplified product of -CN gene (Exon IV) with MaeII, HinfI and
HaeIII on 2% agarose gel electrophoresis. Lane 1: 50 bp DNA ladder (MBI, Fermentas). Lane
2-3 digested PCR product with MaeII, Lane 4-5 with HinfI, Lane 6-7: HaeIII restriction
endonucleases.
DISCUSSION
All the collected samples were analyzed for
genotypic identification of κ-CN by PCR-RFLP. The
restriction pattern observed following enzymatic
digestion of 453 bp amplified fragment of κ-CN was
compared with already known patterns (Table 1)
specific for each genotype. Restriction analysis of
κ-CN amplified fragments with HinfI generated
different DNA length fragments (426 and 27 bp),
HaeIII (223/230 bp), MaeII (554, 199 bp),
respectively, specific for BB genotype. Similar
results were also found in another study carried out
in India on Nili-Ravi buffalo and Murrah breeds also
supported our finding by Mitra et al. (1998), Pipalia
et al. (2001) and Ontaviano et al. (2005) and also in
Egyptian buffaloes (Othman, 2005) revealed
monomorphism (BB) for this gene in buffalo breeds.
But there are variations in the observations of Sing
et al. (2005), who found two alleles, A and B, for
the κ-CN locus in Murrah and Bhadawari breeds
but monomorphism in the Surti and Mehsana breeds
of buffalo. Similarly, two types of alleles were found
in Murrah, Surti and Pandharpuri breed of buffalo
by (Patel et al., 2007). The monomorphic form (BB)
243
Buffalo Bulletin (September 2008) Vol.27 No.3
of κ-CN is responsible for greater yield in cheese
making as well as milk and milk protein yield
(McLean, 1987). Cheese production can be
increased by 10% if milk is from cows of genotype
BB of κ-CN can be used (Marazalli and Ng-Kwai-
Hang, 1986).
The application of molecular markers in
conjunction with conventional animal breeding
practices will help in improvement of genetic gain
by determining the genetic potential of animals. So
genetic markers have vast application in animal
selection for the identification of best alleles to utilize
in breed selection. Our results clearly indicate
uniform and homozygous population of buffaloes for
κ-CN B allele. The present study is the first report
on κ-CN genotyping of the buffalo breed of Pakistan.
Results of this study can also be help in formulating
effective conservation strategies of breeds and
breeding policy for Punjab province.
So, it would also necessary to characterize
the buffalo and cattle breeds at the molecular level
to conserve and maintain the germplasm in pure form
which could effectively be used in genetic
improvement programms.
Buffalo Bulletin (September 2008) Vol.27 No.3

Table 1. DNA fragment sizes for each genotype for κ-CN locus after digestion with Hinf I, Hae III and
Mae II.
Restriction Enzyme
Genotypes Hinf I Hae III Mae II
Sizes in Base pairs (bps)
AA* ----- 326 100 27 230 223 ----- ----- ----- 254 199
AB* 426 326 100 27 230 223 ----- ----- ----- 254 199
BB* 426 ----- ----- 27 230 223 ----- ----- ----- 254 199
* Genotypes found in our study (Reviewed in Barroso et al., 1998).
* Specific to our study.

ACKHOWLEDGEMENTS Lien, S. and Rogne. 1993. Bovine casein haplotypes

1. HEC, Islamabad for funding this study,
2. PIBS diagnostics budget of NIBGE/PAEC for
financial support, 3. Scientists and staff of Livestock
Production and Research Institute (LPRI), Okara
for sample collection.
REFERENCES
Barroso, A., S. Dunner and J. Canon. 1998.
Technical Note: Detection of bovine kappa
casein variamnts A, B, C and E by means of
PCR-SSCP. J. Anim. Sci., 76: 1535-1538.
GOP. 2006-2007. Economic Survey, Economic
Advisor Wing, Finance Division, Islamabad,
Pakistan.
Henderson, J.L. 1971. The Fluid-Milk Industry.
Vol II. Editor AVI London. 18-19.
Kemenes, P.A., L.C.A. Regitano, A.J.M. Rosa, I.U.
Packer, A.G. Relook, L.A. Figueirede, N.A.
Silva, M, Antonia, L. Etchegaray and
L.L.Coutinho. 1999. Kappa-casein, Beta-
lactoglobulin and growth hormone allele
frequencies and genetic distances in Nelore,
Gyr, Guzera, Caracu, Charolais, Canchin, and
Santa Gertrudis cattle. Gene Mol. Bio., 22(4):
539-541.
Lin, C.Y., M. P. Sabour and A.J. Lee. 1992. Direct
typing of milk protein as an aid for genetic
improvement of dairy bulls and cows: A
review. Anim. Breed. Abstr., 60: 1-10.
number, frequencies and applicability as
genetic marker. Anim. Genet., 24: 373-376.
Madrano, J.F. and E. Aguilar-Cordova. 1990.
Genotyping of bovine kappa casein loci
following DNA sequencing amplification. Bio/
Technology, 8:144-146.
Marzialli, A.S. and K.F. Ng-Kwai-Hang. 1986.
Relationship between milk protein
polymorphisms and cheese yielding capacity.
J. Dairy Sci., 69: 1193-1201.
McLean, D.M. 1987. Influence of milk protein
variants on milk composition, yield and cheese
making properties. Anim. Genet., 18: 100-102.
Millier, M., D.D. Dykes and H.F. Poesky. 1988. A
simple salting out procedure for extracting
DNA from human nucleated cells. Nucleic
Acids Res., 16: 215.
Mitra, A., P. Schlee, I. Krause, J. Blusch, T. Werner,
C.R. Bala krishnan and F. Pirchner. 1998.
Kappa casein polymorphism in the Indian dairy
cattle and buffalo: A new genetic variant in
buffalo. Anim. Biotech., 9(2): 81-87.
Otaviano, A.R., H. Tonhati, S.J.A. Desiderio and
M.F.C. Munoz. 2005. Kappa-casein gene
study with molecular marker in female
buffalos. Gene Mol. Bio., 28(2): 237-241.
Othman, O.E. 2005. The identification of kappa-
casein genotyping in Egyptian river buffalo
using PCR-RFLP (Abst). Arab J. Biotech.,
8(2).

*Continued on page 255

244
 Buffalo Bulletin (September 2008) Vol.27 No.3

RELATIONSHIP OF GROWTH HORMONE WITH COMMENCEMENT OF CYCLICITY

IN POST-PARTUM LACTATING RIVERINE BUFFALOES (BUBALUS BUBALIS)

A. Mishra1, P.K. Pankajand2 and B.S. Prakash3

ABSTRACT Indian peninsula and other parts of Asia. Growth

Twenty-two post-partum Murrah breed
riverine buffaloes of first or second lactation were
selected from the National Dairy Research Institute
(NDRI) herd to determine the length of post-partum
period for cyclicity commencement by growth
hormone (GH). Blood samples (5-10 ml) were
collected twice a week until commencement of
cyclicity as determined by progesterone analysis or
for period of 3 months (whichever was earlier). Out
of these 22 animals, 10 were found to be cyclic as
determined through progesterone analysis. Blood
samples were collected twice a week at 3-4 day
intervals from all animals by means of jugular vein
puncture 5 days post-partum. To fulfill the objectives
of the present study, plasma GH was assayed by
enzyme immunoassays (EIA) techniques and plasma
progesterone was analyzed by a direct
radioimmunoassay (RIA) method. The plasma GH
profiles in these two groups of animals were not
significantly different (P>0.05). Further, no
significant correlation was found between GH
concentration and days to commencement of
cyclicity.
Keywords: growth hormone, cyclicity commen-
cement, post-partum, buffalo
INTRODUCTION
Riverine buffaloes contribute greatly to milk
and meat production in many of the countries of the
hormone (GH) is the principal hormone playing
variety of roles in female reproduction and probably
in commencement of cyclicity post-partum. In
lactating bovines, a complex interaction of several
key metabolic hormones, viz., growth hormone (GH),
prolactin (PRL), thyroid hormones, and
glucocorticoids, leads to mobilization of major
substrates for milk synthesis, e.g., acetate, glucose,
amino acid, and fatty acids, during galactopoiesis
(Tucker, 1981). Although the somatogenic and
gonadotrophic axes have long been known to be
closely linked during growth and sexual maturation
(Simpson et al., 1944) until recently the role of
growth hormone (GH) in reproduction had been
described as ‘more akin to fine tuning than that of
major player (Ogilvy-Stuart and Shalet, 1992). GH
modulates steroidogenesis, gametogenesis and gonad
differentiation as well as gonadotrophin secretion
and responsiveness (Zachmann, 1992). However,
its role in the commencement of cyclicity remains
uncertain.
The causes for the long delay in cyclicity
commencement as well as the variation among
individual animals are not clear and have to be
explored by clueidating the endocrine status of these
lactating riverine buffaloes. In the present
investigation, we discuss our studies on the
endocrinology of Murrah breed riverine buffaloes
with emphasis on the endocrine causes for the post-
partum delay in cyclicity commencement in lactating
buffaloes.

1
Department of Veterinary Physiology, College of Veterinary Sciences & A.H., Jabalpur, M.P-482 001
India. e-mail: amishra5@yahoo.co.in
2
Dept. of LPM, College of Veterinary Sciences & A.H., Jabalpur, M.P-482 001 India
3
Dairy Cattle Physiology Division, National Dairy Research Institute, Karnal-132001, Haryana India

245
Buffalo Bulletin (September 2008) Vol.27 No.3
MATERIALS AND METHODS
Hormone analysis
To fulfill the objectives of the present study,
plasma GH was assayed by enzymeimmunoassays
(EIA) techniques and plasma progesterone was
analyzed by a direct RIA method developed in our
laboratory.
Radioimmunoassay (RIA) for progesterone
quantification
Progesterone was estimated by a direct RIA
procedure used routinely in our laboratory (Kamboj
and Prakash, 1993) with some modifications. In the
process of estimation of hormones and evaluation
of the assay system, quality control in terms of
sensitivity, specificity and precision was carried out
for each hormone. The sensitivity of the assay for
progesterone by direct plasma estimation was 4 pg/
tube, which corresponds to 0.2 ng/ml, the 50 percent
binding limit being 70 pg/tube. The intra- and inter-
assay coefficients of variation for progesterone were
8.4 and 12.0 percent, respectively. The cross-
reactivity of the anti-progesterone serum against
different compounds related to progesterone was
worked out to quantify the specificity of the
progesterone antisera (Prakash and Madan, 2001).
Enzyme Immunoassay (EIA) procedure for
plasma GH
A highly sensitive enzyme immunoassay
procedure using the second antibody coating
technique developed in our laboratory (Prakash et
al., 2003) was carried out to estimate plasma GH.
First coating
The first coating was performed by adding
0.63 μg of goat lgG anti rabbit lgG dissolved in 100
μl of coating buffer (15 mM Na 2C0 3, 35 mM
NaHCO3, pH 9.6) per well of the microtitre plate,
(Linbro, Flow laboratories, Scotland). These plates
were subsequently incubated overnight under
refrigerated conditions.
Second coating
For saturating the remaining binding sites,
300 μl of PBS containing 1 percent BSA was added
to all the wells and incubated for 40 to 50 minutes at
room temperature under constant shaking on
246
microtiter plate shaker (Titertek, Flow Laboratories,
Germany).
Washing
The coated plates were washed twice with
350 μl of washing solution (0.05% Tween-20, 10%
PBS in distilled water, Sigma, Germany) per well
using an automated microtitre plate washer (Model:
EL 50 x 8MS, USA).
Assay protocol
Duplicates of 100 μl of unknown plasma or
bovine GH standards prepared in assay buffer
ranging from 40 pg/100 μl/well to 10,000 pg/100 μl/
well were simultaneously pipetted into respective
wells along with 100 μl of charcoal treated plasma
(C.T.P). GH antibody diluted 1:40,000 in assay buffer
(50 mM NaPO4, 0.15 M NaCI, 0.02% Thiomersal,
pH 7.4) were added with the aid of a dilutor
dispenser (Microlab 500 series, Hamilton,
Switzerland). Thereafter, the plates were incubated
overnight at room temperature after 30 minutes
constant agitation. The next day, the plates were
decanted and washed twice with washing solution
before addition of 100 μl of biotinyl-GH conjugate
diluted 1:3,000 in assay buffer. The plates were
further incubated for 30 minutes with constant
agitation, decanted and washed four times with
washing solution. Then 20 ng streptavidin-
peroxidase (Sigma, Germany) in 100 μl of assay
buffer was added to all the wells using a digital
multichannel pipette (Flow Titertek, Finland) and the
plates were wrapped in aluminum foils and incubated
further for 30 minutes under constant agitation. All
steps were performed at room temperature.
Substrate reaction
The plates were then washed four times
with washing solution and incubated further in the
dark for 40 minutes after addition of 150 μl of
substrate solution per well [Substrate buffer: 0.05
M citric acid, 0.11 M Na 2HPO 4, 0.05% ureum
peroxide, pH 4.0 with 5 N HCl, substrate solution:
17 ml of substrate buffer plus 340 μl 3,3',5,5'-
tetramethyl benzidine; 12.5 mg/ml dimethylsulfoxide
(Sigma, Germany)]. The reaction was stopped by
the addition of 50 μl 4 N H2S04 and the colour
produced was measured at 450 nm with a 12-channel
microtitre plate reader (ECIL, Microscan, India).
GH concentration in buffalo plasma samples was
calculated from the standard curve plotted against

absorbance at 450 nm by using Graphpad PRISM R
3.0, software package.The quality control of the
assay was carried out by performing the following:
Assay sensitivity
The lowest GH detection limit significantly
different from zero concentration, was 40 pg/100 μl
plasma/well, which corresponds to 0.4 ng/ml in
plasma and the 50 percent relative binding was seen
at 900 pg/100 μl/well. Intra- and inter-assay
coefficient of variations were determined using
pooled plasma containing 2.0 ng/ml were found to
be 3.68 and 6.89 percent, respectively, from eight
assays. The specificity of the antiserum used was
determined by the method of Hennies and Holtz
(1993). The antiserum showed high specificity for
GH.
Statistical analysis
The data obtained were analyzed by using
Microsoft Excel 2000 and a Graphpad PRISM R
software package, 1995. Paired t-test was employed
to test the difference between plasma GH amongst
high yielders and low yielders. To test the metabolic
and hormonal parameters, analysis of variance
technique was used in the following statistical model:
yijk = μ+ αI + βj + eijk where,
yijk = the dependent variable
μ = overall populations mean
αI = the effect of ith treatment,
βj = the effect of jth week of experimental period
and
eijk = random error associated with kth individual,
normally and independently distributed with mean
zero, and variance σ2.
The correlations among these traits were
calculated within each group, and the significance
was tested using standard statistical methods as
described by Snedecor and Cochran (1968).
RESULTS AND DISCUSSION
(1) Cyclicity commencement
Commencement of cyclicity was deter-
mined by progesterone analysis at regular 3-4 day
intervals. Continuous monitoring of progesterone
levels (from 5 days post-partum up to 3 months)
was carried out on 12 animals which incidentally
247
Buffalo Bulletin (September 2008) Vol.27 No.3
had also calved recently. On the basis of progesterone
profiles, six had commenced cyclicity during the
course of 3 months, while six animals had not
commenced cyclicity even up to 90 days post-
partum.
(2) Milk production performance
On the basis of milk yield data obtain from
the animals, the twelve were also divided into two
groups, viz., low yielders (n=6) and high yielders
(n=6). The high yielders gave 9.0 to 13.0 litres milk/
day whereas the low yielders produced between 5.0
to 8.5 litres milk/day. The overall milk yield + SEM
for low yielders was 6.58+0.469 kg/day as against
10.92+0.608 kg/day for the high yielders, which was
significantly (P<0.01) different.
(3) Endocrine parameters
Plasma growth hormone in high and low
yielders
There was no significant (P>0.05)
difference between mean growth hormone
concentrations post-partum (n=6), which was 14.91
+ 2.315 ng/ml and 10.51 + 1.646 ng/ml for high and
low yielders respectively.
While no reports are available for comparing
our data on growth hormone in high and low yielding
buffaloes (or even cows), the magnitude of growth
hormone levels were similar to those reported by
Sartin et al. (1988), who recorded hormone levels
of 19.3, 16.4 and 13.6 ng/ml at 1 to 20, 21 to 40 and
41 to 56 days lactation in cows, respectively. In
lactating Murrah buffaloes, the level of growth
hormone was reported as 2.48 ng/ml (Jindal and
Ludri, 1990) but in contrast to this according to Patel
(2001), this level is 14 to 20 ng/ml, and it decreases
in advanced lactation. Normal concentration of
growth hormone in plasma of cattle ranges from 3
to 30 ng/ml depending upon age, sex and stage of
lactation (Schams et al., 1989).
The variation in growth hormone level in
different studies can also be attributed to the
different sources of purified growth hormone used
in different studies as well as the differences in
antisera specificities. No significant trend in growth
hormone profile was recorded for either high and
low yielders (Figure 2) over 90 days post-partum.
Vasilatos and Wangsness (1981) reported in cattle
that during early lactation (30 days post-partum) the
plasma growth hormone concentration was elevated
Buffalo Bulletin (September 2008) Vol.27 No.3

(13.2 ng/ml) compared to that in later lactation (90
days post-partum), which was 9.8 ng/ml. However,
they stated that the increased growth hormone status
in early lactation was due to greater magnitude of
individual secretory spikes rather than a difference
in frequency of spikes or baseline plasma levels of
GH.
GH and Commencement of Cyclicity
The mean GH concentration in animals showing early
commencement of cyclicity ranged from 11.874 +
2.532 to 14.479 + 3.517 ng/ml, whereas the GH
concentration in animals which has not exhibited
cyclicity even up to 90 days ranged from 7.598 +
1.671 to 14.596 + 2.643 ng/ml (Figure 1). The plasma
GH profiles in the two groups of animals were not
significantly different (P>0.05). Further no significant
correlation was found between GH concentration
and days to commencement of cyclicity (Table 1).
To the best of our knowledge, there are no reports
either in cattle or in buffaloes which provide
information on the relationship of plasma GH to
commencement of cyclicity.

Table 1. Correlation coefficients (r) of different hormones and commencement of cyclicity in high and
low yielders.

High yielders
GH MILK YIELD
yielders
Low

GH 1.0000 0.1832*
Commencement of Cyclicity (days) 0.1781 -0.2370

*, Significant at 5% level

20 late commencement early commencement

GH Conc(ng/ml)

15

10

15 30 45 60 75 90
Postpartum days

Figure 1. Plasma GH (Mean+SEM) profile in postpartum lactating buffaloes.

248

CONCLUSION
The endocrine profiles associated with the
interrelationship between plasma GH and
progesterone was studied using sensitive EIA and
RIA procedures standardized in our laboratory. The
overall milk yield + SEM for low yielders was 6.58
+ 0.469 kg/day as against 10.92 + 0.608 kg/day for
the high yielders, which was significantly different
(P<0.01). The plasma GH profiles in the two groups
of animals were not significantly different (P>0.05).
Further, no significant correlation was found between
GH concentration and days to commencement of
cyclicity.
ACKNOWLEDGEMENT
The authors would like to thank the Director
of National Dairy Research Institute for providing
financial support during the period of research work.
REFERENCES
Hennies, M and W. Holtz. 1993. Enzyme immuno
assays for the determination of bovine growth
hormone using avidin-peroxidase-complexes.
J. Immunol. Methods, 157: 149-157.
Jindal, S.K. and R.S. Ludri. 1990. Growth hormone
concentration in lactating crossbred cows and
buffaloes. Asian Australian J. Anim. Sci.,
3(4): 319.
Kamboj, M. and B.S. Prakash. 1993. Relationship
of progesterone in plasma and whole milk of
buffaloes during cyclicity and early pregnancy.
Trop. Anim. Health Prod., 25: 185-192.
Ogilvy-Stuart, A.L. and S.M. Shalet. 1992.
Commentary: Growth hormone and puberty.
Journal of Endocrinol., 135: 405-406.
Patel, D.V. 2001. Interrelatinship of growth
hormone and lactation in buffaloes.
M.V.Sc. Thesis, submitted to Deemed
University, IVRI, Izatnagar, India.
249
Buffalo Bulletin (September 2008) Vol.27 No.3
Prakash, B.S., M. Mondal and N. Anadlaxmi. 2003.
Development and validation of a simple
sensitive enzymeimmunoassay (EIA) for
growth hormone (GH) determination in buffalo
plasma. J. Immonoassay and Immunochem
(In press).
Prakash, B.S. and M.L. Madan. 2001. Production
and characterization of a sensitive antiserum
against progesterone. Indian J. Anim. Sci.,
71(3): 251-253.
Sartin, J.L., K.A. Cummins, R.J. Kemppainen, K.A.
Cummins and J.C. Williams. 1988. Plasma
concentration of metabolic hormones in high
and low producing dairy cows. J. Dairy Sci.,
71: 650-657.
Schams, D., U. Winkler, M. Theyerl-Abele and A.
Prokopp. 1989. Variation of BST and IGF-I
concentration in blood plasma of cattle, p. 18.
In Sejrsen, K., M. Vestergaard and A.
Neimann-Sorensen (eds). Use of
Somatotropin in Livestock Production.
Elsevier Applied Science, New York, NY.
Simpson, R.B., J.D. Armstrong, R.W. Harvey, D.C.
Miller, E.P. Heimer and R.M. Cambell. 1991.
Effect of active immunization against growth
hormone- releasing factor on growth and onset
of puberty in beef heifers. J. Anim. Sci., 69:
4914-4924.
Snedecor, G.W. and W.G. Cochran. 1968. Statistical
Methods. Oxford & IBH Pub. Co., New
Delhi.
Tucker, H.A. 1981. Physiological control of
mammary growth, lactogenesis and lactation.
J. Dairy Sci., 64: 1403.
Vasilatos, R. and P.J. Wangsness. 1981. Diurnal
variations in plasma insulin and growth
hormone associate with two stages of
lactation in high producing dairy cows.
Endocrinol., 108(1): 300.
Zachmann, M. 1992. Interrelations between growth
hormone and sex hormones-physiology and
therapeutic consequences. Hormone Res.,
38: 1-8.
Buffalo Bulletin (September 2008) Vol.27 No.3
IMMUNE RESPONSE OF BUFFALO CALVES TO VACCINATION
WITH BRUCELLA ABORTUS STRAIN- 19 VACCINE
S. Bora, G. Mahato, N.N.Barman* , D.K.Bhattacharya and T.C.Dutta
ABSTRACT
Vaccination is the only way to control
brucellosis in endemic areas. Calfhood vaccination
is generally practised to prevent the occurrence of
the disease. Vaccination trial with Brucella abortus
strain-19 vaccine was done in buffalo calves in the
4-8 month age group. The antibody level was assayed
using STAT and 2-MET. In STAT the peak level of
antibody was recorded on the 15th day of vaccination
and a negligible level on the 120 th day post
vaccination. In comparison to STAT the antibody
level detected by 2-MET disappeared much earlier
than STAT titre. The antibody level reached the peak
15 days after immunization, declined rapidly, and
became almost zero on the 90 th day after
immunization. Although the serum antibody level
declined quickly, the cell mediated immunity (CMI)
level could easily be detected by a delayed type of
hypersensitivity test (DTHT) indicating that booster
dose is not required in a Brucella abortus strain -
19 vaccination programme.
Keywords: antibody, Brucellosis, calf hood, DTHT,
vaccination
INTRODUCTION
Brucellosis alone can cause losses of about
rupees 350 million every year (Singh et al., 2000) in
animal husbandry, which is the backbone of the
Indian economy. Today bovine brucellosis is perhaps
the most important economically devastating
reproductive disorder of the rapidly growing Indian
dairy industry, which stands top in milk production
in the world. The disease is endemic in nature and
*Department of Microbiology, College of Veterinary Science, Assam Agricultural University, Khanapara :
Guwahati-781 022 Assam India. e-mail: nnbarman@gmail.com
250
the prevalence rate is very high, hence vaccination
is the only way to control the disease. Brucellosis is
a disease of adult animals; therefore, calf hood
vaccination is generally practised to prevent the
disease. Assam possesses over 678,000 buffaloes
(Anonymous, 2005) and majority of the buffaloes
are swamp type. These animals are the source of a
large quantity of milk in Assam as compared to cattle
and are suitable for work in wetlands, paddy fields
and allied agricultural activities.
The eradication of animal brucellosis has
entered on the use of Brucella abortus starin-19
and Brucella melitensis Rev 1 vaccine for bovines
and small ruminants. Brucella abortus strain -19
has remained the cornerstone of most brucellosis
eradication programmes since 1940. Calf hood
vaccination with S-19 vaccine led to progressive
reduction in cases of brucellosis across the globe.
This strain is stable and has low pathogenicity and
high immunogenicity. The Joint FAO/WHO Expert
Committee on Brucellosis suggested mass
vaccination of bovines, preferably with live strain -
19 vaccine, to reduce the rate of Brucella infection
in high endemic areas (Anonymous,
1986).Vaccinated animals have high degree of
protection against abortion and 65 to 75 percent are
resistant to most kind of exposure.
MATERIALS AND METHODS
A group of six apparently healthy buffalo
calves from Brucella free herds between 4-8 months
of age were selected for the study. The animals were
vaccinated with Brucella abortus strain-19 vaccine
(Live) procured from Indian Veterinary Research
Institute, Izatnagar, Uttar Pradesh, India, at a dose

rate of 5.0 ml subcutaneously (the bacterial
concentration adjusted to 40-80 x 109 colony forming
units) as recommended by the producer of the
vaccine. On the day of vaccination, a similar dose
of normal saline was also administered to an equal
group of healthy buffalo calves which were
maintained as a control group.
Serum samples were collected on 0, 15th,
30th, 60th, 90th and 120th day post- vaccination.
The Serum Tube Agglutination Test (STAT)
and 2-Mercaptoethanol Test (2-MET) was
performed on the collected serum samples as per
the method described by Alton et al. (1975b).
RESULTS AND DISCUSSION
The prevalence rate of brucellosis in
unorganized herds of buffalo was 15.60% and in
organized herds was 8.16%. The serum samples
from vaccinated and control buffalo calves were
Figure 1. STAT and 2-MET titres in vaccinated animals at different post vaccination days.
subjected to STAT to evaluate the antibody
response. Calves vaccinated with Strain-19 vaccine
developed antibody, which reached peak titre
(133.30+16.87) on the 15th day post vaccination and
declined rapidly thereafter. The STAT titre remained
positive up to the 30th day post vaccination. However,
the antibody titre declined to below diagnostic level
and persisted at a negligible level on 120th day post
251
Buffalo Bulletin (September 2008) Vol.27 No.3
vaccination (Figure 1). A similar trend was also
observed by Das and Mulbagal (1983), Afzal et al.
(2000) and Jamal et al. (2003) who recorded a
maximum antibody titre between the 10th and 15th
day post vaccination and found the titre became zero
or insignificant by the 90th day post vaccination.
Brucella abortus strain-19 vaccine has
remained the cornerstone of most brucellosis
eradication programmes since 1940. Calfhood
vaccination with Strain-19 leads to progressive
reduction in cases of brucellosis across the globe
and protects animals up to the 5 th pregnancy
(Manthei, 1952). In the present study, an attempt
was made to evaluate the immune response of strain-
19 vaccine in female buffalo calves.
The serum samples of vaccinated calves
treated with 2-Mercaptoethanol (0.1mol/litre) in
normal saline and assayed by STAT showed
maximum 2-MET titre on the 15 th day post
vaccination. However, the antibody titre declined to
below detectable level from the 90 th day post
vaccination (Figure 1). The antibody titre of 2-MET
presented in the study is in agreement with
conclusions of Das and Mulbagal (1983). Afzal et
al. (2000) also stated that specific immunoglobulin
G titre as measured by 2-Mercaptoethanol treated
serum declined much earlier than STAT titre.
Buffalo Bulletin (September 2008) Vol.27 No.3
It can be noted that there was a greater
reduction in the titre of 2-MET than in the 15th day
sera samples of vaccinated calves and lasted for a
shorter period than STAT titre. This indicates the
development of an IgM immunoglobulin isotype
susceptible to 2-Mercaptoethaol and is in agreement
with the conclusions of Beh (1974) and Das and
Mulbagal (1982). Sutherland (1985) stated that in
vaccinated cattle, the IgM isotype of antibody was
the first antibody, reached a peaked concentration
on 13 th day post vaccination, and remained
predominant, but IgG antibody appeared in low titre
and finally disappeared within a few months.
The magnitude and duration of antibody
response following vaccination is directly related to
age at vaccination and number of organisms
administered (Nicoletti, 1989). Afzal et al. (2000)
also observed rapid decline of serum agglutination
titres (SAT) in calves of 6 months of age than those
of 11-12 months. In cattle, vaccinated at 3-8 months
of age with Strain -19 with approximately 5 × 1010
viable cells, the titre usually recedes to low level at
4-6 months of age, and residual antibodies are
predominantly IgM (Nicoletti, 1989).
The present study clearly showed that
antibody response to Strain-19 vaccination was quick
and lasted for short duration in buffalo calves.
Humoral antibody does not correlate well with the
protective immunity. Calves vaccinated with Strain-
19 have long lasting immunity even though titre
recedes within weeks following vaccination
(Nicoletti, 1989).
ACKNOWLEDGEMENTS
The authors are thankful to the Dean,
Faculty of Veterinary Science, and the Director of
Research (Vety), Assam Agricultural University,
Khanapara Campus, Guwahati-781022, for providing
necessary facilities for the study.
252
REFERENCES
Afzal, M., Mirza, M.A. and M. Jahangir. 2000.
Immune response of buffaloes to vaccination
with Brucella abortus strain-19. Rev. Sci.
Tech., 19(3): 867-870.
Alton, G.G., L.M. Jones and D.E. Pietz. 1975.
Laboratory Techniques in Brucellosis, 2nd
ed. WHO Monograph Series, No.55. World
Health Organization, Geneva.
Anonymous. 1986. Joint FAO/WHO Expert
Committee on Brucellosis: World Health
Organization Technical Report Series, No.
710.
Anonymous. 2005. The 17th livestock population
census. Ministry of Agriculture, Department
of Animal Husbandry Dairying & Fisheries.
Beh, K.J. 1974. Quantitative distribution of Brucella
antibody among immunoglobulin classes in
vaccinated and infected cattle. Res. Vet. Sci.,
17: 1-4.
Das, A.M. and A.N. Mulbagal. 1982. Indian J.
Comp. Micro. Immuno. Infect. Dis., 3(3).
Das, A.M. and A.N. Mulbagal. 1983. Study of
different serological tests on S 19 vaccinated
buffalo and crossbred calves. Indian J.
Comp. Microbiol. Immunol. Infect. Dis.,
40(1): 23-26.
Jamal, S.M., M. Afzal and S. Ahmed. 2003. Immune
response of guinea pigs and buffalo calves to
the locally prepared Brucella abortus strain-
19 vaccine. Rev. Sci. Tech., 223(3): 893-895.
Manthei, C.A. 1952. Evaluation of vaccinal methods
and doses of Brucella abortus strain 19, p.
115-125. In Proceedings of 56th Ann. Mtg.
US. Livestock San. Assoc.
Nicoletti, P. 1989. Immune responses and
vaccination. p. 238-299. In Brucellosis,
Manir Madcour, M. (ed.) Butterworths.
Singh, D.K., D.K. Sinha and V.I. Bishar. 2000.
Brucellosis: Diagnosis and Control. Recent
trends in diagnosis and control of important
zoonoses and food borne infections. ICAR
Summer School, June 2000. 40-46.
Sutherland, S.S. 1985. Immunology of bovine
brucellosis. Vet. Bull., 50: 1334-1335.
 Buffalo Bulletin (September 2008) Vol.27 No.3

EFFICACY OF OXFENDAZOLE AGAINST STRONGYLES

IN MIGRATORY BUFFALO CALVES

Neelesh Sharma1, Vijay Pandey2, S.K. Gupta and S.R. Upadhyay

INTRODUCTION pot belly condition, rough hair coat and diarrhea.

Gastrointestinal parasitic infection is a major
cause of low productivity, unthriftiness and
occasional death in farm animals (Sood, 1981).
Amongst gastrointestinal nematodes, strongyles are
also prevalent in young ones of large ruminants
(Katoch et al., 2007). Migratory buffaloes are
always maintained on grazing pasture and migrate
from one place to another throughout the year.
Oxfendazole, the sulfoxide form of
fenbendazole, is a broad spectrum benzimidazole
anthelmintic used against strongyles, roundworms
and pinworms for small and large ruminants. The
present study reports the efficacy of oxfendazole
against strongyles in migratory buffalo calves.
MATERIALS AND METHODS
The present study was conducted at Gujjar’s
private dairy farms, R.S. Pura area of Jammu district.
The dung samples collected from calves which
showed the signs of worm infestation like dullness,
After screening, a total of 14 migratory buffalo calves
(up to 6 months of age) of both sexes, and naturally
infected with strongyle were selected for this study,
which was conducted during the period from June
to August 2007.
These animals were divided into two groups,
A and B, each containing seven animals of either
sex. Group A animals were kept as an untreated
control, whilst group B animals treated with single
dose of 22.65% oral suspension of oxfendazole
(Axefendol, Alved Pharma and foods Pvt. Ltd.,
India) at the dose rate of 4.5 mg/kg. body weight.
Individual fecal samples of both the groups were
collected from the rectum and examined by direct
smear method to ascertain the infection, and eggs
per gram of feces (EPG) was assessed by Stoll’s
dilution method (Soulsby, 1982).
The efficacy of the drug was assessed on
the basis of percentage reduction in egg count. Egg
count was made on day 0 (pre-treatment), 3, 7 and
14 of post-treatment. The efficacy of the drug for
eliminating infection was calculated by following
formula (Yadav et al., 2007).

Pre-treatment mean EPG - Post-treatment mean EPG

% efficacy of drug = of a group of a group on particular day X 100
Pre-treatment mean EPG of a group

1
Division of Veterinary Clinical Medicine & Jurisprudence, Faculty of Veterinary Science and Animal
Husbandry, Sher-E-Kashmir University of Agricultural Sciences and Technology of Jammu, R.S. Pura,
Jammu-181102 (J & K), India. E-mail:drneelesh_sharma@yahoo.co.in
2
Division of Veterinary Biochemistry. Faculty of Veterinary Science and Animal Husbandry, Sher-E
Kashmir University of Agricultural Sciences and Technology of Jammu, R.S. Pura, Jammu-181102
(J & K), India

253
Buffalo Bulletin (September 2008) Vol.27 No.3
STATISTICAL ANALYSIS
All the data’s were statistically analysed by
using the student ‘t-test’ to find the significant
differences (reduction) in EPG among between
groups (control and treated) and within (treated)
group if any, following standard methods as described
by Snedecor and Cochran (1994).
RESULTS AND DISCUSSION
The results of the efficacy of oxfendazole
against strongyles of migratory buffalo calves are
presented in Table 1. Oxfendazole at a single oral
dose of 4.5 mg/kg body weight, resulted in a
significant (P<0.001) reduction of mean EPG from
day 3 onward, in comparison with the mean EPGs
of the control group and ‘0’ day of the same group
(treated) as well. The mean EPG of the oxfendazole
treated group became ‘0’ on day 14 from day 0
(1217.14 ± 59.23). While the mean EPG of the
infected control group-A gradually increased from
day 0 (1284.28 ± 61.44) to day 14 (1450 ± 61.84).
The efficacy of drug was 56.45% on day 3, 94.25%
on day 7 and 100% on day 14 post treatment i.e.
100% reduction of strongyle eggs was found on day
14 of post-treatment. The EPGs were significantly
lower in treated animals than untreated control group
from day 3 onward. The findings of present study
are in agreement with the findings of Michael et al.
(1979) and Yazwinski et al. (1986), who reported
100% and 99.5% reduction in eggs of gastrointestinal
Table 1. Mean values of eggs per gram (EPG) and percentage reduction of eggs at different days before
and after treatment.
Pre-treatment
Details
0 3
A (Control) 1284.28±61.44 1298.57±65.08
B (Treated) 1217.14 ±59.23 530.14±45.41*
% Efficacy of drug 00
P<0.001
nematodes in buffaloes at a dose rate of 4.5 mg/kg
body weight, respectively. Similarly, Borgsteede and
Reid (1982) reported 100% efficacy of oxfendazole
in calves against gastrointestinal nematodes and also
observed that oral or intraruminal administration of
oxfendazole had the same efficacy. No adverse
reactions or clinical signs were observed in treated
animals during and after treatment. Thus, the present
study suggests that the oxfendazole single dose @4.5
mg/kg body weight is highly efficacious against
strongyles in buffalo calves.
SUMMARY
In the present study, migratory buffalo
calves of up to 6 months of age were taken for the
study of the efficacy of oxfendazole against
strongyles. Oxfendazole at the dose rate of 4.5 mg/
kg b. wt. was 94.25% effective on 7 day and 100%
on day 14 of post treatment. The EPGs were
significantly lower in treated animals than untreated
control group from day 3 onward, while in infected
control group-A, EPG gradually increased from day
0 to day 14.
ACKNOWLEDGEMENTS
Authors are highly thankful to M/s Allied
Pharma and Food Pvt. Ltd., India for free supply of
Axefendol and Dean, F.V.Sc.& A.H., SKUAST-J,
for providing facilities.
Days
Post-treatment
7 14
1370±63.55 1450±61.84
70.00±10.52* 00
56.45 94.25 100
254

REFERENCES
Borgsteede, F.H. and J.F. Reid. 1982. Oxfendazole
efficacy in calves: a comparison of oral and
intraruminal route of administration. Vet. Q.,
4(3): 139-141.
Katoch, R., A. Yadav, S. Vohra, R.K. Taggar and
V. Pandey. 2007. Parasitic diseases of dairy
animals in and around R.S. Pura of Jammu
district. Vet. Practitioner, 8(2): 186-187.
Michael, S.A., A.H. Refaii EI and A.J. Higgins. 1979.
Efficacy of oxfendazole against naturally
acquired gastro-intestinal nematode
infestations in buffaloes in Egypt. Aug., 11(3):
159-163.
*Continued from page 244
Patel, R.K., J.B. Chauhan, K.M. Singh and K.J.
Soni. 2007. Genotypin and alleleic frequencies
of κ-CN and β-LG in Indian River buffalo
Bulls. Buffalo Bull., 26(3): 63-66.
Pinder, S.J., B.N. Perry, C.J. Skidmore and D. Savva.
1991. Analysis of polymorphism in the bovine
casein gene by use of polymerase chain
reaction. Anim. Gene., 22: 11-22.
Pipalia, D.L., D.D. Ladani, B.P. Brahmkshtri, D.N.
Rank, C.G. Joshi. P.H. Vataliya and J.V.
Solanki. 2001. Kappa-casein genotyping of
255
Buffalo Bulletin (September 2008) Vol.27 No.3
Snedecor, G.W. and W.G. Cochran. 1994. Statistical
Methods, 8th ed. The Iowa State University
Press, Ames, Iowa, U.S.A.
Sood, M. 1981. Haemonchosis in India. Parasitol.,
83: 639-650.
Soulsby, E.J.L. 1982. Helminths, Arthropod and
Protozoa of domesticated animals, 7th ed.
Bailliere Tindal London.
Yadav, A., R. Katoch, S. Vohra, J.K. Khajuria, S.
Sood, D.M. Mondhe and A.K. Srivastava.
2007. Efficacy of praziquantel pamoate and
febantel combination against various helminths
of dogs. Vet. Practitioner, 8(2): 170-171.
Yazwinski, T.A., B.L. Presson and H. Featherstone.
1986. Efficacy of oxfendazole as administered
by intraruminal injection to naturally infected
calves. Am. J. Vet. Res., 47(2): 326-328
Indian buffalo breed using PCR-RFLP.
Buffalo J., 2: 195-202.
Sambrook, J., E.F. Fritsch and T. Maniatis. 1989.
Molecular Cloning: A Laboratory Manual,
2nd ed. Vol.3, Cold Spring, Harbour Laboratory
Press, New York.
Singh, S., K. Pushpendra and T.K. Bhattacharya.
2005. DNA polymorphism of κ-CN and β-CN
genes and its association with milk production
and quality traits in buffalo (B. bubalis), p.
200. In Proceedings of National Symposium
on domestic animals diversity: status,
opportunities and challenges, NBAGR,
Karnal.
 Instructions for Authors
Buffalo Bulletin is published by International Buffalo
Information Center under the authorization of Office of University
Library, Kasetsart University, Thailand. Contributions on any aspect
of research or development, progress report of projects and news on
buffalo will be considered for publication in the bulletin.
General editorial policies
Authorship criteria
Authorship is restricted to those who (1) have contributed
substantially to one or more of the following aspects of the work and (2)
are willing to assume public responsibility for the validity of the
work.
Copyright
Copyright to published manuscripts becomes the sole
property of International Buffalo Information Center.
Criteria for manuscript acceptance
Manuscript acceptability is based on clarity of objectives;
originality; appropriateness of the experimental design, methods and
statistical analysis; substance of the results; thoroughness with which the
results are discussed; and appropriateness of the conclusions.
Following acceptance of a paper and prior to publication, the
author will be received the acceptance letter.
Manuscript requirements
Manuscripts preparation
Manuscripts on original research in English language should
include at least the following elements.
Title
• Full title (be concise)
• Name(s) of author(s) and the first author
affiliation with complete address.
Abstract
• An abstract not exceeding 250 words; all
acronyms and abbreviations defined; no
references cited. State what, where and how it
was done, major results.
• Five key words.
Introduction. Review pertinent work, cite key references,
explain importance of the research, and state objectives of
your work.
Materials and Methods. Provide sufficient detail so work
can be repeated. Describe new methods in detail; accepted
methods briefly with references.
Use of trade names. Trade names are to be
avoided in defining products whenever possible.
Use of abbreviations and acronyms. At first text
use, define in parentheses. Do not use abbreviations and
acronyms in titles.
Results and discussion. Present results concisely using
figures and tables as needed. Do not present the same
information in figures and tables. Discuss principles and
relationship, point out exception. Show agreement with
published research work. The significances of work or
conductions should be presented in the end of discussion.
Tables. Number each table with Arabic numerals. Place a
descriptive caption at the top of each table.
Figures. (graphs, charts, line drawings, photographs)
Number each figure with Arabic numerals under the
illustration. Lettering, data lines and symbols must be
sufficiently large so as to be clearly visible when the figure
is reduced to a size commonly used in the journal.
References. List only those references cited in the text.
Required format of described below.
Reference cited format
Manuscripts should follow the name-year reference format.
Cite only necessary publications. Primary rather than secondary
references should be cited, when possible. It is acceptable to cite work
that is “in press” (i.e., accepted but not yet published) with the pertinent
year and volume number of the reference.
In text. Cite publications in text with author name and
year. Three or more authors use “et al.”. In parenthetical citations,
separate author and year with a comma. Use suffixes a, b and c to
separate publications in same year by the same author. Semi-colon
separate citations of different authors. Cite two or more publications
of different authors in chronological sequence, from earliest to latest.
For example:
….used liquid nitrogen vapour freezing technique from Verma et al.
(1975)
….liquid nitrogen vapour freezing technique (Verma et al., 1975)
…and buffaloes (Singh et al., 1983; Shah et al., 1987; Misra, 1996;
Pant et al., 2002)
In reference cited. List only those literature cited in the text.
References should be listed alphabetically by the first author’s last
name. Single author precedes same author with co-authors. Type
references flush left as separate paragraphs. Do not indent manually.
Write the name of book or journal in italic letters. Use the following
format.
• Journal articles: Author(s). Year. Article title. Journal title,
volume number: inclusive pages.
Example: Citation in text: Chaudhary et al. (1981)
Choudhary, P.C., B. Prasad and S.K. Misra. 1981. Note on the use of
rumen liquor in the treatment of chronic alkaline indigestion in
cows. Indian J. Anim. Sci., 51: 356-360.
• Books: Author(s) or editor(s). Year. Title. Publishername,Place
of publication. Number of pages.
Example: Citation in text: Snedecor and Cochram. (1980)
Snedecor, G.W. and W.G. Cochram. 1980. Statistical Methods, 7 th ed.
The Iowa State University Press, Ames, Iowa, USA. 593p.
Sattar, A. 1995. Studies on the effect of immunopotentiation of
vaccinated pregnant buffaloes and cows on neonatal antibody
titre and hematological profile. Ph. D. thesis, University of
Agriculture, Faisalabad, Pakistan. 208p.
• Chapter: Author(s) of the chapter. Year. Title of the chapter,
pages of the chapter. In author(s) or editor(s). Title of the book.
Publisher name, Place of publication.
Example: Citation in text: Sloss and Dufty. (1980)
Sloss, V. and J.H. Dufty. 1980. Disorders during pregnancy,
p. 88-97. In Sloss, V. and J.H. Dufty (eds.) Handbook of Bovine
Obstetrics. Williams and Wilkins, Baltimore, U.S.A.
Sabrani, M., K. Diwyanto and M. Winugroho 1994. A critical
review of buffalo research and development activities in
Indonesia. Past performanceand future strategies, p. 78-89. In
Proceedings of 1 st Asian Buffalo Association Congress,
Thailand.
Submission manuscript
Submit the following items.
Cover letter. Identify the corresponding author and provide his/her
full name, address, numbers for telephone and fax, and e-mail address.
Manuscript. In 12 point Times or Times New Roman. Type on one
side of A4 paper. Use one inch margins. Number all pages. Send an
original manuscript and 1 photocopy.
Disk. Include an IBM-formatted, 3-1/2" disk or 4-3/4" CD-ROM,
containing the manuscript in Microsoft Word.
Mail manuscript to:
By post: International Buffalo Information Center
Office of University Library
Kasetsart University,
50 Pahonyothin Road, Chatuchak,
Bangkok 10900, Thailand
Tel. 66-2-942-8616
By e-mail: libibic@ku.ac.th
Buffalo Bulletin (September 2008) Vol.27 No.3

CONTENTS
Page

An investigation into comparative mortality rates of neonatal buffalo

calves versus cow calves.
A. K. Jain, I. J. Sharma, R. G. Agrawal, P.K. Pankaj, Y.P.S. Malik and A. Dixit.……215

Dystocia due to fetal arthrogryposis in a she buffalo.

S.P. Shukla, S.P. Nema, S.S. Mahor, K.P. Gupta and U.K. Garg................................220

Molecular cloning and characterization of the beta-casein gene

in an Indian riverine buffalo (Bubalus bubalis).
Tarun K. Bhattacharya, Pushpendra Kumar, and Arjava Sharm...............................222

A dicephalus monster in Murrah buffalo.

Sushant Srivastava, Amit Kumar, S.K. Maurya, A. Singh and V. K. Singh.......….......231

Restricted selection index for genetic improvement in Indian buffaloes.

Sunil Kumar, M. C. Yadav and R.B. Prasad...............................................................233

Haematology of graded Murrah buffaloes in the coastal region

of Andhra Pradesh (India).
K. Naveen Chandra, V.G.N.V. Prasad, CH.E. Narasimha Reddy, V.Bhaskar,
Guru D.V. Pandiyan and E. Muralinath……...……...……......................……..…….236

Molecular marker assisted study of the kappa-casein gene

in the Nili-Ravi buffalo breed of Pakistan.
Muhammad N. Riaz, Naveed A. Malik, F. Nasreen, S. Sadaf
and Javed A. Qureshi......................................................…………...……..….......…240

Relationship of growth hormone with commencement of cyclicity

in post-partum lactating riverine buffaloes (Bubalus bubalis).
A. Mishra, P.K. Pankajand and B.S. Prakash............................................................245

Immune response of buffalo calves to vaccination

with Brucella abortus strain-19 vaccine.
S. Bora, G. Mahato, N.N.Barman , D.K.Bhattacharya and T.C.Dutta........................250

Efficacy of oxfendazole against strongyles in migratory buffalo calves.

Neelesh Sharma, Vijay Pandey, S.K. Gupta and S.R. Upadhyay................................253

BUFFALO BULLETIN
IBIC, KASETSART UNIVERSITY, P.O. BOX 1084
BANGKOK 10903, THAILAND
URL : http://ibic.lib.ku.ac.th
E-mail : libibic@ku.ac.th
Tel : 66-2-9428616 ext. 344
Fax : 66-2-9406688