Student Page 7.1: DNA Replication and Transcription Procedure 1. 2. The DNA sequence below has a mutation.

Find the mutation and circle it. Use your knowledge of DNA replication to describe the base sequences of the two DNA molecules produced following one round of replication. In each box, list the DNA sequences of both strands. Indicate which DNA strands are new and which are old. Products of DNA Replication

DNA Strand

A -- T T -- A G -- C C -- G C -- G T -- A G -- C T -- A G -- A
3. In the space below, list the mRNA sequence that would result from transcription of this DNA sequence. DNA Template

T A C G G A C A A

mRNA Transcript

Student Page 7.2A: Assessing the Effects of Mutations Procedure 1. The mRNA sequence below represents the first part of a gene coding for a much longer protein. Use the genetic code table to translate this mRNA sequence into an amino acid sequence. Write the amino acid sequence in the space below. (You may use the amino acid abbreviations.) 1 10 20

AUGCUUUCGGCACCGGUACUA
Amino Acid Sequence

1. Next, consider (one at a time) the effects of the following three mutations. Make the changes indicated on the mRNA strand. Use the genetic code table and list the amino acid sequence that corresponds to each of the following three mutations: Mutation 1: Change base number 4 (C) to a U 1 10

20

AUGCUUUCGGCACCGGUACUA

Mutation 2: Change base number 8 (C) to an A 1 10

20

AUGCUUUCGGCACCGGUACUA

Student Page 7.2A: Assessing the Effects of Mutations (Cont.) Mutation 3: Change base number 12 (A) to a G 1 10

20

AUGCUUUCGGCACCGGUACUA

3.

In the space below, describe the effect of each mutation on the resulting protein. Explain which mutation you expect will have the greatest and least effect on the protein. Be sure to explain your reasoning. Base 4 (C) changes to a U

Mutation 1:

Mutation 2:

Base 8 (C) changes to an A

Mutation 3:

Base 12 (A) changes to a G

Student Page 7.2B: Assessing the Effects of Mutations Procedure 1. The mRNA sequence below represents the first part of a gene coding for a much longer protein. Use the genetic code table to translate this mRNA sequence into an amino acid sequence. Write the amino acid sequence in the space below. 1 10 20

AUGCUUUCGGCACCGGUACUA
Amino Acid Sequence

2.

Next, consider (one at a time) the effects of the following three mutations. Make the changes indicated on the mRNA strand. Use the genetic code table and list the amino acid sequence that corresponds to each of the following three mutations:

Mutation 1: Change base number 5 (U) to a G 1 10

20

AUGCUUUCGGCACCGGUACUA

Mutation 2: Change base number 9 (G) to an A 1 10

20

AUGCUUUCGGCACCGGUACUA

Student Page 7.2B: Assessing the Effects of Mutations (Cont.) Mutation 3: Insert a G base between base 12 (A) and base 13 (C) 1 10 20

AUGCUUUCGGCACCGGUACUA

3.

In the space below, describe the effect of each mutation on the resulting protein. Explain which mutation you expect will have the greatest and least effect on the protein. Be sure to explain your reasoning.

Mutation 1: Base 5 (U) changes to a G

Mutation 2: Base 9 (G) changes to an A

Mutation 3: Insertion of a G base after base 12 (A)

Student Page 7.2C: Assessing the Effects of Mutations Procedure 1. The mRNA sequence below represents the first part of a gene coding for a much longer protein. Use the genetic code table to translate this mRNA sequence into an amino acid sequence. Write the amino acid sequence in the space below. 1 10 20

AUGCUUUCGGCACCGGUACUA
Amino Acid Sequence

2.

Next, consider (one at a time) the effects of the following three mutations. Make the changes indicated on the mRNA strand. Use the genetic code table and list the amino acid sequence that corresponds to each of the following three mutations: 20

Mutation 1: Change base number 6 (U) to an A 1 10

AUGCUUUCGGCACCGGUACUA

Mutation 2: Delete base 7 (U) 1

10

20

AUGCUUUCGGCACCGGUACUA

Student Page 7.2C: Assessing the Effects of Mutations (Cont.) Mutation 3: Change base 19 (C) to an A 1 10 20

AUGCUUUCGGCACCGGUACUA

3.

In the space below, describe the effect of each mutation on the resulting protein. Explain which mutation you expect will have the greatest and least effect on the protein. Be sure to explain your reasoning. Base 6 (U) changes to an A

Mutation 1:

Mutation 2:

Deletion of Base 7 (U)

Mutation 3:

Base 19 (C) changes to an A

Student Page 7.2D: Assessing the Effects of Mutations Procedure 1. The mRNA sequence below represents the first part of a gene coding for a much longer protein. Use the genetic code table to translate this mRNA sequence into an amino acid sequence. Write the amino acid sequence in the space below. 1 10 20

AUGCUUUCGGCACCGGUACUA
Amino Acid Sequence

2.

Next, consider (one at a time) the effects of the following three mutations. Make the changes indicated on the mRNA strand. Use the genetic code table and list the amino acid sequence that corresponds to each of the following three mutations: 20

Mutation 1: Change base number 6 (U) to an A 1 10

AUGCUUUCGGCACCGGUACUA

Mutation 2: Change base number 8 (C) to an A 1 10

20

AUGCUUUCGGCACCGGUACUA

Student Page 7.2D: Assessing the Effects of Mutations (Cont.) Mutation 3: Delete bases 13 15 1 10 20

AUGCUUUCGGCAC C GGUACUA

3.

In the space below, describe the effect of each mutation on the resulting protein. Explain which mutation you expect will have the greatest and least effect on the protein. Be sure to explain your reasoning. Base 6 (U) changes to an A

Mutation 1:

Mutation 2:

Base 8 (C) changes to an A

Mutation 3:

Deletion of Bases 13 15

Student Page 7.3: Genetic Code Table

10

Student Page 7.4AB: Mutations and Their Effects Procedure: Circle the mutation that has the greatest and least effect. Explain the reasoning for your choice.

Greatest Effect
5.2A Change base number 4 (C) to a U Change base number 8 (C) to an A Change base number 12 (A) to a G 5.2B Change base number 5 (U) to a G Change base number 9 (G) to an A Insert a G base between base 12 (A) and base 13 (C) Reasoning:

Least Effect
5.2A Change base number 4 (C) to a U Change base number 8 (C) to an A Change base number 12 (A) to a G 5.2B Change base number 5 (U) to a G Change base number 9 (G) to an A Insert a G base between base 12 (A) and base 13 (C) Reasoning

Student Page 7.4CD: Mutations and Their Effects Procedure: Circle the mutation that has the greatest and least effect. Explain the reasoning for your choice.

Greatest Effect
5.2C Change base number 6 (U) to an A Delete base 7 (U) Change base 19 (C) to an A 5.2D Change base number 6 (U) to an A Change base number 8 (C) to an A Delete bases 13 15 Reasoning:

Least Effect
5.2C Change base number 6 (U) to an A Delete base 7 (U) Change base 19 (C) to an A 5.2D Change base number 6 (U) to an A Change base number 8 (C) to an A Delete bases 13 15 Reasoning

11

Teacher Page 7.4AB: Six Mutations Original mRNA 1 Met Leu Ser 10 Ala Pro Val 20 Leu

AUGCUUUCGGCACCGGUACUA
5.2A Mutation 1: Change base number 4 (C) to a U 1 10 Met Phe Ser Ala Pro Val

20 Leu 20

AUGCUUUCGGCACCGGUACUA
Mutation 2: Change base number 8 (C) to an A 1 10 Met Leu Stop 20 Val Leu

AUGCUUUCGGCACCGGUACUA
Mutation 3: Change base number 12 (A) to a G 1 10 Met Leu Ser Ala Pro

AUGCUUUCGGCACCGGUACUA

5.2B Mutation 1: Change base number 5 (U) to a G 1 10 Met Arg Ser Ala Pro Val

20 Leu 20 Val Leu 20

AUGCUUUCGGCACCGGUACUA
Mutation 2: Change base number 9 (G) to an A 1 10 Met Leu Ser Ala Pro

AUGCUUUCGGCACCGGUACUA
Mutation 3: Insert a G base between base 12 (A) and base 13 (C) 1 10 Met Leu Ser Ala Ala Gly Thr

AUGCUUUCGGCACCGGUACUA

12

Teacher Page 7.4CD: Six Mutations Original mRNA 1 Met Leu Ser 10 Ala Pro Val 20 Leu

AUGCUUUCGGCACCGGUACUA
5.2C Mutation 1: Change base number 6 (U) to an A 1 10 Met Leu Ser Ala 10 Pro Val

20 Leu 20

AUGCUUUCGGCACCGGUACUA
Mutation 2: Delete base 7 (U) 1

AUGCUUUCGGCACCGGUACUA
Met Leu Arg His Arg Tyr 20 Pro Val Ile

Mutation 3: Change base 19 (C) to an A 1 10 Met Leu Ser Ala

AUGCUUUCGGCACCGGUACUA

5.2D Mutation 1: Change base number 6 (U) to an A 1 10 Met Leu Ser Ala Pro Val

20 Leu 20

AUGCUUUCGGCACCGGUACUA
Mutation 2: Change base number 8 (C) to an A 1 10 Met Leu Stop 20 Val Leu

AUGCUUUCGGCACCGGUACUA
Mutation 3: Delete bases 13 15 1 10 Met Leu Ser Ala

AUGCUUUCGGCAC C GGUACUA

13