ARTICLE IN PRESS

Insect Biochemistry and Molecular Biology

Insect Biochemistry and Molecular Biology 38 (2008) 146154 www.elsevier.com/locate/ibmb

Alterations of the acetylcholinesterase enzyme in the oriental fruit y Bactrocera dorsalis are correlated with resistance to the organophosphate insecticide fenitrothion
Ju-Chun Hsua,b,, Wen-Jer Wub, David S. Haymerc, Hsiu-Ying Liaoa, Hai-Tung Fenga
Taiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture, 11, Guang ming Road, Wufong, 413 Taichung Hsien, Taiwan b Department of Entomology, National Taiwan University, 27, Lane 113, Roosevelt Road, Sec. 4, Taipei 106, Taiwan c Department of Cell and Molecular Biology, University of Hawaii at Manoa, 1960 EastWest Road, Honolulu, HI 96822, USA Received 1 June 2007; received in revised form 6 October 2007; accepted 8 October 2007
a

Abstract Alterations of the structure and activity of the enzyme acetylcholinesterase (AChE) leading to resistance to organophosphate insecticides have been examined in the oriental fruit y, Bactrocera dorsalis (Hendel), an economic pest of great economic importance in the Asia-Pacic region. We used afnity chromatography to purify AChE isoenzymes from heads of insects from lines showing the phenotypes of resistance and sensitivity to insecticide treatments. The AChE enzyme from a strain selected for resistance to the insecticide fenitrothion shows substantially lower catalytic efciency for various substrates and 124-, 373- and 5810-fold less sensitivity to inhibition by paraoxon, eserine and fenitroxon, respectively, compared to that of the fenitrothion susceptible line. Using peptide mass ngerprinting, we also show how specic changes in the structure of the AChE enzymes in these lines relate to the resistant and sensitive alleles of the AChE (ace) gene characterized previously in this species (described in Hsu, J.-C., Haymer, D.S., Wu, W.-J., Feng, H.-T., 2006. Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides. Insect Biochem. Mol. Biol. 36, 396402). Polyclonal antibodies specic to the puried isoenzymes and real-time PCR were also used to show that both the amount of the isoenzyme present and the expression levels of the ace genes were not signicantly different between the R and S lines, indicating that quantitative changes in gene expression were not signicantly contributing to the resistance phenotype. Overall, our results support a direct causal relationship between the mutations previously identied in the ace gene of this species and qualitative alterations of the structure and function of the AChE enzyme as the basis for the resistance phenotype. Our results also provide a basis for further comparisons of insecticide resistance phenomena seen in closely related species, such as Bactrocera oleae, as well as in a wide range of more distantly related insect species. r 2007 Elsevier Ltd. All rights reserved.
Keywords: Fenitrothion; ace gene; Insecticide resistance; Enzyme kinetics; Bactrocera dorsalis

1. Introduction The oriental fruit y (Bactrocera dorsalis (Hendel)) causes serious nancial losses to orchards globally and is the most serious fruit pest of fruit trees in Taiwan.
Corresponding author. Taiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture, 11, Guang ming Road, Wufong, 413 Taichung Hsien, Taiwan. Tel.: +886 4 23302101; fax: +886 4 23314106. E-mail address: juchun@tactri.gov.tw (J.-C. Hsu).

Organophosphate based insecticides have been used to control this pest for many years. However, the development of even subtle resistance has been shown to be capable of causing a loss of effectiveness of such control agents (Hsu and Feng, 2000). For example the organophosphorous insecticide fenitrothion has been used for pest control since 1960 (Nishizawa et al., 1961), but in areas such as Taiwan it has become increasingly limited in effectiveness for control of B. dorsalis (Hsu and Feng, 2002). Similar cases of the development of resistance and subsequent reductions in effectiveness to this and other

0965-1748/$ - see front matter r 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2007.10.002

ARTICLE IN PRESS
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 147

organophosphate based insecticides have been observed in a wide range of other insect species in different localities (Hama, 1983, 1984; Konno and Shishido, 1989; Kotze and Walkbank, 1996; Kozaki et al., 2001). Because of this, improved understanding of the actual or potential mechanisms of resistance can be very important for preventing even greater loss of the tools available for pest control. The enzyme acetylcholinesterase (AChE, EC 3.1.1.7) is known to be the target of many organophosphate and carbamate based insecticides. These insecticides work by promoting phosphorylation or carbamylation type modications of the active site of the AChE enzyme. These modications inhibit AChE activity and block the hydrolysis of acetylcholine (Oppenoorth and Welling, 1979), a step that is normally necessary for the proper regulation of nerve cell activity. In Drosophila melanogaster as well as several other insect species, the development of resistance to these insecticides has been associated with point mutations in the gene (ace) encoding the AChE enzyme (Fournier et al., 1992; Mutero et al., 1994; Vaughan et al., 1997). In a number of species (Zhu and Clark, 1995a, b; Kozaki et al., 2001; Weill et al., 2004), at least some of these point mutations appear to correspond to regions encoding the active site of the enzyme. Included in this latter category is a previous study of B. dorsalis (Hsu et al., 2006) where two of the sites producing missense mutations were shown to be identical to sites that had been altered in a strain of a congeneric species, B. oleae, which also exhibited insecticide resistance (Vontas et al., 2002; Hawkes et al., 2005). In addition to the clear evidence associating DNA changes with the acquisition of resistance, it is also important to develop a better understanding of how these mutations may exert either quantitative or qualitative effects on specic genes and their products. In some species, for example the aphid Myzus persicae, insecticide resistance has been associated with various mechanisms such as the overproduction of detoxifying esterases, qualitative alterations of the AChE enzyme itself and mutations in other genes conferring knockdown resistance (reviewed in Margaritopoulos et al., 2007). It is of interest to know which if any of these phenomena occur in B. dorsalis, especially in light of the work in the congeneric species B. oleae that shows a decreased sensitivity to the inhibitors and a qualitative reduction of the catalytic activity of the AChE enzyme as the basis for resistance in this species (Vontas et al., 2002). To this end we examine here the effects on ace gene expression and AChE enzyme activity due to the previously described mutations in the ace gene of B. dorsalis (Hsu et al., 2006). Overall, our results conrm that the resistance phenotype is associated with qualitative effects on the structure and activity of this enzyme. At least for the cases examined here, quantitative changes in the levels of gene expression can also be ruled out as signicant contributors to this phenotype.

2. Materials and methods 2.1. Fly strains An insecticide-susceptible (S) line of the oriental fruit y, B. dorsalis, was established in our laboratory from ies collected from central Taiwan in 1994. This laboratory colony was reared on an articial diet maintained without any exposure to insecticides. An insecticide resistant (R) line was selected from this line, and susceptibilities (LD50) of the ies to varied doses of fenitrothion and methomyl were assayed using topical application as described in Hsu et al. (2004). 2.2. Chemicals Insecticides and their respective oxons used in this study were analytical grade. Fenitrothion, and paraoxon-ethyl were obtained from Fluka Chemie GmbH (Switzerland). Fenitroxon was obtained from Tokyo Kasei Kogyo Co. (Japan). AChE assay reagents and inhibitors, including acetylthiocholine iodide (ATC), propionylthiocholine iodide (PTC), 5,5-dithiobis-2-nitrobenzoic acid (DTNB), S-butyrylthiocholine iodide (BTC), 1,5-bis(4-allyldimethylammonium phenyl)pentan-3-one dibromide (BW284C51), eserine hemisulfate (eserine), ethopropazine hydrochloride (ethopropazine) were purchased from Sigma Chemical Co. (USA). The ECH Sepharose 4B was purchased from Amersham Pharmacia Biotech (Piscataway, NJ). The chemicals tetraethylammonium iodide (Net4I), procainamide, and N-ethoxycarbonyl-2-ethoxy-1, 2-dihydroquinoline (EEDQ) were purchased from ACROS Organics (USA). The bovine serum albumin (BSA) protein assay standard was purchased from Bio-Rad Laboratories (USA). 2.3. Enzyme purication AChE was puried from the heads of adults by afnity chromatography using procainamide as described in Hsiao et al. (2004). Approximately, 12 g of frozen heads were homogenized in 120 mL of ice-cold phosphate buffer (pH 7.4) containing 0.5% (v/v) triton-X100 (extracted buffer). After centrifugation at 13 000g for 15 min, the supernatant was ltered through two layers of cheesecloth to remove the lipids. The recovered material was then applied to a procainamide-based Sepharose 4B afnity column as described by the manufacturer. A buffer containing 50 mM NaCl (PTS) was used to wash the column until the absorbance at 280 nm fell below 0.01 and the AChE was then eluted with 30 mM Net4I in PTS buffer. The purity of enzyme was analyzed by SDS-PAGE. Fractions containing puried AChE were pooled, dialyzed against PTS buffer to remove the Net4I and concentrated using an Amicon concentrator (model 8050) at 4 1C.

ARTICLE IN PRESS
148 J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154

2.4. AChE enzyme quantitation Immunoassays were conducted to quantify the amount of AChE present in ies from both lines. The indirectELISA sandwich method and anti-AChE polyclonal antibodies were used based on a modication of the method from Yeh and Gonsalves (1984). Two puried extracts (about 1 mg, titer of anti-AChEs (1:10000)) of polyclonal antibodies against AChE from both fenitrothion-susceptible and -resistant B. dorsalis, respectively, were produced in rabbits (Taiwan Protein Co., Ltd). Purication was done from pooled antisera using the Melon Gel IgG spin purication kit (Pierce Biotech., USA) following instructions provided by the manufacturer. The concentration of IgG protein was estimated using readings from a spectrophotometer at optical density at 280 nm (OD280). For both lines, ten heads cut from fresh ies were homogenized in phosphate-buffered saline (PBS) and diluted to 1.2 mg total protein per well to coat 96-well microtiter plates for 1 h at 37 1C. Each sample was assayed using four replicates to minimize intra-experiment variation. The 96-well microtiter plates were used for either direct measurement of AChE activity or for an ELISA assay. After blocking, wells were sequentially incubated with anti-AChE rabbit serum (at concentrations of 0.22 mg for anti-susceptible AChE or 0.28 mg anti-fenitrothion AChE/well), and the alkaline phosphataseconjugated goat anti-rabbit IgG (Jackson Immuno Research; 0.04 mg/well). All incubations were carried out for 1 h at 37 1C with washes between successive steps. The absorbance value was determined in an ELISA reader at 405 nm using a Benchmark microplate reader (Bio-Rad, USA). 2.5. AChE activity assays and enzyme kinetics

was calculated from the molecular mass of puried AChE (116 kDa, the predicted mass) and Vmax. The substrate specicity constant (Kcat/Km) was determined from the Kcat and Km values according to the method of Zhu and Brindley (1992). 2.6. Sensitivity of AChE to inhibition Puried AChE was incubated with eight different concentrations of each of ve inhibitors (ethopropaxine, BW284C51, eserine, paraoxon and fenitroxon) at 37 1C for 5 min before adding substrate to assay the AChE activity (the substrate is ATC (0.50 mM)). Ethopropazine was used in a concentration range of 0.886 to 114 mM, BW284C51 from 4.55 pM to 45.5 mM, eserine from 2.73 pM to 2.27 mM, paraoxon from 145 pM to 11.4 mM and fenitroxon from 40.6 pM to 11.4 mM. In each case, AChE activity was assayed as described. The inhibition concentration (I50) for each inhibitor was determined based on log-concentration vs. log-% inhibition regression analysis. In this study, the concentrations of ve inhibitors were 3.55455 mM for ethopropazine, 4.55 pM45.5 mM for BW284C51, 37.2 pM22.7 nM for eserine, 74.5 nM45.5 mM for paraoxon and 18.6 nM11.4 mM for fenitroxon, respectively. Results are reported as means7standard deviation and the sample size is ve for every inhibitor analysis. The plot of the log of residual activity (AChE) against time was linear for a given inhibitor concentration. The bimolecular rate constant (Ki) was calculated by linear regression as described by Main and Iverson (1966). The concentrations in BW284C51, paraoxon and fenitroxon were 20.8 nM45.5 mM, 0.145 nM11.4 mM and 88.8 nM11.4 mM, respectively, and the other inhibitors were in the same concentration ranges as the inhibition concentration described. 2.7. Peptide mass ngerprinting analysis

AChE activity was determined by the method of Ellman et al. (1961). AChE extracts (before and after purication) buffered in sodium phosphate (pH 7.0) were assayed for activity with ATC (0.50 mM) as a substrate. The change in light absorbance at 410 nm was recorded for 5 min in a Benchmark microplate reader (Bio-Rad) and used to calculate AChE activity as in units of mmol ATC hydrolysed/min/mg. The substrate specicity of puried AChE was assessed using ATC, PTC, and BTC. A total of 11 different substrate concentrations ranging from 40 to 4000 mM for ATC and 161600 mM for PTC and BTC were used (as well as no substrate) to determine the enzyme kinetic parameters of puried enzyme from both the fenitrothionsusceptible (S) and -resistant (R) lines. For each substrate the maximum velocities (Vmax) and the Michaelis constants (Km) were calculated using Hanes/Woolf plots (Java-EMBOSS Software). The ratio Vmax/Km is referred to as efciency of catalysis and the turnover number (Kcat)

Using material from both fenitrothion-susceptible and -resistant lines, AChE was obtained for peptide mass analysis using either gel slices isolated from SDS-PAGE gels, processed by in-gel digestion, or from PBS solutions dialyzed against deioned water where direct digestion with trypsin was carried out. These were analyzed by laser desorption/ionization with matrix assisted, time-ofight spectroscopy (MALDI-TOF) (Applied Biosystems/ Voyager DE Pro) (Proteomic MS Core Laboratory, National Chung Hsing University). Peptide mass values obtained were used to search the NCBInr database (2006.02.16) using Ms-Fit software (http://prospector.ucsf. edu/prospector/4.0.8/html/mst.htm). The mass tolerance was set at 100 ppm, and other parameters were typically set as follows: trypsin up to two miss cleavages; cysteine modication, acrylamide; and considered modications including oxidation of Met and carbamidmethylation of cystein.

ARTICLE IN PRESS
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 149

2.8. Quantitative real-time PCR method Total RNA was extracted from the heads of 15 ies of each line using a microscale total RNA extraction kit (RNeasyR Mini kit, Qiagen Gmbh). After treatment with DNase, one microgram of total RNA was used for the rst strand synthesis of cDNA in 20 ml of total volume using the ThermoScriptTM reverse transcription cDNA synthesis system (Invitrogen) with poly T as the primer, according to the manufacturers instructions. Real-time PCR was used to examine the expression of the ace gene in specimens from both the R and S lines. Primers designed to specically amplify ace gene sequences from cDNA were used (described below). In both lines similar amplications were also carried out with primers designed from conserved ribosomal 18S sequences (18S) as a control, and ratios of ace/18S levels of gene expression were calculated. Real-time PCR amplications were done using an IQ5 machine (Bio-Rad, USA). One microliter of template was used in each reaction of 25 ml total volume (including the SYBR Green I). Primers specic to the ace gene (AY155500) were sense: CGGCAAGTTGAACGAGAG; and antisense: AGAGGAAGCGGATGATGG. Primers specic to the 18S ribosomal gene (AF033944) were sense: ATTTGTGCTTCATACGGGTAG; and antisense: AACAGAGGTCTTATTTCATTATTCC. Quantication references were designed to have similar properties in terms of length and %GC content. An optimized thermal program consisting of one cycle of 95 1C for 3 min, 40 cycles of 95 1C for 10 s, 52 1C for 15 s, and followed by a nal one cycle of 72 1C for 2.5 min was used. Following the qRTPCR, the homogeneity of PCR product was conrmed by the melting curve analysis. The relative amount of target gene against reference gene was calculated according to the 2DCt method (Pfaf, 2001). The assay was repeated six times with total RNA extracted separately for ies from both lines, and three replicates were carried out for each reaction to minimize intraexperiment variation. 2.9. Statistical analysis Using EXCEL software statistical analysis of the AChE kinetics was carried out using two factor ANOVA. For other experiments the two-tailed Students t-test was used. Differences were considered signicant at Po0.05 level. 3. Results 3.1. AChE purication and activity The purity of the AChE isoenzyme was conrmed by SDS-PAGE using the coomassie blue staining method using material obtained from both the fenitrothionsusceptible (S) and -resistant (R) lines. In both cases a

Fig. 1. SDS-PAGE analysis of AChEs puried from ies of the susceptible and fenitrothion-resistant lines. Puried AChEs were mixed with loading dye and DTT reducing agent and heated at 95 1C for 5 min in a dry bath. Treated samples were loaded onto a 10% SDS-PAGE and electrophoresed for 1.5 h at 100 V at room temperature. The protein bands were visualized by coomassie blue staining (kit from Amersham Pharmacia Biotech). Susppuried AChE from susceptible oriental fruit ies; Resistpuried AChE from fenitrothion-resistant ies; marker lanemid-range protein marker (GeneMark, Taiwan).

monomer of 59.7 kDa (estimated molecular weight, MW) was obtained (Fig. 1). The overall purication factors and yields were similar for both lines (about 1500-fold and 20%, respectively) (Table 1). Resistance ratios and cross-resistance ratios were calculated as the ratio of the resistant LD50 to the susceptible LD50 values for fenitrothion (RR) or methomyl (CR) insecticide treatments. 3.2. AChE kinetics Three substrates (ATC, PTC, and BTC) were used to assess the kinetic parameters of the AChE enzyme puried from both the S and R lines (Table 2): (a) The hydrolyzing efciencies (Vmax) for these substrates differed signicantly between two lines (Fsubstrates (2,20) 139.2, Po0.05). The AChE from the R line exhibited hydrolyzing efciency about two times lower (two factor ANOVA, Fline (1,20) 35.6, Po0.05) compared with the AChE puried from the S line for all substrates investigated. (b) The substrate afnities (Km) also differed signicantly between two lines using two factor ANOVA (Fsubstrate (2,20) 75.3, Po0.05 for Km) with the AChE from the R line exhibiting signicantly lower afnities (two factor ANOVA, Fline (1,20) 20.8, Po0.05) for all three of the substrates compared to the AChE puried from the S line. 3.3. Sensitivity of AChE to inhibition AChEs puried from both S and R lines showed similar curves for inhibition by BW284C51, eserine, paraoxon and

ARTICLE IN PRESS
150 J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 Table 1 Purication ratios of acetylcholinesterase for homogenized extracts (crude) and puried by afnity chromatography from fenitrothion-susceptible (S) and -resistant (R) oriental fruit y linesa Lines Step Total activity (mmol/min) 78.375.17 16.470.15 50.471.22 10.271.13 Specic activity (mmol/min/mg) 0.2870.01 4217120 0.1870.01 2667111 Yield (%) Purication factor (fold) Resistance ratios RR S R Crude Puried Crude Puried 100 20.9 100 20.2 1 1504 1 1478 1 416 CR 1 6.1

The resistance ratio was calculated as the value of the resistant LD50/the susceptible LD50 value for fenitrothion (RR) or methomyl (CR) treatment, respectively. The susceptible LD50 values for fenitrothion and methomyl are 22.8 and 43.7 ng/y, respectively. a The results are presented as the means7SD (n 2).

Table 2 Comparison of the kinetic parameters of AChE puried from S and R lines by hydrolysis of three substratesa Substrates ATC PTC BTC Lines S R S R S R Vmax (mmol/min/mg) 158.575.69 69.770.95 131.274.15 70.972.43 79.671.55 45.870.49 Km (mM) 16.574.00 35.578.43 53.4725.2 65.576.21 85.777.27 129.272.76 Vmax/Km (ratio) 9.62 1.96 2.46 1.08 0.93 0.35 Kcat (min1) 18 400 8080 15 200 8220 9230 5310 Kcat/Km (mM1 min1) 1116 228 285 126 108 41

a The results are presented as the means7SD (n 4). The Vmax and Km for these substrates differ signicantly between two lines by two factor ANOVA test (Po0.05) as described in the text (Section 3.2).

fenitroxon although inhibition by ethopropazine required approximately a 100-fold higher concentration (Fig. 2). In all cases the puried AChE from the R line displayed less overall activity compared to that of the AChE puried from the S line. The I50 values in Table 3 show that in the S line, eserine was the most potent inhibitor of puried AChE, followed by fenitroxon, paraoxon, BW284C51, and nally ethopropazine. In the R line eserine was also the most potent inhibitor (followed by fenitroxon), but in this case BW284C51 was a more potent inhibitor than paraoxon. However, ethopropazine was the least effective here also. This table also shows that overall for eserine, fenitroxon and paraoxon, the puried AChE enzyme from the R line was much less sensitive to inhibition compared to the AChE from the S line. Table 3 also shows that the values for inhibition constants (Ki) of AChE in each of the lines ranged from 4.93 103 to 5.09 107 M1 min1. Here again eserine was the most potent inhibitor while ethopropazine was the least. Except for eserine, these inhibitors also showed higher Ki values for the S line compared to the R line. 3.4. Peptide mass ngerprinting Peptide mass ngerprinting was used rst to conrm that the enzymes puried from these B. dorsalis lines were AChEs (Table 4). AChE from the S line is identied as the

normal AChE of this species (AAO06900), and the peptide products from this line are also compared to the AChE from the R line (AAO06932). Next, the residues obtained for the R and S lines were directly compared. Only the amino acid change corresponding to position G488 (peptide corresponding to residues #486506) was found in these experiments despite the fact this experiment was performed several times using both AChE enzyme in solution and from slices of polyacrylamide gels for both lines. 3.5. Quantitation of gene expression As assessed using the t-test, no signicant differences were detected in terms of the quantities of AChE recovered as indicated by the indirect-ELISA assay using antibodies directed against both the susceptible AChE and resistant AChE (Table 5). The real-time PCR analysis also shows that the levels of expression of the ace gene (relative to 18S expression levels) were roughly equivalent in individuals from both the susceptible and resistant lines (Table 6). 4. Discussion The development of resistance to organophosphate based insecticides is a current and growing problem for the management of many insect pest species of agricultural

ARTICLE IN PRESS
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 151

Fig. 2. Effects of ve inhibitors (ethopropaxine, BW284C51, eserine, paraoxon and fenitroxon) on activity of AChE from both fenitrothion-susceptible and -resistant lines at eight concentrations.

Table 3 I50 values and bimolecular rate constants (Ki) for ve inhibitors of enzyme activity for AChE from both S and R lines of B. dorsalis Inhibitor I50 (nM) Susceptible Eserine Fenitroxon Paraoxon BW284C51 Ethopropazine 0.01270.0095 0.04370.037 49.379.08 10407315 195 000721 900 Resistant 4.4870.38 2507121 61207374 9757405 215 000797 200 373 5810 124 0.94 1.10 R/S Ki ( 103 M1 min1) Susceptible 46 00077050 314783.8 26678.33 54.071.31 6.0370.136 Resistant 50 90071880 18378.37 12276.93 50.271.49 4.9770.353 0.90 1.72 2.09 1.08 1.21 S/R

The R/S ratio was calculated as the value of the resistant I50/the susceptible I50. The S/R ratio was calculated as the value of the susceptible Ki/the resistant Ki. Signicant differences from the susceptible colony by Student t-test (Po0.05).

and medical importance, and because of this a wide range of studies have focused on the elucidation of the molecular basis of this resistance. For example, our previous study of insecticide resistance in B. dorsalis (Hsu et al., 2006) showed that ies exhibiting high levels of resistance to the organophosphate insecticide fenitrothion carried three specic mutations in the ace gene of this species (designated bdace2). Indeed mutations of ace genes have been reported to be associated with insecticide resistance for a wide range of dipteran species (Fournier et al., 1992; Mutero et al., 1994; Vaughan et al., 1997; Vontas et al., 2002). For our study in particular it was of interest to note that two of the changes we identied (Hsu et al., 2006) occurred at positions identical to mutations of the ace gene reported in a strain of a congeneric species, B. oleae, which also exhibited insecticide resistance (Vontas et al., 2002). In addition to the association of mutations with the acquisition of insecticide resistance it is important to examine whether such mutations are associated primarily with either quantitative or qualitative effects on the production and/or activity of specic enzymes. In B. oleae, for example, it is clear that the mutations were associated

with reductions of the catalytic efciency of the AChE enzyme on the order of 3540% (Vontas et al., 2002). However, in non-dipteran species such as those in the Hemiptera (Aphididae) at least three distinct mechanisms have been associated with the acquisition of resistance. These include alterations exhibiting both quantitative and qualitative effects on the structure and function of the AChE enzyme and on distinct genes involved in sodium channeling (Margaritopoulos et al., 2007). To investigate this phenomenon in B. dorsalis, here we puried and analyzed the biochemical properties of AChE isoenzymes obtained from both the resistant (R) and susceptible (S) insects analyzed in our previous study (Hsu et al., 2006). We also compared the changes we observed with those reported for B. oleae (Vontas et al., 2002) as well as various other insect species. We rst used peptide mass ngerprinting to link specic alterations in the AChE proteins from the two lines to predictions made from the DNA sequence of the alleles of the ace gene associated with the R and S phenotypes described in Hsu et al. (2006). The alteration at position G488 (found in the R line) was, however, the only one out

ARTICLE IN PRESS
152 Table 4 Peptide mass ngerprint results Residues nos. Measured mass (Da) Calculated mass (Da) Error (ppm) Sequence J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154

AChE from the susceptible line match details: 400407 966.454 408417 1137.59 443455 1584.88 462467 748.433 468485 2021.02 2397.17 486506 507518 1500.73 561570 1135.63 571586 1763.83 588602 1834.86 612620 1258.59 625642 2021.03

966.438 1137.57 1584.81 748.435 2020.99 2397.09 1500.70 1135.62 1763.79 1834.84 1258.57 2020.98

16 15 44 3.6 15 30 18 7.2 22 14 14 24 97 7.9 12 71 23 13 60 11 7 16 7.9 17 13 79 61 15 20

MMETADLR GYDILMGNVR KYLEIMNNIFGK EAIIFR HTSWVGNPGLENQQQIGR AVGDHFFTCPTNEYAQALAER GASVHYYYFTHR MLNAVIEFAK TGNPATDGEEWPNFTK DPVYYVFSTDDKEEK CAFWNEYLR WGSQCELKPSSASSLQQK MSSVYGVIDR LVVQTSSGPVR KPVPAEPWHGVLDATR MMETADLR GYDILMGNVR DEGTYFLLYDFIDYFDKDEATSLPR EAIIFR HTSWVGNPGLENQQQIGR AVSDHFFTCPTNEYAQALAER GASVHYYYFTHR RMLNAVIEFAK TGNPATDGEEWPNFTK KDPVYYVFSTDDKEEK DPVYYVFSTDDKEEK GPLEGR CAFWNEYLR WGSQCELKPSSASSLQQK

AChE from the fenitrothion-resistant line match details: 5059 1142.66 1142.55 6070 1142.66 1142.65 101116 1772.97 1772.94 400407 966.507 966.438 408417 1137.60 1137.57 418442 3033.36 3033.40 462467 748.480 748.435 468485 2021.02 2021.00 486506 2427.12 2427.10 507518 1500.73 1500.70 560570 1307.70 1307.71 571586 1763.82 1763.79 587602 1962.96 1962.93 588502 1834.98 1834.84 606611 628.380 628.341 612620 1258.59 1258.57 625642 2021.02 2020.98
Indicates residue changes noted between the peptides from the two different lines.

Table 5 Quantifying the AChE from the S and R lines by the indirect-ELISA methoda Lines AChE activity (mmol/min/mg) The absorbance value in OD405 (mean7SD, n 6) Anti-susceptible AChE S R 0.26970.071 0.12170.022 0.9770.12 0.8870.12 Anti-resistant AChE 0.8570.23 0.7970.22

Table 6 Real-time PCR results showing levels of expression of the ace and ribosomal 18S genes in the fenitrothion-susceptible (S) and -resistant (R) lines Lines S R Ace (Ct) 24.4970.84 25.4170.76 18S (Ct) 15.1071.20 16.1371.52 Ratioa of ace/18S 0.0017570.00101 0.0017770.000847

Signicant differences from the susceptible colony by Student t-test (Po0.05). a The alkaline phosphatase activities were detected spectrophotometrically at 405 nm, and the absorbance values for this wavelength (OD405) were used to calculate the quantity of AChE.

Ct refers to the threshold cycle. The ratio is used to show the relative quantication of expression of the target gene (ace) in comparison to the reference gene (18S) (Pfaf, 2001). a Ratio 2[Ctace-Ct18S].

of three predicted missense changes in the peptides we could actually identify. The I214 mutation position may not be easily identied by the peptide mass ngerprinting because the MW of trypsin digested peptide fragment including this mutation is on the order of 6340 Da in the S line (6326 Da in the R line). Normally, the abundance of monoisotopic ions above 3000 Da becomes vanishingly low and difcult to resolve (Yergey et al., 1983). The inability

to detect alterations of peptides corresponding to the third mutation may be explained by proximity to the end of the primary translation product. This was also seen in the case in the AChE puried from Drosophila, and here it was speculated that mutations occurring near the end of a gene might place them beyond the C-terminal amino-acid of the mature protein (Mutero and Fournier, 1991) remaining after posttranslational processing. Further investigations may show that similar phenomena may apply to the AChE protein from the oriental fruit y.

ARTICLE IN PRESS
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 153

In terms of activity, we found that the puried AChE enzyme from the R line of B. dorsalis exhibited approximately one half the level of activity compared to the S line. This lower level of activity agreed with our previous ndings obtained from crude preparations of AChE in these same ies (Hsu et al., 2006). This reduction in activity of puried AChE from resistant individuals is also similar to results seen in studies of resistance in the Colorado potato beetle (Zhu and Clark, 1995b). However, in studies of organophosphate-resistance for insects such as the green rice leafhopper (Hama, 1983, 1984) and lesser grain borer (Guedes et al., 1998) no similar reductions were seen. In terms of hydrolyzing efciencies (Vmax), the overall range of values obtained for the puried AChE from both lines were similar to those observed from studies of Drosophila (Gnagey et al., 1987) and other insect species such as the Colorado potato beetle, lesser grain borer, Western corn rootworm and greenbug (Zhu and Clark, 1994; Guedes et al., 1998; Gao et al., 1998; Gao and Zhu, 2001). However, between the S and R lines of B. dorsalis examined here, the puried AChEs had different kinetic characteristics. For the R line the enzyme activity, Vmax/Km ratio, turnover number (Kcat) and substrate specicity constant (Kcat/Km) of AChE for the substrates, ATC, PTC, and BTC were nearly two-fold lower compared to that from the S line (Table 2). This is consistent with the hypothesis that a modication of the enzyme catalytic site is present in the enzyme from the resistant ies. Puried AChE from the two lines examined here also differed in terms of inhibition by various compounds (as measured using I50 values). The R line was insensitive to inhibition even under high concentrations of paraoxon or fenitroxon (105107 M), and was also 1245810-fold more insensitive to inhibition by eserine, paraoxon and fenitroxon, respectively, compared to the S line. This range of effects using different inhibitors is to some extent also consistent with cross resistance to other organophosphate insecticides seen previously in B. dorsalis (Hsu et al., 2004). However, AChE from the R line showed only slight differences in inhibition by BW284C51 or ethopropazine compared to AChE from the S line. The BW284C51 compound is considered to be a very specic inhibitor of AChE (Felder et al., 2002), and it is curious why our results do not show a greater difference in inhibitory effects between the two lines. One possible explanation for this is the fact that although one of the sites affected here (I214V) interacts with the key anionic site residue W121 (in Torpedo californica; position 138 in B. dorsalis) (Harel et al., 2000; Hsu et al., 2006), Felder et al. (2002) showed that in T. californica, BW284C51 binds only weakly to this particular site. Because of the weak binding, any altering of the interactions between the I214V and W121 sites may simply be limited in effect. Finally, using anti-AChE polyclonal antibodies we also showed that there were no quantitative differences in the amount of enzyme present in extracts from the R and S lines. Real-time PCR was also used to measure the levels of

RNA expression of the different alleles of the ace gene (relative to the 18S gene), and here again no signicant differences were detected between the two lines. Overall, these ndings strongly indicate that the qualitative alteration of the structure and function of the AChE enzyme appears to be the major cause for the observed resistance of B. dorsalis to fenitrothion. No evidence of quantitative effects on expression of the ace gene or the amount of enzyme produced between the R and S lines that would explain the phenotypes observed was obtained here. The conclusion that the resistance phenomenon observed in B. dorsalis results from qualitative effects on the AChE enzyme is entirely consistent with the results seen for B. oleae (Vontas et al., 2002). For both of these species, point mutations at two identical positions in the ace gene producing predicted amino acid substitutions in the AChE enzyme were detected, and in both cases signicant reductions in the catalytic efciency of the enzyme and decreased sensitivity to inhibition were observed in association with resistance. As described in the paper by Vontas et al. (2002) one of these alterations, specically the I214V mutation, appears to be located within the active site of enzyme, and this certainly would be expected to have a dramatic impact on enzyme activity for both species. Alteration of this site may also result in decreased deacetylation activity, and this could affect the sensitivity of the enzyme to various carbamate based insecticides (Harel et al., 2000; Villatte et al., 2000; Shi et al., 2004). In addition to these qualitative effects, we also showed that at least for the B. dorsalis lines analyzed here, these mutations did not appear to be associated with any quantitative alterations in the level of gene expression. It remains to be seen whether these kinds of effects on gene expression or alterations of distinct genes, such as that seen in the Aphididae (Margaritopoulos et al., 2007), apply to the case of resistance phenomena in these or other fruit y species. Acknowledgments The authors wish to acknowledge the helpful comments and corrections on an earlier version of this manuscript made by Dr. J.G. Vontas and the suggestions for signicant improvements made by two anonymous reviewers. We also wish to thank Y.-C. Chen for assistance with the bioassays and G.-S. Lin for his assistance with the real-time PCR assay. We also appreciate Dr. C.-C. Lo for access to the real-time PCR equipment. This research was supported by the Council of Agriculture, Executive Yuan, and National Science Council (NSC 95-2313-B-001), Taiwan. References
Ellman, G.L., Courtney, K.D., Andres Jr., V., Featherstone, R.M., 1961. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7, 8896.

ARTICLE IN PRESS
154 J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 nesterases by di-isopropyl phosphorouoridate. Biochem. J. 100, 525531. Margaritopoulos, J.T., Skouras, P.J., Nikolaidou, P., Manolikaki, J., Maritsa, K., Tsamandani, K., Kanavaki, O.M., Bacandritsos, N., Zarpas, K.D., Tsitsipis, J.A., 2007. Insecticide resistance status of Myzus persicae (Hemiptera: Aphididae) populations from peach and tobacco in mainland Greece. Pest Manage. Sci. 63, 821829. Mutero, A., Fournier, D., 1991. Drosophila acetylcholinesterase structure. In: Massouile, J., Bacou, F., Bacou, E., Chatonnet, A., Doctor, B.P., Quinn, D.M. (Eds.), Cholinesterases: Structure, Function, Mechanism, Genetics, and Cell Biology. American Chemical Society Publishers, Washington, pp. 141145. Mutero, A., Pralavorio, M., Bride, J.M., Fournier, D., 1994. Resistanceassociated point mutations in insecticide-insensitive acetylcholinesterase. Proc. Natl. Acad. Sci. USA 91, 59225926. Nishizawa, Y., Fujii, K., Kadota, T., Miyamoto, J., Sakamoto, H., 1961. Studies on organophosphorus insecticides part VII. Chemical and biological properties of new low toxic organophosphorus insecticide, O, O-dimiethyl-O-(3-methyl-4-nitrophenyl) phosphorothioate. Agric. Biol. Chem. 25, 605610. Oppenoorth, F.J., Welling, W., 1979. Biochemistry and physiology of resistance. In: Wilkinson, C.F. (Ed.), Insecticide Biochemistry and Physiology, second ed. Plenum Press, New York, pp. 507551. Pfaf, M.W., 2001. A new mathematical model for relative quantication in real-time RT-PCR. Nucleic Acids Res. 29, e45. Shi, M.A., Lougarre, A., Alies, C., Fremaux, I., Tang, Z.H., Stojan, J., Fournier, D., 2004. Acetylcholinesterase alterations reveal the tness cost of mutations conferring insecticide resistance. BMC Evol. Biol. 4, 5. Vaughan, A., Rocheleau, T., Ffrench-Constant, R., 1997. Site-directed mutagenesis of an acetylcholinesterase gene from the yellow fever mosquito Aedes aegypti confers insecticide insensitivity. Exp. Parasitol. 87, 237244. Villatte, F., Ziliani, P., Marcel, V., Menozzi, P., Fournier, D., 2000. A high number of mutations in insect acetylcholinesterase may provide insecticide resistance. Pestic. Biochem. Physiol. 67, 95102. Vontas, J.G., Hejazi, M.J., Hawkes, N.J., Cosmidis, N., Loukas, M., Hemingway, J., 2002. Resistance-associated point mutations of organophosphate insensitive acetylcholinesterase, in the olive fruit y Bactrocera oleae. Insect Mol. Biol. 11, 329336. Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A., Marguine, M., Raymond, M., 2004. The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Mol. Biol. 13, 17. Yeh, S.D., Gonsalves, D., 1984. Purication and immunological analyses of cylindrical-inclusion protein induced by papaya ringspot virus and watermelon mosaic virus 1. Phytopathology 74, 12731278. Yergey, J., Heller, D., Hansen, G., Cotter, R.J., Fenselau, C., 1983. Isotopic distributions in mass spectra of large molecules. Anal. Chem. 55, 353356. Zhu, K.Y., Brindley, W.A., 1992. Catalytic and inhibitory properties of a major molecular form of acetylcholinesterase isolated from Lygus hesperus Knight (Hemiptera: Miridae). Comp. Biochem. Physiol. 103B, 147151. Zhu, K.Y., Clark, J.M., 1994. Purication and characterization of acetylcholinesterase from the Colorado potato beetle, Leptinotarsa decemlineata (Say). Insect Biochem. Mol. Biol. 24, 453461. Zhu, K.Y., Clark, J.M., 1995a. Cloning and sequencing of a cDNA encoding acetylcholinesterase in Colorado potato beetle, Leptinotarsa decemlineata (Say). Insect Biochem. Mol. Biol. 25, 11291138. Zhu, K.Y., Clark, J.M., 1995b. Comparisons of kinetic properties of acetylcholinesterase puried from azinphosmethyl-susceptible and resistant strains of Colorado potato beetle. Pestic. Biochem. Physiol. 51, 5767. Felder, C.E., Harel, M., Silman, I., Sussman, J.L., 2002. Structure of a complex of the potent and specic inhibitor BW284C51 with Torpedo californica acetylcholinesterase. Acta Cryst. D 58, 17651771. Fournier, D., Bride, J.M., Hoffman, F., Karch, F., 1992. Acetylcholinesterase: two types of modications confer resistance to insecticides. J. Biol. Chem. 267, 1427014274. Gao, J.R., Zhu, K.Y., 2001. An acetylcholinesterase puried from the greenbug (Schizaphis graminum) with some unique enzymological and pharmacological characteristics. Insect Biochem. Mol. Biol. 31, 10951104. Gao, J.R., Rao, J.V., Wilde, G.E., Zhu, K.Y., 1998. Purication and kinetic analysis of acetylcholinesterase from Western corn rootworm, Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae). Arch. Insect Biochem. Physiol. 39, 118125. Gnagey, A.L., Forte, M., Rosenberry, T.L., 1987. Isolation and characterization of acetylcholinesterase from Drosophila. J. Biol. Chem. 262, 1329013298. Guedes, R.N., Zhu, K.Y., Kambhampati, S., Dover, B.A., 1998. Characterization of acetylcholinesterase puried from the lesser grain borer, Rhyzopertha dominica (Coleoptera: Bostrichidae). Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 119, 205210. Hama, H., 1983. Resistance to insecticides due to reduced sensitivity of acetylcholinesterase. In: Georghiou, P.G., Saito, T. (Eds.), Pest Resistance to Pesticides. Plenum Press, New York, pp. 146. Hama, H., 1984. Mechanism of fenitrothion-resistance and diazinonresistance in the green rice leafhopper, Nephotettix cincticeps Uhler (Hemiptera, Deltocephalidae)the role of aliesterase. Jpn. J. Appl. Entomol. Zool. 28, 143149. Harel, M., Kryger, G., Rosenberry, T.L., Mallender, W.D., Lewis, T., Fletcher, R.J., Guss, J.M., Silman, I., Sussman, J.L., 2000. Threedimensional structures of Drosophila melanogaster acetylcholinesterase and of its complexes with two potent inhibitors. Prot. Sci. 9, 10631072. Hawkes, N.J., Janes, R.W., Hemingway, J., Vontas, J., 2005. Detection of resistance-associated point mutations of organophosphate-insensitive acetylcholinesterase in the olive fruit y, Bactrocera oleae (Gmelin). Pestic. Biochem. Physiol. 81, 154163. Hsiao, Y.-M., Lai, J.-Y., Liao, H.-Y., Feng, H.-T., 2004. Purication and characterization of acetylcholinesterase from oriental fruit y (Bactrocera dorsalis (Hendel)) (Diptera: Tephritidae). J. Agric. Food Chem. 52, 53405346. Hsu, J.-C., Feng, H.-T., 2000. Insecticide susceptibility of the oriental fruit y (Bactrocera dorsalis (Hendel)) (Diptera: Tephritidae) in Taiwan. Chinese J. Entomol. 20, 109118. Hsu, J.-C., Feng, H.-T., 2002. Susceptibility of melon y (Bactrocera cucurbitae) and oriental fruit y (B. dorsalis) to insecticides in Taiwan. Plant Prot. Bull. 44, 303314 (in Chinese, with English abstract). Hsu, J.-C., Feng, H.-T., Wu, W.-J., 2004. Resistance and synergistic effects of insecticides in Bactrocera dorsalis (Diptera: Tephritidae) in Taiwan. J. Econ. Entomol. 97, 16821688. Hsu, J.-C., Haymer, D.S., Wu, W.-J., Feng, H.-T., 2006. Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides. Insect Biochem. Mol. Biol. 36, 396402. Konno, Y., Shishido, T., 1989. Binding-protein, a factor of fenitrooxon detoxication in OP-resistant rice stem borers. J. Pestic. Sci. 14, 359362. Kotze, A.C., Walkbank, B.E., 1996. Esterase and monooxygenase activities in organophosphate-resistant strains of Oryzaephilus surinamensts (Coleoptera, Cucujidae). J. Econ. Entomol. 89, 571576. Kozaki, T., Shono, T., Tomita, T., Kono, Y., 2001. Fenitroxon insensitive acetylcholinesterases of the housey, Musca domestica associated with point mutations. Insect Biochem. Mol. Biol. 31, 991997. Main, A.R., Iverson, F., 1966. Measurement of the afnity and phosphorylation constants governing irreversible inhibition of choli-