Zilpaterol hydrochloride alters abundance of -adrenergic receptors in bovine muscle cells but has little effect on de novo fatty

acid biosynthesis in bovine subcutaneous adipose tissue explants E. K. Miller, K. Y. Chung, J. P. Hutcheson, D. A. Yates, S. B. Smith and B. J. Johnson J ANIM SCI 2012, 90:1317-1327. doi: 10.2527/jas.2011-4589 originally published online November 11, 2011

The online version of this article, along with updated information and services, is located on the World Wide Web at: http://www.journalofanimalscience.org/content/90/4/1317

www.asas.org

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

Zilpaterol hydrochloride alters abundance of -adrenergic receptors in bovine muscle cells but has little effect on de novo fatty acid biosynthesis in bovine subcutaneous adipose tissue explants
E. K. Miller,* K. Y. Chung, J. P. Hutcheson, D. A. Yates, S. B. Smith, and B. J. Johnson1
*Department of Animal Sciences and Industry, Kansas State University, Manhattan 66506; Department of Animal and Food Sciences, Texas Tech University, Lubbock 79409; Intervet Schering Plough Animal Health, De Soto, KS 66018; and Department of Animal Science, Texas A&M University, College Station 77843

ABSTRACT: We predicted that zilpaterol hydrochloride (ZH), a -adrenergic receptor (AR) agonist, would depress mRNA and protein abundance of -AR in bovine satellite cells. We also predicted that ZH would decrease total lipid synthesis in bovine adipose tissue. Bovine satellite cells isolated from the semimembranosus muscle were plated on tissue culture plates coated with reduced growth factor matrigel or collagen. Real-time quantitative PCR was used to measure specific gene expression after 48 h of ZH exposure in proliferating satellite cells and fused myoblasts. There was no effect of ZH dose on [3H]thymidine incorporation into DNA in proliferating myoblasts. Zilpaterol hydrochloride at 1 M decreased (P < 0.05) 1-AR mRNA, and 0.01 and 1 M ZH decreased (P < 0.05) 2-AR and 3-AR mRNA in myoblasts. The expression of IGF-I mRNA tended to increase (P = 0.07) with 1 M ZH. There was no effect (P > 0.10) of ZH on the -AR or IGF-I gene expression in fused myotube cultures at 192 h or on

fusion percentage. The 2-AR antagonist ICI-118, 551 at 0.1 M attenuated (P < 0.05) the effect of 0.1 M ZH to reduce expression of 1- and 2-AR mRNA. The combination of 0.01 M ZH and 0.1 M ICI-118, 551 caused an increase (P < 0.05) in 1-AR gene expression. There was no effect (P > 0.10) of ICI-118, 551 or ZH on 3-AR or IGF-I. Western blot analysis revealed that the protein content of 2-AR in ZH-treated myotube cultures decreased (P < 0.05) relative to control. Total lipid synthesis from acetate was increased by ZH in bovine subcutaneous adipose tissue explants in the absence of theophylline but was decreased by ZH when theophylline was included in the incubation medium. These data indicate that ZH alters mRNA and protein concentrations of -AR in satellite cell cultures, which in turn could affect responsiveness of cells to prolonged ZH exposure in vivo. Similar to other -adrenergic agonists, ZH had only modest effects on lipid metabolism in adipose tissue explants.

Key words: adipose tissue, beta-adrenergic receptor, bovine, satellite cell, zilpaterol hydrochloride 2012 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2012. 90:13171327 http://dx.doi.org/10.2527/jas.2011-4589

INTRODUCTION
Zilpaterol hydrochloride (ZH) is an orally active -adrenergic receptor (AR) agonist approved for use in feedlot cattle in the United States (Delmore et al., 2010). Administration of ZH to feedlot steers and heifers the last 20 to 40 d on feed increased ADG, ribeye area, and dressing percentage and improved feed efficiency and carcass yield grade (Beckett et al., 2009;

1 Corresponding author: bradley.johnson@ttu.edu Received August 12, 2011. Accepted November 4, 2011.

Montgomery et al., 2009; Baxa et al., 2010). Zilpaterol hydrochloride elicits a response through binding to -AR, which are membrane-bound receptors located on most mammalian cells (Strosberg et al., 1993; Mills and Mersmann, 1995). The activation of protein kinase A, as elicited by -adrenergic agonist (-AA), is responsible for changes in protein synthesis and degradation, particularly in skeletal muscle (Mersmann, 1998), and ZH putatively works to increase muscle growth via binding to the -AR. The treatment of ZH induced fast glycolytic fiber types such as myosin heavy chain IIX rather than slow oxidative fiber types such as myosin heavy chain I (Baxa et al., 2010). There is limited information on the direct effects of ZH on bovine skeletal muscle and adipose tissue.

1317
Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

1318

Miller et al.

Therefore, one purpose of these experiments was to investigate the direct effects of ZH on bovine satellite cell proliferation and the expression of mRNA for the -AR subtypes and IGF-I in bovine satellite cell cultures. Marked reductions in subcutaneous (s.c.) fat thickness were noted in sheep fed cimaterol or clenbuterol (Baker et al., 1984; Thornton et al., 1985; Hamby et al., 1986). However, clenbuterol treatment elicited a small increase in adipocyte size in lambs (Coleman et al., 1988). Ricks et al. (1984) first demonstrated a significant reduction in carcass fat from 24 finishing steers. Subsequently, Miller et al. (1988) reported a 40% reduction in s.c. fat thickness and KPH in heifers fed clenbuterol. However, we reported no change in amount of s.c. fat or s.c. fat thickness in young, clenbuterol-fed Angus steers (Schiavetta et al., 1990). Therefore, this study also documented shortterm effects of ZH on lipid synthesis in bovine adipose tissue explants to establish whether ZH depresses adipogenesis via direct effects on adipose tissue metabolism.

[3H]Thymidine Incorporation
Satellite cells were plated on 2-cm2 culture plates for the measurement of thymidine incorporation into DNA. Culture plates were precoated with reduced growth factor basement membrane matrigel diluted 1:10 (vol/vol) with DMEM. Cells were plated in DMEM containing 10% FBS and incubated at 37C, 95% CO2 in a watersaturated environment. Plating density for cells was empirically established so that all cultures were 25 to 50% confluent after the incubation period. This ensured that cell proliferation rate was not affected by contact inhibition. Cultures were rinsed 3 times with serumfree DMEM 24 h after plating the bovine satellite cells in 10% FBS/DMEM, and different concentrations of ZH (0, 0.0001, 0.001, 0.01, 0.1, 1.0, and 10 M; Merck Animal Health, Whitehouse Station, NJ) were added in 10% FBS/DMEM. At 72 h, cultures were rinsed 3 times with serum-free DMEM and 1 Ci/mL of [3H] thymidine (NEN Life Science, Boston, MA) was added to each well. Cells with [3H]thymidine were incubated at 37C, 5% CO2 in a water-saturated environment for 3 h. After incubation, satellite cells were rinsed 3 times with cold serum-free DMEM to remove free [3H]thymidine. Cold 5% trichloroacetic acid (Sigma, St. Louis, MO) was added to every well and incubated overnight at 4C. The next day, cells were rinsed 2 times with cold trichloroacetic acid to remove any remaining unincorporated [3H]thymidine. The precipitated cell material was dissolved in 0.5 mL of 0.5 M sodium hydroxide (NaOH; Sigma) in a rocking incubator for 30 min at 37C. The NaOH suspensions were transferred quantitatively into scintillation vials containing 10 mL of scintillation cocktail (Fisher Scientific, Hanover Park, IL). The samples were allowed to stand for a few hours in low light to reduce chemiluminescence before being counted in a scintillation counter. All treatments were measured in triplicate, with 7 total assays included in the final analysis.

MATERIALS AND METHODS

All experimental procedures with animals were approved by the Kansas State University and the Texas A&M University Institutional Animal Care and Use committees.

Bovine Satellite Cell Isolation

Satellite cell isolation was conducted as described previously (Johnson et al., 1998). Cattle were euthanized by captive bolt stunning followed by exsanguination following standard industry procedures. Using sterile techniques, approximately 500 g was dissected from the semimembranosus muscle and transported to the cell culture laboratory at Kansas State University. Subsequent procedures were conducted in a sterile field under a tissue culture hood. After removal of connective tissue the muscle was passed through a sterile meat grinder. The ground muscle was incubated with 0.1% pronase (CalBiochem, La Jolla, CA) in Earls balanced salt solution for 1 h at 37C with frequent mixing. After incubation, the mixture was centrifuged at 1,500 g for 4 min at room temperature, the pellet was suspended in PBS (140 mM NaCl, 1 mM KH2PO4, 3 mM KCl, 8 mM Na2HPO4), and the suspension was centrifuged at 500 g for 10 min. The supernatant fraction was centrifuged at 1,500 g for 10 min to pellet the mononucleated cells. The PBS wash and differential centrifugation were repeated 2 more times. The resulting mononucleated cell preparation was suspended in 4C Dulbeccos modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 10% (vol/vol) dimethylsulfoxide and frozen. Cells from 7 animals were stored frozen in liquid nitrogen.

Satellite Cell Differentiation

Satellite cells were plated as described previously on 9.62-cm2 collagen-coated culture plates for differentiation studies. At 48 h, cultures were rinsed 3 times with serum-free DMEM and 3% swine serum/DMEM was added. At 96 h, cells were rinsed 3 times with serumfree DMEM and 3% horse serum (HS)/BSA-linoleic acid (1.5 g/mL)/DMEM fusion media was added. Zilpaterol hydrochloride (0, 0.0001, 0.001, 0.01, 0.1, and 1 M) was added to the cultures at 144 h. After approximately 216 h in culture, cells fused into multinucleated myotubes and were stained using Hoechst 33342 stain.

RNA Isolation on Proliferating Myoblasts

Satellite cells were plated in 10% FBS/DMEM as described previously in 9.62-cm2 tissue culture plates.

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

Zilpaterol and bovine cell cultures

1319

After 48 h, cultures were 25 to 50% confluent and were rinsed 3 times with serum-free DMEM and ZH (0, 0.0001, 0.001, 0.01, and 1 M) was added to the cultures in 10% FBS/DMEM. At 96 h, total RNA was isolated using the Absolutely RNA Microprep Kit (Stratagene, La Jolla, CA). The concentration of RNA was determined by absorbance at 260 nm. One microgram of total RNA was reverse transcribed to produce first-strand cDNA using TaqMan Reverse Transcription Reagents, MultiScribe Reverse Transcriptase (Applied Biosystems, Foster City, CA). Random hexamers were used as primers in cDNA synthesis. In addition, satellite cells were plated as described previously to assess the effects of ZH alone or in combination with a specific 2-AR antagonist, ICI-118, 551 (Sigma). Treatments consisted of the following: 1) control, 2) 0.01 M ZH, 3) 0.1 M ICI, 4) 0.01 M ZH + 0.1 M ICI, and 5) 0.01 M ZH + 0.01 M ICI. The concentration of inhibitor chosen to use in combination with ZH was similar to that in previous experiments we conducted in our laboratory with comparable experiments in which receptor antagonists were used to inhibit the effect of its agonist (Sissom et al., 2006). Culture conditions and RNA isolation were as described previously.

Real-Time Quantitative PCR

Real-time quantitative-PCR was used to measure the quantity of 1-AR, 2-AR, and 3-AR and IGF-I gene expression relative to the quantity of 18S rRNA in total RNA isolated from bovine satellite cells treated with ZH. Measurement of the relative quantity of cDNA was performed using TaqMan Universal PCR Master Mix (Applied Biosystems), 900 nM of the appropriate forward and reverse primers, 200 nM of appropriate TaqMan detection probe, and 1 L of the cDNA mixture. The bovine-specific 1-AR, 2-AR, and 3-AR, IGF-I forward and reverse primers, and TaqMan detection probes (Table 1) were designed using published GenBank sequences. Commercially available eukaryotic 18S rRNA primers and probes were used as an endogenous control (Applied Biosystems; GenBank accession no. X03205). The ABI Prism 7000 detection system (Applied Biosystems) was used to perform the assay using the thermal cycling variables recommended by the manufacturer (50 cycles of 15 s at 95C and 1 min at 60C). The 18S rRNA endogenous control was used to normalize the expression of 1-AR, 2-AR, and 3-AR and IGF-I.

RNA Isolation from Myotubes

Bovine satellite cells were plated in 10% FBS/ DMEM as described previously on 9.62-cm2 tissue culture plates. After 48 h, cultures were rinsed 3 times with serum-free DMEM and 3% swine serum/DMEM was added. After a 96-h incubation, cells were rinsed 3 times with DMEM, and 3% HS/BSA-linoleic acid (1.5 g/mL)/DMEM was added. At 120 h, ZH (0, 0.0001, 0.001, 0.01, and 1 M) in 3% HS/BSA-linoleic acid (1.5 g/mL)/DMEM was added. At 168 h, total RNA was isolated using the Absolutely RNA Microprep Kit (Stratagene). The concentration of RNA and cDNA synthesis was measured as described previously.

Preparation of Protein Extracts

Total protein was isolated using the mammalian protein extraction reagent (Pierce Biotechnology, Rockford, IL). Bovine satellite cells were plated as described previously on 9.62-cm2 collagen-coated plates. For myoblast cultures, after a 144-h incubation, cells were rinsed 3 times with serum-free DMEM and 10% FBS/DMEM was added. For myotube cultures, after 144 h of incubation, cells were rinsed 3 times with serum-free DMEM and 3% HS/DMEM was added with ZH (0, 0.001, 0.01, 0.1, 1, and 10 M). At 168 h, for myotubes, cells were rinsed with warm PBS and extraction reagent (350 L/ well) was added. The cultures were gently shaken for 5 min to ensure complete cell lysis and then centrifuged

Table 1. Sequences for -1, -2, and -3 adrenergic receptors and IGF-I specific PCR primers and TaqMan probes (Applied Biosystems, Foster City, CA)
Item -1 adrenergic receptor (accession No. AF188187) Forward Reverse TaqMan probe -2 adrenergic receptor (accession No. NM_174231) Forward Reverse TaqMan probe -3 adrenergic receptor (accession No. XF86961) Forward Reverse TaqMan probe IGF-1 (accession No. X15726) Forward Reverse TaqMan probe Sequence GTGGGACCGCTGGGAGTAT TGACACACAGGGTCTCAATGC 6FAM-CTCCTTCTTCTGCGAGCTCTGGACCTC-TAMRA CAGCTCCAGAAGATCGACAAATC CTGCTCCACTTGACTGACGTTT 6FAM-AGGGCCGCTTCCATGCCC-TAMRA AGGCAACCTGCTGGTAATCG GTCACGAACACGTTGGTCATG 6FAM-CCCGGACGCCGAGACTCCAG-TAMRA TGTGATTTCTTGAAGCAGGTGAA AGCACAGGGCCAGATAGAAGAG 6FAM-TGCCCATCACATCCTCCTCGCA-TAMRA

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

1320

Miller et al.

for 5 min at 14,000 g. The supernatant was collected and protein concentration was determined using a ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). Average protein concentration collected was 8 mg/mL.

scintillation cocktail, and radioactivity was counted with a scintillation counter.

Statistical Analysis
Data were analyzed as a completely randomized design using PROC MIXED (SAS Inst. Inc., Cary, NC). The difference between control and treatment was evaluated using the least significance difference procedure of SAS.

Western Blot Analysis

Protein samples were denatured using equal volume of SDS--mercaptoethanol and boiled for 2 min. Total protein (30 g) was then separated by gel electrophoresis using Novex 1020% Tris-glycine gels (Invitrogen, Carlsbad, CA). Gels were run for 100 min at 125 V and 130 mA. The protein was then transferred onto a polyvinylidene fluoride membrane (Bio-Rad, Hercules, CA). The polyvinylidene fluoride membranes were blocked using XCell SureLock Mini-Cell (Invitrogen) for 120 min at 4C. The primary antibody against 2AR (ab40834, Abcam Inc., Cambridge, MA; Steenhuis et al., 2011) and GAPDH (ab9484, Abcam Inc.) in blocking buffer was added to the membrane and incubated overnight at 4C. After overnight incubation, the membrane was washed 3 times with PBS-Tween 20. The secondary antibody for the 2-AR primary antibody (ab6885; Abcam Inc., Cambridge, MA) and for the glyceraldehyde 3-phosphate dehydrogenase primary antibody (ab6789; Abcam Inc.) were added to the membrane and incubated for 2 h. Blots were washed 3 times with PBS-Tween 20 and exposed to X-ray film (Carestream Health, Rochester, NY) for detection. The peak heights of 2-AR and glyceraldehyde 3-phosphate dehydrogenase bands were quantified using a Bio-Rad Imaging System (Bio-Rad).

RESULTS AND DISCUSSION Effect of ZH on Cell Proliferation, Differentiation, and mRNA Expression of the -AR, and IGF-I mRNA in Bovine Satellite Cells
Satellite cells are mononucleated cells that are important in postnatal skeletal muscle growth (Mauro, 1961; Moss and Leblond, 1971). Because of the postmitotic nature of the muscle fiber, the fusion of satellite cells with muscle fibers is necessary to support postnatal muscle growth. These cells are the external source of DNA required for the muscle fiber to sustain muscle hypertrophy, and this DNA accumulation is highly correlated to muscle growth rate (Trenkle et al., 1978). Because of their role in postnatal muscle growth, satellite cells are useful tools in investigating the mode of action of different muscle growth-promoting agents, such as -AA. There was no effect of ZH on bovine satellite cell rate of proliferation as measured by [3H]thymidine incorporation (Figure 1). Additionally, ZH did not alter the extent of differentiation of bovine satellite cells as assessed by percentage fusion (data not shown). OConnor et al. (1991b) reported a decrease in DNA concentration in skeletal muscle of ram lambs fed cimaterol. The hind limb muscle DNA concentration was reduced by 42% during a 3-wk of administration of cimaterol and remained 25% less after 6 wk of treatment. The total weight and protein content of the muscles from the hind limb of the lambs was increased by 30% during the 3-wk administration of cimaterol, suggesting that an increase in satellite cell proliferation was not necessary to support the -agonist induced muscle hypertrophy. Rehfeldt et al. (1997) observed no alteration in the DNA content of skeletal muscles of broiler chicks administered clenbuterol for 3 wk. Similarly, cull beef cows administered ractopamine for 35 d before slaughter showed no change in satellite cell numbers and muscle fiber associated nuclei (Gonzalez et al., 2007). In contrast to our data, Grant et al. (1990) observed an increase in cell proliferation in muscle satellite cells isolated from chick breast muscle with ractopamine treatment; however, there was no effect on the fusion of those cells into the muscle fiber.

Bovine Adipose Tissue Explant System

Two experiments were conducted to establish the effects of ZH on de novo lipid synthesis. Subcutaneous adipose tissue from over the scapula was obtained at slaughter from finished steers that were being processed at the Texas A&M University Rosenthal Meat Science and Technology Center. Samples were obtained within 20 min of exsanguination. Adipose tissue samples (50 to 100 mg) were transferred to 25-mL flasks containing 5 mM glucose, 5 mM acetate, 10 mM HEPES buffer, and 1 Ci [1-14C]acetate in Krebs-Henseleit buffer flasks (May et al., 1994) and 0, 1, 10, 100, or 1,000 M ZH (n = 3 steers; trial 1) or 0, 1, 10, or 1,000 M ZH (n = 3 steers; trial 2). Flasks in trial 2 also contained 500 M theophylline to inhibit phosphodiesterase activity. Vials were gassed for 1 min with 95% O2:5% CO2 and incubated for 2 h in a shaking water bath at 37C. At the end of the incubation period, reactions were terminated by addition of 1 mL of 2 N H2SO4. The neutral lipids in the adipose tissues were extracted by the chloroform:methanol procedure (May et al., 1994), evaporated to dryness, and resuspended in 10 mL of

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

Zilpaterol and bovine cell cultures

1321

Figure 1. Effect of zilpaterol (Merck Animal Health, Whitehouse Station, NJ) on [3H]thymidine incorporation (n = 7). Bovine satellite cells were plated in 10% fetal bovine serum/Dulbeccos modified Eagle medium. Zilpaterol was added at 48 h, and [3H]thymidine was added at 96 h. Bars represented as percentage difference from control SEM. All data points in individual assays were the average values obtained from 3 wells on each culture dish. There was no effect of zilpaterol on [3H]thymidine incorporation.

The concentrations of ractopamine used in experiments that resulted in increased cell proliferation were pharmacological doses compared with the lesser doses used in the current study. Shappell et al. (2000) observed a 30% increase in cell number and DNA concentration in C2C12 cells treated with a high dose (10 M) of ractopamine. This may have been due to the increased amount of ractopamine used or the source of the cells used because there was no effect of ractopamine in the cells utilized after later passages. The 2agonist clenbuterol was reported to stimulate fusion of neonatal muscle cultures derived from rat muscle (McMillan et al., 1992). In those cultures, both fractional and absolute rates of protein synthesis were increased within 24 h of treatment with clenbuterol. In contrast, the same authors reported no effects of clenbuterol on satellite cells isolated from mature rats, nor any effects on L6 myoblast or myotube cultures. There is some variability in the data reported with regard to -agonists and skeletal muscle cell proliferation and differentiation in vitro; however, the majority of data suggest no alteration in DNA content of muscles from animals administered a -agonist in vivo. The amounts of ZH used in this study spanned from physiological to pharmacological and there were no differences in rate of proliferation as measured by [3H]thymidine incorporation. Therefore, the increased muscle growth reported in the majority of studies in cattle and the fact that no effect was found on skeletal muscle DNA content support the theory that the increased muscle hypertrophy reported with -agonists is supported by other processes (Miller et al., 1988; Schiavetta et al., 1990; Smith et al., 1995), and an alteration of the DNA content may not be necessary. Changes in the mRNA abundance of the -AR in skeletal muscle may be an important method for the enhanced muscle growth reported with -agonists. Zil-

paterol hydrochloride addition (1 M) to proliferating myoblasts resulted in a decrease (P = 0.07) in 1-AR mRNA (Figure 2A). Similarly, ZH (0.01 and 1 M) decreased 2-AR (P < 0.05) and 3-AR mRNA (0.01 M, P < 0.01; 1 M, P = 0.06; Figures 2B and 2C). The reduction in mRNA of the -AR is similar to that in other studies demonstrating alterations in density of receptor number with -agonist treatment. Administration of clenbuterol to male rats for 10 d resulted in a 35% reduction in 2-AR density in skeletal muscle (Huang et al., 2000). This reduction in receptor density was also observed in lung tissue of the rats. Walker et al. (2007) observed reductions in the mRNA expression of both 1-AR and 2-AR mRNA in skeletal muscle from Holstein steers administered ractopamine. Additionally, in pigs administered ractopamine, the number of 2-AR in adipose tissue was decreased at 1, 8, and 24 d after treatment, whereas there was no effect of ractopamine on receptor number in skeletal muscle (Spurlock et al., 1994). In contrast, Winterholler et al. (2007) observed a tendency for increased 2-AR mRNA in skeletal muscle isolated from yearling steers administered ractopamine for 28 d before slaughter. Additionally, we previously observed a tendency for ractopamine administration to feedlot heifers to increase 2-AR mRNA in semimembranosous muscle collected at slaughter (Sissom et al., 2007). It is evident from our current results and previous research that -agonists can alter the mRNA expression and density of -AR in skeletal muscle as well as other tissues. These changes may play an important role in regulating the response to -agonist treatment and warrant further investigation. In addition to the alteration of -AR mRNA in proliferating bovine satellite cell cultures, there was a tendency (P = 0.07) for the expression of IGF-I mRNA to be increased with ZH (1 M) addition (Figure 3). In cultured satellite cells, IGF-I is a potent stimulator of both cell proliferation and differentiation (Allen and Rankin, 1990; Johnson and Allen, 1990) and plays an important role in stimulating protein synthesis and decreasing protein degradation in muscle cell cultures (Hembree et al., 1991; Forsberg and Hong, 1994). Despite the tendency for increased expression of IGF-I mRNA, we did not detect differences in proliferation and differentiation. OConnor et al. (1991a) observed no change in IGF-I concentrations after administration of cimaterol for 3 wk. Similarly, clenbuterol administration to growing lambs resulted in no change in IGF-I concentrations (Young et al., 1995). Grant et al. (1993) reported no change in IGF-I mRNA expression in skeletal muscle and liver in pigs fed ractopamine. There also are reports suggesting IGF-I can be reduced in both circulation and mRNA expression by -agonist treatment. In Holstein steers administered ractopamine for 28 d before slaughter, there was a decrease in serum IGF-I (Walker et al., 2007). Additionally, there was a decrease in IGF-I mRNA expression in LM tissue collected at slaughter. In growing lambs fed cimaterol for

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

1322

Miller et al.

Figure 2. Zilpaterol (Merck Animal Health, Whitehouse Station, NJ) decreased myoblast A) 1-adrenergic receptor (AR; P = 0.07, n = 7), B) 2-AR (P < 0.05, n = 7), and C) 3-AR mRNA (0.01 M, P < 0.01; 1.0 M, P = 0.06, n = 7). Bovine satellite cells were plated in 10% fetal bovine serum/Dulbeccos modified Eagle medium. Zilpaterol was added at 48 h. Total RNA was isolated at 96 h, and relative mRNA abundance was determined by real-time PCR. Data points represented as relative to control. Bars without a common letter differ (P = 0.07). Bars are mean values relative to control SEM.

6 wk, there was a decrease in circulating IGF-I concentrations (Beermann, 1987). Conversely, clenbuterol administration to rats increased IGF-I mRNA and IGF-I content skeletal muscle without any change in serum IGF-I (Awede et al., 2002). This report is consistent with the increase in IGF-I mRNA we observed. There was no effect (P > 0.10) of ZH on the expression of genes analyzed in fused myotube cultures at 192 h (Figures 4 and 5). Shappell et al. (2000) reported increased cell number, protein, and DNA concentrations in C2C12 myoblasts after ractopamine treatment; however, no differences were reported in fused myotube cultures treated with ractopamine. Thus, under our culture conditions, ZH administration to bovine satellite cell myotube cultures had no effect on the expression of the -AR and IGF-I mRNA in fused myotubes.
Figure 3. Zilpaterol (Merck Animal Health, Whitehouse Station, NJ) increased myoblast IGF-I mRNA (P = 0.07, n = 7). Bovine satellite cells were plated in 10% fetal bovine serum/Dulbeccos modified Eagle medium. Zilpaterol was added at 48 h. Total RNA was isolated at 96 h, and relative mRNA abundance was determined by real-time PCR. Data points represented as relative to control. Bars without a common letter differ (P = 0.07). Bars are mean values relative to control SEM.

Effect of ZH and the 2-AR Antagonist ICI-118, 551 on the mRNA Expression of the -AR and IGF-I mRNA in Proliferating Bovine Satellite Cells
We used the specific 2-AR antagonist ICI-118, 551 to determine whether the effects of ZH in myoblast

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

Zilpaterol and bovine cell cultures

1323

Figure 4. Effect of zilpaterol (Merck Animal Health, Whitehouse Station, NJ) on myotube A) 1-adrenergic receptor (AR), B) 2-AR, and C) 3-AR mRNA. Bovine satellite cells were plated in 10% fetal bovine serum/Dulbeccos modified Eagle medium. After 24 h, 3% swine serum/ Dulbeccos modified Eagle medium was added, and 3% horse serum/Dulbeccos modified Eagle medium was added at 144 h. Zilpaterol was added at 168 h to fused myotubes. Total RNA was isolated at 216 h, and relative mRNA abundance was determined by real-time PCR. Data points represented as relative to control. Bars are mean values relative to control SEM. There was no effect (P > 0.10) of treatment on the expression of 1, 2, and 3-AR mRNA (n = 5).

Figure 5. Effect of zilpaterol (Merck Animal Health, Whitehouse Station, NJ) on myotube IGF-I mRNA. Bovine satellite cells were plated in 10% fetal bovine serum/Dulbeccos modified Eagle medium. After 24 h, 3% swine serum/Dulbeccos modified Eagle medium was added, and 3% horse serum/Dulbeccos modified Eagle medium was added at 14 h. Zilpaterol was added at 168 h to fused myotubes. Total RNA was isolated at 216 h and relative mRNA abundance was determined by real-time PCR. Data points represented as relative to control. Bars are mean values relative to control SEM. There was no effect (P > 0.10) of treatment on the expression of IGF-I mRNA (n = 5).

cultures were mediated through the 2-AR. The 2-AR antagonist ICI-118, 551 at 1 M attenuated the reduced expression of 1-AR mRNA elicited by 0.01 M ZH (Figure 6A). The combination of these concentrations of IC-118, 551 and ZH increased (P < 0.05) 1-AR gene expression. For the expression of 2-AR, both 0.01 M and 0.1 M ICI-118,551 blocked the reduction in mRNA caused by 0.01 M ZH (Figure 6B). There was no effect (P > 0.10) of IC-118, 551 on 3-AR mRNA, nor was there an effect (P > 0.10) of ZH (Figure 6C). There also was no effect (P > 0.10) of ICI-118, 551 alone or in combination with ZH on the expression of IGF-I mRNA (Figure 7). The ICI-118, 551 was used in this culture system to determine whether the effects on the expression of the receptors and IGF-I mRNA was mediated through the 2-AR. In a previous study, ICI118551 blocked the effect of ZH in lipopolysaccharideexposed u937 macrophages (Verhoeckx et al., 2005). In a similar manner, ractopamine-stimulated increases in cell number, protein, and DNA concentrations were attenuated by propranolol, an antagonist for both the 1- and 2-AR (Shappell et al., 2000). The stimulation of lipogenesis by ractopamine in rat adipocytes was partially inhibited by propranolol as well (Hausman et al., 1989). In our study, the results indicate that the reduction in -AR mRNA by ZH was mediated through

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

1324

Miller et al.

Figure 6. Zilpaterol decreased and zilpaterol (Merck Animal Health, Whitehouse Station, NJ) + ICI-118, 551 combination increased myoblast 1-adrenergic receptor (AR) mRNA (A: P < 0.05, n = 4). Additionally, zilpaterol decreased myoblast 2-AR mRNA, and ICI-118, 551 blocked the reduction (B: P < 0.05, n = 4) and had no effect on 3-AR mRNA (C). Bovine satellite cells were plated in 10% fetal bovine serum/Dulbeccos modified Eagle medium. Zilpaterol was added at 48 h. Total RNA was isolated at 96 h, and relative mRNA abundance was determined by real-time PCR. Data points represented as relative to control. Bars without a common letter differ (P < 0.05). Bars are mean values relative to control SEM.

the 2-AR because of the ability of ICI-118,551 to ameliorate these effects.

Effect of ZH on Bovine Satellite Cell and 2-AR Protein Expression

Western blot analysis revealed that the protein content of 2-AR in ZH-treated myotube cultures decreased (P = 0.05) relative to control (Figure 8) We were unable to detect differences in the mRNA expression of 2-AR mRNA in myotube cultures, but there was an decrease in protein in the Western blot analysis for 2-AR. This indicated that the decrease in 2-AR protein expression due to ZH treatment may be in response to a posttranscriptional event. The reduction in protein expression from myotubes supports much of the research suggesting -agonists decrease receptor density (Spurlock et al., 1994; Huang et al., 2000; Walker et al., 2007). In contrast, ractopamine administration has led to a tendency for an increase in 2-AR mRNA in skeletal muscle isolated from yearling steers and feedlot

heifers collected at slaughter (Sissom et al., 2007; Winterholler et al., 2007). Also, in chicken skeletal muscle cells treated with isoproterenol (a -agonist), there was an increase in -AR population of 40% between d 7 and 10 in culture (Young et al., 2000).

Lipogenesis in ZH-Treated Adipose Tissue Explants

Because of the relative insensitivity of bovine adipose tissue to -AA, including epinephrine (Prior et al., 1983; Miller et al., 1989), greater concentrations of ZH were used in the experiments with adipose tissue explants than in those using satellite cell cultures. In the first adipose tissue trial, in which theophylline was not included in incubation media, ZH stimulated acetate incorporation into total lipids (Table 2). Similarly, fatty acid synthesis was stimulated by ractopamine in rat adipocytes; this was partially inhibited by propranolol, indicating that the stimulation of lipogenesis by ractopamine involved the -AR (Hausman et al., 1989).

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

Zilpaterol and bovine cell cultures

1325

Figure 7. Effect of zilpaterol (Merck Animal Health, Whitehouse Station, NJ) and ICI-118, 551 alone or in combination on myoblast IGF-I mRNA. Bovine satellite cells were plated in 10% fetal bovine serum/Dulbeccos modified Eagle medium. Zilpaterol and ICI-118, 551 was added at 48 h. Total RNA was isolated at 96 h, and relative mRNA abundance was determined by real-time PCR. Data points represented as relative to control. Bars are mean values relative to control SEM (n = 4).

Adenosine accumulates during adrenergic stimulation of adipose tissue, which causes inhibition of adenylate cyclase (Fredholm, 1981; Mills and Mersmann, 1995). Theophylline enhances the action of -AA in adipose tissue by inhibiting phospodiesterase (Arner et al., 1993). This increases the concentration of cyclic adenosine monophosphate and can overcome the effects of adenosine. Therefore, theophylline was included in the media for the second trial. With the addition of 500 M theophylline, ZH caused a dose-dependent reduction in lipid synthesis from acetate when data were expressed as a percentage of control values (Table 2). However, even at the greatest concentration of ZH, lipogenesis from acetate was depressed only about 40%.

Figure 8. A) Western blot image of zilpaterol (Merck Animal Health, Whitehouse Station, NJ)-induced decrease in 2-adrenergic receptor (AR) in myotube cultures. B) Zilpaterol decreased 2-AR protein expression in myotube cultures (P < 0.05, n = 4). Bovine satellite cells were plated in 10% fetal bovine serum/Dulbeccos modified Eagle medium for 144 h. Myotubes were cultured with 3% horse serum/Dulbeccos modified Eagle medium with or without zilpaterol for 168 h. Total protein was isolated and used in Western blot analysis. Bars are mean values SEM.

In a previous study (Miller et al., 1988), we were unable to demonstrate an effect of 50 M epinephrine plus 500 M theophylline on acetate incorporation into lipids in bovine s.c. adipose tissue, even though adipose tissues from clenbuterol-fed steers exhibited strongly depressed rates of lipogenesis in vitro. Miller et al. (1989) tested the effects of clenbuterol in short-term incubations of

Table 2. Total lipid synthesis from acetate in subcutaneous adipose tissue incubated with zilpaterol hydrochloride (Merck Animal Health, Whitehouse Station, NJ)
Zilpaterol hydrochloride, M Item1 Trial 1 Rate2 Percentage control Trial 2 Rate Percentage control
1

Control 8.4 16.2

1 24.1 243 15.3 71

10 21.4 232 13.3 51

100 27.4 337

1,000 28.6 352 7.2 41

SEM 5.6 33.6 4.4 13

P-value 0.16 0.004 0.25 0.05

Trial 1: acetate conversion to lipids in subcutaneous (s.c.) adipose tissue, no theophylline. Trial 2: acetate conversion to lipids in s.c. adipose tissue, 500 M theophylline. 2 Acetate (nmol) incorporated into total lipids/(2 h/100 mg of adipose tissue). All values are means for 3 steers (lipid synthesis) or preadipocyte cultures (SCD gene expression).
Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

1326

Miller et al.
Delmore, R. J., J. M. Hodgen, and B. J. Johnson. 2010. Perspectives on the application of zilpaterol hydrochloride in the United States beef industry. J. Anim. Sci. 88:28252828. Forsberg, N. E., and D. Hong. 1994. Effects of serum and insulinlike growth factor I on protein degradation and protease gene expression in rat L8 myotubes. J. Anim. Sci. 72:22792288. Fredholm, B. B. 1981. Adenosine and lipolysis. Int. J. Obes. 5:643 649. Gonzalez, J. M., J. N. Carter, D. D. Johnson, S. E. Luellette, and S. E. Johnson. 2007. Effect of ractopamine-hydrochloride and trenbolone acetate on longissimus muscle fiber area, diameter, and satellite cell numbers in cull beef cows. J. Anim. Sci. 85:18931901. Grant, A. L., D. M. Skjaerlund, W. G. Helferich, W. G. Bergen, and R. A. Merkel. 1993. Skeletal muscle growth and expression of skeletal muscle -actin mRNA and insulin-like growth factor I mRNA in pigs during feeding and withdrawal of ractopamine. J. Anim. Sci. 71:33193326. Grant, A. L., D. M. Skjaerlund, W. G. Jelferich, and W. G. Bergen. 1990. Effects of phenethanolamines and propanolol on the proliferation of cultured chick breast muscle satellite cells. J. Anim. Sci. 68:652658. Hamby, P. L., J. R. Stouffer, and S. B. Smith. 1986. Muscle metabolism and real-time ultrasound measurement of muscle and subcutaneous adipose tissue growth in lambs fed diets containing a beta-agonist. J. Anim. Sci. 63:14101417. Hausman, D. B., R. J. Martin, E. L. Veenhuizen, and D. B. Anderson. 1989. Effect of ractopamine on insulin sensitivity and response of isolated rat adipocytes. J. Anim. Sci. 67:14551464. Hembree, J. R., M. R. Hathaway, and W. R. Dayton. 1991. Isolation and culture of fetal porcine myogenic cells and the effect of insulin, IGF-I, and sera on protein turnover in porcine myotube cultures. J. Anim. Sci. 69:32413250. Huang, H., C. Gazzola, G. G. Pegg, and M. N. Sillence. 2000. Differential effects of dexamethasone and clenbuterol on rat growth on 2-adrenoceptors in lung and skeletal muscle. J. Anim. Sci. 78:604608. Johnson, B. J., N. Halstead, M. E. White, M. R. Hathaway, A. DiCostanzo, and W. R. Dayton. 1998. Activation state of muscle satellite cells isolated from steers implanted with a combined trenbolone acetate and estradiol implant. J. Anim. Sci. 76:27792786. Johnson, S. E., and R. E. Allen. 1990. The effects of bFGF, IGF-I, and TGF-beta on RMo skeletal muscle cell proliferation and differentiation. Exp. Cell Res. 187:250254. Mauro, A. 1961. Satellite cell of skeletal muscle fibers. J. Biophys. Biochem. Cytol. 9:493495. May, S. G., J. W. Savell, D. K. Lunt, J. J. Wilson, J. C. Laurenz, and S. B. Smith. 1994. Evidence for preadipocyte proliferation during culture of subcutaneous and intramuscular adipose tissues from Angus and Wagyu crossbred steers. J. Anim. Sci. 72:31103117. McMillan, D. N., B. S. Noble, and C. A. Maltin. 1992. The effect of the -adrenergic agonist clenbuterol on growth and protein metabolism in rat muscle cell culture. J. Anim. Sci. 70:30143023. Mersmann, H. J. 1998. Overview of the effects of -adrenergic receptor agonists on animal growth including mechanisms of action. J. Anim. Sci. 76:160172. Mills, S. E., and H. J. Mersmann. 1995. Beta-adrenergic agonists, their receptors, and growth: Special reference to the peculiarities in pigs. Page 1 in The Biology of Fat in Meat Animals: Current Advances. S. B. Smith and D. R. Smith, ed. American Society of Animal Science, Champaign, IL. Miller, M. F., H. R. Cross, J. J. Wilson, and S. B. Smith. 1989. Acute and long-term lipogenic response to insulin and clenbuterol in bovine intramuscular and subcutaneous adipose tissues. J. Anim. Sci. 67:928933. Miller, M. F., D. K. Garcia, M. E. Coleman, P. A. Ekeren, D. K. Lunt, K. A. Wagner, M. Procknor, T. H. Welsh Jr., and S. B. Smith. 1988. Adipose tissue, longissimus muscle and ante-

bovine s.c. adipose tissue from control cattle and from the cattle treated with 7 mg clenbuterol/heifer per day for 50 d. Lipogenesis from acetate was not affected by clenbuterol in control steers (835 vs. 604 nmol2 h1105 cells1) or clenbuterol-treated steers (413 vs. 383 nmol2 h1105 cells1).

Overall Conclusions
These data suggest that the expression of 2-AR was differentially regulated by ZH in myoblasts and myotubes. Additionally, they would support previous research suggesting that the expression of -AR in bovine skeletal muscle cells can vary due to variables such as treatment with -agonists and time in culture (Bridge et al., 1998). These data further support the important role the 2-AR plays in modulating the function of ZH on skeletal muscle growth. Finally, the minimal effects of ZH on de novo fatty acid biosynthesis in our bovine adipose tissue explant system are consistent with the previously reported, modest effects of other -adrenergic agents on adipose tissue metabolism. Thus, the reduction in carcass adiposity frequently (although not invariably) observed in cattle treated with -AA more likely is attributable to redirection of nutrients from adipose tissue fatty acid biosynthesis to muscle accretion.

LITERATURE CITED
Allen, R. E., and L. L. Rankin. 1990. Regulation of satellite cells during skeletal muscle growth and development. Proc. Soc. Exp. Biol. Med. 194:8186. Arner, P., J. Hellmer, E. Hagstrom-Toft, and J. Bolinder. 1993. Effect of phosphodiesterase inhibition with amrinone or theophylline on lipolysis and blood flow in human adipose tissue in vivo as measured with microdialysis. J. Lipid Res. 34:17371743. Awede, B. L., J. Thissen, and J. Lebacq. 2002. Role of IGF-I and IGFBPs in the changes of mass and phenotype induced in rate soleus muscle by clenbuterol. Am. J. Physiol. Endocrinol. Metab. 282:E31E37. Baker, P. K., R. H. Dalrymple, D. L. Ingle, and C. A. Ricks. 1984. Use of a -adrenergic agonist to alter muscle and fat deposition in lambs. J. Anim. Sci. 59:12561261. Baxa, T. J., J. P. Hutcheson, M. F. Miller, J. C. Brooks, W. T. Nichols, M. N. Streeter, D. A. Yates, and B. J. Johnson. 2010. Additive effects of a steroidal implant and zilpaterol hydrochloride on feedlot performance, carcass characteristics, and skeletal muscle messenger ribonucleic acid abundance in finishing steers. J. Anim. Sci. 88:330337. Beckett, J. L., R. J. Delmore, G. C. Duff, D. A. Yates, D. M. Allen, T. E. Lawrence, and N. Elam. 2009. Effects of zilpaterol hydrochloride on growth rates, feed conversion, and carcass traits in calf-fed Holstein steers. J. Anim. Sci. 87:40924100. Beermann, D. H. 1987. Effects of beta-adrenergic agonists on endocrine influence and cellular aspects of muscle growth. Pages 5763 in Proc. Recip. Meat Conf., St. Paul, MN. Bridge, K. Y., C. K. Smith II, and R. B. Young. 1998. Beta-adrenergic receptor gene expression in bovine skeletal muscle cells in culture. J. Anim. Sci. 76:23822391. Coleman, M. E., P. A. Ekeren, and S. B. Smith. 1988. Lipid synthesis and adipocyte growth in adipose tissue from sheep chronically fed a beta-adrenergic agent. J. Anim. Sci. 66:372378.

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

Zilpaterol and bovine cell cultures

rior pituitary growth and function in clenbuterol-fed heifers. J. Anim. Sci. 66:1220. Montgomery, J. L., C. R. Krehbiel, J. J. Cranston, D. A. Yates, J. P. Hutcheson, W. T. Nichols, M. N. Streeter, D. T. Bechtol, E. Johnson, T. TerHune, and T. H. Montgomery. 2009. Dietary zilpaterol hydrochloride. I. Feedlot performance and carcass traits of steers and heifers. J. Anim. Sci. 87:13741383. Moss, F. P., and C. P. Leblond. 1971. Satellite cells as the source of nuclei in muscles of growing rats. Anat. Rec. 170:421435. OConnor, R. M., W. R. Butler, K. D. Finnerty, D. E. Hogue, and D. H. Beermann. 1991a. Acute and chronic hormone and metabolite changes in lambs fed the beta-agonist cimaterol. Domest. Anim. Endocrinol. 8:549554. OConnor, R. M., W. R. Butler, K. D. Finnerty, D. E. Hogue, and D. H. Beermann. 1991b. Temporal pattern of skeletal muscle changes in lambs fed cimaterol. Domest. Anim. Endocrinol. 8:549554. Prior, R. L., S. B. Smith, B. D. Schanbacher, and H. J. Mersmann. 1983. Lipid metabolism in finishing bulls and steers implanted with oestradiol-17-dipropionate. Anim. Prod. 37:8188. Rehfeldt, C., R. Schadereit, R. Weikard, and K. Reichel. 1997. Effect of clenbuterol on growth, carcass, and skeletal muscle characteristics in broiler chickens. Br. Poult. Sci. 38:366373. Ricks, C. A., R. H. Dalrymple, P. K. Baker, and D. L. Ingle. 1984. Use of a -agonist to alter fat and muscle deposition in steers. J. Anim. Sci. 59:12471255. Schiavetta, A. M., M. F. Miller, D. K. Lunt, and S. B. Smith. 1990. Adipose tissue cellularity and muscle growth in young steers fed the -adrenergic agonist clenbuterol for 50 days and after 78 days of withdrawal. J. Anim. Sci. 68:36143623. Shappell, N. W., V. J. Feil, D. J. Smith, G. L. Larsen, and D. C. McFarland. 2000. Response of C2C12 mouse and turkey skeletal muscle cells to the -adrenergic agonist ractopamine. J. Anim. Sci. 78:699708. Sissom, E. K., C. D. Reinhardt, J. P. Hutcheson, W. T. Nichols, D. A. Yates, R. S. Swingle, and B. J. Johnson. 2007. Response to ractopamine-HCl in heifers is altered by implant strategy across days on feed. J. Anim. Sci. 85:21252132. Sissom, E. K., C. D. Reinhardt, and B. J. Johnson. 2006. Melengestrol acetate alters muscle cell proliferation in heifers and steers. J. Anim. Sci. 84:29502958. Smith, S. B., S. K. Davis, J. J. Wilson, R. T. Stone, F. Y. Wu, D. K. Garcia, D. K. Lunt, and A. M. Schiavetta. 1995. Bovine fast-twitch myosin light chain-1: cloning and mRNA amount

1327

in muscle of cattle treated with clenbuterol. Am. J. Physiol. 268(Endocrinol. Metab. 31):E858E865. Spurlock, M. E., J. C. Cusumano, S. Q. Ji, D. B. Anderson, C. K. Smith II, D. L. Hancock, and S. E. Mills. 1994. The effect of ractopamine on -adrenoreceptor density and affinity in porcine adipose and skeletal muscle tissue. J. Anim. Sci. 72:7580. Steenhuis, P., R. E. Huntley, Z. Gurenko, L. Yin, B. A. Dale, N. Fazel, and R. R. Isseroff. 2011. Adrenergic signaling in human oral keratinocytes and wound repair. J. Dent. Res. 90:186192. Strosberg, A. D., L. Camoin, N. Blin, and B. Maigret. 1993. In receptors coupled to GTP-binding proteins, ligand binding and G-protein activation is a multi-step dynamic process. Drug Des. Discov. 9:199211. Thornton, R. F., R. K. Tume, G. Payne, T. W. Larsen, G. W. Johnson, and M. A. Hohenhaus. 1985. The influence of the 2-adrendergic agonist, clenbuterol, on lipid metabolism and carcass composition of sheep. Proc. N.Z. Soc. Anim. Prod. 45:97106. Trenkle, A. D., L. DeWitt, and D. G. Topel. 1978. Influence of age, nutrition and genotype on carcass traits and cellular development of m. longissimus of cattle. J. Anim. Sci. 46:15971603. Verhoeckx, K. C. M., R. P. Doornbos, J. Van Der Greef, R. F. Witkamp, and R. J. T. Rodenburg. 2005. Inhibitory effects of the 2-adrenergic receptor agonist zilpaterol on the LPS induced production of TNF- in vitro and in vivo. J. Vet. Pharmacol. Ther. 28:531537. Walker, D. K., E. C. Tigemeyer, E. K. Sissom, K. R. Brown, J. J. Higgins, G. A. Andrews, and B. J. Johnson. 2007. Effects of steroidal implantation and ractopamine-HCl on nitrogen retention, blood metabolites and skeletal muscle gene expression in Holstein steers. J. Anim. Physiol. Anim. Nutr. (Berl.) 91:439447. Winterholler, S. J., G. L. Parsons, C. D. Reinhardt, J. P. Hutcheson, W. T. Nichols, D. A. Yates, R. S. Swingle, and B. J. Johnson. 2007. Response to ractopamine-hydrogen chloride is similar in yearling steers across days on feed. J. Anim. Sci. 85:413419. Young, O. A., S. Watkins, J. M. Oldham, and J. J. Bass. 1995. The role of insulin-like growth factor I in clenbuterol-stimulated growth in growing lambs. J. Anim. Sci. 73:30693077. Young, R. B., K. Y. Bridge, and J. R. Vaughn. 2000. Beta-adrenergic receptor population is up regulated by increased cyclic adenosine monophosphate concentration in chicken skeletal muscle cells in culture. In Vitro Cell. Dev. Biol. Anim. 36:485492.

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013

References

This article cites 48 articles, 35 of which you can access for free at: http://www.journalofanimalscience.org/content/90/4/1317#BIBL

Downloaded from www.journalofanimalscience.org by guest on May 28, 2013