Meat Science 85 (2010) 589590

Contents lists available at ScienceDirect

Meat Science
journal homepage: www.elsevier.com/locate/meatsci

Rapid DNA extraction of pig ear tissues

S. Kunhareang, H. Zhou, J.G.H. Hickford *
Gene-Marker Laboratory, Department of Agricultural Sciences, Faculty of Agriculture and Life Sciences, P.O. Box 84, Lincoln University, Lincoln 7647, New Zealand

a r t i c l e

i n f o

a b s t r a c t
A single-step DNA isolation procedure from pig tissues was developed and the product used directly for polymerase chain reaction (PCR) amplication, single-strand conformational polymorphism (SSCP) analysis and sequencing. The procedure consists of proteinase K digestion of 210 mg of fresh tissue, at 55 C for 1 h, followed by application of the products of digestion to lter paper. A 1.2 mm-diameter punch of that paper has sufcient DNA to act as a template for PCR amplication. The quality of the genomic DNA appeared to be high as the PCR amplicons produced sharp banding patterns on both agarose gel electrophoresis and on SSCP analysis, and they could be used for DNA sequencing following cloning. The dried genomic DNA on lter paper can be kept at room temperature. The procedure is considered effective as it is simple, fast and inexpensive. It would be useful for large-scale genotyping and could be used to obtain genomic DNA from various tissues. 2010 Elsevier Ltd. All rights reserved.

Article history: Received 28 August 2009 Received in revised form 2 February 2010 Accepted 27 February 2010

Keywords: DNA isolation PCR amplication Tissue Pig

Genetic analysis based on polymerase chain reaction (PCR) amplication of genomic DNA has become popular. In this approach, good quality DNA has to be extracted from a blood or tissue source. Blood has become acknowledged as a good source of genomic DNA for use as a PCR template, although the process and cost of blood collection creates a constraint on the large-scale and rapid use of this approach. Moreover, blood samples may not be available for DNA testing if the only tissue available is meat or skin, as may be available from slaughtered animals. For this reason, an alternative method for extracting genomic DNA from pig tissues was developed. Previously described DNA purication methods include genomic DNA extraction from specic tissues using phenolchloroform-based approaches, with a popular method described by Sambrook, Fritsch, and Maniatis (1989). There are also methods based on the use of Chelex-100 (Roberge, Pommier, & Houde, 1997; Walsh, Metzger, & Higuchi, 1991; Yue & Orban, 2005) and methods based on grinding tissue in liquid nitrogen (Biase, Franco, Goulart, & Antunes, 2002). These methods have been used effectively, but are time-consuming, accrue a storage and handling cost, and use hazardous reagents that require special handling and disposal mechanisms. In this study we report a rapid and simple protocol for DNA extraction from pig ear tissues, using readily available laboratory chemicals. We consider this method to be less time-consuming, affordable and safe. A small piece of ear tissue weighing between 2 and 10 mg was chopped nely and then incubated for 1 h at 55 C in 200 ll diges* Corresponding author. Tel.: +64 3 3252811; fax: +64 3 3253851. E-mail address: hickford@lincoln.ac.nz (J.G.H. Hickford). 0309-1740/$ - see front matter 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.meatsci.2010.02.028

tion solution containing 50 lg/ml proteinase K (Quantum Scientic, Queensland, Australia), 40 mM TrisHCl, 20 mM EDTA and 1% Triton X-100 (pH 8.0). After the inactivation of proteinase K by heating to 95 C for 15 min, samples were cooled to room temperature, centrifuged for 30 s at 2000g to pellet the undigested tissues and the solution (approximately 150 ll) containing DNA was dotted onto 3MM lter paper (Whatmann, Middlesex, UK). This produced a spot of approximately 20 mm in diameter that was air-dried. The quality of the DNA on the lter paper was examined by PCR-single-strand conformational polymorphism (SSCP) analysis of porcine CAPN3 and MYF5 amplicons. A 210-bp fragment of CAPN3 exon 10 was amplied using the primers reported by Zhou, Hickford, and Fang (2007), and a 488-bp fragment of MYF5 exon 1 was amplied using primers described by Kunhareang, Zhou, and Hickford (2009). An unambiguous single band of the expected size was obtained for each amplicon and very little background was observed in agarose gels (results not shown). The amplicons were then subject to SSCP analyses and two SSCP patterns were observed for CAPN3 exon 10 and four patterns for MYF5 exon 1. The SSCP patterns generated by PCR amplicons from DNA extracted by this rapid method were identical to, and as clear as those derived from genomic DNA extracted using a phenolchloroform method (Fig. 1A and B). The efciency and reliability of the genomic DNA extraction method was further assessed by cloning and sequencing PCR amplicons. The 488-bp of MYF5 exon 1 was amplied using Pwo Super Yield DNA polymerase (Roche Applied Science, Mannheim, Germany) and cloned and sequenced as previously described by Kunhareang, Zhou, and Hickford (2009). The chromatogram trace showed obvious individual peaks which could be read through to

590

S. Kunhareang et al. / Meat Science 85 (2010) 589590

To assess the efciency of the rapid DNA extraction method, the concentration of proteinase K used and digestion time were varied. It was found that proteinase K works very effectively when its concentration ranged between 50 and 500 lg/ml. This suggests that proteinase K is necessary for digestion, but it does not need to be present at high concentration. Furthermore, only 1.01.5 h is required for effective incubation to yield sufcient DNA template for PCR amplication. The method therefore requires fewer reagents and exchanges of reagents compared to phenolchloroform methods, and it does not require special chemical handling and disposal mechanisms. The 20 mm diameter DNA spots prepared by this method can be used for between 30 and 50 individual PCR amplications and this provides sufcient template for multiple PCR reactions. The lter papers and genomic DNA extracted can be kept at room temperature for more than a half year and with a minimal storage cost, and can be used for PCR amplication directly, with no further washing steps required. In summary, here we report a simple, inexpensive and safe method for extracting DNA that can subsequently be used for PCR amplication. Since the method is a one-step manipulation, it has a reduced risk of contamination with foreign DNA. This method enables the long-term preservation of genomic DNA samples at room temperature and does not require cold-storage facilities. The extracted DNA is suitable for other purposes following PCR amplication, such as SSCP analysis, cloning and sequencing. The method would be applicable to typing large numbers of samples, when large-scale genotyping is needed. Acknowledgements This research was nancially supported by the Gene-Marker Laboratory at Lincoln University, New Zealand. The authors would like to thank Q. Freeman, S.O. Byun, J. Han, and J. Hu for technical assistance. References
Biase, F. H., Franco, M. M., Goulart, L. R., & Antunes, R. C. (2002). Protocol for extraction of genomic DNA from swine solid tissues. Genetics and Molecular Biology, 25, 313315. Kunhareang, S., Zhou, H., & Hickford, J. G. H. (2009). Allelic variation in the porcine MYF5 gene detected by PCR-SSCP. Molecular Biotechnology, 41, 208212. Roberge, C., Pommier, S. A., & Houde, A. (1997). Rapid DNA purication for Hal gene PCR diagnosis in porcine tissues and extension to other meat species. Meat Science, 45, 1722. Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular cloning: A laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Walsh, P. S., Metzger, D. A., & Higuchi, R. (1991). Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques, 10, 506513. Yue, G. H., & Orban, L. (2005). A simple and affordable method for high-throughput DNA extraction from animal tissues for polymerase chain reaction. Electrophoresis, 26, 30813083. Zhou, H., Hickford, J. G. H., & Fang, Q. (2007). Single nucleotide polymorphisms of the ovine calpain 3 (CAPN3) gene. Molecular and Cellular Probes, 21, 7879.

Fig. 1. PCR amplicons of the porcine CAPN3 and MYF5 genes. Amplicons of CAPN3 exon 10 (A) and MYF5 exon 1 (B) were subject to SSCP analyses in 14% and 11% polyacrylamide gels. These amplicons were generated from DNA extracted using either the single-step method described here (lanes 15) or a traditional phenol chloroform method (lanes 68). (C) A 1.8 kb fragment of the MYF5 gene was amplied from the dried supernatant DNA from the method described above. Lane M is a 1 kb plus DNA ladder.

the end of the cloned sequence and beyond into the plasmid vector (results not shown). In order to further check the quality of the genomic DNA extracted by this method, PCR amplication of a 1.8 kb fragment of 0 0 MYF5 was performed. A third primer 5 taaggagcttttatccgtgg3 was designed and used with exon 1 upstream primer to amplify a fragment spanning from exon 1 to exon 3. PCR conditions were the same as previously for MYF5 exon 1, with the exception of annealing at 56 C and an extension time of 2 min length. Agarose gel analysis revealed that a 1.8 kb DNA fragment could be amplied from the rapidly extracted DNA samples (Fig. 1C).