SCIENTIFIC REPORT

Biacores SPR technology and DNA footprinting for the discovery and development of new DNA-targeted therapeutics and reagents
W. David Wilson, Lei Wang, Farial Tanious, Arvind Kumar, David W. Boykin, Carolina Carrasco1 and Christian Bailly1 Department of Chemistry, Georgia State University, Atlanta, Georgia 30303 USA and 1 INSERM U-524 et Laboratoire de Pharmacologie Antitumorale du Centre Oscar Lambret, IRCL, Place de Verdun, 59045 Lille, France

A number of clinically useful agents against diseases, from cancer to infectious disease, exert their therapeutic action by interacting with cellular DNA and causing some perturbation in protein-DNA recognition. Discovery of compounds with enhanced DNA-targeting capability is critical to the development of potential drugs of this type. We describe here the use of a complementary approach involving compound design and synthesis, a combinatorial analysis of binding sites by DNA footprinting methods and high resolution Biacore analysis to discover and characterize new DNA targeting and interaction modes with increased specificity and affinity
lthough the first draft of the complete human genome sequence was announced almost one year ago and the genomes of a large number of organisms are now being sequenced, the use of this vast amount of new information is just beginning. One of the challenges presented by this array of sequence information is to design new types of compounds that can readily penetrate the cell nucleus and interact with a desired target sequence of DNA. Such compounds would have multiple uses in therapeutics and biotechnology. We have found that even relatively small molecules can have remarkable good therapeutic effects by targeting DNA of certain organisms. A prodrug of furamidine, (DB75 in Figure 1), for example, has recently completed phase I clinical trials and has activity against several infectious disease organisms ranging from Pneumocystis carinii to trypanosomes. The compound is already scheduled to enter two phase II trials this year. DB75, which is the active component, is known to bind strongly in the DNA minor groove with selectivity for AT-rich sequences (1). Its therapeutic action is thought to
Biacore Journal Number 1 2001

come from selective uptake by target cells with inhibition of one or more DNA-directed enzymes or control proteins in those cells. These initial studies demonstrate that the compound readily enters cells and has low toxicity to humans at therapeutic doses. The prodrug and other compounds under development are very promising advances in the treatment of infectious diseases that affect millions of people worldwide. Development of additional compounds in this series offers the potential of an improved therapeutic ratio as well as possible generation of additional biological activities against other organisms or disease cells including cancer cells. For these reasons derivatives of DB75 are being synthesized and their interactions with DNA are being characterized. Synthesis of benzimidazole derivatives and replacement of the phenyl rings of DB75 with benzimidazole rings is a high priority since benzimidazoles offer the potential of expanded DNA base pair recognition (Figure 1). Benzimidazole isomers, unlike the phenyl rings of DB75, can recognize AT base pairs through donation of a hydrogen

O H2N + H2N O H 2N + H2N N N H H 2N + NH 2 H2N O N H + N N H DB293 NH2 H2N + N DB270 NH2 NH2 + NH2 DB75

H N N G-NH2 Fig. 1 N N H AN3/T02

Figure 1 Structures for the symmetric compounds DB75 and DB270 as well as the nonsymmetric compound DB293 that display the new dimer DNA recognition mode. Possible recognition of AT and GC base pairs by benzimidazole isomers is also illustrated.
PAGE 15

SCIENTIFIC REPORT
DNase I Footprinting
120 110 100 90 Cont 0.4 80 70 60 50 40

DB293 Net

0.5 0.75 1 2 3 Cont 5 10

DB293 (3 M) 2 Differential cleavage 1 0 -1 -2 -3

netropsin (10 M)

Surface Plasmon Resonance

50

B
Response (Ru)

40 30 20 10 0 -10 0 50 40 Response (Ru) 30 20 10 0 -10 0 100 100

AATT

Figure 2 DNaseI footprinting results define a new mixed AT and GC type recognition sequence (shown in yellow) for DB293. This sequence was synthesized as a biotin labeled oligomer hairpin along with a control sequence, oligo1, with a classical AATT minor groove binding site. Sensorgrams for DB293 binding to the AATT control sequence and to oligo2-1 are shown.

-4 3 GTCCTTTGTCGATACTGGTACTAATGCGGTTCGAGCTTTAATTGGGAGTGATTTCCCTTGTTTTCGAACGTACGGA 110 100 90 80 70 60 50 40

T 5"biotin-CGAATTCG C 3"-GCTTAAGC T C OLIGO 1 5"biotin-CTATGACCATGAT C 3"-GATACTGGTACTA T C OLIGO 2 T

200 300 Time (sec)

400

500

ATGA

T 5"biotin-CTATGAC C 3"-GATACTG T C OLIGO 2-1

T 5"biotin-CCATGAT C 3"-GGTACTA T C OLIGO 2-2

200 300 Time (sec)

400

500

Figure 3 A Scatchard plot for the binding of DB293 to oligo1 (blue) and oligo2-1 (red) using results from the sensorgrams in Figure 2 and other experiments. The oligo1 result is typical for AT specific minor groove agents and indicates one strong binding site. The oligo2-1 result is very unusual and illustrates the power of SPR methods to dissect small molecule-biopolymer interactions. Two molecules bind to this oligomer with very strong cooperative interactions.
PAGE 16

bond to A-N3 or T-O2 in the minor groove. Selective binding to GC base pairs could occur through hydrogen bond formation between the G-NH2 group in the minor groove and the unprotonated benzimidazole nitrogen (Figure 1). To evaluate the results for new compounds DNaseI footprinting studies are conducted to quickly characterize compound interactions with a combinatorial-type set of sequences of different size. The DNaseI footprinting results shown in Figure 2 provided an early clue that the approach of using benzimidazole derivatives could be successful. Unlike the related symmetrical compounds DB75 and DB270, the phenyl-furan-benzimidazole DB293, binds most strongly to a DNA sequence that has both GC and AT base pairs. Analysis of the footprinting results provided the sequence of the unique DNA binding site for DB293 (oligo2 in Figure 2) out of the huge set of possible DNA interaction sites. This exciting new selective recognition result, however, raised many questions. For example, why does DB293 bind to GC-containing sequences while the closely related derivative, DB270 with two benzimidazoles, does not bind well to any GC containing sequence? Questions of stoichiometry, relative affinities and binding kinetics also required answers for development of an understanding of this new DNA recognition mode. In addition, synthesis of additional analogs of DB293 was

initiated to probe structure-activity relationships in the DNA complexes of compounds related to DB293 and a more rapid screen for the ability of the new molecules to interact with target sequences of DNA was needed. Initially SPR experiments on a Biacore 2000 instrument and now on both a 2000 and a Biacore 3000 in our laboratories have provided answers to most of these questions. To characterize the complex of DB293 with the unique target DNA in molecular detail, oligomers were copied directly from the DNaseI footprinting sequence, 5'-biotin labeled and immobilized on Biacore SA sensorchips with standard methods. The sequence of the unique binding site was copied into oligo2 and a reference sequence with a classical minor groove AATT binding site, oligo1, was also taken from the footprinting results as a control (Figure 2). The binding stoichiometry suggested that up to four molecules of DB293 were binding strongly to oligo2 but that the binding of DB75 and DB270 to this oligomer was much weaker. To simplify the system again for high-resolution analysis oligo2 was divided into two smaller pieces, oligo2-1 and 22 (Figure 2). Each of these oligomers gave sensorgrams with excellent S/N ratios that indicated quite clearly that two molecules of DB293 could bind to each of the two smaller oligomers. As an illustration of this surprising result for such a small oligomer, sensorgrams for DB293
Biacore Journal Number 1 2001

SCIENTIFIC REPORT
binding to oligo2-1 and the oligo1 AATT control sequence are shown in Figure 2. DB293 gives excellent results in both systems with clear saturation of the oligomers at two different ratios of the compound. Flow cells for oligo2-1 and oligo1 in this experiment have essentially the same amount of DNA immobilized so that the sensorgram saturation levels can be compared directly for stoichiometry differences. SPR detection is a major advantage in small molecule systems of this type where stoichiometry issues are of major importance. These Biacore results provided the first clear molecular indication of the basis for the new DNA recognition mode adopted by DB293. Unlike other related heterocyclic mono and dications, DB293 interacts with DNA in a stacked 2:1 complex that can recognize both strands of its target DNA sequence for enhanced specificity. Biacore SPR experiments with the same sensor chip used in Figure 2 indicated that even very closely related compounds, such as DB75 and DB270, in Figure 1 could not form any similar stacked recognition complexes and bound weakly to oligo2-1. Scatchard plots generated from the sensorgrams in Figure 2 confirm and define in more detail the 2:1 complex of DB293 with oligo2-1 and the 1:1 complex with the AATT site in oligo1 (Figure 3). A very important feature of the interaction, that was not apparent from the other experiments but is easily seen in the Scatchard plots, is that the two DB293 molecules bind to oligo2-1 in a highly cooperative complex (2). The concave curvature of the Scatchard plot is characteristic of positive cooperativity and is an unusual feature of small molecule-DNA interactions that has been rarely studied in detail due to difficulties in obtaining the required data at very low compound concentrations. It again illustrates the advantages of SPR detection technology for high-resolution analysis of small molecule-DNA interactions. The results for oligo2-1 and DB293 in the Scatchard plot were fitted with an equation with two binding sites: r = ( K1Cfree + 2K1K2Cfree2) / (1+ (K1Cfree) + K1K2Cfree2 ) (1) where K1 and K2 , the macroscopic thermodynamic binding constants, are the variable parameters to fit, r = moles of compound bound / mole DNA-hairpin duplex = RUavg / RUmax, RUavg is the response at the steady state level (for example, in Figure 2), RUmax is the response for binding one molecule to the hairpin duplex, Cfree is the concentration of the compound in the flow solution. Averaging of the sensorgrams over a time period at the steady state level to determine RUavg was performed with the BIAevaluation software. RUmax
Biacore Journal Number 1 2001

can be predicted using the following equation: RUmax = RUDNA (MWcompound / MWDNA ) RII (2) where RUDNA is the amount of immobilized DNA in response units, MW is molecular weight of compound and DNA respectively and RII is the refractive index increment ratio of compound to DNA. The RII value is close to one for proteins and DNA but can deviate considerably above and below 1.0 for small molecules (3). The K1 value is 2.8x106 while the K2 value is much larger, 7.3x107, as expected for positive cooperativity in binding. The statistical prediction is that K1 should be four times K2 for noncooperative binding so the larger value for K2 indicates pronounced cooperativity in the binding of DB293 to oligo2-1. Similar cooperative binding was observed with oligo2-2. In contrast, DB293, as well as DB75 and DB270 (Figure 1) bound to the control oligo1 in a noncooperative 1:1 complex (K2 approximately zero in equation 1) as expected for a classical minor groove complex. None of the other compounds bound strongly to oligo2-1 in agreement with footprinting results. The very specific stoichiometry and strong binding of DB293 to oligo2-1 suggested that the complex would be excellent for structure determination. For this reason NMR analysis was initiated on the 2:1 complex of DB293 with oligo2-1 and the system does provide excellent 2D NMR spectra. Initial structural results suggest that the two molecules of DB293 bind in a stacked, antiparallel manner to the minor groove of oligomers with the central sequence ATGA as found in oligo2-1 and 2-2. This is a completely new recognition mode for heterocyclic dications although monocationic polyamides, related to the antibiotic distamycin, can also form stacked dimers in the minor groove. It is interesting that no polyamide dications can form the stacked dimer as seen with DB293. The stacking of two molecules of DB293 for binding to DNA is extremely important for DNA recognition. Since DNA is a double helix, each of the DB293 molecules in the stacked complex can recognize bases on one of the DNA strands of the double helix. Structural results, for example, suggest that the G base on the ATGA strand of the duplex is recognized by the imidazole isomer with the NH pointed out of the groove, as diagramed in Figure 1. Biacore analyses of additional modified DNA sequences are in complete agreement with these predictions from the structural model. The structural results described above suggested that the stacked dimer should be very sensitive to modifications of the DB293 structure. To test this point DB293 analogs with modified

N o H2N HN DB501 NH2 + NH2 N o H2N + NH2 HN DB293 NH2 + NH2 N o H2N HN + NH2 HN HN DB704 N o H2N + HN NH DB294 HN NH2 + NH2 + NH2

Figure 4 Examples of analogs of DB293 that have been synthesized and screened with Biacore methods. Biacore SPR and DNA footprinting results indicate that the monocation DB501 and the alklyamidine DB294 do not bind by the dimer mode but the guanidinium derivative, DB704, does form a dimer complex with oligo2-1.

PAGE 17

SCIENTIFIC REPORT

Figure 5 A schematic illustrating the complementary nature of the DNA footprinting/probe, Biacore and compound design and synthesis efforts to prepare compounds with new capability to recognize specific DNA sequences

Acknowledgments

The authors thank the IFR22 for access to the Biacore 3000 in Lille and Nathalie Jouy for helpful assistance with the instrument. We thank the Georgia Research Alliance for funds in support of purchase of the Biacore 2000 in Atlanta. Carolina Carrasco has been supported by a Marie Curie Fellowship of the European Community Programme Improving Human Research Potential and the Socio-economic Knowledge Base under contract number HPMFCT2000-00701. This work was supported by National Institutes of Health Research Grant GM 61587 and a Gates Foundation Grant (to W.D.W. and D.W.B.), by INSERM and the Ligue Nationale Franaise Contre le Cancer (Comit du Nord) (to C.B.) and by an INSERM Poste Orange Grant (to W.D.W. and C.B.)
PAGE 20

amidine groups were synthesized and SPR binding studies conducted (4). The results showed that addition of alkyl groups to the amidines of DB293 strongly inhibited formation of the stacked dimer. Conversion of the amidine to a guanidinium group, however, also resulted in a compound, DB704, which could form a cooperative dimer with oligo2-1 although with a lower affinity. These results are summarized in Figure 4. Since the polyamide series of compounds can form stacked dimer complexes with DNA only when they are monocations, it seemed that DB293 dimer interactions might be enhanced by converting the dication to a monocation. The SPR results, however, demonstrated just the opposite and dimer formation in the DNA minor groove was strongly inhibited with the monocation (Figure 4). A large number of additional syntheses are in progress or have been completed and Biacore binding experiments with these derivatives will be essential to establish structural limits on the formation of the dimer recognition mode. In summary, using complementary Biacore SPR, footprinting, and compound design and synthesis methods we have discovered a new DNA recognition mode for small molecule complexes with DNA. This new mode involves a stacked heterocyclic complex that can specifically recognize both strands of the DNA duplex to provide much higher binding specificity than classical monomer interactions with DNA. Figure 5 is a diagram of how these three areas

interact in a complementary feedback system to define the DNA interactions of new compounds and eventually lead to the development of derivatives with improved DNA recognition capability. In the Biacore SPR analysis screen, three criteria are used to define strong dimer formation with a DNA sequence by a new compound: overall affinity, positive cooperativity and a 2:1 stoichiometry. As noted above, SPR detection technology offers many advantages in this type of analysis. In the next phase of the project, many base modifications to the oligo2-1 sequence are being made and the new DNAs are being immobilized on SPR flow cells to help characterize the DNA recognition specificity limits to the DB293 stacked dimer. Biacores SPR technology is thus a key element of our collaborative small moleculeDNA interaction research program that is aimed at designing a new category of DNA reading drugs with potential direct therapeutic action and biotechnology applications. References 1. Laughton, C.A., Tanious, F.A., Nunn, C. M., Boykin, D. W., Wilson, W. D. and Neidle, S. Biochemistry 35: 5655 (1996) 2. Wang, L., Bailly, C., Kumar, A., Ding, D., Bajic, M., Boykin, D. W. and Wilson, W. D. Proc. Natl. Acad. Sci. USA 97: 12 (2000) 3. Davis, T.M. and Wilson, W. D. Anal. Biochem. 284: 348 (2000) 4. Wang, L., Carrasco, C., Kumar, A., Stephens, C. E., Bailly, C., Boykin, D. W. and Wilson, W. D. Biochemistry 40: 2511 (2001)
Biacore Journal Number 1 2001