ARTICLE IN PRESS

FOOD MICROBIOLOGY
Food Microbiology 25 (2008) 5664 www.elsevier.com/locate/fm

Discrimination of Saccharomyces cerevisiae wine strains using microsatellite multiplex PCR and band pattern analysis
Enrico Vaudano, Emilia Garcia-Moruno
CRA-Istituto Sperimentale per lEnologia, Via Pietro Micca 35, 14100 Asti, Italy Received 28 December 2006; received in revised form 7 August 2007; accepted 16 August 2007 Available online 21 August 2007

Abstract We propose a rapid method for Saccharomyces cerevisiae strain identication based on multiplex PCR analysis of polymorphic microsatellite loci. Simple DNA extraction without the use of phenol, followed by a rapid PCR procedure optimised for multiplex amplication of loci SC8132X, YOR267C and SCPTSY7 and band pattern analysis of the fragments generated by agarose and polyacrylamide gel electrophoresis, has allowed us to distinguish among a panel of 30 tested commercial wine strains. This method was successfully performed in an ecological study where dominance between two strains was checked at two fermentation temperatures: 15 and 20 1C. The method should be useful for routine and low-budget discrimination of yeast strains, both in the wine and yeast production industries. r 2007 Elsevier Ltd. All rights reserved.
Keywords: Microsatellite; PCR; Yeast strains; Wine; Fermentation

1. Introduction The use of selected strains for alcoholic fermentation in winemaking is now widespread. The inuence of yeast interactions on wine quality has become clear, especially their contribution to avour. (Lambrechts and Pretorius, 2000; Swiegers et al., 2005). Modern oenologists are conscious that fermentations with different strains can produce different characteristics in wine. This has resulted in the industrial production of a large number of selected strains with different features for different applications. At present, the market offers hundreds of strains, almost all within the species Saccharomyces cerevisiae. A parallel interest has grown in developing rapid methodologies that allow unequivocal identication of yeasts. In winemaking, applications include verifying the dominance of inoculated strains over the wild strains present in the must, following strain dynamics during
Corresponding author. Tel.: +39 141433828; fax: +39 141436829.

E-mail address: biologia.molecolare@isenologia.it (E. Vaudano). 0740-0020/$ - see front matter r 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.fm.2007.08.001

fermentation and, from the point of view of the yeast producers, controlling quality in strain production, as well as detecting fraud. The ecological studies offer one of the most interesting applications. In winemaking, selected strains are inoculated in a non-sterile must where abundant wild Saccharomyces and non-Saccharomyces strains are present. Rapid strain discrimination methodologies should allow for the observance of the yeast population dynamics, the dominance capability of the selected strain and the inuence of ambient factors on yeast growth. In wine fermentation, temperature is one of the main factors affecting the yeast dynamics (Fleet and Heard, 1993); ecological studies have shown different behaviours of the S. cerevisiae strains (Epifanio et al., 1999; Torija et al., 2003). Indeed, one of the prominent features requested by the winemaker is the ability to perform good fermentations at a certain temperature. Often, in a typical fermentation of white grapes, the fermentation temperature is maintained below 18 1C, but it is not rare to reach 1215 1C to enhance the production of avouring esters and reduce higher alcohol formation. At this temperature, sluggish and stuck

ARTICLE IN PRESS
E. Vaudano, E. Garcia-Moruno / Food Microbiology 25 (2008) 5664 57

fermentation occurs frequently and, consequently, selected strains with a cryophilic metabolism and the ability to dominate the wild ora in this stressed condition are preferred. In the last years, studies have focused on strain differentiation using molecular methods (recently reviewed by Beh et al., 2006) such as karyotyping (Carle and Olson, 1985; Blondin and Vezinhet, 1988) and restriction fragment length polymorphism (RFLP) analysis of mDNA (Querol et al., 1992), as well as PCR-based methods including internal transcribed sequence (ITS) of ribosomal DNA sequencing (Montrocher et al., 1998), insertion site polymorphism of delta elements (Cameron et al., 1979; Ness et al., 1993), amplied fragment length polymorphism (AFLP) (De Barros Lopes et al., 1999), random amplied polymorphic DNA (RAPD) (Baleiras-Couto et al., 1996), intron splice sequence amplication (De Barros Lopes et al., 1996) and PCR of intron of mitochondrial genes pez et al., 2003). (Lo These methods represent an enhancement with respect to classical physiological tests in terms of resolution and processing time, but some of them have limits because they are hardly applicable for routine analysis or, when they are easy to implement, they insufciently discriminate at the strain level. Furthermore, in some methods, such as delta typing and RAPD, the reproducibility depends on the purity and the concentration of the DNA template ndez-Espinar et al., 2001; Beh et al., 2006). These (Ferna drawbacks imply costly and time-consuming DNA cleanup steps and in some cases also the need of several reactions to evaluate the occurrence of non-reproducible bands. Based on the length polymorphism of simple sequence repeat loci dispersed throughout the entire genome, microsatellite analysis has successfully been used to discriminate S. cerevisiae strains (Field and Wills, 1998; rez et al., 2001; Gonzalez Techera et al., 2001; Pe Hennequin et al., 2001; Malgoire et al., 2005). Recently, multiplex PCR of microsatellite loci with high degrees of polymorphism has allowed the separation of a large number of commercial yeast strains (Schuller et al., 2004; Bradbury et al., 2005; Legras et al., 2005). This discriminatory power, combined with its robustness and applicability to raw DNA templates (Howell et al., 2004), has allowed the PCR of microsatellite loci method to be one of the most popular methods in strain discrimination. The bottleneck in the routine application of this method occurs during the amplicon analysis step: the use of polyacrylamide sequence gels and sequencer apparatus to determine amplicon size is time-consuming and costly. To bypass this limit, simple electrophoresis with high-strength agarose has been proposed (Routman and Cheverud, 1994; Ferraro et al., 1998). Recently, Howell et al. (2004) suggested S. cerevisiae strain typing based on PCR amplication of the SC8132X locus, and amplicon sizing by polyacrylamide gel electrophoresis and ethidium bromide staining.

To construct a rapid and sufciently discriminatory routine method applicable even in low-budget, highthroughput laboratories, we have implemented multiplex amplication of three highly polymorphic microsatellite loci (Gonzalez Techera et al., 2001), followed by analysis of the band patterns generated by agarose gel electrophoresis. As a rst step, we checked its discriminatory power on a panel of 29 market-available selected strains plus a reference S. cerevisiae type strain. The suitability of this method was then examined in trials testing the effect of fermentation temperature on the growth rates and competitive capabilities of two selected co-inoculated strains. 2. Materials and methods 2.1. Yeast strains and media S. cerevisiae strains were purchased from wine yeast suppliers. The commercial strains are listed in Table 1. The type strain of S. cerevisiae (CBS 1171) was obtained from the collection of CRA-Istituto Sperimentale per lEnologia of Asti, Italy (ISE). Commercial dried strains were suspended in sterile 5% sucrose rehydration medium for 30 min at 40 1C, diluted, and spread on YMA medium plates (10 g L1 glucose, 5 g L1 peptone, 3 g L1 yeast extract, 3 g L1 malt extract and 20 g L1 agar), then incubated at 24 1C for 48 h. 2.2. DNA extraction During the rst step in the study, when we tested the discriminatory power of the method, DNA was extracted as described by Harju et al. (2004). Briey, single colonies were resuspended in 200 mL of lysis buffer (2% (w/v) Triton X-100, 1% (w/v) SDS, 100 mmol L1 NaCl, 10 mmol L1 TrisHCl pH 8.0, 1 mmol L1 EDTA pH 8.0). The tubes were placed in a freezer at 80 1C for 3 min (until
Table 1 Saccharomyces cerevisiae strains used in this study No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Strain DSM Fermichamp DSM Fermivin DSM C. Chardonnay DSM Fermiblanc Vitilevure DV 10 DSM C. Merlot DSM VR5 Laffort F15 Laffort Zymaore ST Lallemand Lalvin ICV D47 Lallemand Uvaferm VRB Lallemand Uvaferm 228 Lallemand Uvaferm 43 Lallemand Uvaferm CM Lallemand Uvaferm MCS No. 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Strain Lallemand Uvaferm CEG Lallemand Uvaferm CS2 Lallemand Uvaferm CK Lallemand Uvaferm 299 Lallemand Uvaferm BDX Lallemand Uvaferm ALB Lallemand Uvaferm SLO Lallemand Uvaferm WAM Vitilevure Chardonnay Vitilevure GY Vitilevure Syrah Instant SC SDL Prim 10 SDL Tuf 4 CBS 1171 (Type strain)

ARTICLE IN PRESS
58 E. Vaudano, E. Garcia-Moruno / Food Microbiology 25 (2008) 5664

completely frozen), and then placed in a thermomixer (Eppendorf AG, Hamburg, Germany) at 95 1C with no agitation for 1 min to thaw them quickly. The process was repeated once, and the tubes were vortexed at maximum speed for 30 s. The tubes were chilled on ice and 200 mL of chloroform was added. They were then vortexed for 2 min and centrifuged at 20,000g for 5 min at 5 1C. The supernatants were transferred to new tubes and 400 mL of pure ice-cold ethanol were added to each. The samples were allowed to precipitate for 10 min at 20 1C and then centrifuged at 20,000g for 10 min at 5 1C. The supernatants were discarded and the DNA pellets were washed with 0.5 mL 70% (v/v) ethanol followed by vacuum drying at 45 1C. The DNA was resuspended in 15 mL TE (10 mmol L1 Tris, 1 mmol L1 EDTA, pH 8.0). During the second step, when the applicability of the method in competition trials was tested, PCR was directly performed on cells picked from a colony with a micropipette tip and resuspended in a PCR mix previously distributed in 0.2 mL wells. 2.3. PCR and electrophoresis Three microsatellite loci, SC8132X, YOR267C and SCPTSY7, were used because of their high degree of polymorphism (Field and Wills, 1998; Gonzalez Techera et al., 2001). Amplication was performed with pairs of specic forward and reverse primers (Table 2). The primers for SC8132X and the forward primer for YOR267C were designed by Field and Wills (1998), the reverse primer for YOR267C was made by Gonzalez Techera et al. (2001), rez while the forward primer for SCPTSY7 was made by Pe et al. (2001). The reverse primer for SCPTSY7 was designed by us using Primer 3 free software to generate amplicons that would cause banding in distinct positions and not overlap the other two loci. PCR amplications were performed in a Biorad MyCycler thermal cycler (Biorad Laboratories, Inc. Hercules USA) in 20 mL volumes constituted as follows: 1 mL of extracted DNA solution (2040 ng of DNA), 3.1 mmol L1 MgCl2, 0.4 mmol L1 of each dNTP, 2 mL of 10X PCR buffer minus magnesium, 2 U of Taq DNA polymerase (Sigma Chemical Co., St. Louis, USA), 10 pmol of each primer for locus SCYOR267C, 15 pmol of primers for
Table 2 Primers for amplication of three Saccharomyces cerevisiae microsatellite loci Locus Chromosome Primers

locus SC8132X and 40 pmol of primers for locus SCPTSY7 (MWG Biotech, Ebersberg, Germany). The concentration of all the components of the PCR reaction was optimised to reduce the non-specic amplications. In the fermentation trials, the reaction volumes were 10 mL with the same reagent concentrations in order to economise on the Taq polymerase and other expensive reagents. The protocol, optimised for multiplex amplication of the three loci, was: 4 min at 94 1C, 28 cycles of 30 s at 94 1C, 45 s at 56 1C, 30 s at 72 1C and, nally, 10 min at 72 1C. The products were run on a 2.5% (w/v) agarose MS-8 (Eppendorf AG, Hamburg, Germany) gel (15 10 cm) in TBE buffer at 100 V (constant voltage) for 80 min, and the gel was then stained with ethidium bromide. When used, polyacrylamide electrophoresis was carried out with 8.6 6.8 cm2 precast 10% (w/v) TBE gels (Biorad Laboratories) at 100 V (constant voltage) for 60 min. Sigma low ladder marker set 100-20 bp molecular weight marker (Sigma Chemical Co.) was used. The patterns were processed with cluster analysis software (Bionumerics, Applied Maths, Keistraat, Belgium) using a Dice binary similarity index, and the dendrogram was built with the UPGMA method. Cophenetic correlation was applied to ascertain reliable and unreliable cluster as described by Rossetti and Giraffa (2005). The cophenetic correlation in percent is shown at each branch.

2.4. Repeatability of the method and stability of the microsatellite markers Repeatability was tested by performing the amplication on ve colony DNA extractions for each strain, and the amplication products were analysed with agarose electrophoresis in ve different runs. In order to verify the stability of the microsatellite markers during alcoholic fermentation, trials were carried out with three randomly selected strains: strain 2 (DSM ` ge Chardonnay) and strain Fermivin), strain 3 (DSM Cepa 5 (Vitilevure DV10). After rehydration, each was singly inoculated in a 500 mL ask of sterile grape must. Fermentation at 16 1C was completed in 20 days.

Size in bp as expected by BLAST (s288c strain)

SC8132X YOR267C SCPTSY7

XVI XV XIII

FW: CTGCTCAACTTGTGATGGGTTTTGG RV: CCTCGTTACTATCGTCTTCATCTTGC FW: GGTGACTCTAACGGCAGAGTGG RV: GGATCTACTTGCAGTATACGGG FW: AAAAGCGTAAGCAATGGTGTAGAT RV: AAATGATGCCAATATTGAAAAGGT

174 411 295

ARTICLE IN PRESS
E. Vaudano, E. Garcia-Moruno / Food Microbiology 25 (2008) 5664 59

Analysis was performed on 10 randomly selected colonies sampled at the beginning and end of fermentation for each strain. 2.5. Fermentations ` ge Chardonnay Two S. cerevisiae strains, DSM Cepa (strain 3 listed in Table 1) and Vitilevure DV10 (strain 5) were selected for the fermentation trials because of their similar application and characteristics (use in white grape fermentation, alcohol tolerance and phenotype killer), as reported by the producers. Vitilevure DV10 is indicated as cryotolerant. Sterile grape must was employed (Biotta AG, Tagerwilen, Switzerland). Ammonium sulphate and ammonium phosphates, at a concentration of 150 mg L1 for each compound, were added as nitrogen supplements to the fermentations. Sucrose was added to reach 200 g L1 of total sugars. Fermentations were carried out by placing 1.6 L of sterile must in a 2 L conical ask, containing a magnetic stirrer. The apparatus was capped with a rubber cap with a hole, into which a cotton-tipped Pasteur pipette was inserted. A single strain was agar plated and one colony was picked and tested with multiplex PCR analysis to verify its identity. Afterwards, the same colony was resuspended in preculture medium consisting of a sterile grape must supplemented with nitrogen and without the addition of sugar. After 24 h of aerobic growth at 20 1C with 100 oscillations per minute, a mixed inoculum was made in equal proportions using 5 105 cells mL1 for each strain. Trials with a single strain inoculum of 1 106 cells mL1 were performed to verify the ability of each strain to complete the fermentation. Fermentations were conducted at 15 and 20 1C and were performed in duplicate under all conditions. Samples were taken at the same points in the fermentation process for each trial: initial must (10 min after the inoculum), must with 60% of residual sugar, must with 30% of residual sugar and end time fermentation (o2 g L1). The sugar concentrations in the fermentations were monitored by HPLC using a Polysphere OAKC column (Merck, Darmstadt, Germany) with a refraction index detector. The samples were diluted and spread on YMA medium plates. After incubation for 48 h at 25 1C, colonies from plates containing 150200 colonies were randomly selected for PCR analysis. For each time point, 4860 colonies per replicate were analysed. A total of 900 colonies were tested. 3. Results 3.1. Yeast strain typing The results obtained with agarose electrophoresis are shown in Fig. 1. For each strain, several faint bands were

detected in addition to the intense ones, probably because of non-specic amplication. For two strains exhibiting a large number of these bands, 19 and 30 (type strain), amplication was performed with single locus primers individually, and the band patterns obtained were compared with multiplex amplication results. As shown in Fig. 2, these weak bands were also present in amplications performed with one locus primers alone and are not due to an interaction among primer sets for the three loci. Although they were reproducible, these bands were not considered for polymorphism evaluation. Differences in the numbers and sizes of fragments were found. For strains 1, 3, 4, 6, 8, 10, 11, 15, 20, 24 and 25 only three intense bands were present; however, the majority showed a higher number of fragments varying from one to three for each locus, to generate a total number of bands of from three to nine. The computerised analysis of the band patterns (Fig. 3) revealed, among strains, couples 37, 1829, 820 and 1416 that exhibited a similarity above 80%, with small differences in band size, while two couples of strains 29 and 411 resulted in a 100% similarity coefcient. All the cluster above 80% of similarity results reliable with a cophenetic correlation of 100%. To verify these results, the PCR products were run on a 10% (w/v) TBE polyacrylamide gel and compared with the agarose gel (Fig. 4). This electrophoresis (Fig. 4b) showed that couples, 1829, 820 and 1416 exhibited clear and estimable differences in band numbers and/or positions. The results from couples 37 and 411 were quite similar but distinguishable with regard to the amplicons generated with the SCPTSY7 primer set for the couple 37, and to the amplicons generated with SCPTSY7 and SC8132X for the couple 411. Finally, DSM Fermivin (strain 2) and Laffort Zymaore ST (strain 9) showed identical proles in all electrophoresis analyses. In the repeatability test, all ve repetitions for each strain gave the same band pattern, with the fragments showing standard deviations that did not exceed 1.5% (Table 3) of the average size of the fragment, and the patterns, analysed using Bionumerics software, matched with 100% similarity coefcients. The amplications performed at the beginning and the end of the fermentations on the three selected strains yielded the same proles and showed that microsatellite markers are stable throughout fermentation (data not shown). 3.2. Fermentation In the fermentation trials, no differences in band prole were found when PCR was performed directly on the colonies by picking and resuspending the cells, with respect to the amplication made on DNA extracted by a freezethaw method. The bands were sharp and the differences between the two strains used were evident. The noise

ARTICLE IN PRESS
60 E. Vaudano, E. Garcia-Moruno / Food Microbiology 25 (2008) 5664

Size (bp)

10

11

12

Size (bp)

400 300 200

400 300 200

Size (bp) M

13

14

15

16

17

18

19

20

21

22

23

24

Size (bp)

400 300 200

400 300 200

Size (bp) M

25

26

27

28

29

30

Size (bp)

400 300 200

400 300 200

Fig. 1. Electrophoretic patterns of the 30 strains obtained with 2.5% agarose gel. Correspondence number-strains are reported in Table 1.

Size (bp)

Size (bp)

400 300 200

400 300 200

Fig. 2. Electrophoretic patterns of strain 19 (a) and 30 (b) obtained with 2.5% agarose gel. PCR: singleplex locus SCPTSY7 (lanes 1), SC8132X (lanes 2), YOR267C (lanes 3), multiplex (lanes 4). Correspondence number-strains are reported in Table 1.

represented by proteins and other cellular components ran very rapidly and did not interfere with DNA migration (Fig. 5). The performances of the two strains in the fermentation trials are represented in Fig. 6. In a 15 1C trial, strain 5 rapidly dominated the fermentation; after 30% of the

sugars were consumed, this strain reached 70% of the total population and, at the end of the fermentation, strain 3 virtually disappeared (Fig. 6a). In the 20 1C fermentation (Fig. 6b), the behaviour of the two strains was different. In the rst half of the trial, they co-dominated, while in the latter stages of fermentation,

ARTICLE IN PRESS
E. Vaudano, E. Garcia-Moruno / Food Microbiology 25 (2008) 5664 61

Fig. 3. Cluster analysis of the 30 strains analysed with 2.5% agarose gel using Dice similarity coefcient. Dendrogram was built with UPGMA method. Cophenetic correlation in percent is shown at each branch. Correspondence number-strains are reported in Table 1.

the strain 5 population increased. When the sugars were totally consumed, strain 5 represented 8590% of the total population.

4. Discussion Although sequence analysis, which allows accurate determination of amplicon size, remains the reference standard for strain microsatellite typing, the high cost and limited output are obstacles to routine application in the oenology eld. The method we have proposed based on the analysis of patterns generated by multiplex PCR could be a

good compromise among discriminatory ability, time required for analysis and cost. We were able to distinguish among 29 commercial strains of the 30 tested; the strains that showed high similarity with agarose electrophoresis were further analysed and distinguished with a polyacrylamide precast gel. Only two, DSM Fermivin and Laffort Zymaore ST, were indistinguishable, both with agarose and polyacrylamide gel electrophoresis. Recently, genetic analysis of these two strains using 17 polymorphic markers (Bradbury et al., 2005) revealed only slight differences in four loci, including SC8132X (YPL009C). The SC8132X locus showed, in this study, one allele in DSM Fermivin and two in Laffort Zymaore ST, separated by 47 bp. This substantial difference should be discernible with agarose or polyacrylamide gel electrophoresis; our analysis, however, showed total identity between the two strains with no difference in amplicon number and size in SC8132X amplication. This disagreement could be due to a small genetic difference caused by mutation during the production process of different lots of yeast. Another hypothesis is that the yeast producer sells two yeast strains with the same commercial name in different markets. Interestingly, some strains gave a large number of intense bands. When the numbers of bands per locus is greater than one, this is probably due to heterozygosis of the loci in diploid, polyploid or aneuploid strains, which are common among selected wine yeasts (Bakalinsky and Snow, 1990; Hennequin et al., 2001; Bradbury et al., 2005); for strains that give one band per locus, no estimate of ploidy could be made. The results obtained from direct PCR of the colony revealed the simplicity and robustness of the method. Furthermore, the possibility of bypassing the DNA extraction step speeds up the processing time and the use of high-resolution agarose represent a benet in term of safety and cost. In ecological studies of yeast, where the ability to follow the growth of a single S. cerevisiae strain with a statistical, well-based approach is fundamental, the opportunity to quickly, cheaply and reliably carry out genetic analysis of hundreds of samples is an obvious advantage. In our study, we have observed the growth of two strains co-inoculated at two different temperatures of fermentation. The different behaviours at the two temperatures conrm the inuence of this parameter on the development and interaction of the S. cerevisiae strains (Fleet and Heard, 1993; Torija et al., 2003). Strain 5 was shown to be, as reported by the producer, more cryophilic than strain 3, as it dominated thoroughly the trial at 15 1C and proved to be more adaptative during low temperature fermentations. At 20 1C, the two strains were equally present in the rst phases of fermentation; however, under this condition, strain 5 demonstrated its superior competitive ability by dominating the nal phase of fermentation when the ethanol concentration increased. The variation in tolerance

ARTICLE IN PRESS
62 E. Vaudano, E. Garcia-Moruno / Food Microbiology 25 (2008) 5664

Size (bp) M

11

29

18

20

16

14

Size (bp)

400 300 200

400 300 200

Size (bp)

11

29

18

20

16

14

Size (bp)

400 300 200

400 300 200

Fig. 4. Electrophoretic patterns of strains with similarity above 80% obtained with 2.5% agarose gel (a) and 10% polyacrylamide TBE gel (b). Correspondence number-strains are reported in Table 1.

Table 3 Example of repeatability obtained with the method on ve Saccharomyces cerevisiae strains Strain no. 3 4 9 11 30 Mean of band size (n 5)7S.D. 39273, 39174, 39372, 39273, 42576, 26571, 25072, 28574, 24572, 24573, 21771 21171 26672, 23771, 22071, 17072 20173 21172, 14671

Correspondence number-strains are reported in Table 1.

Fig. 5. Example of electrophoretic patterns obtained with 2.5% agarose gel of PCR products, performing direct colony PCR during fermentation trial: prole (a) strain 3, prole (b) strain 5. Correspondence numberstrains are reported in Table 1.

to this potentially toxic molecule, which is one of the major causes of sluggish and stuck fermentation (Casey and Ingledew, 1985; DAmore and Stewart, 1987; Carrasco et al., 2001) may explain the proportion of the two strains at the middle-end phase. In conclusion, rapid colony DNA extraction without the use of dangerous reagents, such as phenol, or expensive reagents, such as uorophore-marked primers and specic Taq polymerase, plus the use of agarose for electrophoresis, make this method suitable for routine application. Once the colonies have grown, only 4 h are needed to obtain band proles. Furthermore, with direct PCR of individual colonies, the time should be further reduced at less of 3 h, allowing one to process hundreds of samples per day using 96-well plates. The method can be applied to quality assurance in the yeast industry to detect wild yeast contamination and control inoculum purity. In wine production, the interaction between the yeast and the metabolites present in the must is fundamental to the expression of sensory characteristics. Although the method is culture-dependent and therefore is not rapid enough to have a real time monitoring, the ability to verify the dominance or proportion of selected strains would be helpful in selecting an optimal strain for every kind of fermentation, in optimising the yeast inoculum and in evaluating the sensory impact of strains in winery fermentations. A culture-independent application of microsatellite multiplex PCR could be performed with the aim to avoid the colony

ARTICLE IN PRESS
E. Vaudano, E. Garcia-Moruno / Food Microbiology 25 (2008) 5664 63 Baleiras-Couto, M.M., Ejisma, B., Hofstra, H., Huis int Veld, J.H.J., Vossen, J.M.B.M., 1996. Evaluation of molecular typing techniques to assign genetic diversity among Saccharomyces cerevisiae strains. Appl. Environ. Microbiol. 62, 4146. Beh, A.L., Fleet, G.H., Prakitchaiwattana, C., Heard, G.M., 2006. Evaluation of molecular methods for the analysis of yeasts in foods and beverages. In: Hocking, A.D., Pitt, J.I., Samson, R.A., Thrane, U. (Eds.), Advances in Food Mycology, Series: Advances in Experimental Medicine and Biology, vol. 571, pp. 69106. Blondin, B., Vezinhet, F., 1988. Identication des souches de levure lectrophore ` ses en champ oenologiques par leur caryotypes obtenus en e e. Rev. Fr. Enol. 28, 711. pulse Bradbury, J.E., Richards, K.D., Niederer, H.A., Lee, S.A., Dumbar, P.R., Gardner, R.C., 2005. A homozygous diploid subset of commercial wine yeast strains. Antonie Van Leeuwenhoek 3, 112. Cameron, J.R., Loh, E.Y., Davis, R.W., 1979. Evidence for transposition of dispersed repetitive DNA families in yeast. Cell 16, 739751. Carle, G., Olson, M., 1985. An electrophoretic karyotype for yeast. Proc. Natl. Acad. Sci. U.S.A. 82, 37563760. Carrasco, P., Querol, A., Del Olmo, M., 2001. Analysis of stress resistance of commercial wine strains. Arch. Microbiol. 175, 450457. Casey, G.P., Ingledew, W.M., 1985. Reevaluation of alcohol synthesis and tolerance in brewers yeast. J. Am. Soc. Brew. Chem. 43, 7583. DAmore, T., Stewart, G.G., 1987. Ethanol tolerance of yeast. Enzyme Microb. Technol. 9, 322330. De Barros Lopes, M., Soden, A.S., Henschke, P.A., Langridge, P., 1996. PCR differentiation of commercial yeast strains using intron splice primers. Appl. Environ. Microbiol. 62, 45144520. De Barros Lopes, M., Rainieri, S., Henschke, P.A., Langridge, P., 1999. AFLP ngerprinting for analysis of yeast genetic variation. Int. J. Syst. Bacteriol. 49, 915924. pez, R., 1999. The Epifanio, S.I., Gutierrez, A.R., Santamar a, M.P., Lo inuence of oenological practices on the selection of wild yeast strains in spontaneous fermentation. Am. J. Enol. Vitic. 50 (2), 219224. ndez-Espinar, M.T., Lo pez, V., Ramo n, D., Bartra, E., Querol, A., Ferna 2001. Study of the authenticity of commercial wine yeast strains by molecular techniques. Int. J. Food Microbiol. 70, 110. Ferraro, T., Schill, J., Ballas, C., Mulholland, N., Golden, G., Smith, G., Buono, R., Berrettini, W., 1998. Genotyping microsatellite polymorphism by agarose gel electrophoresis with ethidium bromide staining: application to quantitative trait loci analysis of seizure susceptibility mice. Psychiatr. Genet. 8, 227233. Field, D., Wills, C., 1998. Abundant microsatellite polymorphism in Saccharomyces cerevisiae, and the different distributions of microsatellites in eight prokaryotes and S. cerevisiae, result from strong mutation pressures and a variety of selective forces. Proc. Natl. Acad. Sci. USA 95, 16471652. Fleet, G.H., Heard, G.M., 1993. Yeasts: growth during fermentation. In: Fleet, G.M. (Ed.), Wine Microbiology and Biotechnology. Harwood Academic Publisher, Chur, Switzerland, pp. 2754. Gonzalez Techera, A., Jubany, S., Carrau, F.M., Caggero, C., 2001. Differentiation of industrial wine yeast strains using microsatellite markers. Lett. Appl. Microbiol. 33 (1), 7175. Harju, S., Fedosyuk, H., Peterson, K.R., 2004. Rapid isolation of yeast genomic DNA: Bust n Grab. BMC Biotech 4. /http://www. biomedcentral.com/1472-6750/4/8S. Hennequin, C., Thierry, A., Richard, G.F., Lecointre, G., Nguyen, H.V., Gaillardin, C., Dujon, B., 2001. Microsatellite typing as a new tool for identication of Saccharomyces cerevisiae strains. J. Clin. Microbiol. 39 (2), 551559. Howell, K.S., Bartowsky, E.J., Fleet, G.H., Henschke, P.A., 2004. Microsatellite PCR proling of Saccharomyces cerevisiae strains during wine fermentation. Lett. Appl. Microbiol. 38, 315320. Lambrechts, M.G., Pretorius, I.S., 2000. Yeasts and its importance to wine aromaa review. S. Afr. J. Enol. Vitic. 21, 97129. Legras, J.L., Ruh, O., Merdinoglu, D., Karst, F., 2005. Selection of hypervariable microsatellite loci for the characterization of Saccharomyces cerevisiae strains. Int. J. Food Microbiol. 102, 7383.

100% 90% Frequency of colonies tested 80% 70% 60% 50% 40% 30% 20% 10% 0% 100 60 30 Residual sugar (%) 0

100% 90% Frequency of colonies tested 80% 70% 60% 50% 40% 30% 20% 10% 0% 100 60 30 Residual sugar (%) 0

Fig. 6. Fermentation of grape must with mixed inoculum of strains. (a) 15 1C fermentation. (b) 20 1C fermentation. : strain 5, : strain 3. Bars represent standard error. Correspondence number-strains are reported in Table 1.

step and to have a rapid tool for the control of implantation, allowing the winemaker to intervene rapidly during fermentation. Acknowledgements We are grateful to Lia Rossetti and Giorgio Giraffa of the CRA-Istituto Sperimentale Lattiero Caseario, Lodi Italy for the assistance in cluster analysis with Bionumerics software. References
Bakalinsky, A., Snow, R., 1990. The chromosomal constitution of wine strain of Saccharomyces cerevisiae. Yeast 6, 367382.

ARTICLE IN PRESS
64 E. Vaudano, E. Garcia-Moruno / Food Microbiology 25 (2008) 5664 n, D., 1992. Molecular Querol, A., Barrio, E., Huerta, T., Ramo monitoring of wine fermentations conducted by active dry yeast strains. Appl. Environ. Microbiol. 58, 29482953. Rossetti, L., Giraffa, G., 2005. Rapid identication of dairy lactic acid bacteria by M13-generated, RAPD-PCR ngerprint databases. J. Microb. Methods 63 (2), 135144. Routman, E., Cheverud, J., 1994. A rapid method of scoring simple sequence repeat polymorphism with agarose gel electrophoresis. Mamm. Genome 5, 187188. Schuller, D., Valero, E., Dequin, S., Casal, M., 2004. Survey of molecular methods for the typing of wine yeast. FEMS Microbiol. Lett. 231, 1926. Swiegers, J., Bartowsky, E., Henschke, P., Pretorius, I., 2005. Yeast and bacterial modulation of wine aroma and avour. Aust. J. Grape Wine Res. 11, 127138. ` s, N., Poblet, M., Guillamo n, J.M., Mas, A., 2003. Torija, M.J., Roze Effects of fermentation temperature on the strain population of Saccharomyces cerevisiae. Int. J. Food Microbiol. 80, 4753. pez, V., Ferna ndez-Espinar, M.T., Barrio, E., Ramo n, D., Querol, A., Lo 2003. A new PCR-based method for monitoring inoculated wine fermentations. Int. J. Food Microbiol. 81, 6371. , M., 2005. Malgoire, J.Y., Bertout, S., Renaud, F., Bastide, J.M., Mallie Typing of Saccharomyces cerevisiae clinical strains by using microsatellite sequence polymorphism. J. Clin. Microbiol. 43, 11331137. Montrocher, R., Verner, M.C., Briolay, J., Gautier, C., Marmeisse, R., 1998. Phylogenetic analysis of the Saccharomyces cerevisiae group based on polymorphism of rDNA spacer sequences. Int. J. Syst. Bacteriol. 48, 295303. e, F., Dubourdieu, D., Aigle, M., Dulau, L., 1993. Ness, F., Lavalle Identication of yeast strain using the polymerase chain reaction. J. Sci. Food Agric. 62, 8994. rez, M.A., Gallego, F.J., Mart nez, I., Hidalgo, P., 2001. Detection and Pe selection of microsatellites (SSRs) in the genome of the yeast Saccharomyces cerevisiae as molecular markers. Lett. Appl. Microbiol. 33 (1), 461466.