MODUL TASK 1: Tanggal 25 April 2011 A. GAMETOGENESIS : 1. Draw and describe various stages of mitosis ! 2.

What is the role of meiosis in gametogenesis? And how it could be ? 3. Describe the differences between meiosis in male and female by considering the started time and the time of arrested, the number of daughter cell, etc 4. What is the most common cause of abnormal chromosome number ? Give an example of clinical syndrome in relation to abnormal number of chromosomes 5. Draw and describe the stage and morphological changes during production and maturation of sperm and oocyte! What hormones do stimulate and control those process ? B. TRANSPORT OF GAMETES AND FERTILIZATION 1. How can woman recognize of having ovulation? Are there any signs, symptomps or tools indicating this process? 2. What is corpus albicans ? explain its function in menstrual cycle and pregnancy ! 3. Explain such phases of fertilization and how the egg respond to fertilization ? 4. Are there any contraception methods for men? Give more explanation ! 5. Describe anything about IVF !

C. CLEAVAGE, IMPLANTATION, and PLACENTATION 1. Unrecognized abortus is a phenomenon of loosing embryo before woman realizes that she is pregnant. What is the advantages of this phenomenon and how it could be happened? 2. Describe such phases on endometrium during menstrual cycle ! Is there any correlation with ovarian cycle ? 3. What is the function of zona pellucida after fertilization to implantation stage ? 4. During implantation process, the trophoblast is invading the maternal tissue. As trophoblast contains approximately 50% paternal genes; thus, this trophoblast is assumed as foreign body. However, there is no rejection to the conceptus / fertilization process immediated by immunologic respon in mothers system. What is the underlying reason? 5. What is placental barrier ? Does it provide absolute integrity of the fetal and maternal circulation ? Give more explaination ! D. GENERATE MULTIPLE CELL LAYER 1. What is gastrulation ? Describe it on the basis of timing, function, and mechanism ! 2. Describe the process of neurulation ! 3. A 28-years old mother had delivered twins babies. Doctor who had helped her found that the babies have a common placenta, a common amniotic cavity and a common chorionic cavity. Could you explain this phenomenone ? E. FETAL DEVELOPMENT 1. How to calculate gestational age ? 2. Describe main external characteristics in fetal period ! MODUL TASK 2: Tanggal 26 April 2011 1. We present a DNA sequence below a. Translate below DNA sequence into amino acids form (in abbreviation): CCTCTTTTGCTCTGGTATACATCGTATTCG Page |1

b. Change above sequence into a new sequence affected by mutation at T18A. Furthermore, translate it into amino acid form. c. What type of mutation occur on above process ? give axplanation about the effect of that mutation to the protein product? 2. The sequence below shows a small portion of codon 5-8 the normal -hemoglobin mRNA and the sequence of sickle-cell anemia patients at the same segment. Normal: --- CCA GAA GAG AAG --Sickle-cell anemia patient: --- CCA GUA GAG AAG --In regard to above mutation, explain the underlying mechanism occur in DNA and mention the differentiation of amino acid sequence! 3. Brother of Mrs A has a severe haemophilia. He died at 8 years old due to a cerebral bleeding. However, Mrs A has also 3 healthy brothers whom were un-affected.

I:1

I:2

4. 5. 6. 7. 8.

Fig. 1 The pedigree of Mrs A family a. What is the mode of inheritance? Give a reason for your answer! b. What is the chance of Mrs A to be a carrier for haemophilia A? c. The possibility hemophilia by a carrier II:1of the son (individu II:2III:1) to suffering II:3 II:4 mother is II:5 d. What is the laboratory analysis to detect the mutation in haemophilia cases? e. In condition of no mutation occur to individual I:2s blood, what is the possible explanation for II:1 haemophilia status? Why is it important to know your patient's ethnic background? Why should you ask about consanguinity? Mention three genetic causes of Down syndrome and mention the prevalence for all those causes Referring to no. 5 question, mention the recurrence risk for a sibling with Down syndrome for each causes. Even though condition such as Down syndrome and Edwards syndrome can usually be diagnosed by clinical examination alone, a karyotype is always recommended. Give the reason for this ! Mr. and Mrs. Wahyu bring 2-years old child, Ninik, to do cytogenetic analysis as referred by a pediatrician. She was diagnosed as Down Syndrome because of specific signs such as upslanting palpebral fissure, hyperterolism, telechantus, flat nasal bridge, big tongue, hypotonic mouth, simean creases in both palm, and clynodactily. Ninik is their first child. Mr. Wahyu age is 29 years old and Mrs. Wahyu age is 26 years old. Niniks karyotype is: 46,XX,der(21;21)(q10;q10). a. What can be intrepreted from the result of above karyotype? b. What is the next step should be done? c. In regard to further step should be done as you explain in no.b, if those couple want to have more children, what is your suggestion ? d. Please draw the possibility of pairing homologue and the segregation occured in Meiosis I to produce Niniks karyotype: Page |1 2

9. What will you do to determine the sex status of suspected patient with development sex disorder in case ambiguous genitalia? 10. Case of Alterina in 2010 as widely reported by such media, various opinions emerge talking about gender. The chromosome analysis showed 47, XXY showing Klinefelter's syndrome, men with excess X chromosome. However, considering other laboratory finding which showed his two X chromosomes, Alterina was defined as women so that he joined womens prison a. According to your knowledge, what the name of laboratory analysis which only detect the presence of chromosome X? b. What is the basis explanation of above laboratory analysis ? MODUL TASK 3: Tanggal 25 April 2011 1. What are the fetal period and characterized ? 2. When is increase in weight of gestation? 3. How length is gestation? 4. How is growth of the head in fetal life? 5. What are growth of fetal life from fourth until ninth months? 6. What are factors determining of Birth Defects and 5 example agent and effect at Congenital Malformations?

SUB MODULE 2a NEONATAL INTRODUCTION MODULE TASK Tanggal 27 April 2011 1. What is the parameter for LBW baby that allowed to be discharge? And what are monitoring follow-up after coming home: 2. In infants who do not drink breast milk, what was done to prevent hypoglycemia? 3. Please mention clasification of newborn body temperature: 4. How to prevent of heat loss in newborn based on mechanism of heat loss in newborn? 5. Please mention the definition of normal newborn

SUBMODULE 2 b NEONATAL ADAPTATION Modul task Tanggal 28 April 2011 1. Neonatal adaptation demand to 2. Mention organ that involves in adaptation in newborn baby 3. What are the differences between fetal circulation and neonatal circulation? 4. What happen in neonatal pulmonary adaption? 5. What happen in neonatal gastrointestinal adaptation? 6. What happen in neonatal urogenital adaptation? 7. How about imunologic status in fetus and newborn? SUB MODULE 2C NEONATAL PHYSIC DIAGNOSTIC MODULE TASK Tanggal 29 April 2011 1.After knowing the normal physical growth, can you make Flowchart Examination of the newborn baby ? 2.What is red flags in physical growth? 3.What is the steps of neonatal physical examination? 4. Mention all of important anamnesis that need attention before examination of the baby
Page |1 3

5. Things that we needed when the we do physical examination: SUB MODULE 2d BREASTFEEDING MANAGEMENT MODULE TASK Tanggal 2 Mei 2011 1. Can the mother take prescribed or over-the-counter medications when the mother breastfeeding? 2. When do the mother need to call my babys health care provider? 3. Can the mother breastfeed the premature baby?. 4.Should mothers who smoke breastfed? 5. How do mother know that her baby is getting enough milk? SUB MODULE 3A GROWTH & DEVELOPMENT IN CHILDREN MODULE TASK Tanggal 3 Mei 2011 1. Mention the Red Flag (abnormality of development) in motor development and when is the time to make decision to refer this child to the hospital? 2. Mention Red Flag in cognitive development 3. Mention Red Flag in psychosocial development that can be detected since he/she was a baby SUB MODULE 3b GROWTH & DEVELOPMENT EXAM IN CHILDREN MODULE TASK Tanggal 4 Mei 2011 1. How do the hormones, brains, and circadian rhythms od adolescents differ from those of younger children? 2. The endocrine system consists of a large number of different tissues and organs. Explain what endocrine tissue or organ and hormones involves in puberty. 3. Give a brief description of the mechanisms Hypothalamic-pituitary-gonadal axis for puberty process. 4. Give a brief description how to asses normal girls puberty and tanners system staging. 5. Give a brief description how to asses normal boys puberty. 6. What changes occur in the bodys size and shape during adolescence? 7. What is precocious puberty and what causes it ? 8. What is precocious delayed puberty in boys and girls, and what causes it ? DEVELOPMENT IN ADOLESCENT MODUL TASK Tanggal 5 Mei 2011 1. Mention developmental changes in adolescents that impact parenting and communication 2. What should we do to face the psychosocial changes in adolescent? 3. What the parents can do to face the cognitive changes in adolescent? 4. Can you explain about identity search period? 5. Explain the psychological problems that can happen in adolescence and why it can happen? 6. Give brief description risk-taking behavior that happen in adolescence and why it can happen? Mention some anticipatory guidance for parents of adolescent in every stage of adolescent (early,middle,late adolescent). SUB MODULE 3c: IMMUNIZATION MODULE TASK Tanggal 26 April 2011 1.Why should all the children be vaccinated? What are the importance? 2. Why are some of these vaccines still needed if the diseases are not as common anymore? 3. Do vaccines even work? It seems like most of the people who get these diseases have been vaccinated
Page |1 4

4. Mention contraindication of each vaccines (BCG,Hepatitis B, DPT, Polio,Measles) 5.What ingredients are in vaccines?are they safe? SUB MODULE 3d: REHABILITATION IN SPECIAL CASES/MEDICAL REHAB IN CHILDREN MODULE TASK : Tanggal 4 Mei 2011 Explain the definition of Cerebral Palsy, the risk factors of Cerebral Palsy, and the Therapeutic Management of Cerebral Palsy. SUB MODULE 4a: DEMOGRAPHY, EPIDEMIOLOGY OF ELDERLY, ITS CLINICAL IMPLICATION Modul Task 1 Tanggal 6 Mei 2011 1. Find data on population demographics and the elderly in Indonesia by BPS (Central Bureau of Statistics) 2. Find data on chronic diseases that occur in the elderly in Indonesia 3. Find data on causes of death most of the elderly in Indonesia
Modul Task 2 Tanggal 6 Mei 2011 Task Module 1. What are the explanations of the theory: Free Radicals, glycosylation and DNA repair. 2. Look for changes in anatomical and fisologis because of the aging process, on the organs: a. Endocrine System e. Urinary system / kidneys i. Senses b. Cardiovascular System f. Musculoskeletal system j. Immune system c. Respiratory System g. Nervous system d. Hematological System h. Gastrointestinal System Task Module 3 Tanggal 4 Mei 2011 Write down everything about your grandmother / grandfather / great-brother that are older than 60 years in terms of: 1. How is his /her health condition, if he/she is ill, is her/his illness affects anything? 2. How daily activities, whether normal like you, or need help to deal with everyday activities?, What activities need to be assisted, and who helped? 3. What level of intelligence / cognitive, is it still good or has dementia or forgetfulness 4. What about the psychological condition, if unstable, or easily offended, angry, suspicious, or easily upset / crying 5. How is your impression of the nutritional status of body posture (skinny, pretty or fat)?, Whether his /her appetite is still good or has been reduced. If reduced or skinny, what are the causes? 6. For the needs of daily life where is obtained it cost? 7. If sick, is there any health insurance for the grandmother / grandfather ? 8. With who your grandmother / grandfather / great-brother stay home?

SUB MODULE 4E PHARMACOTHERAPY IN AGING MODULE TASK : Tanggal 9 Mei 2011 1. Explain the pharmacokinetic changes caused by increasing age that affect drug level and adverse drug reaction. 2. To avoid or reduce adverse drug reactions, how can we give pharmacotherapy to the elderly patient.
Page |1 5

SUB MODULE 4d EXERCISE IN ELDERLY Modul Task Tanggal 10 Mei 2011 1. What kind of exercise that the elderly can do at home, and what kind of advice that you recomended for the elderly and their family ? 2. What of benefits exercise for elderly ? 3. Please prescribe that you recommended for a man elderly 65 year old in order to safe exercise ? SUB MODULE 4C: NEUROPSYCHIATRIC DISORDER & OVERVIEW of GERIATRIC GIANTS MODUL TASK Tanggal 9 Mei 2011 1. What is the definition and domain of cognitive function ? 2. Explain the neuroanatomy and physiology of memory ! 3. Explain the classification of memory by temporal direction and information type ! 4. What is the definition aphasia motoric and sensoric ? 5. What is the definition and caused of dementia ? SUB MODULE 5a: NUTRIGENOMICS & MICRONUTRIENT MODULE TASK Tanggal 11 Mei 2011 4. Please explain the effects of fermented soybean in gene expression 5. Explain about the digestion system, the enzymes that involves and the absorption process in our body. 6. Explain about classification of vitamin, its function, metabolism and the disease correlate with vitamin deficiency 7. Explain about mineral that we needs, its role in metabolism and the disease correlate with mineral deficiency 8. Explain the defenses against changes in hydrogen ion concentration in our body 9. Explain about the digestion system, the enzymes that involves and the absorption process in our body. 10. Explain about classification of vitamin, its functions, metabolism and the disease correlate with its deficiency 11. Explain about mineral that we needs, its role in metabolism and the disease correlate with mineral deficiency 12. Explain the defenses against changes in hydrogen ion concentration in our body SUB MODULE 5b NUTRITION IN INFANT MODUL TASK Tanggal 12 Mei 2011 1. Explain about the nutritional daily requirement in infant 2. Explain about the differences between human milk and cows milk 3. Explain about the schedule to give infant feeding 4. Explain about the kind of infant formula 5. Explain about how to assess the nutritional status in infant SUB MODULE 5C NUTRITION IN TODDLER & ADOLESCENCE MODULE TASK Tanggal 13 Mei 2011 1. Explain about how to assessed the nutritional status in toddler and adolescence
Page |1 6

2. Explain about the nutritional daily requirements in toddlers and adolescences 3. Explain about nutritional disorder anorexia nervosa and bulimia nervosa in adolescence SUB MODULE 5d: NUTRITION IN ELDERLY MODUL TASKS Tanggal 16 Mei 2011 1. What is the non-physiological factors that can cause weight loss in elderly with PEM? 2. Can you explain many factors that can affect nutritional assessment in elderly?

Page |1 7