Sei sulla pagina 1di 3

La clonacin y caracterizacin parcial de promotores regulados de Lactococcus lactis Tn917-lacZ Integrantes con el nuevo promotor Probe Vector, PAK

80 Transposn Tn917-LTV1 se utiliz para producir una coleccin de cepas de Lactococcus lactis con la fusin de un gen lacZ sin promotor a loci cromosmicos. Screening 2.500 Tn917-LTV1 integrantes revel 222 que expresan b-galactosidasa en placas a 30 C. Campo pulsado electroforesis en gel revel Tn917-LTV1 inserciones en al menos 13 loci en 15 cepas analizadas. Integrantes en el que bgalactosidasa de expresin estaba regulada por la temperatura o el pH y / o concentracin de arginina fueron aislados. En la mayora de los casos, la regulacin observada en las placas fue reproducible en medio lquido. Un integrante, PA170, produce b-galactosidasa a pH 5,2 pero no a pH 7,0, produce ms b-galactosidasa a 15 y C que a 30 & C, y ha aumentado la actividad galactosidasa b en la fase estacionaria. Fragmentos de ADN potencialmente llevan promotores seleccionados a partir de Lactococcus lactis integrantes fueron clonados en Escherichia coli. Un nuevo promotor vector de sonda, pAK80, que contiene galactosidasa sin promotor b-genes de Leuconostoc mesenteroides subsp. cremoris y Lactococcus lactis subsp. lactis biovar regin citrato diacetylactis replicacin del plsmido se construy, y los fragmentos se insertan lactococcal. El plsmido pAK80 fue capaz de detectar y discriminar incluso promotores dbiles en Lactococcus lactis. Cuando se inserta en pAK80, el promotor clonado a partir de una muestra PA170 expresin regulada de b-galactosidasa anloga a la regulacin observada en PA170. Lactococcus lactis es un microorganismo industrial importante utilizado para producir una variedad de quesos y productos lcteos cultivados tales como suero de leche. La modificacin gentica de Lactococcus lactis puede ser deseable, por ejemplo, para mejorar la produccin de cido, resistencia a bacterifagos, o la produccin de compuestos de sabor por cepas importantes industrialmente. Una mejor comprensin de la regulacin de la expresin gnica en este organismo y una coleccin de promotores regulados facilitara las modificaciones deseadas. Regulacin de la expresin gnica en Lactococcus lactis ha sido objeto de varios estudios (revisado recientemente en las referencias 11 y 36). Una variedad de vectores de seleccin de promotor se han desarrollado estos vectores permiten la deteccin de los promotores en Lactococcus lactis despus de la insercin de fragmentos de ADN en un polienlazador que precede a un gen indicador sin promotor (1, 6, 22, 31, 33, 38). La funcin y la regulacin de estos promotores eran, en la mayora de los casos, no dilucidado. Varios promotores de genes lactococcal definidos se han demostrado ser regulada (9, 12, 15, 35, 39). El anlisis preciso de la regulacin de la expresin gnica no siempre es posible con los sistemas de mltiples copias. Varios transposones que llevan un gen indicador sin promotor se han construido y utilizado como sondas de promotor en enterobacterias (3), que permite el anlisis de la expresin gnica con una copia por cromosoma. Youngman et al. (41) utiliza el gram-positivos Enterococcus faecalis transposn Tn917 para el estudio de los genes de esporulacin en Bacillus subtilis. Recientemente, se inform de que Tn917-lacZ derivados, incluyendo Tn917-LTV1 (8) (Fig. 1) y Tn917-TV32 (40), transposicin en Lactococcus lactis y de que el cromosoma de la bacteria no contiene puntos calientes para inserciones (Tn917 18). Diez Lactococcus lactis Tn917-TV32 integrantes que expresan b-galactosidasa, presumiblemente como resultado de la fusin de promotores cromosmicas en el gen lacZ, se aislaron (18). En este artculo, se describe la produccin de una coleccin de 222 Lactococcus lactis Tn917-LTV1 integrantes que expresan b-galactosidasa (b-Gal1). La seleccin de integrantes en las placas para la expresin regulada de la b-galactosidasa se utiliza como un paso inicial en la identificacin de los sitios en el cromosoma de Lactococcus lactis donde la expresin gnica regulada ocurre tras la insercin de genes. ADN de Lactococcus adyacente al extremo lacZ del transposn Tn917 de cinco integrantes-lacZ se clon en Escherichia coli. Estos integrantes fueron elegidos por b-galactosidasa expresin responde a factores ambientales en relacin con los procesos de produccin utilizados en las industrias lcteas. Un vector promotor nueva sonda, pAK80, fue construido y ha demostrado ser ms sensible que pGKV210 (37) para la deteccin de promotor. Finalmente, se muestra que, cuando uno de los promotores se inserta en pAK80, la regulacin de la expresin gnica es anloga a la regulacin observada en el original Tn917-LTV1 integrante. (Los resultados preliminares de este trabajo fueron presentados en el IV Simposio de bacterias del cido lctico, Noordweijkerhout, Pases Bajos, septiembre de 1993, y en el ASM Cuarta Conferencia Internacional sobre Gentica estreptoccica, Santa Fe, N.Mex., Mayo de 1994.) Materiales y mtodos Cepas bacterianas, medios de cultivo, reactivos y plsmidos. Lactococcus lactis MG1363, MG1614 (14), y derivados habitualmente se cultivan en M17 (34) que contiene 0,5% de glucosa en lugar de lactosa a 308C, a menos que se especifique lo contrario. E. coli DH5a (Life Technologies, Gaithersburg, MD) se cultiv a 378C en medio Luria-Bertani (LB) agar caldo LB o (4). Eritromicina (ERY), cloranfenicol (CAM), ampicilina (AMP), o nitrofenil-bD-galactopiransido (ONPG), y 5-bromo-4-cloro-3-indolil-bD galactopiransido (X-Gal) fueron adquiridos de Sigma Chemical Co. (St. Louis, MO). ERY se utiliza para la seleccin de pGKV210 y derivados de pAK80 en Lactococcus lactis en 5,0 y 1,0 mg / ml, respectivamente. Las concentraciones de CAM usados para la actividad de filtrado promotor en fragmentos de DNA insertados en pGKV210 eran 4, 8, 12, 16, y 20 mg / ml. ERY AMP y se utilizaron para la seleccin en E. coli en 250 y 100 mg / ml, respectivamente. X-Gal se utiliz a 160 mg / ml de Lactococcus lactis. Las enzimas de restriccin se usaron como se recomienda por el proveedor. Los plsmidos se enumeran en la Tabla 1. Produccin y seleccin de fusiones de promotor. Una coleccin de aproximadamente 2.500 Tn917 LTV1 inserciones en el cromosoma de Lactococcus lactis MG1363 fue producido por la tcnica de rplica de galvanoplastia se describe anteriormente (18). Los integrantes se sembraron en placas M17 que contiene ERY y X-gal y se incubaron a 308C durante 40 horas y luego a 208C durante 100 h. Un nmero creciente de b-GAL1 integrantes fueron detectados con concentraciones crecientes de X-Gal, con un mximo a 320 mg / ml. Colonias de color azul se seleccionaron y se volvieron a sembrar una vez en M17 que contiene ERY y X-Gal. Las colonias se volvieron a sembrar fueron nombrados PA1 a PA242. Veintin integrantes murieron durante el proceso restreaking. PA243, que expresa b-galactosidasa, se aisl a partir de una coleccin de 10 Tn917-LTV1 inserciones en el cromosoma de MG1614. Tn917-LTV1 integrantes que muestran pH regulado-b-galactosidasa de expresin se identificaron con M17 (que contena 0,5% de glucosa) y M17arg (que contena 0,1% de glucosa y 0,1% de arginina) placas, ambos suplementados con X-Gal. Despus del crecimiento de Lactococcus lactis durante 20 a 40 h a 308C, el pH fue de aproximadamente 5,3 y 6,9 en M17 en M17arg. El pH se calcula mediante el uso de tiras indicadoras de pH en una suspensin de una colonia en 250 ml de agua bidestilada. El efecto del pH es una consecuencia del catabolismo de la arginina con la formacin concomitante de amoniaco. Placas para el cribado se incubaron a 308C durante 24 h. Identificacin de los integrantes que muestran la temperatura regulada b-galactosidasa de expresin fue por estras en un conjunto duplicado de placas con X-Gal e incubando a 15 y 308C. Para obtener un crecimiento comparable bacteriana en las vetas, las placas se incubaron durante 24 horas a 308C y 190 h a 158C. Inspeccin de colonias individuales no era adecuado para el cribado porque las diferencias en tamao de las colonias fuertemente influenciado el desarrollo del color. En cambio, resultados reproducibles se obtuvieron cuando integrantes fueron parcheados en placas de agar en rayas cortas. ADN preparacin y manipulacin. El plsmido extracciones se realizaron por tcnicas publicadas (por Lactococcus lactis [29, 30] y E. coli [5]). Genmica Lactococcus lactis ADN se purific como se describe por Johansen y Kibenich (19). Hibridaciones Southern sobre digerido con EcoRI del ADN genmico se realiz como se describi previamente (18). 32P sondas marcadas eran o pLTV1 o un fragmento de 4,0 kb EcoRI-de pLTV1 que contiene la regin de replicacin pE194. Preparacin de ADN de Lactococcus lactis genmico, digestin con enzimas de restriccin en bloques de agarosa, y electroforesis de campo pulsado en gel se realizaron como se ha descrito previamente (18). PCRs se realizaron en las condiciones descritas por Pedersen et al. (30). ADN se introdujo en Lactococcus lactis mediante electroporacin de clulas competentes glycinegrown (17) y en E. coli como se describe por Hanahan (16). Los plsmidos que contienen el ADN de Lactococcus lactis cromosmico adyacente al extremo proximal de lacZ de Tn917 se produce a partir de Tn917-LTV1 integrantes como los descritos por Youngman (40) con las modificaciones descritas a continuacin. El ADN cromosmico (100 ng) a partir de Lactococcus lactis Tn917-LTV1 integrantes se digiri con EcoRI, se extrajo con fenol, se precipit con etanol, y se lig en un volumen final de 10 ml. La mezcla de ligacin se introdujo en E. coli, y los transformantes se seleccionaron AMPresistant. Construccin de pGKV210 / C. Un sitio ClaI se introdujo en el polienlazador que precede al promotor cat86 gen en pGKV210 como sigue. Un oligonucletido sinttico, 59 GATCGCCATC GATGGC 39, se hibrid s, produciendo un oligonucletido de doble cadena con extremos cohesivos BamHI y un sitio interno ClaI. Este se insert en el nico sitio BamHI en el polienlazador de pGKV210, resultando en el plsmido pGKV210 / C. La construccin de la sonda de promotor pAK80 vector. Un nuevo promotor vector de sonda de Lactococcus lactis, pAK80, que contiene el plsmido de citrato replicn mnimo (30), un promotor de bgalactosidasa opern derivada de Leuconostoc mesenteroides subsp. cremoris, y un gen de resistencia a eritromicina, se construy como sigue. Un 1,7-kb EcoRI fragmento que contiene el replicn mnimo de la Lactococcus lactis subsp. lactis biovar diacetylactis citrato de plsmido (ori, repB, y; 300 pb de DNA flanqueante [30]) fue clonado a partir pKR41 (13) en el nico sitio EcoRI de pVA891 (24) para producir pAK66, un Lactococcus-E. coli vector lanzadera. El Leuconostoc mesenteroides subsp. cremoris b-galactosidasa genes se obtuvieron a partir de un clon designado pSB1. Este clon fue construido durante el transcurso de la clonacin y secuenciacin de la cepa DB1165 IS1165 (20). PSB1 plsmido contiene un 5,8-kb BglII-SalI fragmento, que contiene la mayor parte de IS1165 y ADN flanqueante, insertado en el polienlazador del pIC19H (25). Anlisis de secuencia de ADN revel que el inserto en pSB1 contiene los genes galactosidasa B-(lacL LACM) de Leuconostoc mesenteroides subsp. cremoris y que son casi idnticos a los de Leuconostoc lactis (10). Slo tres se detectaron diferencias en 830 pb secuenciados. Desde DH5a/pSB1 era azul, a pesar de tener una insercin en el polienlazador pIC19H, los Leuconostoc LACL LACM genes se expresan en E. coli. La sustitucin del promotor LACM lacL con un polienlazador se hizo por PCR. Los dos siguientes se utilizaron cebadores: lac-1, es decir, el 59 ATAGATCTGC AGGATC CCGGGTAACTTTGAAAGGATATTCCTC 39, y lac-2, es decir, el 59 ATTGAGG GTATACGGTGGGCG 39. La parte subrayada de lac-1 es idntico al comienzo del gen lacL y contiene el sitio de unin al ribosoma, pero no la regin reguladora. La secuencia restante contiene una variedad de sitios de restriccin, incluyendo BglII. La lac 2 cebador es complementario con el gen de la b-galactosidasa, recocido 20 pb aguas abajo del nico sitio NcoI. Amplificacin por PCR con estos cebadores amplifica desde el sitio de unin al ribosoma para justo ms all del sitio NcoI, produciendo un fragmento de 360-pb. Este fragmento de 360-pb se purific, se digiri con BglII y NcoI, y se clonaron en NcoI-BglII digerido pSB1, sustituyendo el promotor y todas las secuencias aguas arriba Leuconostoc con un polienlazador. El plsmido resultante se denomin pAK67. El anlisis de secuencia revel ningn inesperados PCR de las alteraciones inducidas. Los codones de parada se introdujeron en el poliengarce de pAK67 con los siguientes dos oligonucletidos complementarios: Stop-1, es decir, 59 GGGTCTAGAT TA 39, y Stop-2, es decir, 59 TAATCTAGAC CC 39. El recocido da una molcula de ADN de extremos romos que contiene un sitio interno de restriccin XbaI. Este pequeo fragmento se clon en el sitio SmaI de pAK67. Estos oligonucletidos se disearon de tal manera que el sitio SmaI se mantendra, un nuevo sitio XbaI estaran presentes en plsmidos con este inserto pequeo, y codones de parada estara presente en todos los tres marcos de lectura. La clonacin se realiz mediante la digestin con SmaI pAK67, tratamiento con fosfatasa, y ligando con una mezcla de los dos oligonucletidos que haban sido tratados con cinasa y recocido. Los transformantes se purificaron, y aquellos en los que el plsmido se haba ganado un sitio XbaI se analizaron adicionalmente. Anlisis de secuencia de ADN revel un clon, pAK67.7, con la estructura deseada. La secuencia de la regin de poliengarce de pAK67.7 se ilustra en la figura. 2A. El paso final en la produccin del vector de sonda de promotor fue la combinacin de los genes manipulados LACM LACL con un replicn y un marcador seleccionable para Lactococcus lactis. Un 4,0kb fragmento HindIII-SalI de pAK67.7 se clon en pAK66 digerido con HindIII y SalI. El plsmido resultante, pAK80, es un promotor de Lactococcus vector de la sonda y se ilustra en la figura. 2B. pAK80 fue demostrado que funciona como un vector de sonda de promotor mediante la insercin de un promotor de Lactococcus lactis tRNA, resultando en el plsmido pAK90 (28). La cepa MG1363 albergar pAK80 o pAK90 se sembr en placas M17 adems de X-Gal. Slo MG1363/pAK90 era azul. El nmero de copias de pAK80 se estim en 5 a 10 copias por clula por comparacin con un patrn de concentracin conocida en geles de agarosa. Medicin de la actividad B-galactosidasa en cultivos lquidos. b-galactosidasa actividad se midi como se describe por Miller (27) con las siguientes modificaciones. Los cultivos crecieron en M17 o M17arg que contiene 1,5 veces la cantidad normal de M17 y se recogieron despus de 20 horas a 308C o 165 horas a 158C. Las clulas se recogieron por centrifugacin y se concentr hasta 10-veces

en tampn Z. Slo medio mililitro de suspensin bacteriana se mezcl con 12,5 ml de 0,1% de dodecil sulfato de sodio y 25 ml de cloroformo en un mezclador vrtex durante 10 s. Despus de 5 min de incubacin en un bao de agua 308C, 100 ml de ONPG (4 mg / ml de un medio [27]) se aadi, y la suspensin se agit con vrtex durante 2 s y se incubaron adicionalmente a 308C. Las reacciones se detuvieron mediante la adicin de 250 ml de carbonato de 1Msodium. Despus de la centrifugacin, A420 y A550 valores se midieron en el sobrenadante. Si A550 valores super 0,050, la muestra se centrifug de nuevo y volver a medir. b-galactosidasa en unidades Miller se calcul como (522 z A420) / (tzvz OD600), donde t es el tiempo en minutos, v es el volumen de cultivo utilizado en el ensayo en ml, y OD600 es la densidad ptica del cultivo a 600 nm. Las fermentaciones. Cuatro fermentadores, cada uno con 1 litro de M17 hecho con 1,5 veces la cantidad normal de M17 y se completar con ERY, se pusieron a funcionar a 308C. La agitacin se mantuvo a 150 rpm sin un suministro activo de aire. pH en el medio de crecimiento fue controlado automticamente por la adicin de HCl 5 M o 5 M NaOH. Fermentadores fueron establecidos para funcionar en paralelo a pH 5,2 y 7,0. Los fermentadores duplicados se inocularon con 10 ml de un cultivo fresco durante la noche cultivados en el mismo medio. Las fermentaciones se realizaron durante 22 h, y el crecimiento se monitoriz midiendo la DO600. Las muestras para la medicin de la actividad de b-galactosidasa fueron tomadas en seleccionados OD600 valores e intervalos de tiempo. Resultados Produccin de fusiones de promotor y la deteccin de la expresin regulada de galactosidasa b. Una coleccin de cerca de 2.500 Tn917-LTV1 inserciones en Lactococcus lactis MG1363 fue producido y proyectado para la produccin de b-galactosidasa. El b GAL1 integrantes muestran diferentes intensidades azules, que van de claro a azul fuerte. Hibridaciones Southern de EcoRI digerido con ADN cromosmico de 12 GAL1 b-integrantes probaron con el vector de transposicin pLTV1 y la replicacin de una regin especfica de la sonda mostr que 11 integrantes tienen una nica copia de Tn917-LTV1 y que un integrante, PA179, tambin contiene ADN del vector (datos no mostrados). La regin de Tn917 LTV1 que precede el sitio de unin al ribosoma y el gen lacZ contiene codones de parada en los tres marcos de lectura. As, b-galactosidasa resultados de la expresin de la fusin transcripcional de los promotores cromosmicos para el gen lacZ sin promotor en Tn917-LTV1. Todos 222 b-GAL1 integrantes fueron seleccionados en placas de la expresin regulada del galactosidasa b. Veinte integrantes mostraron expresin alterada de b-galactosidasa cuando las placas contenan arginina. El pH de las placas que contienen arginina es mayor que la de las placas sin arginina como consecuencia del catabolismo de la arginina y la concomitante liberacin de amonaco. As, estos promotores estn regulados por pH y / o arginina. Trece integrantes mostraron expresin alterada en relacin 158C a 308C que a. En cuatro de estos integrantes, la expresin estaba regulada tambin por el pH y / o arginina Quince integrantes que muestran expresin regulada de b-galactosidasa en placas fueron seleccionadas para el anlisis adicional. Desde Tn917-LTV1 contiene dos sitios SmaI (Fig. 1), la ubicacin de Tn917-LTV1 en fragmentos cromosmicos SmaI se podra establecer mediante electroforesis en gel de campo pulsado. Insercin del transposn en fragmentos SmaI cromosmicos de 50 kb o ms grandes era detectable. PA193 tiene dos copias de Tn917-LTV1 en el cromosoma. La ubicacin de Tn917-LTV1 no se pudo determinar en PA222, muy probablemente debido a que el transposn se ha insertado cerca del extremo de un fragmento SmaI o en un fragmento menor de 50 kb. En los restantes 13 integrantes analizados, Tn917-LTV1 se inserta en al menos 12 posiciones diferentes (Tabla 2). Regulacin de la expresin de b-galactosidasa se analiz en cultivos lquidos. Los integrantes muestran la regulacin por pH y / o arginina tena la misma regulacin en medios lquidos como lo hicieron en placas (Tabla 3), mientras que slo dos de seis integrantes regulado por temperatura de crecimiento en placas fueron regulados por la temperatura en medios lquidos (Tabla 4) . Caracterizacin de pH regulado-b-galactosidasa expresin en PA170. La regulacin del pH potencial de la expresin de b-galactosidasa en el Integrante PA170 se analiz por fermentacin a un pH constante mantenida sin el uso de arginina (Fig. 3A). b sntesis galactosidasa fue claramente dependiente del pH. El aumento de la actividad galactosidasa a pH 5,2 b no era proporcional al aumento de la DO600 (Fig. 3B). La pendiente de la curva es la relacin de cambio de b-galactosidasa relativa al cambio en la masa de clulas. Esta relacin, Db-Gal/DOD600, era menor que 1 en la fase de crecimiento exponencial, pero aument a alrededor de 20 en la fase de crecimiento tarda, es decir, un mayor que 1,9 DO600. As, la expresin de la b-galactosidasa en PA170 est regulado por pH y fase de crecimiento, as como la temperatura (Tabla 4). Clonacin de Lactococcus lactis fragmentos de ADN potencialmente albergar promotores regulados y la insercin en pGKV210. Adems del gen lacZ, Tn917-LTV1 puertos una regin de replicacin ColE1, un gen de b-lactamasa, y un poliengarce (Fig. 1) que permite ADN del husped adyacente a lacZ para ser clonado en E. coli (40). Esta es la principal ventaja al usar Tn917-LTV1 lugar de Tn917-TV32. Clonacin del ADN de Lactococcus adyacente se hizo para integrantes PA143, PA162, PA163, PA170, PA243 y, como resultado los plsmidos designados p143, P162, P163, P170, y P243 (Tabla 1). El promotor sonda pGKV210 vector contiene un gen cat sin promotor precedido por un polienlazador y un gen de resistencia ERY (37). Cuando un fragmento que alberga un promotor se inserta en el poliengarce en la orientacin correcta, el plsmido confiere resistencia CAM. El nivel de resistencia CAM es dependiente de la fuerza del promotor insertado (38). Un sitio ClaI est localizado en Tn917LTV1 30 pb desde el extremo proximal de lacZ (Fig. 1). Los fragmentos EcoRI-ClaI que contienen ADN de lactococos de plsmidos p143, P163, P170, P243 y se insertaron en pGKV210 / C, un derivado de pGKV210 que lleva los sitios EcoRI y ClaI en el polienlazador. Los derivados de pGKV210 / C derivados fueron designados pGKV210 / C :: 143, pGKV210 / C :: 163, pGKV210 / C :: 170, y pGKV210 / C :: 243, respectivamente (Tabla 1). El ADN de lactococos de P162 contiene un sitio ClaI situado 0,7 kb desde el extremo lacZ del transposn. El lactococcal fragmento EcoRI-ClaI de P162 fue insertado en pGKV210 / C para dar pGKV210 / C :: 162u. El lactococcal fragmento ClaI de P162 fue insertado en la orientacin correcta en pGKV210 / C, dando pGKV210 / C :: 162d. Los derivados de pGKV210 / C fueron introducidos en Lactococcus lactis MG1363. La deteccin de la actividad del promotor fue mediante siembra de cultivos de una noche en M17 placas suplementadas con concentraciones Ery y diversos de CAM para determinar la concentracin mxima de CAM en la que se produce el crecimiento. En MG1363, el plsmido pGKV210 / C 243 :: resistencia conferida a 12 mg por ml de CAM, pGKV210 / C :: 143 y pGKV210 / C :: 162u confiere resistencia a 4 mg de CAM por ml, y pGKV210 / C :: 162d , pGKV210 / C :: 163, pGKV210 / C :: 170, y pGKV210 no permiti un crecimiento an en 4 mg de CAM por ml. Insercin de fragmentos de ADN de lactococos en pAK80 y anlisis de la expresin regulada b galactosidasa en Lactococcus lactis. EcoRI-ClaI que contienen fragmentos de ADN de lactococos de plsmidos p143, P163, P170, P243 y se insertaron en pAK80. Debido a que los genes b-galactosidasa de pAK80 contienen sitios ClaI, los fragmentos de EcoRI ClaI se subclon primero en pGEM-7Zf (1). De manera similar, la lactococcal EcoRI-ClaI y fragmentos ClaI de P162 se subclonaron en pGEM-7Zf (1). Los pGEM-7Zf (1) derivados fueron digeridos con XhoI y BamHI, y el ADN de lactococos se insert en el polienlazador de pAK80. Los derivados de pAK80 resultantes se denominaron pAK80 :: 143, por ejemplo (Tabla 1). Los derivados de pAK80 se introdujo en MG1363 de Lactococcus lactis y se seleccionaron para la actividad promotora en placas que contenan ERY y X-Gal. De los fragmentos de ADN lactococcal analizados, todos menos los fragmentos p162d y P163 contena un promotor detectable. El promotor PA162 est contenido en el fragmento p162u, y el fragmento de P163 posteriormente se demostr que contienen un marco de lectura abierto en toda su longitud (datos no mostrados), por lo tanto, un promotor no se espera que en estos fragmentos. La regulacin de los promotores lactococcal en los derivados de pAK80 se compar con la regulacin observada en el original de Tn917-LTV1 integrantes (Cuadros 3 y 4). La regulacin de la expresin de b-galactosidasa en MG1363/pAK80 :: 170 es anloga a la regulacin observada en PA170. Los promotores de los fragmentos restantes o bien perder el Reglamento (MG1363/pAK80 :: 243; pH y / o arginina), invierta el Reglamento (MG1363/pAK80 :: 143; temperatura), o ganar una regulacin inesperado (MG1363/pAK80 :: 243; temperatura). El aumento en el nmero de copia del promotor P143 producido un aumento de 200 veces en la actividad de b-galactosidasa a 308C, mientras que el aumento del nmero de copias del promotor P162 producido un aumento de cuatro veces y aumentando el nmero de copias del promotor P170 producido un aumento de 10-veces . Regulacin del promotor P170 en pAK80 :: 170 por el pH fue probado en constante pH fermentaciones. Sntesis de b-galactosidasa es claramente dependiente del pH (Fig. 4A). El aumento de la actividad de b-galactosidasa a pH 5,2 no fue proporcional al incremento en OD600 (Fig. 4B). As, la expresin de la b-galactosidasa en MG1363/pAK80 :: 170 se regula de la misma manera como lo es en PA170, es decir, por el pH y la fase de crecimiento, as como la temperatura. Discusin Regulacin de la expresin gnica en Lactococcus lactis tiene importantes aplicaciones cientficas y comerciales. Los estudios de la regulacin de genes en esta bacteria y otras bacterias gram positivas condujo a la identificacin de nuevos mecanismos de regulacin todava no se observan en bacterias gram-negativas (2, 23). La capacidad de regular la expresin de genes ser importante en la construccin de cepas genticamente mejoradas para aplicaciones industriales, incluyendo su uso como cultivos iniciadores y los organismos de produccin. En este estudio, se analiz la expresin de genes en Lactococcus lactis regulado por temperatura o pH, factores importantes en los procesos de produccin de leche. Tn917-LTV1 se utiliz como una sonda de promotor en Lactococcus lactis y varios integrantes que muestran expresin regulada de la b-galactosidasa aislada. En 15 integrantes seleccionados para caracterizacin adicional, Tn917-LTV1 se demostr que se encuentra en al menos 13 diferentes loci en el cromosoma de Lactococcus lactis (Tabla 2). PA193 tiene dos Tn917-LTV1 copias insertado en el cromosoma y por lo tanto es diferente de PA237 y PA241. El nivel basal de la b-galactosidasa es menor en PA241 que en PA237 (Tabla 3), lo que indica que el transposn reside en lugares diferentes en estos integrantes. b-galactosidasa se midi la actividad en la fase estacionaria de cultivos porque las actividades eran generalmente demasiado bajo en la fase de crecimiento exponencial. Reforzar los medios lquidos con extra M17 produce un mayor rendimiento celular y el aumento de los niveles de b-galactosidasa. Estos hallazgos indican que el gen lacZ en Tn917-LTV1 est relativamente mal expresada en Lactococcus lactis y que los integrantes PA tienen Tn917-LTV1 insertado en genes que se expresan en la fase estacionaria. Esta ltima se apoya en el hecho de que el color azul emerge generalmente en los parches finales en el perodo de incubacin. El pH y / o la regulacin arginina deduce de proyecciones placa fue reproducible en medios lquidos (Tabla 3). Sin embargo, el consenso significativo sobre la regulacin de la temperatura slo se observ en dos de los seis integrantes analizadas (Tabla 4). Las razones para la falta de consenso podra ser las diferencias en la composicin de agar y medios lquidos y que el color azul observado en las placas representa un efecto acumulado de la actividad de b-galactosidasa, mientras que la actividad medida en los medios lquidos refleja la actividad en el momento de la cosecha . Los medios utilizados para la deteccin de pH y / o arginina regulado-galactosidasa expresin de b difieren no slo en el pH del cultivo final, sino tambin en las concentraciones de arginina y de la glucosa. El efecto observado en la expresin de lacZ por lo tanto podra ser causado por cualquiera de estas diferencias, ya sea por separado o en combinacin. Para probar la regulacin por pH, integrante PA170 fue cultivada en fermentadores a pH 5,2 o 7,0. La expresin de b-galactosidasa fue regulada por el pH y la fase de crecimiento (Fig. 3). Estos resultados no excluyen una disposicin adicional por la arginina o la glucosa. Se construy un vector promotor nueva sonda, pAK80, con los genes b-galactosidasa de Leuconostoc mesenteroides subsp. cremoris como genes reporteros y un replicn theta de replicacin del plsmido de citrato de Lactococcus lactis subsp. lactis biovar diacetylactis. La expresin de los genes b-galactosidasa no est sujeta a regulacin postranscripcional, y la presencia de un replicn theta de replicacin proporciona un vector que es estructuralmente estable y segregationally (7, 21). La gama de actividades b-galactosidasa medibles con pAK80 es muy amplio, desde, 0,1 unidades Miller para el vector sin inserto para .5,000 unidades Miller con un promotor insertado tRNA (28). Los promotores medidos en el estudio corriente producida entre 1 y 700 unidades Miller de actividad galactosidasa b. El ADN clonado fragmentos potencialmente llevan promotores de seleccionado Lactococcus lactis Tn917-LTV1 integrantes se analizaron tanto en pGKV210 (37) y pAK80 por proyecciones de placa. Cuando se analiz en pGKV210, no la actividad del promotor puede ser detectado en el fragmento de ADN de PA170, y un promotor de la actividad bajo, cerca del lmite de deteccin, se detect en los fragmentos de PA143 y PA162. En contraste, la actividad del promotor se detect en el fragmento de PA170 por pAK80, y los promotores albergadas en PA143 y PA162 se

discrimin por pAK80 (Tablas 3 y 4). Por lo tanto, pAK80 puede detectar y discriminar entre los promotores dbiles. Definidos genes Lactococcus ya han sido analizados por el uso de pAK80; los promotores del gen upp y el opern tRNA se encuentra mediante el uso de pAK80 (26, 28). Una comparacin de la regulacin de la expresin de b-galactosidasa en Lactococcus lactis que albergaban los derivados de pAK80 y la Lactococcus lactis Tn917 correspondiente LTV1 integrantes (Tablas 3 y 4) revel que la regulacin de la expresin de b-galactosidasa en MG1363/pAK80 :: 170 es anlogo a la regulacin observada en PA170. Los fragmentos restantes lactococcal en pAK80 causada ya sea un no regulado o un inesperado regulacin de la expresin de b-galactosidasa. As, los resultados contrastantes se pueden obtener cuando caracterizaciones promotor se llevan a cabo con un transposn o un vector de plsmido. Promotor P170 es activo a pH 5,2 pero no a pH 7,0, es ms activa a 158C que a 308C, y ha aumentado la actividad en la fase estacionaria. Este promotor ser til para varios propsitos. La baja actividad a pH 7,0 debe permitir genes que codifican productos txicos a la clula para ser clonado. Expresin ocurrir solamente cuando el pH se reduce. Bajo condiciones de cultivo de temperatura mejorar la solubilidad intracelular o la eficacia de secrecin de protenas heterlogas expresadas en E. coli (32). Estas observaciones pueden aplicarse tambin a Lactococcus lactis, haciendo P170 ideal para la expresin de protenas heterlogas. P170 es tambin un promotor ideal para mejoradas genticamente cultivos lcticos iniciadores. P170 se provocar la expresin de un gen deseado durante la maduracin del queso, como resultado de la actividad del promotor de alto a bajo pH, a baja temperatura, y en la fase estacionaria. Construcciones podran incluir grado alimenticio vectores plasmdicos (para ejemplos, vase 13) que contienen P170 o la insercin de los genes deseados en el cromosoma en el locus identificado en PA170 como muestra la regulacin deseada de la expresin gnica.