Sei sulla pagina 1di 22

UniversidadeFederaldeSoPaulo CampusDiadema


Professores:IleanaRubi JooAlexandrino JoelMachadoJr. KatiaC.M.Pellegrino MarceloA.Vallim MarielleC.Schneider

BibliografiaBsica: GriffithsAJ,WesslerSR,LewontinRC,CarrollSB.2009.IntroduoGentica,9edio.GuanabaraKoogan. PierceBA.2011.Gentica:umenfoqueconceitual.3edio.GuanabaraKoogan. NussbaumRL,McInnesRR,WillardHF.2008.GenticamdicaThompson&Thompson.7aedio.Elsevier.

PadresdeHeranaAutossmica 1.Doiscobaiasforamcruzadose,durantevriosanos,produziramumaprolecom29filhotesdepelagempreta e9depelagembranca.Expliqueessesresultados,fornecendoosgentiposdosgenitoresedaprole. 2.Socruzadososseguintesgentipos:AaBbCcDdXAaBbCcDd,Citeaproporodaproledestecruzamento quepossuiosseguintegentipos:AaBbCcDd;aabbccdd;AaBbccDd. 3. Em milho, os gros prpura so dominantes em relao aos amarelos e gros cheios so dominantes em relao a murchos. Uma planta de milho de gros prpura e cheios cruzada com uma planta de gros amarelosemurchos,sendoqueaseguinteprolefoiobtida: Prpura,cheio..112 Prpura,murcho....103 Amarelo,cheio..91 Amarelo,murcho...94 Quais os gentipos provveis dos genitores e da prole? Teste sua hiptese gentica utilizando o teste do quiquadrado. 4. Suponha que para determinado gene em um organismo diplide, so necessrias8 unidades de produtos proticosparaofuncionamentonormal.Cadaalelotiposelvagemproduzcincounidades.Seumamutaocria umalelonulo,vocachaqueessealeloserrecessivooudominante? 5.Umalelorecessivoraroherdadodemodomendelianocausaadoenagalactosemia.Essadoenacausada pela inabilidade em processar galactose, levando ao mau funcionamento muscular, nervoso e renal. Um homemfenotipicamentenormalcujopaitemgalactosemiacasousecomumamulher,cujairmtambmtem adoena. a.Desenheoheredogramacomasinformaesdescritas,indicandoopossvelgentipodaspessoas. b.Qualaprobabilidadedequeumfilhodessecasaltambmtenhagalactosemia? 6. Para os seguintes heredogramas, diga se a condio anormal dominante ou recessiva. Cite a lgica subjacentesuaresposta.

7.Completeasseguintessentenascomotermoadequado: Alelo Homozigoto Caractersticadescontnua Locus Recessivo Cruzamentorecproco Cruzamentoteste Retrocruzamento Selvagem Dominante Gene Gentipo Fentipo Heterozigoto

a. ______________________ Exibe apenas alguns fentipos facilmente distinguveis. Um exemplo a forma da sementedeervilha,aqualpodeserlisaourugosa. b.______________________CruzamentoentreumindivduodaF1eumdosgentiposparentais(P). c.______________________Conjuntodegenesqueumindivduopossui. d. ______________________ Cruzamentos nos quais os fentipos dos genitores masculino e feminino so revertidos. e.______________________Refereseacaractersticaqueexpressanosindivduoshomozigotoseheterozigotos. f.______________________Refereseaoindivduoquepossuidoisalelosidnticosemumlcus. g.______________________Umadentreasformasalternativasdeumgene. h.______________________Refereseaofentipoqueexpressoapenasquandoemhomozigose. i.______________________Formanomutantedeumgene. j.______________________Posionocromossomoondeestsituadoumgeneespecfico. k.______________________Indivduoquepossuidoisalelosdiferentesemumlcus. l.______________________Fatorgenticoqueajudaadeterminarumacaracterstica;emgeral,definidocomouma seqnciadeDNAquetranscritaemumamolculadeRNA. m.______________________Cruzamentoentreumindivduocomumgentipodesconhecidoeumindivduocom gentipohomozigotorecessivo. n.______________________Aparecimentooumanifestaodeumacaracterstica.

Determinaodosexo,HeranaligadaaosexoeHeranacitoplasmtica 1. A fenilcetonria (PKU) uma doena autossmica recessiva que resulta de um defeito em uma enzima que normalmente metaboliza o aminocido fenilalanina. Quando esta enzima est defeituosa, altos nveis de um derivadodefenilalaninacausamdanocerebral.Nopassado,amaioriadascrianascomPKUapresentavamretardo mental. Atualmente, o retardo mental pode ser evitado nas crianas com essa doena controlandose cuidadosamenteaquantidadedefenilalaninanadieta.Comoresultadodessetratamento,muitaspessoascomPKU esto atingindo a idade reprodutiva sem retardo mental. Ao final da adolescncia, quando o desenvolvimento do sistemanervosocentraljestcompleto, muitaspessoascomPKUdeixamadietarestritiva.OsfilhosdemulherescomPKU,quenofazemmaisrestriode fenilalanina, freqentemente tm baixo peso ao nascimento, anomalias no desenvolvimento e retardo mental, muitoemborasejamheterozigotosparaoalelorecessivodePKU.Entretanto,osfilhosdeumhomemcomPKUno temessesproblema.Forneaumaexplicaoparaessasobservaes. 2. Na planta ornamental maravilha, as ramificaes podem ser verdes, variegadas e brancas. A gerao F1, provenientedocruzamentodefloresfemininaspresentesemramosverdesoubrancos,possuiosmesmosfentipos maternos,independentedogenitormasculino.Emqualquercruzamentoemqueaflorfemininaseencontraemum galhovariegado,aprognieapresentaplantasverdes,variegadasoubrancas,damesmaforma,independentemente dogenitormasculino. a.Qualaexplicaoparaaheranadacordafolha? b.Qualoresultadoesperadodosseguintescruzamentos? galhobrancoXgalhoverde galhoverdeXgalhobranco galhovariegadoXgalhobranco galhobrancoXgalhovariegado c.Porquplantasquepossuemfolhasvariegadassobrevivemeplantascomfolhasbrancasno? 3.Oquesegregaocitoplasmtica? 4. A produo de pigmento nos olhos dos indivduos jovens de mariposa do gnero Ephestia est relacionada ao efeito materno. Ao atingir o estgio adulto, a cordos olhos pode ficar clara ou escura, dependendo nesta fase da vidadogentipodoindivduo.Aproduodequinurenina(substnciaqueresultanapigmentaoescuradoolho) est relacionada ao alelo dominante Q. A partir do cruzamento entre uma fmea heterozigota com um macho homozigoto recessivo, indique o gentipo e a proporo fenotpica esperada na prole quando jovem e no estgio adulto. 5.Ocasionalmente,umcromossomoXdecamundongosequebraemdoisfragmentos,ecadafragmentoficaligadoa um autossomo diferente. Nesse evento, apenas os genes de um dos fragmentos sofreram inativao do X. O que essaobservaoindicasobreomecanismodeinativaodoXemmamferos? 6. Um homem e uma mulher tm viso normal, embora o pai de ambos possua daltonismo verdevermelho, uma heranarecessivaligadaaocromossomosexualX.Desenheoheredograma,mencionandoogentipodosindivduos eindiqueaprobabilidadedosfilhosdestecasalserem: a.Ummeninocomvisonormalparaascoresverdevermelho b.Umameninacomvisonormalparaascoresverdevermelho c.Ummeninodaltnico d.Umameninadaltnica 7.Emovelhas,apresenadechifresproduzidaporumaleloautossmicoquedominanteemmachoserecessivo em fmeas. Uma fmea com chifres cruzada com um macho sem chifres. Uma das fmeas resultantes de F1 cruzadacomummachosemchifres.Queproporodaproledemachosefmeasdessecruzamentoterchifres?

8.Desenheumheredogramaquerepresenteumacaractersticaautossmicadominante,limitadaaosexomasculino, eexcluaapossibilidadedequeacaractersticasejaligadaaoY. 9.Umhomemcomumdefeitonoesmaltedentrio,oqualresultanacoloraoamareladadosdentes,casasecom umamulhernormalparaestacaracterstica.Todasastrsfilhasdocasaltmdentesamarelados,masosfilhosso normais. Os filhos casamse com mulheres normais e todas as crianas tm esmalte dentrio normal. As filhas tambmse casamcomhomensnormais,porm50%dascrianaspossuemdentesamarelados.Dopontodevista gentico,comovocexplicaestefato? 10.AlgumasDrosophilasomuitosensveisaodixidodecarbono.Talsensibilidadeumcasodeheranamaternae est relacionada ao alelo recessivo de um gene denominado sigma. Quais so os resultados esperados dos cruzamentos:sensvelXresistente;resistenteXsensvel. 11.Umhomemcomumacaractersticagenticaespecficaincomumcasasecomumamulhernoafetada,eeles tmquatrofilhos.Oheredogramadessafamliamostradoabaixo,masapresenaouausnciadacaractersticanas crianasnoestindicada.Paracadatipodeherana,indiquequantascrianasdacadasexoseesperaqueexpresse acaracterstica.Suponhaqueofentipodopairaroetotalmentepenetrante. CaractersticarecessivaligadaaoX CaractersticadominanteligadaaoX CaractersticaligadaaoY

11.UmgeneticistacruzoufmeasdeDrosophilaquetinhamolhosbrancosecoloraodocorpoescuro(ebony)com machos selvagens. Sabese que para estas duas caractersticas os fentipos selvagens so dominantes sobre os mutantes.NageraoF1,todasasfmeastinhamolhosvermelhosecorpocinzaenquantoqueosmachostinham olhosbrancosecorpocinza.AsmoscasdaF1foramintercruzadasparaobterseumageraoF2.Os384indivduos daF2foramclassificadosdeacordocomoseufentipo,conformemostradoabaixo: Cordosolhos Cordocorpo Prole Branco Ebony 2021 Branco Cinza 7073 Vermelho Ebony 2825 Vermelho Cinza 7671 Expliqueotipodeheranaparaacordosolhosedocorpo,indicandoogentipodosindivduos. 12.ComoadeterminaodosexonosistemaXY/XXdiferedosistemaZZ/ZW? 13.TantoaespciehumanacomoasmoscasdefrutaspossuemcromossomossexuaisdotipoXY/XX.Pormhuma diferenanadeterminaodosexoentreessesorganismos.Expliquetaldiferena. 14.Nopeixemosquito,quetemumadeterminaosexualdotipoXY/XX,asmanchasnocorposoherdadascomo umacaractersticaligadaaoY.Acaractersticaexibe100%depenetrnciaquandoopeixecriadoa22oC;porma penetrnciacaipara42%quandoopeixecriadoa26oC.Ummachocommanchascruzadocomumafmeasem manchaseaF1entrecruzadaparaproduziraF2.Setodaaproleforcriadaa22oC,queproporodaF1eF2ter manchas?Aocontrrio,setodaaproleforcriadaa26oC,queproporodaF1termanchas? 15.Determineopadrodeheranadosheredogramasmostradosaseguir.

16.Quaissoascaractersticaquedevemoslevaremconsideraoquandofazemosaanlisedeheredogramasde distrbiosrecessivosligadosaoX? 17.Quaissoascaractersticaquedevemoslevaremconsideraoquandofazemosaanlisedeheredogramasde distrbiosdominatesligadosaoX? 18.QualafunodogeneSRYeondeeleselocaliza? 19.AhipertricosenaorelhamasculinaumacaracteristicaligadaaoXouY? 20.Oqueumacaractersticainfluenciadapelosexo?Doexemplodabarbadobode 21.Oqueumacaractersticalimitadaaosexo?Doexemplodaplumagememgalinhas 22.Quaissoascaractersticaquedevemoslevaremconsideraoquandofazemosaanlisedeheredogramasde distrbiosrecessivosligadosaoX? 23. Quais so as caracterstica que devemos levar em considerao quando fazemos a anlise de heredograms de distrbiosdominantesligadosaoX? 24.QualafunodogeneSRYeondeeleselocaliza? 25.AhipertricosenaorelhamasculinaumacaractersticaligadaaoXouY? VejanolivrodoPierce,B.2004GenticaumenfoqueconceitualCapitulo5eresponda: 26.Oqueumacaractersticainfluenciadapelosexo?Doexemplodabarbadobode.


Extensesemodificaesdomendelismo 1. O diagrama abaixo representa um gel de eletroforese. As linhas direita indicam as posies nas quais os fragmentos de DNA podem migrar de acordo com os seus tamanhos. A posio de um fragmento de DNA que corresponde apartecodificante de um gene,extradodeumorganismocom gentiposelvagem (AA) mostrada. Considerandoqueoalelomutantea1possuiumainserode2kbemrelaonaseqnciadoaleloselvagemeque o alelo mutante a2 tem uma deleo de 1kb, represente as bandas de DNA no gel de eletroforese que seriam esperadasdeacordocomogentipodosindivduos.

2. Em humanos, a doena galactosemia causa retardo mental durante a infncia. A lactose (acar do leite) degradada em glicose e galactose. Normalmente, a galactose decomposta pela enzima galactose1fosfato uridiltransferase(GALT). Entretanto,empacientes comgalactosemia,GALT inativa,levandoaoacmulodealtos nveis de galactose, a qual, no crebro, causa retardo mental. Que tratamento para a cura secundria da galactosemiavocsugere? 3. Cinco casais numerados de 1 a 5 so mostrados na tabela abaixo, incluindo seus respectivos fentipos para o grupo sanguneo ABO, MN e fator Rh. Cada casal teve apenas um dos cinco filhos apresentados na tabela. Considerandoasinformaesfornecidas,indiquequalcrianapertenceacadacasal.
Fentipoparental (1)A,M,Rh XA,N,Rh (2)B,M,Rh XB,M,Rh+ (3)O,N,Rh+XB,N,Rh+ (4)AB,M,Rh+XO,N,Rh+ (5)AB,MN,Rh XAB,MN,Rh Fentipodosfilhos (a)A,N,Rh (b)O,N,Rh+ (c)O,MN,Rh (d)B,M,Rh+ (e)B,MN,Rh+

4.Emhumanos,aPKU(fenilcetonria)umadoenacausadapelaineficinciaenzimticanaetapaAdaseqncia simplificadadereaes,eaAKU(alcaptonria)devidaeumaineficinciaenzimticaemumadasetapas,resumida aquicomoB: AB FenilalaninatirosinaCO2+H2O UmapessoacomPKUcasasecomumapessoacomAKU.Quefentiposvocesperaparaseusfilhos? 5. Entre raposas criadas surgiu uma mutao que deu cor de pelagem platina. A cor era de grande interesse dos criadores, os quais no conseguiam desenvolver uma linhagem pura de platina. Toda vez que duas platinas eram cruzadas,apareciamnaprolealgumasraposasselvagens.Porexemplo,asreproduesrepetidasentreummesmo casal de raposas platina produziu 82 platinas e 38 com colorao selvagem. Todos os outros cruzamentos com parentais platina resultaram em prole com propores semelhantes de pelagem. Formule uma hiptese gentica concisaquejustifiquetaisresultados. 6.Umamulherquetemumpoodlealbino(umfentipoautossmicorecessivo)desejaobterfilhotesbrancos.Assim, elalevouocoaumcriador,quedissequeiriacruzarafmeacomummachoalbino,tambmdeumestoquepuro. Quandonasceramosseisfilhotes,todoserampretos.Amulherprocessouocriador,alegandoqueelesubstituiuo machoporumcopreto,dandoosseisfilhotesindesejados.Vocfoichamadocomoespecialistatestemunha,ea defesalheperguntasepossvelproduzirprolepretadedoisalbinosrecessivospuros.Quetestemunhovocdaria? 7. A sndrome Marfan um distrbio do tecido conjuntivo fibroso, caracterizada por muitos sintomas, incluindo dedosfinos,defeitosocularesedoenacardaca. a.UseoheredogramamostradoaseguirparaproporummododeheranaparaasndromeMarfan.


8.Foramisoladosvriosmutantes,todososquaisrequeremocompostoFparacrescimento.Oscompostos(AeE) naviabiossintticaparaFsoconhecidos,massuaordemnavianoconhecida.Cadacompostotestadoquanto asuahabilidadedeapoiarocrescimentodecadamutante(1a5).Noquadroseguinte,umsinal+indicacrescimento eumsinalindicafaltadecrescimento. a.QualaordemdoscomponentesdeAaEnavia?b.Emquepontodaviacadamutanteestbloqueado?

Mutante1 Mutante2 Mutante3 Mutante4 Mutante5 A + B + + + C + + D + + + + E F + + + + +

9.Emcebola,acordobulbopodeseramarela,roxaoubranca.Docruzamentoentreplantashomozigotascombulbo roxoebulbobranco,foiobtidonageraoF2aproporode9roxos:3amarelos:4brancos. a. Qual a explicao gentica para este resultado? b. Estabelea um esquema que explique bioquimicamente este resultado. 10. A cor de pelagem das raposas pode ser negro, platina (azul acinzentado) o zafira (azul muito claro). Nos cruzamentosaseguirforamobtidasasseguintesF1: negroxzafira:Todosnegros. negroxzafira:1/2negros+1/2zafira negroxzafira:1/2negros+1/2platina zafiraxzafira:Todoszafira platinaxzafira:1/2platina+1/2zafira Qualhipteseexplicariamelhoressesresultados? 11.Umcachorronegro,cujopaierabranco,cruzacomumacadelacinza,cujameeranegra.Sabesequeacorda pelagem negra dominante sobre a branca nos machos e observase dominncia incompleta nas fmeas, apresentando cor cinza. Explique como sero os gentipos dos cachorros do cruzamento citado e os gentipos e fentiposdosfilhotes.

Ligao,RecombinaoeMapeamentoGnicoemEucariotos 1. Uma srie de cruzamentos de dois pontos envolve sete loci, produzindo as seguintes freqncias de recombinao.Usandoestas freqnciasderecombinao,mapeieosloci,mostrandoosgruposdeligaoeaordemdasdistnciasentreosloci decadagrupodeligao. a,b10;a,c50;a,d14;a,e50;a,f50;a,g50;b,c50;b,d4;b,e50;b,f50;b,g50;c,d50;c,e 8;c,f50;c,g12;d,e50;d,f50;d,g50;e,f50;e,g18;f,g50. 2. No tomateiro, o alelo que condiciona planta alta (D) dominante em relao aquele para planta an (d). A presenadepilosidadenofrutodependedoalelorecessivop,enquantooaleloPcondicionafrutoslisos.Apsum cruzamentoteste,oseguinteresultadofoiobtidonaprole:5anelisa,118anepilosa,5altaepilosa,161altae lisa. a. Qual a freqncia esperada de cada fentipo a partir de um cruzamentoteste, se os genes apresentarem distribuioindependente? b.Deacordocomasuarespostanoitema,qualaexplicaoparaosresultadosobtidos? c. Esquematize as situaes que ocorreram no paquteno, anfase I e telfase II, nos meicitos do indivduo da geraoF1. 3. Um cruzamento entre indivduos com os gentipos a+ab+b X aabb, produz a seguinte prole: a+ab+b=122; a+abb=79;aab+b=81;aabb=118. a.OsgenesdoslcusAeBestoligados? b.Seosgenesestiveremligados,qualadistnciaentreosdoisloci? c.Osalelosnogenitorheterozigotoestoemqualconfigurao?Justifique. 4.Emumadeterminadaespciedeplanta,acoloraoalaranjadadaflor(s)recessivaemrelaoacoloraoazul (S); o estigma vermelho (r) recessivo em relao ao estigma verde (R), e o estilete longo (l) recessivo se comparadoaoestiletecurto(L).Umindivduotriploheterozigotoparaosgenesacimamencionadosfoisubmetidoa umcruzamentoteste,resultandonaprole Fentipo Nmerodeindivduos Floralaranjada,estigmaverde,estiletecurto 27 Floralaranjada,estigmavermelho,estiletecurto 85 Florazul,estigmavermelho,estiletecurto 402 Floralaranjada,estigmavermelho,estiletelongo 977 Floralaranjada,estigmaverde,estiletelongo 427 Florazul,estigmaverde,estiletelongo 95 Florazul,estigmaverde,estiletecurto 960 Florazul,estigmavermelho,estiletelongo 27

a. Explique os resultadosobtidos, indicando o gentipo da prole, da gerao parental e estabelecendo o mapa de ligao. b.Desenheosalelosemsuasposiesadequadasnoscromossomosdotriploheterozigotoeindiqueaconfigurao dosalelos. c.Seforapropriadodeacordocomsuaexplicao,calculeainterfernciaeexpliqueosignificadodovalorobtido. 5.Comofeitoomapeamentodecentrmero? 6.Quaissoostiposdeorganismosquepodemosempregarparamapearmosocentrmero? 7.Considereumaespciedepeixeondeocorrem3genesligadoscomaseguinterelaodedominncia: b+dominantesobreb w+dominantesobrew c+dominantesobrec

Aorealizarmosumcruzamentoteste(F1xPhomozigotorecessivo),foramobtidasasseguintesclassesgenotpicas comosrespectivosnmerosdepeixesporclasse: b+w+c/bwc=382 bwc+/bwc=379 b+wc/bwc=69 bw+c+/bwc=67 b+wc+/bwc=48 bw+c/bwc=44 bwc/bwc=6 b+w+c+/bwc=5 a)Quaisosgruposnaprolequerepresentamostiposparentaisounocrossing? b)Quaisosgruposnaprolequerepresentamostiposcrossingduplo? c)Qualaseqnciacorretadosgenes? d)Quaisasdistnciasentreosgenes? e)Hinterferncia?Seafirmativo,qualoseuvalor? f)Construaomapa 8.Apartirdosfentiposdadosnoquadroabaixoparacruzamentostestedetrspontospara(1)a,b,ce(2)b,c,d, determineaseqnciadosquatrogenesa,b,ced,eastrsdistnciasdemapaentreeles.Osfentiposrecessivos sosimbolizadosporletrasminsculaseosfentiposdominantesporsinais+. 1 2 +++669 bcd8 ab+139 b++441 a++3 b+d90 ++c121 +cd376 +bc2 +++14 a+c2280 ++d153 abc653 +c+65 +b+2215 bc+141 9.OslociAeBdistamumdooutro10cM.Docruzamentotestaabaixoqualaproporodaprole? A B a b a b a b

Genticabacterianaeseusvrus 1.Descrevaciclolticoeciclolisognico.corretoafirmarqueumbacterifagocomciclolisognicopodetambm desenvolverocicloltico.Justifiquesuaresposta. 2.QualadiferenaentreumabactriadoadoracomoplasmdiocontendooFatorFeoutradefinidacombactria comaltafreqnciaderecombinao(Hfr)? 3.Definaconjugaobacteriana.Enumerequaisfatoresestoenvolvidosquequaissoospassosnesseprocesso. 4. Aps a conjugao de uma bactria doadora contendo o plasmdio com o fator F com uma receptora F, voc esperariaoaparecimentodeduasclulasF+?VocesperariaomesmodaconjugaodeumabactriaHfrcomoutra F?Justifiquesuasrespostas 5.Atransduodomaterialgenticobacterianodeumacpamediadoporumvrus.Descrevaquaissoostipos possveisdetransduo.

Princpiosbsicosdecitogentica 1.Respondaositensabaixo: a)Quais so ascaractersticascromossmicas utilizadasparadescriodeumcaritipo, empregandosecolorao convencional? b) Discuta como tcnicas de colorao diferencial dos cromossomos podem auxiliar na resoluo de problemas prticosdasdiferentesreasdagentica. c)Diferencieeucromatinadeheterocromatinaquantonaturezaefuno. 2.Definaasseguintesregiescromossmicas: a)Cromtidesirms b)Centrmero c)Telmero d)RONs 3. Descreva, em detalhes, a estrutura da cromatina dos eucariotos e explique como ocorre o processo de empacotamentodoestgiodefibrade10nmatocromossomometafsico. 4.Descrevaaestruturadeumcromossomometafsicoesuaclassificaoquantoposiodocentrmero. 5. Considere uma clula com nmero diplide de 2n=8 cromossomos, sendo o primeiro par metacntrico de tamanhogrande,osegundoacrocntricode tamanhomdio,o terceirosubmetacntricode tamanhomdio,mas menorqueosegundopar,eoquartotelocntricodetamanhopequeno: a)Qualonmerofundamental(NF)debraoscromossmicosnestaclula? b)Quantascromtidesexistemnafasedemetfasemittica? c) Faa uma representao esquemtica dos cromossomos durante a anfase da mitose, levando em conta os diferentestiposmorfolgicospresentesnaclula. 6.Considerandooscromossomosemmetfasemitticadaclulamostradaabaixo,determine: a)Onmerodiplide(autossomosecromossomosexual). b)Amorfologiadoscromossomos. c)Quaisostiposdegametasformadosporestemachodegafanhoto? d) Supondo que a clula metafsica mostrada na foto completasse o processo de diviso mittica, quantos cromossomos(autossomosesexuais)seriamobservadosnasclulasfilhas?

7.Diferenciemutaocromossmicademutaognica.Comosoclassificadasasmutaescromossmicas? 8.Diferencieeuploidiadeaneuploidia.Almdisso: a)Expliqueaorigemdessesmecanismosatravsdeexemplos. b)Comentesobreovalordospoliplidesvegetaisparaohomem. 9.Expliqueadiferenaentreindivduosautopoliplidesealopoliplides. 10.Porquosindivduostriplidessonormalmenteestreis?Dexemplo.

11.Expliqueomecanismodeorigemdasaneuploidias.ExemplifiqueatravsdaSndromedeDown. 12.Compareasconseqnciasderearranjosestruturaisbalanceadosenobalanceados. 13. Uma mulher normal (2n=46, XX) casada com um homem portador de uma translocao (Robertsoniana) equilibradaentreumelementodopar21eumdoselementosdopar22(2n=45,XY,t(21q;22q).Esquematize(com asrespectivaslegendase/ouexplicaes)ostiposdedescendentesqueessecasalpodeoriginar. 14. Um homem normal (2n=46, XY) casado com uma mulher portadora de uma translocao (Robertsoniana) equilibrada entre um elemento do par 21 e um dos elementos do par 13 (45, XX, t(13q,21q). Sabendose que a trissomia do cromossomo 13 causa a Sndrome de Patau e que monossmicos para autossomos so abortados, esquematize os tipos de descendentes que esse casal pode originar, citando a porcentagem de prole normal e afetadapelasSndromedeDownePatau. 15. Diferencie, quanto a constituio citogentica, as sndromes de Klinefelter, Down e Turner. Qual o principal mecanismodeorigemdessasaneuploidias? 16.UmaespciediplideA(2n=4)aparentadaaumaespciediplideB(2n=6).Descrevaosmecanismosdeorigem nosseguintespoliplides,especificandoonmerodecromossomosdecadaumdeles: a)umautotriplideparaaespcieA; b)umalotetraplideapartirdasespciesAeB. 17. Em uma espcie de planta com 2n=16 cromossomos, qual ser o nmero de cromossomos encontrados por clulanosseguintesmutantes:a)monossmico;b)autotetraplide;c)tetrassmico;d)autopentaplide.

ElementosdeTransposio 1.Emboraoselementostransponveisdaclasse2sejamabundantesnosgenomasdeeucariontesmulticelulares,os elementos da classe 1 geralmente constituem a maior frao dos genomas muito grandes, tais como os dos humanos, milho e cevada. Considerando o que voc sabe sobre os elementos da classe 1 e 2, o que h nesses mecanismosdistintosdetransposioqueexplicariaessadiferenadeabundncia? 2.Antesdaintegraodeumtransposon,suatransposasefazumcortedesencontradonoDNAalvodohospedeiro. Seoscortessonosstiosindicadospelassetasaseguir,desenhecomoseraseqnciadoDNAhospedeiroapso transposontersidoinserido.Representeotransposoncomoumretngulo. 5AATTTGGCCTAGTACTAATTGGTTGG3 3TTAAACCGGATCATGATTAACCAACC5 3.Quaisassimilaridadesediferenasentreretrovrus,retrotransposonsetransposons? 4.Umdeterminadoelementodetransposiogerarepetiesflanqueadorasdiretasquetm4pbdetamanho.Cite aseqnciaqueserencontradaemambososladosdeumelementodetransposioseesteelementoseinserirna posioindicadanaseguinteseqnciadeDNA. 5ATTCGAACTGACCGATCA3 5.UmalinhagemdeE.coliresistenteaoantibiticoestreptomicinaeaoutralinhagemresistenteaoantibitico ampicilina.Asduaslinhagensforamcultivadasjuntaseentoplaqueadasemmeioseletivocontendoestreptomicina eampicilina.Surgiramvriascolnias,indicandoqueasclulasadquiriramresistnciaaambososantibiticos.Sugira ummecanismoparaexplicaraaquisiodaduplaresistncia. 6.Quecaractersticasgeraissoencontradasemmuitoselementosdetransposio? 7.Comooselementosdetransposioparticipamnadisseminaodaresistnciaaantibiticosembactrias? 8. Quais dos seguintes pares de seqncias de DNA podem ser encontradas nas repeties terminais de uma seqnciadeinsero?Explique a)5GAATCCGCA3e5ACGCCTAAG3 b)5GAATCCGCA3e5CTTAGGCGT3 c)5GAATCCGCA3e5GAATCCGCA3 d)5GAATCCGCA3e5TGCGGATTC3 9.Citetrshiptesesqueexplicamaamplaocorrnciadoselementosdetransposionogenomadosorganismos procarionteseeucariontes. 10.PorqueoselementosdetransposiosoclassificadosemtransposonsdeDNAetransposonsdeRNA?Quala diferenaeasprincipaiscaractersticasdecadaumdeles? 11.Comoelementosdetransposioautnomosenoautnomosdiferem? 12.Comopodemoshumanossobreviverdadoque45%dogenomahumanoderivadodeelementosmveis? 13.Estabeleaarelaoentreelementosdetransposioerearranjoscromossmicos. 14.Comentecomooselementosdetransposiopodemserutilizadoscomoferramentasbiolgicasteis.

Genticadepopulaes 1.Quaissoasforasevolutivasquecausammudanasnasfreqnciasallicasnaspopulaes?Escolhaumdelese explique. 2.Calculeasfreqnciasallicasegenotpicasparaasseguintespopulaes.Escolhaumadelaseverifiqueseest emequilbriodeHardyWeinberg. a)AAAaaab)AAAaaac)AAAaaa D=20H=50R=30D=80H=100R=120D=40H=220R=240 3.Umalelocausadordeumadoenararanamaioriadaspopulaesincomumenteencontradoemaltafreqncia emumadeterminadapopulao.Comovocexplicariaessefato? 4.Relacioneseleonaturalearesistnciabacterianaaosantibiticos. 5.Umafileiraextradecliosumacaractersticaautossmicarecessivaqueocorreem900dos10.000residentesde umailhadoPacficosul.Calculeasfreqnciasgnicasegenotpicasnessapopulao. 6.Emumapopulaodecamundongos,existemosalelosA1eA2.Nessapopulao,384camundongosapresentamo gentipoA1A1,210ogentipoA1A2 e260ogentipoA2A2.CalculeasfreqnciasdosalelosA1 eA2 easfreqncias paracadaclassegenotpica.VerifiqueseapopulaoestounoemequilbriodeH.W. 7.Adistoniaumdistrbiodemovimentoqueafeta1em1.000pessoasjudaicasdescendentesdolesteeuropeu (ashkenazi).Qualafreqnciadeportadoresnestapopulao? 8. A acidria glutrica tipo I causa uma paralisia progressiva e dano cerebral. muito comum nos amish da Pensilvnia(EUA),onde0,25%dosneonatostmodistrbio.Calculeaporcentagemquenotemoalelocausador dadoena. 9.EmDrosophila,corpodecorpretaumcarterdominanteenquantocorpomarromrecessivo.Emumaamostra de 210 drosfilas, 90 apresentam o gentipo duplo dominante, 50 so heterozigotas e 70 moscas possuem o gentipoduplorecessivoparacordocorpo.AssumindoqueessapopulaoestemequilbriodeHardyWeinberg, calculesuasfreqnciasallicasegenotpicas. 10. Explique comoumalelomutantequecausaumadoenahereditriaquandoemhomozigosepersisteem uma populaoeporqusuafreqnciaaumentadaemcertasregiesgeogrficas. 11. A partir das informaes apresentadas abaixo, indique qual das populaes esto em equilbrio de Hardy Weinbergutilizandootestedoquiquadrado. a)GeneCCR5:1/1,60%;1/32,35.1%;32/32,4.9% b)Genedahemoglobina:AA,75.6%;AS,24.2%;SS,0.2% 12.Deumapopulaodeumaespciedeinseto,foramanalisados1000indivduosquantopigmentaodotrax. Destes,40eramgranulados,640estriadose320uniformes.ConsiderandoequilbriodeHardyWeinberg,aponteo gentipoheterozigoto,supondoheranacodominanteeumpardealelos. 13. Em uma grande populao natural da espcie Hypotetica sp. a variabilidade para um lcus gnico (M) foi avaliada. No gel de eletroforese, trs padres de bandas foram observados, conforme mostrado abaixo. A partir destainformao,determineasfrequnciasallicas.

GenticaQuantitativa 1.Emumaplanta,aalturavariade6a36cm.Quandoplantascom6e36cmforamcruzadas,todasasplantasda geraoF1apresentaramcercade21cmdealtura.NageraoF2,umavariaocontnuanaalturadasplantasfoi observada;porm,amaioriatinhacercade21cme3das200plantaseramdealturabaixa(6cm)talcomoumdos parentais. a.Qualotipodeinteraoallicapredominantenadeterminaodocarteralturadaplanta? b.Quantosgenesestoenvolvidosnadeterminaodaalturadaplantaequalacontribuiodecadaalelo? c.Quaisospossveisgentiposdasplantascom31cm? 2.Comodiferemasherdabilidadesemsentidoamploesentidorestrito? 3.Paraaesquizofrenia,aconcordnciaparagmeosmonozigticosde60%eparagmeosdizigticosde10%. Estesfatosmostramqueaesquizofreniaumacaractersticacomlimiardebasegentica? 4.Avariaofenotpicanaproduodeleiteemumrebanhodegadoleiteirofoianalisada,sendoqueosseguintes componentesdevarinciaforamobtidos:
Varinciagenticaaditiva=0,4 Varinciadedominnciagentica=0,1 Varinciadeinteraognica=0,2 Varinciaambiental=0,5 Varinciadeinteraogenticoambiental=0,0

a.Qualaherbabilidadedesentidorestritoparaaproduodeleite? b.Qualaherbabilidadedesentidoamploparaaproduodeleite? 5.AmdiaeavarinciadocomprimentodacoroladeduaslinhagensdeNicotinaedaprognie estomostradasnatabelaabaixo. Umparental(P1)possuicorolacurtaenquantoooutro(P2)apresentacorolalonga. a.QualavarinciagenticaeambientalnageraoF1eF2? b. Calcule o valor da herdabilidade em sentido amplo da F2 e explique o significado do valor obtido. Gerao Mdia Varincia P1 40,47 3,12 P2 93,75 3,87 F1 63,90 4,74 F2 68,72 47,70 6.Qualadiferenaentrecorrelaesfenotpicasegenticas? 7.Umestudiosoemgenticaquantitativadizqueaherdabilidadeemsentidorestritoparamassa corprea em seres humanos 0,7, enquanto a herdabilidade em sentido amplo 0,3. Estes valoresestocorretos?Explique. 8.Emumacriaodecoelhos,opesomdiodapopulaode3kg.Umcriadorselecionaos10 coelhosmaioresdessapopulao,cujopesomdiode4kg,eosendocruza.Seaherdabilidade do peso corpreo de coelhos de 0,7, qual o peso esperado entre a prole de coelhos selecionados? 9. O grau de comportamento antisocial uma caracterstica quantitativa em homens. Alguns pesquisadores utilizaram dados de centenas de homens para investigar a relao entre o comportamentoantisocialedoisfatores.Oprimeirofatoreraogentiponolocoquecodificaa enzima monoamina oxidade A (MAOA). A MAOA age no encfalo, onde degrada vrios neurotransmissoresqueasclulasnervosasutilizamparasecomunicar.OgeneparaaMAOAest localizado no cromossomo X. Em conseqncia a diferenas genticas no promotor desse gene, alguns homens tm MOAO de baixa atividade, outros, de alta atividade. O segundo fator era a

experinciademaustratosduranteainfncia.Combaseemdiversasevidncias,ospesquisadores determinaram se cada homem havia sofrido maustratos, provveis maustratos ou graves maustratos.Osdadosestoresumidosnogrficoabaixo.

a. A variao no comportamento antisocial, entre homens, , pelo menos em parte, devido a diferenasambientais?Explique. b.Ocomportamentoantisocialhereditrio? 10. O transportador da serotonima uma protena de superfcie celular que recicla o neurotransmissorserotonina,depoisdetersidousadoparatransportarumamensagementreas clulas nervosas no encfalo. Existem dois alelos do gene transportador de serotonina: s e l. Alguns pesquisadores descobriram que as pessoas com gentipos sl e ss apresentaram escores mais altos que as pessoas com gentipo ll em teste de neuroticismo, conforme mostra a figura abaixo. a.Essesdadossocompatveiscomahiptesedequeogenedotransportadordaserotonina umQTLqueinfluenciaoneuroticismo?Explique.

11. Quais as interaes allicas e gnicas que so comumente estudadas em gentica quantitativa?DiferencieasinteraescombasenocomportamentodaspopulaesF1. 12.Comopoderiaserdefinidaumacaractersticaquantitativa?Compareacomumacaracterstica qualitativa.

ReplicaoeTranscrio 1.Oprincpiodetransformaodasbactriasfoiumadasevidnciasqueomaterialgenticoera constitudoporDNA.DescrevaoracionaldoexperimentodeFrederickGriffith. 2.QualexperimentodemonstrouqueomaterialgenticoeraconstitudoporDNAenoprotena? Explique. 3. Qual experimento foi determinante para que Watson e Crick sugerissem a estrutura da molculadeDNA.Quaisconclusesforamtiradasdesteexperimento? 4.Quaissoostiposdeligaesqumicasenvolvidasnaformaodafitasimplesenafitaduplade DNA.Qualosentidodemontagemosdesoxirribonucleotdeosemcadafita.Qualoracionalque issoocorra? 5.Descrevaoexperimentoquedemonstrouqueoprocessodereplicaosemiconservativo. 6. Quais so as funes de cada uma das enzimas ou protenas na replicao do DNA: primase, ligase, DNA polimerase III, DNA polimerase I, helicase, protenas SSB, grampo deslizante, topoisomerase, grampo conector. Coloque estas protenas numa ordem lgica quanto ao seu aparecimentoduranteareplicao. 7.Comoocorreainiciaodareplicaoemprocariotoseeucariotos? 8.Comoocorreainiciaodatranscrioemprocariotos? 9.Comoocorreainiciaodatranscrioemeucariotos? 10.DescrevaomecanismoderecomposiodosxonsduranteoprocessamentodosmRNA. 11.ParademonstrarqueoDNA(enoprotenas)eraomaterialgentico,bacterifagosT4foram marcadoscomP32ouS35eemseguidaforaminfectadosemE.coli.Qualmolculabiolgicaesses istoposmarcam?Osbacterifagosqueforamproduzidosporestainfecoreteramqualistopo marcado?ComoesteexperimentomostrouqueoDNAeraomaterialgentico? 12.Desenheaforquilhadereplicaoemarqueosfinais5e3eindiquequalafitacontinuaea descontnua. Abaixo do seu desenho, indique em qual direo a forquilha de replicao est se movendo.Porqueogrupo3OHnadesoxirribosetoimportanteparaasntesedoDNA? 13.Oqueumaspliceossomoeoqueelefaz?QualtipodeRNAestpresentenospliceossomo. 14. Descreva a funo de cada um dos seguintes componentes envolvidos na transcrio: subunidadesigma,RNApolimerase,fatordetranscrio,protenaRho,sequnciaAAUAAA. 15.DesenheumaseqnciadeDNAcom30nucleotdeosedefinaestaseqnciacomosendo5 3ou35.Apartirdisto,desenheafitacomplementar.Definaumaseqnciade15basesnafita moldeparaotranscritocodificante.IndiqueosentidodasntesedestemRNA.

Sntesedeprotenas 1.DescrevacomoocorrealigaodeumaminocidoaumRNAtransportador. 2.Descrevaaestruturadosribossomosemeucariotoseprocariotos. 3.Emrelaoaosribossomos,oqueocentrodecodificadoreocentrodepeptidiltransferase? 4.Emrelaoaoinciodatraduoemprocariotos,oquesoseqnciasdeShineDalgarno? 5.Comoocorreainiciaodatraduoemeucariotos? 6.Qualaimportnciadaestruturacapparaoinciodatraduoemeucariotos? 7.Emrelaoaoprocessodealongamentoduranteatraduo,qualaimportnciadosfatoresde alongamentoTu(EFTu)edofatordealongamentoG(EFG)?

Regulaodaexpressognica 1.QuaissooselementosdoDNAeosgenesestruturaispresentesnooperonlac? 2.Quaisprotenassocodificadaspelosgenesestruturaisequaissosuasfunes? 3.Porquedizemosqueoprodutodatranscriodosgenesestruturaisdooperonlacresultaem umtranscritopolicistrnico? 4.Comoorepressorprevineatranscriodooperonlac? 5.Qualoefeitosobrearegulaodooperonlacseaconcentraodeglicosenomeiodecultura estiverelevadoeaconcentraodelactosetambm?Explique. 6.Qualoefeitosobrearegulaodooperonlacseaglicosenomeiodeculturaestiverausenteea concentraodelactoseestiverelevada?Explique. 7.Qualoefeitosobrearegulaodooperonlacseaconcentraodeglicosenomeiodecultura estiverelevadoeaconcentraodelactoseestiverausente?Explique. 8.Qualoefeitosobrearegulaodooperonlacseglicoseelactosenomeiodeculturaestiverem ausentes?Explique. 9. Qual o efeito sobre a regulao do operon lac se a ocorrer uma mutao do tipo deleo do operador?Ocorrertranscriodooperonnapresenadelactoseeausnciadeglicosenomeio? Explique. 10.Qualoefeitosobrearegulaodooperonlacseaocorrerumamutaodotipodeleodo genelacI?Ocorrertranscriodooperonnapresenadelactoseeausnciadeglicosenomeio? Explique. 11.Qualoefeitosobrearegulaodooperonlacseaocorrerumamutaodotipodeleodo stioCAP?Ocorrertranscriodooperonnapresenadelactoseeausnciadeglicosenomeio? Explique. 12.QualaimportnciadoAMPcnarepressocatabolicadooperonlac? 13.Porquearegulaognicadiferenteemaiscomplexadoseucariotosquenosprocariotos? 14.Qualaimportnciadosacentuadoresnaregulaognicadoseucariotos? 15. Quais so os modos de represso da transcrio por protenas que se ligam em stios repressoresnoDNA?

MutaognicaemecanismosdereparodoDNA 1.Umgenecodificaumaprotenacomaseguinteseqnciadeaminocidos: MetArgCisIleLisArg Umamutaoemumniconucleotdeoalteraaseqnciadeaminocidospara: MetAspAlaTirLisGliGluAlaProVal Ocorre uma segunda mutao de um s nucleotdeo no mesmo gene, e suprime os efeitos da primeiramutao(umsupressorintragnico).Comapresenadamutaooriginaleosupressor intragnico,aprotenatemaseguinteseqnciadeaminocidos: MetAspGliIleLisArg Qualanaturezaealocalizaodaprimeiramutaoedamutaosupressoraintragnica? 2. Cite trs tipos diferentes de mecanismos de reparo de DNA e explique resumidamente o funcionamentodecadaum. 3.AseguinteseqnciadenucleotdeosencontradaemumcurtotrechodoDNA: 5AG3 3TC5 a. Cite uma seqncia mutante que pode resultar da depurinao espontnea nesse trecho do DNA. b. Cite uma seqncia mutante que pode resultar da desaminao espontnea nesse trecho do DNA. 4.AseqnciadenucleotdeosabaixoencontradaemumcurtotrechodoDNA: 5ATGT3 3TACA5 Seestaseqnciatratadacomhidroxilamina,queadicionagrupohidroxilaaumacitosina,que seqnciasresultaroapsareplicao? 5. A seguinte seqncia de nucleotdeos encontrada no filamento molde de DNA. Primeiro determine os aminocidos da protena codificados por essa seqncia e depois cite a seqncia alteradadeaminocidosdaprotenaqueserencontradaemcadaumadasmutaes: 3TACTGGCCGTTAGTTGATATAACT5 a.Mutante1:transiononucleotdeo11. b.Mutante2:transiononucleotdeo13. c.Mutante3:deleodonucleotdeo7. d.Mutante4:transversodeTAnonucleotdeo15. e.Mutante5:adiodeTGGapsonucleotdeo6. f.Mutante6:transiononucleotdeo9. 6.Definamutaodepontoediscutasobresuasorigens. 7.Oqueumamutaoespontnea?Comoelaocorre?Quaissuasconseqncias? 8.QuaissooserrosnareplicaodoDNAecomoelespodemserreparados?