Virus

ELSEVIER
Virus Research 35 (1995) 155-167

Research

Large deletions in the S-untranslated region of foot-and-mouth disease virus of serotype C

Ckistina Escarmis a, Joaquin Dopazo b, Mercedes Dhvila a, Eduardo L. Palma Esteban Domingo a,* ,
a Centro de Biologia Molecular Seuero Ochoa (CSIC-UAM), Universidad Aut6noma de Madrid, 28049-Cantoblanco, Madrid, Spain b Centro .rVacional de Biotecnologi CSIC, Universidad Autckoma de Madrid, 28049-Cantoblanco, a, Madrid, Spain Institute de Biologia Molecular. Centro de Investigaci6n Veterinaria, INTA-cc77, I708 Moron, Buenos Aires, Argentina Received 25 July 1994; revised 29 September 1994; accepted 29 September 1994

Abstract
Nucleotide sequences of the S-untranslated region (S-UTR), at the 3 -side of the poly C tract, have been compared for 21 isolates of foot-and-mouth disease virus (FMDV) of serotype C from Europe, South America and The Philippines. A deletion of 43 nucleotides is present in the European isolates as compared with most American isolates. A larger deletion of 86 nucleotides is present in some viruses from South America and The Philippines. These deletions include the loss of one or two pseudoknot structures predicted in this region of the S-UTR. In addition, multiple point mutations have allowed the derivation Iof a phylogenetic tree which defines a grouping of isolates very similar to that derived from the capsid gene sequences of the same viruses. The study provides evidence that deletion (or addition) events must be very frequent during evolution of FMDV type C, since viruses which are phylogenetically very closely related (they belong to the same tree branch) maiy differ in the presence or absence of these deletions. Implications for FMDV evolution are discussed.
Keywords:

:Picornavirus; Pseudoknot;

Virus evolution; Polymerase chain reaction

1. Introduction Foot-and-mouth disease virus (FMDV) is the causative agent of one of the economically most important animal diseases world-wide (for review see Bachrach,

* Corresponding

author.

Fax (34) 1 3974799. Science B.V. All rights reserved

016%1702/95/$09.50 0 1995 Elsevier SSDI 0168..1702(94)00091-3

156

C. Escarmis et al. / Virus Research 35 (1995) 155-167

1968; Pereira, 1981; Domingo et al., 1990). In a collaborative effort involving several laboratories, about 66 field isolates of serotype C from Europe, South America and The Philippines have been analyzed with regard to nucleotide sequences of the capsid coding-regions and antigenic reactivities with monoclonal antibodies and polyclonal sera (Mateu et al., 1987, 1988, 1994; Piccone et al., 1988; Martinez et al., 1988, 1991, 1992; Villaverde et al., 1991; reviews in Domingo et al., 1990, 1992). The main conclusions on the genetic and antigenic evolution of this FMDV serotype are the following. (1) A subtype may dominate in some geographical areas (i.e. C, viruses in Europe and C, in South America) but, apart from these large groupings, there is no clear association between antigenic specificities within a subtype and particular geographical locations (Martinez et al., 1992; Mateu et al., 1994). (2) Rates of fixation of mutations over prolonged time periods (considering

Table 1 FMDV isolates

used in the phylogenetic

analysis

of the 5 -UTR Isolation date 2/1970 l/1977 1969 1960 5/1953 1965 3/1989 l/1981 5/1955 3/1983 9/1984 6/1969 10/1971 l/1975 5/1992 12/1984 1944-1945 12/1966 lo/1987 2/1988 Circa 1926

of FMDV

of serotype

C a

FMDV designation C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, Sta Pau Sp/70 (C-S8clJ Vie Sp/77 Haute Loire Fr/69 Vosges Fr/60 Loupoigne Be1/53 Noville Sw/65 Brescia It/88 Serra de Dar6 Sp/81 Resende Br/55 Argentina/83 Argentina/84 Argentina/69 Indaial Br/71-78 Santa Fe Arg/75 039 Arg/92

Phylogenetic group b II II II II II II II II V V V V IV IV IV IV III III VI VI I

Place of isolation Santa Pau, Girona, Spain Vie, Barcelona, Spain Haute Loire, France Vosges, France Loupoigne, Belgium Noville, Switzerland Brescia, Lombardy, Italy Serra de Dare, Girona, Spain Resende, Rio de Janeiro, Brazil Daireaux, Buenos Aires, Argentina General Rota, Cordoba, Argentina Pehuajo, Buenos Aires, Argentina Indaial, Santa Catarina, Brazil San Carlos, Santa Fe, Argentina Chapaleufu, La Pampa, Argentina Marcos Juarez, Cbrdoba, Argentina Pando, Uruguay Rio Grande, Tierra de1 Fuego, Argentina Santa Cruz, Lubao, Pampanga, The Philippines Cotabato, Mindanao, The Philippines Germany

C, Argentina/85 C, Pando Ur/44 C, Tierra de1 Fuego Arg/66 C Philippines/3/87 C Philippines/l/88 CGC Ger/26

a The isolates were obtained from: the World Reference Laboratory (WRL), Pirbright, UK; the Pan American Foot and Mouth Disease Center (CPFA), Rio de Janeiro, Brasil; Servicio National de Sanidad Animal (SENASA), Buenos Aires, Argentina; Rhone-Mirieux, Lyon, France; and Laboratorios Sobrino S.A., Olot, Girona, Spain. Their antigenic characterization using monoclonal antibodies has been previously described (Mateu et al., 1987, 1988; Martinez et al., 1991). b Grouping of the isolates obtained before 1990 was derived from a phylogenetic analysis of VP1 RNA using the least-squares method, as previously described (Martinez et al., 1992). Sequences from VP1 RNA of isolate C, 039 Arg/92 indicate that this recent isolate from Argentina belongs to group IV. C-SScl is a plaque-purified derivative of the natural isolate C, Sta Pau Sp/70 (Sobrino et al., 1983).

C. Escarrnbet al./I&us Research (1995) 155-167 35

151

isolates collected over six decades) have been estimated in about 1.4 X lop3 substitutions per nucleotide and year (Martinez et al., 1992). Five- to ten-fold higher values were calculated for sequential isolates during an FMD outbreak, or in the course of a persistent infection in cattle (Martinez et al., 1992). Also, different genomic segments within the protein-coding region varied in their rate of evolution (Villaverde et al., 1988). (3) The FMDV type C capsid appears to be quite restricted with regard to the numbers and nature of amino acid replacements tolerated ,at antigenic sites. Perhaps the most dramatic manifestation of this observation is the extensive fitness loss in viruses with multiple amino acid replacements selected with neutralizing polyclonal sera (Borrego et al., 1993). Antigenic variation in the field seems to be driven essentially by alternation between a restricted number of amino acids at a limited number of capsid sites (Martinez et al., 1992; Mateu et al., 1994). Most of these phenotypic modifications were caused by point mutations; small deletions were very rare, and large deletions have never been observed in the capsid genes (Domingo et al., 1990, 1992). To explore whether the main features of FMDV type C evolution derived from analysis of coding sequences would hold for an extracistronic region, we have determine nucleotide sequences from the S-untranslated region (S-UTR) at the d 3 -side of the polycytidilate (poly C) tract of 21 isolates of FMDV type C from Europe, South America and The Philippines. A phylogenetic tree derived from these sequences shows a grouping of isolates very similar to that previously derived from the phylogeny of the capsid genes (Martinez et al., 1992). The rate of evolution is two-fold lower than that calculated with VP1 RNA sequences. Interestingly, the comparison shows the occurrence of large deletions (or additions) with high frequency, presumably corresponding to loss (or gain) of pseudoknot structures predicted to occur in this region of the FMDV genome.

2. Materials and methods 2.1. Mrusts The origin of the FMDVs of serotype C analyzed is indicated in Table 1. The procedure:s used for virus isolation and purification, and for the extraction of genomic RNA have been previously described (Martinez et al., 1992). 2.2. Polymerase chain reaction (PCR) amplification and nucleotide sequencing The region at the 3 -side of the poly C tract amplified corresponds to residues 1 to 213, according to the numbering for FMDV C-S8cl given in Escarmis et al. (1992) (Fig. 1). The primers used were STTCGTGCGCAGACGTCCCAT3 (complementary to residues 213 to 194 of FMDV C-S8cl RNA) and 5 CCCTAAGTI TTACCGTCTGTCCCG3 [corresponding to residues - 3 to 21 ( - 3 indicates that this primer includes three cytidylate residues at its S-end, corresponding to the three 3 -t~erminal residues of the poly C tract)]. For the divergent FMDV CGC

158

C. Escarmis et al. / virus Research 35 (1995) 155-167 +S "Pcl1' 3h --tPoly c . . L AUG '

1 C-IRESA 213202

717

Fig. 1. Scheme of the 5 -untranslated region (5 -UTR) of FMDV C-S8cl indicating fragment S, the poly C tract, and part of fragment L. Nucleotides in S and L are numbered independently, and according to the sequences presented in Escarmis et al. (1992). The two black squares indicate the positions of the primers used for amplification and sequencing as detailed in Sect. 2. IRES is the internal ribosome entry site, and Wg is the protein covalently linked to the 5 -end of the genomic RNA.

Ger/26 the primers had to be modified to be STTCGTGCGCGGACGTCCCGT3 and SCCCAAGTITCACCGTCTCCCG3 , respectively; to amplify genomic sequences from C, Indaial Br/71-78, C, Argentina/83, C, Argentina/84, C, Argentina/85, and C, Santa Fe Arg/75 the latter primer was substituted by SCCCTAAGTTTTACCGTCGTICCCG3 (corresponding to positions - 3 to 21). Variant primers were designed based either on previously published sequences for C, Resende Br/55 (Cao et al., 1991) or by direct RNA sequencing using additional primers located downstream from the region of interest (results not shown). The PCR products were purified using a commercial kit (Wizard PCR preps DNA purification system, Promega), and sequenced by cycle sequencing using the f-mol DNA sequencing system (Promega), including an additional incubation step with terminal deoxynucleotidyl transferase (DeBorde et al., 1986). RNA sequencing by primer extension and dideoxynucleotide-induced chain termination was carried out essentially as described by Fichot and Girard (1990). 2.3. Phylogenetic analysis Nucleotide sequences were aligned using the PILEUP program from the GCG package (Devereux et al., 1984). Genetic distances were calculated using the method of Jukes and Cantor (1969). A phylogenetic tree was derived using the neighbour-joining method (Saitou and Nei, 19871, as implemented in the NEIGHBOR program from the PHYLIP package (Felsenstein, 1993). The reliability of the tree was checked by the bootstrap method (Felsenstein, 1985) using the programs SEQBOOT, DNADIST and CONSENSE, as described in Felsenstein (1993). The significant nodes and branches were confirmed applying the maximum likelihood procedure (Felsenstein, 19811, as implemented in the program DNAML. Errors for branch lengths were calculated employing a recently described adaptation of a bootstrap approach (Dopazo, 1994).
3. Results 3.1. Large deletions in the S-UTR of FMDV isolates of serotype C

The presence of a large deletion at the 5 -UTR of FMDV was first reported in a comparison of two type A viruses belonging to a different serological subtype

C. Escarmis et al. / virus Research 35 (1995) 155-167

159

(Clarke et al., 1987). We previously described a deletion of 43 nucleotides in the same S-UTR region of FMDV C-S&l relative to C, Resende Br/55 (Escarmis et al., 1992). The alignment of the corresponding sequences for 21 FMDV type C isolates (Fig. 2) indicates that such a deletion is present in each of the European viruses irrespective of their geographical origin or time of isolation (compare Fig. 2 and Table 1). In addition, the alignment shows that FMDV C, Santa Fe Arg/75, C, Pando Ur/44, and C Philippines/3/87 include a larger deletion of 86 nucleotides as compared with the other isolates from South America or The Philippines. This larger deletion spans the one found in RNA from the European viruses, duplicating it towards the 3 -side of the sequence examined (residues 1 to 89 in Fig. 2). Since partially repeated sequences are present in this region (indicated in Fig. 2), and one of the repeats is included in one of the primers used for amplification by PCR, it was important to ascertain that the deletions observed were not caused by alternative priming at secondary sites during PCR amplification. To this effect, virion RNA from FMDV C-S8c1, C, Tierra de1 Fuego Arg/66, CGC Ger/26, C, Indaial BI-/71-78 and C, Pando Ur/44 was sequenced, as detailed in Sect. 2. These RNAs were chosen as representatives of the different lengths (or types of deletions) observed. The RNA sequences were identical to those obtained from amplified cDNA, confirming the results shown in Fig. 2. Formally, the observed sequence differences could be caused either by deletion or by duplication or addition events (see Sect. 4). However, we will refer to them in the text as deletions, for simplicity. 3.2. Deletions probably involve loss of pseudoknot domains The 5 -untranslated region examined (Figs. 1 and 2) corresponds to that predicted to contain pseudoknot structures (Pleij et al., 1985) in FMDV of serotypes A and 0 (Clarke et al., 1987; Le et al., 1993). By analogy, pseudoknot structures are predicted for this region of the S-UTR of FMDV serotype C (Fig. 3). Both the sequence and spacing between predicted pseudoknots are highly conserved among FMDV serotypes A, 0 and C. The nucleotide substitutions that distinguish serotypes C from Al2 are shown in Fig. 3. Several compensatory mutations, which tend to maintain the folding of the pseudoknot structure, have been identified in the sequences compared (Fig. 4). Other changes are either located in the unpaired stretches of the RNA, or, when located in the stems of the pseudoknot, they do not alter significantly the predicted stability of the structure (Fig. 4). The only exception is a mutation in isolate C, 039 Arg/92 in position 2 of pseudoknot II that will destroy stem 1 of this pseudoknot. However, in this case, as well as in some other isolates, an alternative pseudoknot can be formed 6 bases towards the 3 -end (not shown). The number of predicted pseudoknots varies in the different isolates. While all C, isolates show four pseudoknots, C, isolates have three, and C, Pando Ur/44, C, Santa Fe Arg/75 and C Philippines/3/87 have two pseudoknots (see Fig. 3). The large: deletions in the S-untranslated region at the 3 -side of the poly C tract

160

C. Exam&

et al. /L&us

Research 35 (1995) 155-167

10

30

50

70

90

Cl Sta Pa" sp/70 Cl Vie X1/77 Cl Haute Loire FrI69 Cl Vosges m/so Cl Loupoigne Be1/53 Cl Noville Cl Brescia Cl Serra C3 Resende Sw/65 It./88 SW81 Br,55

-CTWSGSWSCSCGG
T T T T A A A A A T T T

T T TC AT XI AT AA

G ACGTAAAAGGGATGTAACCACAAGCTTAACACSGXCTCKSCE
ACGTAAAAGGGATGTRACCACAAGCTTAACACCGTCTCTCCC ACGTAARAGGGATGTAACCACAAGCTTAACACCGTCTCTTCC G G G T T T T TC

de Dar6

T G GA T G GA T G GA TGGA T A

C3 Argentina183 C3 Argentina/84 C5 Argentina/69 C3 Indaial C3 Santa Br/71-78 Fe AW/75

GCGTAAAAGGGATATAACCACAAGCTTAACACCG*~C~CCC
ACGTARAARGGAGGTAACCACAAGCTTGATACCGTCTATCCC

G G G
. G . . . G G . . . .

C3 039 kg/92 C3 Argentina/85 C2 Pando W/44 C4 Tierra de1 Fuego C Philippines/3/87 C Philippines/l/88 CGC Gx/26 &g/66

ACGTAAAGGGGAAGTAACCACAAGCTTGATOCCATCTGTCCC

T T ATC

A A A

T TT

ACGTRAAAGGGAGGTAACCATAAGCTTGACOCCGTCTGTCCC ACGTAAAAGGGGAGGTAACCACAAGCTTGACOCCGTCTGTCCC
ACGTGAAAGGGATGTAACCACAGGCTTAACACCGTCCCCCCCCCG~~~~

TG . . . . . . . . . GT AG A T . . . . . . . TGGA

A . . . . . . . .

T . . . CT GT

ACGTGAAAGGGAGGTAACCACAAGCTTGACACCGTCTGTCCC

T GT A

110

130

150

170

Cl St_B. Pa" sp/70 C;

Cl Cl

CG?TAACGGGATGCAACCGTABGACACACfTTCATCCGGA
C C R A A A A A A A A A A A A A A AAAC C C C C TGC TC C PCAT TC A A AAM MAT G AX G G C A CT T T A A T T T T

Vie Sp177 Haute Loire Fr169

Vosges

m/so
g
G T T T T T T GT GT GT 4 C AC AC C A T T AT T AC AC AC C

Cl Loupoigne Be1153 Cl Noville Sw/65 Cl Brescia Cl Serxa C3 Resende It188 Br,!35 de Dard Sp/81

A A A CT CT CT CT C C G TCT T T AG AG T G GC C C CT CT C A A A A A A A A A A A A A

C3 Argentina/83 C3 Argentina184 C5 Argentina/69 c3 Indaial Br/71-78 c3 Santa Fe &g/75 c3 039 C3 Argentina/85 C2 Pando "r/44 C4 Tierra del Fuego Arg/66 C Philippines/3/87 C Philippines/l/88 'XC Gerl26

mc
ASAC AAs2 AAT SAC AAT RAA

GT

c
C

T T T

GT GT T

AC
AC AC

TGT
IGT C 7%

c
C

Fig. 2. Alignment of S-terminal nucleotide sequences from the S-UTR of FMDV RNA (location of the sequenced region given in Fig. 1). The name of the isolates is written on the left, and their origin is given in Table 1. Only the sequence between the two primers used in the PCR amplification is represented; the sequence corresponding to the primers is not given since, for some of the isolates, the corresponding genomic sequence has not been determined. The sequences given correspond to nucleotides 22 to 193 in fig. 6 of Escarmis et al. (1992). Due to several partial repeats along the sequence compared (underlined with continuous or discontinuous tracing in the C, Sta Pau Sp/70 and C, Resende Br/_55 sequences), the gap spanning nucleotides 1 to 46 was located in a different position in our previous alignment (Escarmis et al., 1992). The new alignment presented here has been optimised to yield a minimum number of variant nucleotides among the sequences compared. Only nucleotides which differ from the C, Sta Pau/70 sequence are included. Lower case letters indicate the dominant nucleotide in a position showing multiple bands in the sequencing gel. Dots represent sequence gaps (deletions).

C. Escarmi et al. / Wus Research 35 (1995) 155-167 s

161

Cp Pando lJrl44

Fig. 3. Pseudoknot structures predicted in the S-UTR of isolates C, Resende Br/5.5, C-S&l and Ca Pando Ur/44. Only the nucleotides close to the pseudoknots are shown. The indicated number of nucleotides (18 or 20) between each pseudoknot has been omitted from the sequences; complete sequences ar given in Fig. 2. The primers corresponding to positions - 3 to - 21, not included in Fig. e 2, are shown in italics (left of each row). For C-S8cl and C, Pando Ur/44 this sequence was obtained by direct sequencing of genomic RNA (see Sect. 2), and for C, Resende Br/55 it was taken from Cao et al. (1991). The broken lines indicate the interactions in stem 2. Nucleotides different from those of Al2 (Clarke et al., 1987) are circled. The arrow termed Del. on pseudoknots IV (last column) indicates the exact position at which one nucleotide is deleted in the type C sequences relative to type Al2 (Clarke et al. 1987). The horizontal arrows C,, C, Pando on the C, Resende Br/55 sequence (first row) point to likely positions at which a C, Resende Br/55-like ancestor could originate by deletion a C,- or C, Pando-like pseudoknot arrangement (see also Sect. 4).

found among type C isolates (Fig. 2) correspond to the loss of one or two pseudoknot domains (Fig. 3). Likely positions at which the deletion events could occur are indicated in Figs. 2 and 3. No sequences whose alignments could be compatible with deletions involving only part of a predicted pseudoknot have been found. 3.3. The phylogenetic tree defines the same groupings as the capsid genes, but a lower rate of long-term evolution In addition to large deletions, the sequence alignment (Fig. 2) shows numerous nucleotide substitutions [of each RNA relative to the C-S8cl sequence, as shown in Fig. 2, or of each isolate relative to the corresponding consensus defined for each subtype or for each geographical group (not shown)]. The number of nucleotide replacements was sufficient to permit the derivation of a phylogenetic tree (Fig. 5). The grouping of isolates is identical to that derived previously from the VP1 and Pl sequences of the same viruses (Martinez et al., 1992). In particular, the results with 5 -UTR sequences give further support to the previous suggestion that FMDV CGC Ger/26 belonged to a phylogenetic line now probably extinct

162
Pseudoknot structures

C. Escarmii et al. / vinrs Research 35 (1995) 155-167

Positionb MutationC Strain Predicted effects on pseudoknot

10 12

C+T A-G G+A G-A T-C C+T C+T A-iG T-+A T-+C C-+T

C3 Indaial Br/71-78 Cg Argentina/69 C3 Indaial Br/71-78 c3 039 A+92 C Philippines/l/88 C3 Argentina/84 C Philippines/l/88 C Philippines/l/86 Cs Argentina/69 C-S&l; Cl Vie Sp/77

Compensatory

of 20, G+A to T-G

T-A pair changes Compensatory

---- ---

__._._a.__._._ . .._ 20
I[

of 10, C+T

. . *;\ \
# :L$ . .-. .-. .-. ,-.-. .\\

2
7 3 13 23

Disrupts

stem 1 of 23, A+G to T-G to T-G

Compensatory

: k .\, -;;.. h ::, . . . . :x.-.x.-. 2b

C-G pair changes C-G pair changes Compensatory

of 7, T+C

.-. .-. .-. 1-w.

c\ ii,, \

?? .J \ ?? \ ;10

III

7 7 8

Destroys T-A pair at one end of stem 2 Destroys T-A pair at one end of stem 2 to T-G

. ; : \. \\ \\ -;;:\ . . . . . . . y . 9n

C3 Argentina/65

C-G pair changes

. . C

\ . 3-c=
.-.-lb.: .-. . .

. \ \;:.

IY
2 0

8
al

T-S
A+G

SWXdd
Severald

Compensatory Compensatory

of 20, A+G of 8, T+C

,-:I:

. . ;=2 .\.

Fig. 4. Nucleotide substitutions observed in the base-paired regions of the pseudoknot domains of the FMDV type C genome. a The entire pseudoknot structures are depicted in Fig. 3. b Position refers to the nucleotide according to the numbering of residues shown in the schematic structure on the left. Mutation found in the strain listed in the next column relative to the sequence of C, Resende Br/55 (given in Fig. 3). d These compensatory mutations have been found in C, Indaial Br/71-78, C, 039 Arg/92, C, Argentina/85 C, Tierra de1 Fuego Arg/66, CGC Ger/26, C, Pando Ur/44, C, Santa Fe Arg/75, and all C, isolates. In addition to mutations listed, a total of 17 changes were scored in the unpaired regions shown on the schemes, relative to the C, Resende Br/55 sequence.

(Martinez et al., 1992, and Fig. 5). Some isolates of the C, subtype (group IV from Martinez et al., 1992) were not clearly resolved in the tree derived with 5 -UTR sequences (Fig. 5), although they do not occupy a position at variance with the one derived from the VP1 gene analysis (Martinez et al., 1992). The sequence of the new isolate C, 039 Arg/92 appears to be either more related to group IV (sequences related to C, Indaial Br/71-78) or to define a new group by itself. However, VP1 sequences of this isolate indicate that it belongs to group IV (see Table 1). From the genetic distances, a rate of fixation of mutations of (6 + 2) X 10e4 substitutions per nucleotide per year is calculated. This value is about two times lower than the rate previously calculated for the VP1 gene (Martinez et al., 1992). This result extends to long-term evolution of FMDV, the previous conclusion, reached from a study with closely related isolates (Villaverde et al., 19881, that different genomic segments of the same FMDV isolates may evolve at different rates. In summary, a molecular epidemiological analysis of the 5 -UTR of FMDV type

C. Escarmk et al. / Mrus Research 35 (1995) 155-167

163

C, -I-km del Fuego A@66

C3Santa Fe A@75 C3 Indstsl Br/71-78

5 substilufions

Fig. 5. Phylogenetic tree derived from the 5 -UTR sequences given in Fig. 2. Horizontal lines represent genetic distances as indicated in the scale; vertical distances are arbitrary and given for clarity. The oldest isolate, CGC Ger/26, was used to root the tree (as described in Martinez et al., 1992). The procedures used for tree reconstruction and determination of significance levels and standard deviations of branch lengths are described in Sect. 2. Significance levels for nodes are: * 0.05 > P > 0.01, and * * * 0.001 > P. No symbol on a node (except in the root) means that the branching order at this point is not defined in more than the 95% of the bootstrap replicates (although it is the most probable). Shaded bars indicate 1 SD around the branching point obtained as in Dopazo (1994). Inverted triangles indicate that a deletion of 86 nucleotides (filled triangles) or 43 nucleotides (empty triangles) occurred at the corresponding branch.

C has confirmed the phylogenetic relationships previously established with capsid genes. A salient feature of the present study is the evidence for the occurrence of large deletions during the natural evolution of FMDV. Such deletions appear to correspon to the loss of pseudoknot motifs. d 4. Discussion
The evidence for the presence of pseudoknot structures in the untranslated region located between the poly C tract and the IRES element of aphthoviruses

164

C. Escarmis et al. / L%us Research 35 (1995) 155-167

remains purely predictive, since no direct biochemical evidence for this type of tertiary structure is available for this virus group. However, the clear conservation of the predicted pseudoknot structures, and the spacing between them, in phylogenetically diverse aphthoviruses suggest that the pseudoknot is probably an authentic folding pattern in this genomic location. This has been further substantiated by the present comparison of multiple FMDV isolates, since the great majority of genetic variations scored tend to preserve the predicted structures either by being not disruptive of the stem-loop patterns, or even by being accompanied by compensatory, sister replacements (Fig. 4). Moreover, pseudoknots are also predicted in the corresponding genomic area of encephalomyocarditis virus and hepatitis A virus (Le et al., 1993), further suggesting that these tertiary structures probably play an important role in the biology of picornaviruses. Pseudoknot structures have been identified in several viral RNAs where they constitute important regulatory signals for viral replication and translation (review in ten Dam et al., 1992). Recently pseudoknot structures have been demonstrated to mediate ribosomal frameshifting (Brierley, 1993) and to promote RNA synthesis (Jacobson et al., 1993). In the case of the 5 -UTR of FMDV their role has not been established. However, the fact that in the present study no isolates have been found which lack a portion of a pseudoknot suggests that one or more complete pseudoknot domains are critical for some aspect of viral replication. The location of pseudoknots between the unusually long poly C tract - of function equally unknown - and the IRES element, itself harbouring a functional short polypyrimidine tract, suggests a possible spacer function perhaps structured to keep the poly C and IRES apart. The variation in the number of pseudoknots during FMDV evolution could come about by deletion or addition events, the latter either by intragenomic duplication or by genetic recombination. As indicated by the horizontal arrows in Fig. 3, the viral polymerase could, by a copy-choice mechanism, create deletions or duplications facilitated by the sequence repeats found in this genomic region (see Fig. 2). Also, pseudoknots could act as polymerase pausing sites and, thus, promote polymerase jumping. Heterologous recombination events, resulting in the insertion of cellular RNA fragments, seem more unlikely, but they cannot be completely excluded since the partially repeated sequences underlined in Fig. 2 show considerable identity with the rat p fibrinogen gene, as pointed out by Clarke et al. (1987). The phylogenetic analysis of the 5 -UTR of type C isolates (Fig. 5) suggests that the deletion or addition events must be very frequent during FMDV evolution. Indeed, C, Pando Ur/44 and C, Tierra de1 Fuego belong to the same tree branch, and yet they have a large deletion and no deletion, respectively, relative to the C3 Resende Br/55 sequence (see Fig. 2). A similar situation is found with C, Santa Fe Arg/75c and C, Indaial Br/71 (compare Figs. 2 and 5). Even more remarkable are the results with the two isolates from The Philippines. These two viruses are indistinguishable with regard to the aligned 5 -UTR sequences (Fig. 2), and they are also closely related in their capsid genes (Martinez et al., 1991, 1992). In spite of such close relationship, C Philippines 3/87 shows the large deletion of 86

C. Escartnik et al. / virus Research 35 (1995) 155-167

165

nucleotides relative to most South American viruses, whereas the C Philippines l/88 isolate shows no deletion (see Fig. 2). The presence of the deletion in the earlier isolate need not mean that an addition or duplication, rather than a deletion event, took place during evolution of this virus subline. During an outbreak of FMD generally multiple evolutionary sublines coexist, and the precursor of C Philippines l/88 need not be C Philippines 3/87 (Dopazo et al., 1988, 1993). The phylogenetic relationships established with 5 -UTR sequences are very similar to those defined with the capsid genes (Martinez et al., 1992), suggesting a similar evolution pattern of these two genomic regions in these viruses. The rareness af deletion events in the capsid genes probably reflects the need to keep the folding of capsid proteins compatible with particle stability. A limited tolerance of the capsid, even to single amino acid replacements, has been recently suggested on the basis of structural studies (Lea et al., 1994). The results reported here indicate that when structural and functional constraints allow it, the FMDV replicase is also capable of extending genome plasticity by adding or deleting considerably long genomic RNA stretches. The continuous action of negative selection to preserve virus viability seems to be the main restriction to virus variation (Domingo and Holland, 1994)

Acknowledgements

The authors thank Dr. Felsenstein for providing the PHYLIP package, and Dino Feigelstock for providing some of the viruses from Argentina. Work at CBMSO supported by CICYT BI091-0051-C02-01, The European Community (Bridge Program), and Fundacion Ramon Areces. Work at INTA supported by grant 89-01/88-009 from the Secretaria de Estado de Ciencia y Tecnica de Argentina. JD is supported by a CSIC-Fundacion Ram& Areces contract.

References
Bachrach, H.L. (1968) Foot-and-mouth disease virus. Annu. Rev. Microbial. 22, 201-244. Borrego, B., Novella, I.S., Giralt, E., Andreu, D. and Domingo, E. (1993) Distinct repertoire of antigenic variants of foot-and-mouth disease virus in the presence or absence of immune selection. J. Virol. 67, 6071-6079. Brierley, I. (1993) Probing the mechanism of ribosomal frameshifting on viral RNAs. Biochem. Sot. Trans. 21, 822-826. Cao, X., Bergmann, I.E. and Beck, E. (1991) Comparison of the 5 and 3 untranslated genomic regions of virulent and attenuated foot-and-mouth disease viruses (strains 0 Campos and C3 Resende). J. Gen. Virol. 72, 2821-2825. Clarke, B.EJ., Brown, A.L., Currey, K.M., Newton, S.E., Rowlands, D.J. and Carroll, A.R. (1987) Potential secondary and tertiary structure in the genomic RNA of foot-and-mouth disease virus. Nucleic Acids Res. 15, 7067-7079. DeBorde, D.C., Naeve, C.W., Herlocher, M.L. and Maassab, H. (1986) Resolution of a common RNA sequencing ambiguity by terminal deoxynucleotidyl transferase. Anal. B&hem. 157, 275-282.

166

C. Escarmis et al. / Wus Research 35 (1995) 155-167

Devereux, J., Haeberli, P. and Smithies, 0. (1984) A comprehensive set of sequence analysis programs for the Vax. Nucleic Acids Res. 12, 387-395. Domingo, E., Escarmis, C., Martinez, M.A., Martinez-Salas, E., and Mateu, M.G. (1992) Foot-andmouth disease virus populations are quasispecies. Curr. Top. Microbial. Immunol. 176, 33-47. Domingo, E. and Holland, J.J. (1994) Mutation rates and rapid evolution of RNA viruses. In: S.S. Morse (Ed.), The Evolutionary Biology of Viruses, pp. 161-184. Raven Press, New York. Domingo, E., Mateu, M.G., Martinez, M.A., Dopazo, J., Moya, A. and Sobrino, F. (1990) Genetic variability and antigenic diversity of foot-and-mouth disease virus. Appl. Virol. Res. 2, 233-266. Dopazo, J. (1994) Estimating errors and confidence intervals for branch lengths in phylogenetic trees by a bootstrap approach. J. Mol. Evol. 38, 300-304. Dopazo, J., Dress, A. and von Haeseler, A. (1993) Split decomposition: a technique to analyze viral evolution. Proc. Natl. Acad. Sci. USA 90, 10320-10324. Dopazo, J., Sobrino, F., Palma, E.L., Domingo, E. and Moya, A. (1988) Gene encoding capsid protein VP1 of foot-and-mouth disease virus: a quasispecies model of molecular evolution. Proc. Natl. Acad. Sci. USA 85, 6811-6815. Escarmis, C., Toja, M., Medina, M. and Domingo, E. (1992) Modifications of the 5 untranslated region of foot-and-mouth disease virus after prolonged persistence in cell culture. Virus Res. 26, 113-125. Felsenstein, J. (1981) Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol. 28, 49-62. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791. Felsenstein, J. (1993) PHYLIP (Phylogeny Inference Package) version 3.5, Dept. of Genetics, University of Washington, Seattle. Fichot, 0. and Girard, M. (1990) An improved method for sequencing of RNA templates. Nucleic Acids Res. 18, 6162. Jacobson, S.J., Konings, D.A.M. and Sarnow, P. (1993) Biochemical and genetic evidence for a pseudoknot structure at the 3 terminus of the poliovirus RNA genome and its role in viral RNA amplification. J. Viral. 67, 2961-2971. Jukes, T.H. and Cantor, CR. (1969) Evolution of protein molecules. In: H.N. Munro (Ed.). Mammalian protein metabolism, vol III, pp. 71-123. Academic Press, New York. Le, S-Y., Chen, J.H., Sonenberg, N. and Maize1 Jr., J.V. (1993) Conserved tertiary structural elements in the 5 nontranslated region of cardiovirus, aphthovirus and hepatitis A virus RNAs. Nucleic Acids Res. 21, 2445-2451. Lea, S., Hernhndez, J., Blakemore, W., Brocchi, E., Curry, S., Domingo, E., Fry, E., Ghazaleh, R.A.-, King, A., Newman, J., Stuart, D. and Mateu, M.G. (1994) The structure and antigenicity of a type C foot-and-mouth disease virus. Structure 2, 123-139. Martinez, M.A., Carrillo, C., Plana, J., Mascarella, R., Bergad& J., Palma, E.L., Domingo, E. and Sobrino, F. (1988) Genetic and immunogenetic variations among closely related isolates of footand-mouth disease virus. Gene 62, 75-84. Martinez, M.A., Dopazo, J., Hernindez, J., Mateu, M.G., Sobrino, F., Domingo, E. and Knowles, N.J. (1992) Evolution of the capsid protein genes of foot-and-mouth disease virus: antigenic variation without accumulation of amino acid substitutions over six decades. J. Virol. 66, 3557-3565. Martinez, M.A., Hernhndez, J., Piccone, M.E., Palma, E.L., Domingo, E., Knowles, N. and Mateu, M.G. (1991) Two mechanisms of antigenic diversification of foot-and-mouth disease virus. Virology 184, 695-706. Mateu, M.G., Da Silva, J.L., Rocha, E., de Brum, D.L., Alonso, A., Enjuanes, L., Domingo, E. and Barahona, H. (1988) Extensive antigenic heterogeneity of foot-and-mouth disease virus of serotype C. Virology 167, 113-124. Mateu, M.G., Hernindez, J., Martinez, M.A., Feigelstock, D., Lea, S., PBrez, J.J., Giralt, E., Stuart, D., Palma, E.L. and Domingo, E. (1994) Antigenic heterogeneity of a foot-and-mouth disease virus serotype in the field is mediated by very limited sequence variation at several antigenic sites. J. Virol. 68, 1407-1417. Mateu, M.G., Rocha, E., Vicente, O., Vayreda, F., Navalpotro, C., Andreu, D., Pedroso, E., Giralt, E., Enjuanes, L. and Domingo, E. (1987) Reactivity with monoclonal antibodies of viruses from an episode of foot-and-mouth disease. Virus Res. 8, 261-274.

C. Escarmis et al. / l4rus Research 35 (1995) 155-167

167

Pereira, H.G. (1981) Foot-and-mouth disease. In: E.P.G. Gibbs (Ed.), Virus Diseases of Food Animals, Vol. 2, pp. 333-363. Academic Press, New York. Piccone, ME., Kaplan, G., Giavedoni, L., Domingo, E. and Palma, EL. (1988) VP1 of serotype C foot-and-mouth disease viruses: long-term conservation of sequences. J. Virol. 62, 1469-1473. Pleij, C.W.A., Rietveld, K. and Bosch, L. (1985) A new principle of RNA folding based on pseudoknotting. Nucl Acids Res. 13, 1717-1731. eic Saitou, N. and Nei, M. (1987) The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406-425. Sobrino, F., Dhila, M., Ortin, J. and Domingo, E. (1983) Multiple genetic variants arise in the course of replication of foot-and-mouth disease virus in cell cultures. Virology 128, 310-318. Sobrino, F., Palma, E.L., Beck, E., Davila, M., de la Torre, J.C., Negro, P., Villanueva, N., Ortin, J. and Domingo, E. (1986) Fixation of mutations in the viral genome during an outbreak of foot-and-mouth disease: heterogeneity and rate variations. Gene 50, 149-159. ten Dam, E., Pleij, K. and Draper, D. (1992) Structural and functional aspects of RNA pseudoknots. Biochemistry 31, 11665-11676. Villaverde, A., Martinez, M.A., Sobrino, F., Dopazo, J., Moya, A. and Domingo, E. (1991) Fixation of mutations at the VP1 gene of foot-and-mouth disease virus. Can quasispecies define a transient molecular clock?. Gene 103, 147-153. Villaverde, A., Martinez-Salas, E. and Domingo, E. (1988) 3D gene of foot-and-mouth disease virus: conservatron by convergence of average sequences. J. Mol. Biol. 204, 771-776.