Hum Genet (2009) 124:579591 DOI 10.

1007/s00439-008-0593-6

REVIEW ARTICLE

Lactose digestion and the evolutionary genetics of lactase persistence

Catherine J. E. Ingram Charlotte A. Mulcare Yuval Itan Mark G. Thomas Dallas M. Swallow

Received: 6 August 2008 / Accepted: 6 November 2008 / Published online: 26 November 2008 Springer-Verlag 2008

Abstract It has been known for some 40 years that lactase production persists into adult life in some people but not in others. However, the mechanism and evolutionary signiWcance of this variation have proved more elusive, and continue to excite the interest of investigators from diVerent disciplines. This genetically determined trait diVers in frequency worldwide and is due to cis-acting polymorphism of regulation of lactase gene expression. A single nucleotide polymorphism located 13.9 kb upstream from the lactase gene (C-13910 > T) was proposed to be the cause, and the 13910*T allele, which is widespread in Europe was found to be located on a very extended haplotype of 500 kb or more. The long region of haplotype conservation reXects a recent origin, and this, together with high frequencies, is evidence of positive selection, but also means that 13910*T might be an associated marker, rather than being causal of lactase persistence itself. Doubt about function was increased when it was shown that the original SNP did not account for lactase persistence in most African populations. However, the recent discovery that there are

several other SNPs associated with lactase persistence in close proximity (within 100 bp), and that they all reside in a piece of sequence that has enhancer function in vitro, does suggest that they may each be functional, and their occurrence on diVerent haplotype backgrounds shows that several independent mutations led to lactase persistence. Here we provide access to a database of worldwide distributions of lactase persistence and of the C-13910*T allele, as well as reviewing lactase molecular and population genetics and the role of selection in determining present day distributions of the lactase persistence phenotype.

Introduction Lactase, the small intestinal enzyme responsible for cleaving lactose into its constituent absorbable monosaccharides, glucose and galactose, is essential for the nourishment of newborn mammals, whose sole source of nutrition is milk, in which lactose is the major carbohydrate component. In adult mammals other than humans lactase production decreases signiWcantly in quantity following weaning (Buller et al. 1990; Lacey et al. 1994; Sebastio et al. 1989). Although individual diVerences in the ability of human adults to digest milk had been remarked upon in Roman times, variation in expression of lactase was not established as a genetically determined trait until the second half of the twentieth century. Indeed before this, expression of high levels of lactase in adulthood was considered by people of European descent to be the normal state of aVairs, and widespread deWciency of lactase in adults was only appreciated in the early 1960s (Auricchio et al. 1963; Dahlqvist et al. 1963). Here, we review all aspects of this polymorphism from description of phenotype to molecular and evolutionary

Electronic supplementary material The online version of this article (doi:10.1007/s00439-008-0593-6) contains supplementary material, which is available to authorized users. C. J. E. Ingram C. A. Mulcare Y. Itan M. G. Thomas D. M. Swallow (&) Department of Genetics Evolution and Environment, University College London, Wolfson House, 4 Stephenson Way, London NW1 2HE, UK e-mail: d.swallow@ucl.ac.uk Y. Itan Centre for Mathematics and Physics in the Life Sciences and Experimental Biology, CoMPLEX, University College London, Wolfson House, 4 Stephenson Way, London NW1 2HE, UK

123

580

Hum Genet (2009) 124:579591

genetics. Since we had noted that the population distribution data available in many literature reviews contained anomalous information (as will be discussed below) we also provide access to a newly constructed database of phenotypic data taken from source publications.

Symptoms of lactose intolerance Undigested lactose passing through the small intestine into the colon has two physiological eVects. First, an osmotic gradient is set up across the gut wall, which results in an inXux of water, causing symptoms of diarrhoea. Second, the lactose can be fermented by colonic bacteria, to produce fatty acids and gaseous by-products (including hydrogen, used in the tolerance test), potentially causing discomfort, bloating and Xatulence. However most lactase non-persistent individuals can tolerate small amounts of lactose (as in tea or coVee), and some can consume a lot without ill eVects (Scrimshaw and Murray 1988; Suarez et al. 1997). Variation in the composition of the gut Xora between individuals (Hertzler et al. 1997; Hertzler and Savaiano 1996), as well as a psychosomatic component (Briet et al. 1997; Peuhkuri et al. 2000; Saltzman et al. 1999) may account for some of the interindividual variation in symptoms.

Determination of lactase persistence status People whose lactase persists at high levels throughout adult life are said to be lactase persistent while those with little lactase as adults are described as lactase non-persistent (also referred to in the literature as primary adult hypolactasia). Since taking intestinal biopsies from healthy people is invasive and not acceptable unless the person is having other investigations, lactase persistence status is often inferred by a method depending on lactose digestion. This allows people to be classiWed as lactose digesters and maldigesters. This diVerence in digestion is measured by a test traditionally known as a lactose tolerance test and thus the terms tolerant and intolerant are sometimes used, though this can be confused with dietary intolerance. The lactose tolerance test usually involves giving a lactose load after an overnight fast and then measuring blood glucose or breath hydrogen. A baseline measurement of blood glucose or breath hydrogen is taken before ingestion of the lactose, and then at various time intervals thereafter. An increase in blood glucose indicates lactose digestion (glucose produced from the lactose hydrolysis is absorbed into the bloodstream), and no increase, or a Xat line is indicative of a lactose maldigester (probable lactase nonpersistent) phenotype. An increase in breath hydrogen indicates maldigestion and reXects colonic fermentation of the lactose, as described in the following section. In both cases somewhat arbitrary cut-oV points have to be set for distinguishing the two phenotypes and both methods inform upon the persons ability to digest lactose rather than the given individuals lactase expression. It must therefore be borne in mind that there will be an underlying error rate, leading to both false negatives and false positives. The relative eYciency of the tests has been examined in more than one study, and the breath hydrogen method was found the most accurate (Mulcare et al. 2004; Newcomer et al 1975; Peuhkuri 2000). It is also convenient and cheap. Lactase levels can, however, be secondarily reduced by gastrointestinal disease, leading to secondary lactose intolerance and also some people fail to produce hydrogen. In the clinical setting there are ways of improving the quality of the test. These include retesting, and giving a dose of a non-digestible carbohydrate, lactulose, to test for the presence of hydrogen producing bacteria (see section below), and investigation of other causes of the lactose intolerance, which might include examination of biopsy material.

Worldwide distribution of lactase persistence Surveys of lactase persistence phenotype frequencies have been carried out in many populations over the years, so that the global distribution of lactase persistence is now fairly well characterised (Flatz 1987; Swallow and Hollox 2000; Table 1 supplementary information; Fig. 1a). This reveals that lactase non-persistence is the most common phenotype in humans (65% if one takes into account population census size as shown in Table 2 of the supplementary information), with lactase persistence being common only in certain populations with a long history of pastoralism and milking (McCracken 1971; Simoons 1970). Lactase persistence is at highest frequency in north-western Europe, with a decreasing cline to the south and east. On the Indian subcontinent the frequency of lactase persistence is higher in the north-west than elsewhere, and further east than India the lactase persistence frequency is generally low. In Africa, the distribution is patchy, with some pastoralist nomadic tribes having high frequencies of lactase persistence compared with neighbouring groups living in the same country (Bayoumi et al. 1981, 1982), with a similar pattern observed between Bedouin and neighbouring populations in the Middle East (Fig. 2, Cook and al-Torki 1975; Dissanyake et al. 1990; Snook et al. 1976). The noted correlation of lactase persistence phenotype with the cultural practise of milking generated the hypothesis that this trait has been subject to strong positive selection (Aoki 1986; Holden and Mace 1997; McCracken 1971; Simoons 1970, 1978).

123

Hum Genet (2009) 124:579591 Fig. 1 Interpolated maps of the old world showing the distribution of (a) lactase persistence data taken from the literature (Supplementary data Table 1), (b) -13910*T distribution (c) lactase persistence frequency predicted from -13910*T distribution, using the data collection to be found in Supplementary data Table 3. Maps were generated using PYNGL (http:// www.pyngl.ucar.edu). Only includes individuals over 12 years of age, who are unrelated, and literature for which the original publications have been located and checked. Articles in which there was clear selection bias, and recent immigrant populations are excluded, but the data can be found in Supplementary data Table 1. The Americas are excluded from all maps because of the paucity of data. Most data were obtained from lactose tolerance tests using either breath hydrogen or blood glucose, though in some cases enzyme assay data were available. Locations were either as described precisely in the publication, or taken from capital cities or central points of a country or region where precise location is not mentioned. Where more than one data set was available weighted averages of the data were taken. Predicted frequency taken to be p2 + 2pq, where p is the frequency of 13910*T. Data points are shown as dots. It should be noted that the interpolation is inaccurate where there are few data points. A colour version of this Wgure can be found in the electronic supplementary information

581

(a)

(b)

(c)

123

582 Fig. 2 Examples of countries/ geographic regions in which individual ethnic groups display large diVerences in lactose absorption capacity. See Supplementary data (Table 1) for details
0.9

Hum Genet (2009) 124:579591

Lactose digester frequency

0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

Beja Jaali Baggara Nilotes Fulani Hausa Ibo Yoruba Jordanian Bedouin Non-Bedouin Jordanians Saudi Bedouin Non-Bedouin Saudis

Sudan

Nigeria

Middle East

Identifying the causes of lactase persistence By the early 1970s it was established that the lactase persistence polymorphism in humans has a genetic cause, and is inherited in an autosomal dominant manner (Ferguson and Maxwell 1967; Metneki et al. 1984; Sahi 1974). Further evidence that lactase persistence is a genetic trait, and more speciWcally that it is caused by a cis-acting element, was produced in the early 1980s. Ho et al. reported a trimodal distribution of sucrase:lactase ratios in intestinal samples from British adults of northern European ancestry. The trimodal distribution was interpreted as attributable to groups of individuals homozygous for lactase persistence (highest lactase activity), heterozygotes with mid-level activity and non-persistent homozygotes with low lactase activity (Ho et al. 1982), and similar results were subsequently obtained in individuals of German ancestry (Flatz 1984). The intermediate lactase activity observed in the heterozygotes indicated that only one copy of the lactase gene was being fully expressed. Evidence for transcriptional regulation (Escher et al. 1992) and conWrmatory evidence for the cis-acting
-14010*C -13915*G -13910*T -13907*G

nature of this (Wang et al. 1995) was obtained from mRNA studies. Sequencing of LCT and the immediate promoter region in Europeans showed no nucleotide changes that were absolutely associated with persistence/non-persistence (Boll et al. 1991; Lloyd et al. 1992; Poulter et al. 2003). However, several polymorphisms do exist across the 50 kb LCT gene and association studies revealed that very few haplotypes occur in most of the human populations tested, although greater diversity was observed in African populations (Hollox et al. 2001). One combination of alleles designated the A haplotype (Fig. 3) is particularly common in northern Europe and is associated with lactase persistence (Harvey et al. 1998). A putative causative single nucleotide polymorphism (C-13910 > T) was subsequently identiWed 13.9 kb upstream of the LCT transcription initiation site (Enattah et al. 2002) (Fig. 3). It is located in an intron of an adjacent gene, MCM6, and occurs exclusively on the background of the A haplotype (Poulter et al. 2003). The 13910*T allele was found to associate completely with lactase persistence, ascertained directly by enzyme

MCM6
A B C U
1 2 3 4 5 6 7 8 9 10 11

LCT

Fig. 3 Diagrammatic representation of the genes MCM6 and LCT. The arrow indicates the location of 13910*T, and the other alleles shown more recently to be associated with lactase persistence. Locations of SNPs used for LCT core haplotype analysis are shown, with the possible allelic combinations of the four common worldwide 11 SNP

haplotypes described in Hollox et al. (2001). The open circles indicate an ancestral allele and Wlled circles denote the derived allele at a locus. SNPs used for assessing haplotype background of the lactase persistence associated variants in our own studies are 4, 6, 9 and 10

123

Hum Genet (2009) 124:579591

583

activity in 196 Finnish individuals, and subsequent studies have conWrmed a tight but not absolute association between 13910*T and lactase persistence as judged by lactose tolerance testing in populations of northern European ancestry (Bernardes-Silva et al. 2007; Hogenauer et al. 2005; Kerber et al. 2007; Poulter et al. 2003) and there was also a correlation, but not absolute, between genotypes and enzymatic activity (Poulter et al. 2003). However the A haplotype extends far beyond the 50 kb LCT gene region, with carriers of the 13910*T allele having almost identical chromosomes extending for nearly 1 Mb (Bersaglieri et al. 2004; Poulter et al. 2003).

Evidence for function of 13910*T In vitro studies provided evidence that the 13910*T allele increases transcription in promoterreporter construct assays in cell lines (Lewinsky et al. 2005; Olds and Sibley 2003; Troelsen et al. 2003), suggesting that it may have enhancer activity in vivo. A transcription factor, Oct-1, was identiWed which bound more strongly to the 13910*T containing motif than to the alternative C allele, providing a possible mechanism for up-regulation of LCT (Lewinsky et al. 2005), and suggesting that the cause of lactase persistence had been identiWed (Rasinpera et al. 2004), although many questions remain unanswered.

In contrast to the high frequency in Europe, 13910*T is rare in sub-Saharan African populations (Fig. 1b) even in those populations where lactase persistence frequency is reported to be high (Mulcare et al. 2004), and it is also rare in the Bedouins of the Arabian peninsula, who are also frequently lactose digesters (Ingram et al. 2007). The allele was also absent from all but one of a series of phenotyped individuals of Sudanese ancestry (Ingram et al. 2007). An obvious interpretation was that -13910*T is not truly causal of lactase persistence, but is a very strongly associated marker of the causal element, which appeared on the lactase persistence carrying (A haplotype) chromosome after humans had spread out of Africa. However there was also no association with A haplotype in this African group and subsequent research indicated genetic heterogeneity.

New variants in intron 13 of MCM6, and multiple causes of lactase persistence in Africa Three studies revealed several new sequence variants in very close proximity (Figs. 3, 4; Table 1) to 13910*T (Enattah et al. 2008; Ingram et al. 2007; TishkoV et al. 2007), two of which are clearly associated with lactase persistence in diVerent parts of East Africa (13915*G and 14010*C). One of these, 13915*G, was also shown to be associated with high lactase expression in Saudi Arabia (Imtiaz et al. 2007). A third SNP, 13907*G, showed much weaker evidence, but was found in several studies (Enattah et al. 2008; Ingram 2008; Ingram et al. 2007; TishkoV et al. 2007), and there were several other candidates found in lactase persistent or milk drinking people (Enattah et al. 2008; Ingram et al. 2007; Ingram 2008; Tag et al. 2007; TishkoV et al. 2007). However, even taking these additional variants into account, and supposing them all to be functional, association with phenotype was not complete. Although the occurrence of a few individuals who carried an allele but were lactose maldigesters could be explained by secondary lactase loss, individuals who were digesters but carried no putative causative allele in this genomic region still had to be explained, indicating that there may be more, as yet unidentiWed, causal variants. The genomic region may be particularly susceptible to mutations, and these recent derived variants might simply be markers of a causal element elsewhere. However, the three newly described SNPs all occur on diVerent haplotype backgrounds from each other (using our old nomenclature: 13907*G, on A, 13915*G, on C, and 14010*C probably on B) (Enattah et al. 2008; Ingram et al. 2007; Ingram 2008; TishkoV et al. 2007), although 13907*G is on the same haplotype as 13910*T. In each case the haplotypes extend well beyond the 14 kb allele in both directions, showing clearly that the derived alleles cannot simply be

Population distribution of 13910*T: 13910*T does not account for lactase persistence worldwide and is rare in sub-Saharan African populations Using carefully checked primary source literature data (Supplementary Table 1) we failed to obtain the tight correlation of 13910*T with published worldwide lactase persistence phenotype frequency reported elsewhere (Enattah et al. 2007), but it is clear that in Europe the frequency distribution of 13910*T is in broad agreement with that expected from distribution of the phenotype (Fig. 1). Figure 1a shows an interpolated contour map depicting the distribution of lactase persistence, prepared from phenotypic data taken from all the available literature, in which we were conWdent of the phenotypic testing, and from which children, family members, patients selected for likely intolerance, and twentieth/twenty-Wrst century immigrant status were excluded. Figure 1b shows the distribution of 13910*T and details of the worldwide 13910*T data can be found in the supplementary information (Supplementary Table 3). Figure 1c shows predicted lactose tolerance distribution taken from 13910*T frequencies, assuming that 13910*T is the sole cause of lactase persistence and is dominant (p2 + 2pq).

123

584

Hum Genet (2009) 124:579591

-14133 TTTATGTAACTGTTGAATGCTCATACGACCATGGAATTCTTCCCTTTAAAGAGCTTGGTAAGCATTTGAGTGTAGTTGTTAGACGGAGACGATCACGTC Cdx-2 -14034 ATAGTTTATAGAGTGCATAAAGACCGTAAGTTACCATTTAATACCTTTCATTCAGGAAAAATGTACTTAGACCCTACAATGTACTAGTAGGCCTCTGCGCT HNF3/Fox HNF4 GATA6 T C -13934 GGCAATACAGATAAGATAA GGTAGCTCC GTGGCCTCAAAGGAACTCTCCTCCTTAGGTTGCATTTGTATAATGTTTGATTTTTAGATTGTTCTTTGAGCCCT Oct-1 -13833 GCATTCCACGAGGATAGGTCAGTGGGTATTAACGAGGTAAAAGGGGAGTAGTACGAAAGGGCATTCAAGCGTCCCATCTTCGCTTCAACCAAAGCAGCCC -13733 TGCTTTTTCCTAGTTTTATTAATAGGTTTGATGTAAGGTCGTCTTTGAAA -13684

Fig. 4 Sequence of the enhancer region in intron 13 of MCM6 showing the positions of characterised transcription factor binding sites (Lewinsky et al. 2005) and the SNPs that have been shown to associate with lactase persistence. Note that the protein binding region 13926 to 13909 is comprised of two partially overlapping sites (Oct-1 and

GATA6 as indicated). Several other SNPs that have been identiWed by ourselves and others, in this region, including 13913T > C are not shown since, as yet, no evidence of association with phenotype is available

markers for a single shared causal variant, and that there must be several independent causes of lactase persistence. Each of the alleles has a diVerent geographic distribution, and the preliminary data suggest that -13915*G arose in the Middle East, while 13907*G and 14010*C arose in eastern Africa.

Evidence of function for the alleles identiWed in Africa It is important to critically evaluate the evidence for function of these recently described alleles. Footprint analysis, to determine DNAprotein binding sites, of sequence encompassing the intron 13 region revealed transcription factor recognition sequences for Cdx-2, GATA, HNF3 / Fox and HNF4 along with Oct-1 (Lewinsky et al. 2005). Two of the newly identiWed SNPs are located within the Oct-1 binding site (Fig. 4). Electrophoretic mobility shift assays (EMSAs) used to ascertain the eVect of the new alleles on Oct-1 binding showed that only the original allele, 13910*T containing oligonucleotide probes bound strongly to Oct-1, -13907*G bound to a much lesser extent (Enattah et al. 2008; Ingram et al. 2007), and that binding of the other alleles was less still or undetectable. It can therefore be concluded that the simple change in binding of the protein Oct-1 to this site is unlikely to play a critical role in causing lactase persistence. The identiWcation of the other associated allele, 14010*C, (TishkoV et al. 2007), situated 100 bp away from the predicted Oct-1 binding site would appear to conWrm this. In vitro promoter/reporter analysis of the newly identiWed MCM6 intron 13 variant alleles however, lends some support to the idea that they do aVect enhancer activity. Transcriptional activity of the LCT core promoter was enhanced up to tenfold by addition of sequences from MCM6 intron 13 (Lewinsky et al. 2005; Olds and Sibley 2003; TishkoV et al. 2007) which include the ancestral variant. This activity increased further (by up to 25% more) when one of the variant alleles (14010*C, 13907*G or

13915*G) was present (TishkoV et al. 2007). This eVect is in fact small and the authors did not include 13910*T as a positive control (previously shown to enhance transcription activity a further 80% compared to the ancestral allele (Troelsen et al. 2003). Although a recent paper of Enattah et al. (2008) does conWrm an eVect for 13915*G, the results are hard to evaluate because additional sequences are included in the construct, and the control 13910*T shows very little eVect in this study. However, in the Enattah et al. (2008) paper the Caco-2 cells were not diVerentiated, as they had been in some of the previous studies (Troelsen et al. 2003). This also Xags the problem of the appropriateness of the cell model. Caco-2 is a colon cell line, and the only line known to express lactase and has features more comparable with fetal small intestine (Hauri et al. 1985). The predictive value of these in vitro functional studies with respect to the eVect exerted in vivo by particular alleles is therefore uncertain, but the observations, together with those made previously (Lewinsky et al. 2005; Olds and Sibley 2003; Troelsen et al. 2003) do suggest, though do not conWrm that this region is important in regulation of LCT expression. But how it allows low expression in fetuses, high expression in babies and then down-regulation in some but not other people is currently hard to envisage. Studies in mice Xag the complexities of interpretation of in vitro studies, and indeed in vivo studies highlight the subtleties of tissue and developmental control (Bosse et al. 2006a, b, 2007; van Wering et al. 2004). Unfortunately there are severe restrictions to animal models in elucidating this uniquely human polymorphism.

The role of other factors inXuencing lactase expression The immediate promoter of LCT is moderately well characterised in rat, pig and human (Fang et al. 2000, 2001; Krasinski et al. 2001; Lee et al. 2002; Mitchelmore et al. 2000; Spodsberg et al. 1999; Troelsen et al. 1994, 1997;

123

Hum Genet (2009) 124:579591 Note that we and others have identiWed a total of ten other alleles (including -13913*C) within the 130 bp region -13,900 to -14,030 for which studies of their association and function are ongoing Geographic location of highest observed frequency

585

Table 1 Details of SNPs known to be associated with lactase persistence as of July 2008

Evidence of association with lactase persistence

Ingram et al. (2007), TishkoV et al. (2007), Imtiaz et al. (2007)

Enattah et al. (2002)

TishkoV et al. (2007) Ingram (2008)

TishkoV et al. (2007)

van Wering et al. 2004; Wang et al. 2006), and there are several allelic variants within the Wrst kilobase of human sequence (Harvey et al. 1995; Hollox et al. 1999; Lloyd et al. 1992). Although none of them is causal of persistence, it is just possible that variations in these SNPs aVect expression under certain circumstances or at certain developmental stages: one study shows that the allele -958*T (characteristic of the B haplotype) reduces binding to an uncharacterised transcription factor (Hollox et al. 1999). Whilst it has been well established that regulation of LCT is predominantly under genetically determined transcriptional control there is evidence that other factors inXuence interindividual diVerences in expression of the enzyme. Heterogeneity of the lactase non-persistence phenotype was reported by a number of research groups in their early studies. Some investigators observed individuals who show slower/ abnormal processing of their lactase protein (Sterchi et al. 1990; Witte et al. 1990) which may imply variation in posttranslational controls such as proteolytic cleavage, glycosylation and/or transport to the cell surface, which are involved in the normal processing of lactase (Jacob et al. 1994, 1995, 1996, 2002; Naim and Lentze 1992). Others have made observations suggestive of epigenetic regulation (Maiuri et al. 1991, 1994). Although most non-persistent individuals show no staining for lactase in the jejunal biopsies of the small intestine (concordant with low lactase activity and transcriptional regulation of LCT), some individuals show patchy expression of the enzyme in the intestinal epithelia (Maiuri et al. 1991, 1994). This mosaic expression pattern might be attributable to somatic cell changes in methylation, or histone acetylation but curiously this is not attributable to an inherited change in expression pattern from a single stem cell, since in that case ribbons of positively stained cells would be expected.

Kenya/Tanzania

Saudi Arabia

Haplotype (Hollox et al. 2000 nomenclature)

A Troelsen et al. (2003), Olds and Sibley (2003), Lewinsky et al. (2005)

TishkoV et al. (2007), Enattah et al. (2008)

TishkoV et al. (2007)

Evidence of function

TishkoV et al. (2007), Enattah et al. (2008)

Ethiopia/Sudan

Europe

Evolutionary considerations The original observations in the 1970s and 1980s of a positive correlation between lactase persistence frequencies and milk drinking led to the widely held notion that lactase persistence has been subject to positive selection. In the intervening years molecular evidence has accumulated which would appear to corroborate this hypothesis. Our group Wrst reported on the unusual pattern of lactase gene haplotype diversity across populations (Hollox et al. 2001). We found only four common 50 kb haplotypes outside Africa, with many more within Africa, and a very high frequency of the A haplotype in northern Europe, and suggested that the very diVerent haplotype frequencies observed in N. Europeans as compared to other populations are most probably explained by a combination of genetic drift and strong positive selection for lactase persistence (Hollox et al. 2001).

Not included in dbSNP

rs41380347

rs Number

Substitution (ancestral allele Wrst, from comparison with chimp)

G>C

rs4988235 C>T 13,910

Position of SNP (in bps upstream of LCT)

T>G

14,010

13,915

13,907

C>G

rs41525747

123

586

Hum Genet (2009) 124:579591

-13910*C A haplotype,

-13910*T A haplotype

-13910*C non-A haplotype

Fig. 5 Pie charts showing microsatellite LCT/MCM6 haplotypes on chromosomes of diVerent SNP haplotype background: A haplotype carrying 13910*T, A haplotype carrying 13910*C and non-A haplotype chromosomes. 5579*C (rs2278544), SNP 10 in Fig. 3, used as a marker for A haplotype and 5579*T as a marker for non-A haplotype, and the A haplotype chromosomes are subdivided into those that do and do not carry 13910*T. The lactase persistence associated SNP, 22018*A (rs182549), originally described in Enattah et al. (2002) was tested on all samples and 22018*A correlated in all but one sample with 13910*T. Data taken from families and the haplotypes inferred from family structure. Data sets from: Irish n = 65 chromo-

somes, English n = 64, German, n = 60, French, n = 38, Ashkenazi Jews n = 96, Armenian, n = 88, Kuwaiti, n = 28, Algerian, n = 20, Ethiopian, Amharic n = 118; n values for main charts shown. The inset small charts show Ethiopian chromosomes only; n = 93 for non-A haplotype; n = 25 for A haplotype. It can be seen that both groups of Ahaplotype chromosomes share the same modal haplotype as do both groups of non-A chromosomes. The microsatellites tested are located in intron 16 of MCM6, intron 1, 2 and 13 of LCT, respectively at positions 13840816, 136804355, 136798196, 136763409, from the Human Genome Browser (http://genome.cse.ucsc.edu/cgi-bin/hgGateway July 2003 freeze (colour in online)

More recently it has been shown that 13910*T occurs on an unusually extended haplotype background, which is present in the northern European population at very high frequency (Bersaglieri et al. 2004; Poulter et al. 2003). This is consistent with a model of recent positive selection, in which alleles surrounding the causal variant hitch-hike rapidly to high frequency due to strong positive selection, and haplotype length is exaggerated, indicating a recent mutation event where recombination has not decayed the allelic associations in the region (reviewed in Sabeti et al. 2006). The 13910*T carrying chromosome is a real outlier in the context of molecular signatures of selection compared with the rest of the human genome (HapMap

Consortium 2003). Decreased diversity of microsatellite polymorphisms (STRs) that occurs in the region of LCT and MCM6 was also found for the 13910*T carrying chromosomes, indicating that this allele has risen in frequency quickly and recently (Coelho et al. 2005; Mulcare 2006) (Fig. 5). In our own study (Mulcare 2006) we used a marker for A haplotype chromosomes so that we could compare A haplotype chromosomes which carry the 13910*T with A haplotype chromosomes which do not, thus reducing the eVect of pooling haplotypes of totally diVerent lineages. Interestingly, we can see from this that the microsatellite haplotype that carries 13910*T is also the most frequent

123

Hum Genet (2009) 124:579591

587

of the ancestral A haplotype chromosomes in Europeans, and also in non-Europeans. It can also be seen that within the non-A lineages there is a fairly frequent microsatellite haplotype which occurs in Europeans as well as non-Europeans (Fig. 5). It is associated with the B core haplotype in Europeans, and non-persistence. These observations suggest demographic factors additional to selection for one particular allele, as proposed previously (Hollox et al. 2001). Indeed, in the case of European lactase persistence, recent demic computer simulations indicate that the spread of farming from the near east during the Neolithic transition may have contributed to the high frequencies and genetic homogeneity of lactase persistence on the continent (Y. Itan, M. Thomas et al. manuscript in preparation).

Historical origins of lactase persistence; dating of the lactase persistence associated alleles Each of the microsatellite diversity studies used the microsatellites to attempt to date the expansion of the 13910*T allele and the date ranges were 7,45012,300 (Coelho et al. 2005), and 7,40010,200 years ago (Mulcare 2006), and this agrees with date estimates obtained from extended haplotypes of 2,18820,650 years ago (Bersaglieri et al. 2004). These dates are consistent with models of selection for lactase persistence along with the recent practise of dairying, approximately 9,000 years ago in Europe. Ancient DNA data obtained from human bones has shown that the 13910*T allele was either absent, or present at low frequencies, in early Neolithic Europeans. This is consistent with the -13910*T allele age estimates and supports a model whereby the cultural trait of dairying was adopted prior to lactase persistence becoming frequent (Burger et al. 2007). The newly discovered 14010*C allele is also reported to occur as part of an unusually extended haplotype, suggesting that Africans too carry these signatures of recent positive selection for lactase persistence. In this case the allele is estimated to be between 1,200 and 23,200 years old (TishkoV et al. 2007). The identiWcation of the newly associated alleles themselves suggests that lactase persistence has arisen and been selected for independently in several diVerent human populations, thus the ability to digest milk has been extremely advantageous, at least for some, in the last few thousand years.

What were the evolutionary forces? Because of the worldwide distribution of lactase persistence and the generally coinciding pattern of historically

milk-drinking populations, Simoons and McCracken independently suggested, more than 30 years ago, that milk dependence created strong selection for lactase persistence (McCracken 1971; Simoons 1970). This has become known as the culture historical hypothesis, and suggests that the rise in lactase persistence co-evolved alongside the cultural adaptation of milk drinking, and its associated nutritional beneWts. Nevertheless, the correlation is not absolute and there are exceptions in both directions. For example there are some ethnic groups who rely heavily on milk products and for whom cows or camels play a very important role in their lifestyle, but who have a low reported frequency of lactase persistence, for example, the Dinka and Nuer in Sudan (Bayoumi et al. 1982) and the Somali in Ethiopia (Ingram 2008). Statistical modelling shows that an incomplete correlation can be accommodated if some lactase persistent populations have recently stopped milking or conversely have only recently adopted the habit, therefore allowing insuYcient time for lactase persistence to be driven to high frequency (Aoki 1986). Population migration may also have played an important role. In addition the cultural practise of milk fermentation (e.g. to yoghurt or cheese) reduces lactose content allowing nonpersistent individuals to beneWt from milk products. Holden and Mace using regression analyses and correcting for relatedness of diVerent populations claimed that lactose digestion capacity had most likely evolved as an adaptation to dairying, and concluded that high frequency lactose digestion capacity had never evolved without the prior presence of milking (Holden and Mace 1997). Other evidence suggested to be in support of the culture-historical hypothesis has been provided by the observation that highintra allelic diversity of cattle milk protein genes in Europe coincides with the geographic incidence of lactase persistence, which is consistent with large herd sizes kept for dairying and selection for high milk yields (Beja-Pereira et al. 2003). However, it is noteworthy that at least in the Somali, one of us (CI) has obtained data to suggest that signiWcant quantities of fresh milk are consumed by many who are lactase non-persistent (Ingram 2008) apparently without any adverse eVects, and it seems likely that adaptation of the colonic bacterial Xora allows digestion of lactose by these people. This means that under normal circumstances lactase persistence is unlikely to be under very strong selection in this population, and Wts with the hypothesis that dairying and milk drinking can emerge before the genetic adaptation. It is likely that only at certain times and under more extreme circumstances, such as drought and famine, that the strong selective force operates. This is an extension of the arid climate hypothesis, Wrst suggested by Cook and al-Torki (1975). These authors speculated that in desert climates (i.e. Middle and Near East) where water and food

123

588

Hum Genet (2009) 124:579591

were scarce, nomadic groups could survive by utilizing milk as a food source, and in particular, as a source of clean, uncontaminated Xuid (Cook and al-Torki 1975). This scenario is particularly pertinent to desert nomads whose major source of milk is obtained from camels, as these animals are able to survive up to 2 weeks without food and water by metabolising the fat contained in their humps. The beneWts to persistent individuals may have become more pronounced during outbreaks of diarrhoeal disease, when non-persistent individuals would be unable to utilize milk as a water source without exacerbating their condition. More recent research sought to address the question of why some populations and not others had adopted the cultural habit of milk drinking. The frequencies of lactose malabsorption were greater in populations where environmental conditions, such as extremes of climate or high incidence of endemic cattle disease, made it impossible to raise livestock (Bloom and Sherman 2005). The exceptions to the general distribution were a number of African groups with high lactase persistence frequency who managed to circumvent harsh environmental conditions by adopting a pastoralist way of life (Bloom and Sherman 2005). Obviously, the beneWts of milk drinking cannot be explained by the arid climate hypothesis in Northern Europe. Here, the advantage of improved calcium absorption has been suggested to explain the distribution of the trait (Flatz and Rotthauwe 1973). The low light levels experienced at high latitudes are associated with an increased risk of developing rickets and osteomalacia due to a lack of vitamin D production (which is synthesized by the skin in the presence of sunlight). Vitamin D is involved in the gut absorption of calcium, which is itself an essential mineral required for bone health. In addition, calcium may help to prevent rickets by impairing the breakdown of vitamin D in the liver (Thacher et al. 1999). Although lactase non-persistent individuals could obtain calcium from yoghurt or cheese, dairy foods that contain reduced lactose, milk proteins and lactose are believed to facilitate the absorption of calcium (for review see Gueguen and Pointillart 2000). Hence the ability to drink fresh milk which contains both calcium and components that stimulate its uptake (including small amounts of vitamin D) may have provided an advantage to persistent individuals. Just one hypothesis has been put forward which suggests selection for lactase non-persistence. Since lactase non-persistence is the ancestral state, the need to invoke selection for non-persistence is counter-intuitive, but should not be ignored. In this proposal the selective agent is thought to be malaria (Anderson and Vullo 1994). This proposal came from the observations of high frequency of lactase non-persistence in regions where malaria is endemic, and that individuals with Xavin deWciency are at a slightly reduced risk of infection by malaria. The consumption of milk, which is

rich in riboXavins, was therefore proposed to be unfavourable since it would keep Xavin levels in the bloodstream high. There is currently no support for this hypothesis (Meloni et al. 1998), and it seems unlikely to contribute to the current distribution of lactase persistence.

Present day health and medical considerations Lactose malabsorption can readily be confused with milk protein allergy, which has quite diVerent causes (reviewed in Crittenden and Bennett 2005), and in recent times lactose intolerance has been blamed for causing a variety of systemic conditions, often without clear evidence (Campbell and Matthews 2005; Matthews et al. 2005). Nonetheless it does appear that consumption of milk and milk products by those who cannot digest lactose is a relatively common cause of irritable bowel syndrome in Europe and the USA (Vesa et al. 2000). Many commercial dairy products and other foods (including yoghurts) contain high concentrations of lactose introduced in manufacturing, so that lactose is more widespread in the diet than it was for that same persons ancestors. Lactose tolerance testing can be a useful way of detecting lactose malabsorption and enabling avoidance of the cause, but DNA testing is not yet useful, particularly for non-Europeans (Swallow 2006; Tag et al. 2008; Weiskirchen et al. 2007). In countries such as Finland, where there is a high frequency of lactase non-persistence in comparison with the rest of northern Europe, commercial low lactose products are readily available (Harju 2003). Many association studies have attempted to demonstrate the health beneWts of milk consumption in lactase persistent people, e.g. by providing protection against osteoporosis (Enattah et al. 2005a, b; Meloni et al. 2001; ObermayerPietsch et al. 2004), and others have claimed adverse eVects of lactase persistence and associated high milk consumption (e.g. cataracts, ovarian cancer and diabetes) (Enattah et al. 2004; Larsson et al. 2006; Meloni et al. 2001; Meloni et al. 1999; Villako and Maaroos 1994). The often-contradictory Wndings are diYcult to evaluate because of the high risk of confounding eVects such as mixed ancestry, dietary intake and variation in gut Xora.

Conclusion Lactase persistence has been one of the leading examples of natural selection in humans, and also one of the Wrst clear examples of polymorphism of a regulatory element. Further investigation of the molecular mechanisms as well as the evolutionary forces is however needed to fully understand this normal variation, which is providing an important model for understanding gene/culture co-evolution and

123

Hum Genet (2009) 124:579591

589 Briet F, Pochart P, Marteau P, Flourie B, Arrigoni E, Rambaud JC (1997) Improved clinical tolerance to chronic lactose ingestion in subjects with lactose intolerance: a placebo eVect? Gut 41:632 635 Buller HA, Kothe MJC, Goldman DA, Grubman SA, Sasak WV, Matsudaira PT, Montgomery RK, Grand RJ (1990) Coordinate expression of lactase-phlorizin hydrolase mRNA and enzyme levels in rat intestine during development. J Biol Chem 265:6978 6983 Burger J, Kirchner M, Bramanti B, Haak W, Thomas MG (2007) Absence of the lactase-persistence-associated allele in early Neolithic Europeans. Proc Natl Acad Sci USA 104:37363741 Campbell AK, Matthews SB (2005) Darwins illness revealed. Postgrad Med J 81:248251 Coelho M, Luiselli D, Bertorelle G, Lopes AI, Seixas S, stro-Bisol G, Rocha J (2005) Microsatellite variation and evolution of human lactase persistence. Hum Genet 117:329339 Cook GC, al-Torki MT (1975) High intestinal lactase concentrations in adult Arabs in Saudi Arabia. Br Med J 3:135136 Crittenden RG, Bennett LE (2005) Cows milk allergy: a complex disorder. J Am Coll Nutr 24:582S591S Dahlqvist A, Hammond B, Crane R, Dunphy J, Littman A (1963) Intestinal lactase deWciency and lactose intolerance in adults: preliminary report. Gastroenterology 45:488491 Dissanyake AS, El-Munshid HA, Al-Qurain A (1990) Prevalence of primary adult lactose malabsorption in the eastern province of Saudi Arabia. Ann Saudi Med 10:598601 Enattah NS, Sahi T, Savilahti E, Terwilliger JD, Peltonen L, Jarvela I (2002) IdentiWcation of a variant associated with adult-type hypolactasia. Nat Genet 30:233237 Enattah NS, Forsblom C, Rasinpera H, Tuomi T, Groop PH, Jarvela I (2004) The genetic variant of lactase persistence C (13910) T as a risk factor for type I and II diabetes in the Finnish population. Eur J Clin Nutr 58:13191322 Enattah N, Pekkarinen T, Valimaki MJ, Loyttyniemi E, Jarvela I (2005a) Genetically deWned adult-type hypolactasia and self-reported lactose intolerance as risk factors of osteoporosis in Finnish postmenopausal women. Eur J Clin Nutr 59:11051111 Enattah NS, Sulkava R, Halonen P, Kontula K, Jarvela I (2005b) Genetic variant of lactase-persistent C/T-13910 is associated with bone fractures in very old age. J Am Geriatr Soc 53:7982 Enattah NS, Trudeau A, PimenoV V, Maiuri L, Auricchio S, Greco L, Rossi M, Lentze M, Seo JK, Rahgozar S, Khalil I, Alifrangis M, Natah S, Groop L, Shaat N, Kozlov A, Verschubskaya G, Comas D, Bulayeva K, Mehdi SQ, Terwilliger JD, Sahi T, Savilahti E, Perola M, Sajantila A, Jarvela I, Peltonen L (2007) Evidence of still-ongoing convergence evolution of the lactase persistence T-13910 alleles in humans. Am J Hum Genet 81:615625 Enattah NS, Jensen TG, Nielsen M, Lewinski R, Kuokkanen M, Rasinpera H, El-Shanti H, Seo JK, Alifrangis M, Khalil IF, Natah A, Ali A, Natah S, Comas D, Mehdi SQ, Groop L, Vestergaard EM, Imtiaz F, Rashed MS, Meyer B, Troelsen J, Peltonen L (2008) Independent introduction of two lactase-persistence alleles into human populations reXects diVerent history of adaptation to milk culture. Am J Hum Genet 82:5772 Escher JC, de Koning ND, van Engen CG, Arora S, Buller HA, Montgomery RK, Grand RJ (1992) Molecular basis of lactase levels in adult humans. J Clin Invest 89:480483 Fang R, Santiago NA, Olds LC, Sibley E (2000) The homeodomain protein Cdx2 regulates lactase gene promoter activity during enterocyte diVerentiation. Gastroenterology 118:115127 Fang R, Olds LC, Santiago NA, Sibley E (2001) GATA family transcription factors activate lactase gene promoter in intestinal Caco2 cells. Am J Physiol Gastrointest Liver Physiol 280:G58G67 Ferguson A, Maxwell J (1967) Genetic aetiology of lactose intolerance. Lancet 2:188190

disease susceptibility. The information accrued so far already illustrates the limitations of disease association studies and SNP tagging to Wnd functional genetic variation attributable to multiple mutations, even if they are located in a single gene, and highlights the potential importance of distant regulatory elements.
Acknowledgments CJEI and CAM were funded by BBSRC CASE studentships and YI was funded by UCL Graduate school, UCL ORS and Bnai Brith/Leo Baeck London Lodge scholarships. We thank Neil Bradman, The Centre for Genetic Anthropology, UCL, for access to samples and Melford Charitable Trust for funding.

References
Anderson B, Vullo C (1994) Did malaria select for primary adult lactase deWciency? Gut 35:14871489 Aoki K (1986) A stochastic model of gene-culture coevolution suggested by the culture-historical hypothesis. Proc Natl Acad Sci USA 83:29292933 Auricchio S, Rubino A, Semenza G, Landolt M, Prader A (1963) Isolated intestinal lactase deWciency in the adult. Lancet 2:324326 Bayoumi RA, Saha N, Salih AS, Bakkar AE, Flatz G (1981) Distribution of the lactase phenotypes in the population of the Democratic Republic of the Sudan. Hum Genet 57:279281 Bayoumi RA, Flatz SD, Kuhnau W, Flatz G (1982) Beja and Nilotes: nomadic pastoralist groups in the Sudan with opposite distributions of the adult lactase phenotypes. Am J Phys Anthropol 58:173178 Beja-Pereira A, Luikart G, England PR, Bradley DG, Jann OC, Bertorelle G, Chamberlain AT, Nunes TP, Metodiev S, Ferrand N, Erhardt G (2003) Gene-culture coevolution between cattle milk protein genes and human lactase genes. Nat Genet 35:311313 Bernardes-Silva CF, Pereira AC, de Fatima Alves da Mota, Krieger JE, Laudanna AA (2007) Lactase persistence/non-persistence variants, C/T_13910 and G/A_22018, as a diagnostic tool for lactose intolerance in IBS patients. Clin Chim Acta 386:711 Bersaglieri T, Sabeti PC, Patterson N, Vanderploeg T, SchaVner SF, Drake JA, Rhodes M, Reich DE, Hirschhorn JN (2004) Genetic signatures of strong recent positive selection at the lactase gene. Am J Hum Genet 74:11111120 Bloom G, Sherman PW (2005) Dairying barriers aVect the distribution of lactose malabsorption. Evol Human Behav 26:301312 Boll W, Wagner P, Mantei N (1991) Structure of the chromosomal gene and CDNAs coding for lactase-phlorizin hydrolase in humans with adult-type hypolactasia or persistence of lactase. Am J Hum Genet 48:889902 Bosse T, Piaseckyj CM, Burghard E, Fialkovich JJ, Rajagopal S, Pu WT, Krasinski SD (2006a) Gata4 is essential for the maintenance of jejunalileal identities in the adult mouse small intestine. Mol Cell Biol 26:90609070 Bosse T, van Wering HM, Gielen M, Dowling LN, Fialkovich JJ, Piaseckyj CM, Gonzalez FJ, Akiyama TE, Montgomery RK, Grand RJ, Krasinski SD (2006b) Hepatocyte nuclear factor1alpha is required for expression but dispensable for histone acetylation of the lactase-phlorizin hydrolase gene in vivo. Am J Physiol Gastrointest Liver Physiol 290:G1016G1024 Bosse T, Fialkovich JJ, Piaseckyj CM, Beuling E, Broekman H, Grand RJ, Montgomery RK, Krasinski SD (2007) Gata4 and Hnf1alpha are partially required for the expression of speciWc intestinal genes during development. Am J Physiol Gastrointest Liver Physiol 292:G1302G1314

123

590 Flatz G (1984) Gene dosage eVect on intestinal lactase activity demonstrated in vivo. Am J Hum Genet 36:306310 Flatz G (1987) Genetics of lactose digestion in humans. In: Harris H, Hirschhorn K (eds) Advances in human genetics, vol 16. Plenum Press, New York, pp 177 Flatz G, Rotthauwe HW (1973) Lactose nutrition and natural selection. Lancet 2:7677 Gueguen L, Pointillart A (2000) The bioavailability of dietary calcium. J Am Coll Nutr 19:119S136S HapMap Consortium (2003) The International HapMap Project. Nature 426:789796 Harju M (2003) Chromatographic and enzymatic removal of lactose from milk, IDF World Dairy Summit, Bruges, BELGIQUE (09/2003) 2004, no 389, pp 48 Harvey CB, Pratt WS, Islam I, Whitehouse DB, Swallow DM (1995) DNA polymorphisms in the lactase gene. Linkage disequilibrium across the 70-kb region. Eur J Hum Genet 3:2741 Harvey CB, Hollox EJ, Poulter M, Wang Y, Rossi M, Auricchio S, Iqbal TH, Cooper BT, Barton R, Sarner M, Korpela R, Swallow DM (1998) Lactase haplotype frequencies in Caucasians: association with the lactase persistence/non-persistence polymorphism. Ann Hum Genet 62(Pt 3):215223 Hauri HP, Sterchi EE, Bienz D, Fransen JA, Marxer A (1985) Expression and intracellular transport of microvillus membrane hydrolases in human intestinal epithelial cells. J Cell Biol 101:838851 Hertzler SR, Savaiano DA (1996) Colonic adaptation to daily lactose feeding in lactose maldigesters reduces lactose intolerance. Am J Clin Nutr 64:232236 Hertzler SR, Savaiano DA, Levitt MD (1997) Fecal hydrogen production and consumption measurementsresponse to daily lactose ingestion by lactose maldigesters. Dig Dis Sci 42:348353 Ho MW, Povey S, Swallow DM (1982) Lactase polymorphism in adult British natives: estimating allele frequencies by enzyme assays in autopsy samples. Am J Hum Genet 34:650657 Hogenauer C, Hammer HF, Mellitzer K, Renner W, Krejs GJ, Toplak H (2005) Evaluation of a new DNA test compared with the lactose hydrogen breath test for the diagnosis of lactase non-persistence. Eur J Gastroenterol Hepatol 17:371376 Holden C, Mace R (1997) Phylogenetic analysis of the evolution of lactose digestion in adults. Hum Biol 69:605628 Hollox EJ, Poulter M, Wang Y, Krause A, Swallow DM (1999) Common polymorphism in a highly variable region upstream of the human lactase gene aVects DNAprotein interactions. Eur J Hum Genet 7:791800 Hollox EJ, Poulter M, Zvarik M, Ferak V, Krause A, Jenkins T, Saha N, Kozlov AI, Swallow DM (2001) Lactase haplotype diversity in the Old World. Am J Hum Genet 68:160172 Imtiaz F, Savilahti E, Sarnesto A, Trabzuni D, Al-Kahtani K, Kagevi I, Rashed MS, Meyer BF, Jarvela I (2007) The T/G 13915 variant upstream of the lactase gene (LCT) is the founder allele of lactase persistence in an urban Saudi population. J Med Genet 44:e89 Ingram CJE (2008) The evolutionary genetics of lactase persistence in Africa and the Middle East. Ph.D. thesis University of London Ingram CJE, Elamin MF, Mulcare CA, Weale ME, Tarekegn A, Raga TO, Bekele E, Elamin FM, Thomas MG, Bradman N, Swallow DM (2007) A novel polymorphism associated with lactose tolerance in Africa: multiple causes for lactase persistence? Hum Genet 120:779788 Jacob R, Brewer C, Fransen JA, Naim HY (1994) Transport, function, and sorting of lactase-phlorizin hydrolase in MadinDarby canine kidney cells. J Biol Chem 269:27122721 Jacob R, Bulleid NJ, Naim HY (1995) Folding of human intestinal lactase-phlorizin hydrolase. J Biol Chem 270:1867818684 Jacob R, Radebach I, Wuthrich M, Grunberg J, Sterchi EE, Naim HY (1996) Maturation of human intestinal lactase-phlorizin hydrolase: generation of the brush border form of the enzyme involves

Hum Genet (2009) 124:579591 at least two proteolytic cleavage steps. Eur J Biochem 236:789 795 Jacob R, Peters K, Naim HY (2002) The prosequence of human lactase-phlorizin hydrolase modulates the folding of the mature enzyme. J Biol Chem 277:82178225 Kerber M, Oberkanins C, Kriegshauser G, Kollerits B, senbach-Glaninger A, Fuchs D, Ledochowski M (2007) Hydrogen breath testing versus LCT genotyping for the diagnosis of lactose intolerance: a matter of age? Clin Chim Acta 383:9196 Krasinski SD, van Wering HM, Tannemaat MR, Grand RJ (2001) DiVerential activation of intestinal gene promoters: functional interactions between GATA-5 and HNF-1 alpha. Am J Physiol Gastrointest Liver Physiol 281:G69G84 Lacey SW, Naim HY, Magness RR, Gething M-J, Sambrook JF (1994) Expression of lactase-phlorizin hydrolase in sheep is regulated at the RNA level. Biochem J 302:929935 Larsson SC, Orsini N, Wolk A (2006) Milk, milk products and lactose intake and ovarian cancer risk: a meta-analysis of epidemiological studies. Int J Cancer 118:431441 Lee SY, Wang Z, Lin CK, Contag CH, Olds LC, Cooper AD, Sibley E (2002) Regulation of intestine-speciWc spatiotemporal expression by the rat lactase promoter. J Biol Chem 277:1309913105 Lewinsky RH, Jensen TG, Moller J, Stensballe A, Olsen J, Troelsen JT (2005) T-13910 DNA variant associated with lactase persistence interacts with Oct-1 and stimulates lactase promoter activity in vitro. Hum Mol Genet 14:39453953 Lloyd M, Mevissen G, Fischer M, Olsen W, Goodspeed D, Genini M, Boll W, Semenza G, Mantei N (1992) Regulation of intestinal lactase in adult hypolactasia. J Clin Invest 89:524529 Maiuri L, Raia V, Potter J, Swallow DM, Ho MW, Fiocca R, Finzi G, Cornaggia M, Capella C, Quaroni A, Auricchio S (1991) Mosaic pattern of lactase expression in villous enterocytes in human adult-type hypolactasia. Gastroenterology 100:359369 Maiuri L, Rossi M, Raia V, Garipoli V, Hughes LA, Swallow D, Noren O, Sjostrom H, Auricchio S (1994) Mosaic regulation of lactase in human adult-type hypolactasia. Gastroenterology 107:5460 Matthews SB, Waud JP, Roberts AG, Campbell AK (2005) Systemic lactose intolerance: a new perspective on an old problem. Postgrad Med J 81:167173 McCracken RD (1971) Lactase deWciencyexample of dietary evolution. Curr Anthropol 12:479 Meloni T, Colombo C, Ruggiu G, Dessena M, Meloni GF (1998) Primary lactase deWciency and past malarial endemicity in Sardinia. Ital J Gastroenterol Hepatol 30:490493 Meloni GF, Colombo C, La VC, Ruggiu G, Mannazzu MC, Ambrosini G, Cherchi PL (1999) Lactose absorption in patients with ovarian cancer. Am J Epidemiol 150:183186 Meloni GF, Colombo C, La VC, PaciWco A, Tomasi P, Ogana A, Marinaro AM, Meloni T (2001) High prevalence of lactose absorbers in Northern Sardinian patients with type 1 and type 2 diabetes mellitus. Am J Clin Nutr 73:582585 Metneki J, Cziezel A, Flatz SD, Flatz G (1984) A study of lactose absorption capacity in twins. Hum Genet 67:296300 Mitchelmore C, Troelsen JT, Spodsberg N, Sjostrom H, Noren O (2000) Interaction between the homeodomain proteins Cdx2 and HNF1alpha mediates expression of the lactase-phlorizin hydrolase gene. Biochem J 346(Pt 2):529535 Mulcare (2006) The evolution of the lactase persistence phenotype. Ph.D. thesis University of London, London, UK Mulcare CA, Weale ME, Jones AL, Connell B, Zeitlyn D, Tarekegn A, Swallow DM, Bradman N, Thomas MG (2004) The T allele of a single-nucleotide polymorphism 13.9 kb upstream of the lactase gene (LCT) (C-13.9kbT) does not predict or cause the lactase-persistence phenotype in Africans. Am J Hum Genet 74:11021110 Naim HY, Lentze MJ (1992) Impact of O-glycosylation on the function of human intestinal lactase-phlorizin hydrolase. Characterization

123

Hum Genet (2009) 124:579591 of glycoforms varying in enzyme activity and localization of O-glycoside addition. J Biol Chem 267:2549425504 Newcomer AD, McGill DB, Thomas PJ, Hofmann AF (1975) Prospective comparison of indirect methods for detecting lactase deWciency. N Engl J Med 293:12321236 Obermayer-Pietsch BM, Bonelli CM, Walter DE, Kuhn RJ, Fahrleitner-Pammer A, Berghold A, Goessler W, Stepan V, Dobnig H, Leb G, Renner W (2004) Genetic predisposition for adult lactose intolerance and relation to diet, bone density, and bone fractures. J Bone Miner Res 19:4247 Olds LC, Sibley E (2003) Lactase persistence DNA variant enhances lactase promoter activity in vitro: functional role as a cis regulatory element. Hum Mol Genet 12:23332340 Peuhkuri (2000) Lactose, lactase, and bowel disorders, Ph.D. thesis, University of Helsinki, Finland Peuhkuri K, Vapaatalo H, Korpela R, Teuri U (2000) Lactose intolerancea confusing clinical diagnosis. Am J Clin Nutr 71:600602 Poulter M, Hollox E, Harvey CB, Mulcare C, Peuhkuri K, Kajander K, Sarner M, Korpela R, Swallow DM (2003) The causal element for the lactase persistence/non-persistence polymorphism is located in a 1 Mb region of linkage disequilibrium in Europeans. Ann Hum Genet 67:298311 Rasinpera H, Savilahti E, Enattah NS, Kuokkanen M, Totterman N, Lindahl H, Jarvela I, Kolho KL (2004) A genetic test which can be used to diagnose adult-type hypolactasia in children. Gut 53:15711576 Sabeti PC, SchaVner SF, Fry B, Lohmueller J, Varilly P, Shamovsky O, Palma A, Mikkelsen TS, Altshuler D, Lander ES (2006) Positive natural selection in the human lineage. Science 312:1614 1620 Sahi T (1974) The inheritance of selective adult-type lactose malabsorption. Scand J Gastroenterol 9:173 Saltzman JR, Russell RM, Golner B, Barakat S, Dallal GE, Goldin BR (1999) A randomized trial of Lactobacillus acidophilus BG2FO4 to treat lactose intolerance. Am J Clin Nutr 69:140146 Scrimshaw NS, Murray EB (1988) The acceptability of milk and milk products in populations with a high prevalence of lactose intolerance. Am J Clin Nutr 48:10791159 Sebastio G, Villa M, Sartorio R, Guzzetta V, Poggi V, Auricchio S, Boll W, Mantei N, Semenza G (1989) Control of lactase in human adult-type hypolactasia and in weaning rabbits and rats. Am J Hum Genet 45:489497 Simoons FJ (1970) Primary lactose intolerance and the milking habit: a problem in biological and cultural interrelations, II. A culture historical hypothesis. Am J Dig Dis 15:695710 Simoons FJ (1978) The geographic hypothesis and lactose malabsorptiona weighing of the evidence. Dig Dis 23:963980 Snook CR, Mahmoud JN, Chang WP (1976) Lactose tolerance in adult Jordanian Arabs. Trop Geogr Med 28:333335 Spodsberg N, Troelsen JT, Carlsson P, Enerback S, Sjostrom H, Noren O (1999) Transcriptional regulation of pig lactase-phlorizin hydrolase. Involvement of HNF-1 and FREACs. Gastroenterology 116:842854 Sterchi E, Mills P, Fransen J, Hauri H, Lentze M, Naim H, Ginsel L, Bond J (1990) Biogenesis of intestinal lactase-phlorizin hydrolase in adults with lactose intolerance. Evidence for reduced biosynthesis and slowed-down maturation in enterocytes. J Clin Invest 86:13291337 Suarez FL, Savaiano D, Arbisi P, Levitt MD (1997) Tolerance to the daily ingestion of two cups of milk by individuals claiming lactose intolerance. Am J Clin Nutr 65:15021506

591 Swallow DM (2006) DNA test for hypolactasia premature. Gut 55:131132 Swallow DM, Hollox EJ (2000) The genetic polymorphism of intestinal lactase activity in adult humans. In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds) The metabolic and molecular basis of inherited disease. McGraw-Hill, New York, pp 16511662 Tag CG, SchiZers MC, Mohnen M, Gressner AM, Weiskirchen R (2007) A novel proximal 13914G > A base replacement in the vicinity of the common-13910T/C lactase gene variation results in an atypical LightCycler melting curve in testing with the MutaREAL lactase test. Clin Chem 53:146148 Tag CG, Oberkanins C, Kriegshauser G, Ingram CJ, Swallow DM, Gressner AM, Ledochowski M, Weiskirchen R (2008) Evaluation of a novel reverse-hybridization StripAssay for typing DNA variants useful in diagnosis of adult-type hypolactasia. Clin Chim Acta 392:5862 Thacher TD, Fischer PR, Pettifor JM, Lawson JO, Isichei CO, Reading JC, Chan GM (1999) A comparison of calcium, vitamin D, or both for nutritional rickets in Nigerian children. N Engl J Med 341:563568 TishkoV SA, Reed FA, Ranciaro A, Voight BF, Babbitt CC, Silverman JS, Powell K, Mortensen HM, Hirbo JB, Osman M, Ibrahim M, Omar SA, Lema G, Nyambo TB, Ghori J, Bumpstead S, Pritchard JK, Wray GA, Deloukas P (2007) Convergent adaptation of human lactase persistence in Africa and Europe. Nat Genet 39:31 40 Troelsen JT, Mehlum A, Olsen J, Spodsberg N, Hansen GH, Prydz H, Noren O, Sjostrom H (1994) 1 kb of the lactase-phlorhizin hydrolase promoter directs post-weaning decline and small intestinalspeciWc expression in transgenic mice. FEBS Lett 342:291296 Troelsen JT, Mitchelmore C, Spodsberg N, Jensen AM, Noren O, Sjostrom H (1997) Regulation of lactase-phlorizin hydrolase gene expression by the caudal-related homoeodomain protein Cdx-2. Biochem J 322(Pt 3):833838 Troelsen JT, Olsen J, Moller J, Sjostrom H (2003) An upstream polymorphism associated with lactase persistence has increased enhancer activity. Gastroenterology 125:16861694 van Wering HM, Bosse T, Musters A, de Jong E, de Jong N, Hogen Esch CE, Boudreau F, Swain GP, Dowling LN, Montgomery RK, Grand RJ, Krasinski SD (2004) Complex regulation of the lactase-phlorizin hydrolase promoter by GATA-4. Am J Physiol Gastrointest Liver Physiol 287(4):G899909 Vesa TH, Marteau P, Korpela R (2000) Lactose intolerance. J Am Coll Nutr 19:165S175S Villako K, Maaroos H (1994) Clinical picture of hypolactasia and lactose intolerance. Scand J Gastroenterol Suppl 202:3654 Wang Y, Harvey CB, Pratt WS, Sams VR, Sarner M, Rossi M, Auricchio S, Swallow DM (1995) The lactase persistence/non-persistence polymorphism is controlled by a cis-acting element. Hum Mol Genet 4:657662 Wang Z, Maravelias C, Sibley E (2006) Lactase gene promoter fragments mediate diVerential spatial and temporal expression patterns in transgenic mice. DNA Cell Biol 25:215222 Weiskirchen, Tag CG, Mengsteab S, Gressner AM, Ingram CJE, Swallow DM (2007) Pitfalls in LightCycler Diagnosis of the singlenucleotide polymorphism 13.9 kb upstream of the lactase gene that is associated with adult-type hypolactasia Witte J, Lloyd M, Lorenzsonn V, Korsmo H, Olsen W (1990) The biosynthetic basis of adult lactase deWciency. J Clin Invest 86:13381342

123