Sei sulla pagina 1di 852

Total No.

of Questions : 10]

[Total No. of Pages : 2

P1503

[3764] - 1006 B.E - Civil AIR POLLUTION (1997 Course) (Elective II)
[Max. Marks : 100

Time : 3 Hours] Instructions: 1) 2) 3) 4) 5) 6) Answer any three questions from each section.

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I 1 ) a) b) 2 ) a) b) Enlist Primary and Secondary meteorological factors influencing air pollution and explain each in brief. [8] What is inversion? Explain in brief radiation and subsidence inversion. [8] Explain mechanism, effects and control of Ozone layer depletion. [8] Explain with neat sketch wind rose diagram. What are its applications in air pollution studies? [8] Explain in details any one air pollution episode. [6] Explain the purpose of ambient air sampling and stack gas sampling.[6] Explain effect of atmospheric stability on plume dispersion. [4] What are the effects of global warming? Suggest suitable measures to control global warming. [8] If government wants to fix location for chemical industrial zone, explain the factors required to be considered. [8]

3 ) a) b) c) 4 ) a) b)

P.T.O.

5) Write short notes on (All). (a) Plume behaviour. (b) Plume rise with a neat sketch. (c) Iso - kinetic sampling with a neat sketch.

[18]

6 ) a) b) 7 ) a) b) 8) ) b) 9) ) b)

What are the various factors to be taken into consideration before finalizing the control equipment depending on the properties of the pollutants?[8] Explain the mechanism of photochemical reactions. Write at least two chemical reactions as an example. [8] Explain with a neat sketch working principle of Electro Static Precipitator. [8] Explain with a neat sketch working principle of standard cyclone. [8] What is Environmental Impact Assessment? What are the advantages and limitations of E.I.A.? [8] Explain the important provisions made in The Air (Prevention and Control of pollution) Act 1981. [8] Explain various methods of control of odour problem. [8] Enlist various types of scrubbers? Draw a neat sketch and explain any two types. [8]

Q10)Write short notes on (All). (a) Technique used for filter cleaning. (b) Land use planning for air pollution control. (c) Economic losses due to air pollution.

[18]

*****

[3764] - 1006

-2-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1462

[3764]-101
B.E. (Civil)
HYDROLOGY AND IRRIGATION (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) The data from an isohyetal map of a catchment is shown in following tableIsohyet (mm) Area covered by Isohyet (km2) 250 500 300 400 350 300 400 200 450 100 500

Determine the average depth of precipitation over the catchment area of 500 km2. [8] b) Explain any three methods of determining average rainfall over a catchment. State their advantages and limitations. [8] OR Q2) a) A catchment area has 5 raingauge stations. These gauges recorded the annual rainfall as Station Rainfall (mm) A 1300 B 1420 C 1180 D 1080 E 1650

For 5% error in estimation of average rainfall, determine the minimum number of additional raingauge stations required to be established in the catchment. [8] b) With the help of conceptual sketch, differentiate between infiltration and percolation state, how infiltration is measured in field. [8]

P.T.O.

Q3) a) b)

Q4) a) b) Q5) a) b)

With help of sketch, explain concept and use ofi) index. ii) W index. [8] State any four factors affecting evaporation. Also, state any four measures to control the evaporation. [8] OR Explain with sketch, the ISI standard Pan Evaporimeter. [8] Explain any four factors affecting the infiltration. [8] Define Unit Hydrograph. State step by step method of derivation of Unit Hydrograph. [10] Explain briefly: i) Maximum Probable Flood. ii) Design Flood. iii) Causes of Flood. iv) Factors affecting Flood. [8] OR Explain concept of synthetic Unit Hydrograph. State its advantages.[10] Define flood routing. State assumptions made in routing a flood in a reservoir. [8] SECTION - II

Q6) a) b)

Q7) a) b)

Write the detailed step by step procedure to estimate design discharge at head for designing a canal. [8] Define: i) Duty. iii) Consumptive use of water v) Relation between duty & delta. OR [10] ii) Delta iv) Irrigation Intensity.

Q8) a) b)

State any four causes & four ill effects of water logging. Also, state corrective methods to reclaim water logged area. [8] Differentiatei) Lift Irrigation and Flow Irrigation. ii) Drip Irrigation and Sprinkler Irrigation. [10]

[3764]-101

Q9) a) b) Q10)a) b)

Explain salient features of National water policy. Explain functioning of water users cooperative society in PIM. OR

[8] [8]

Explain functioning of Global water partnership. [8] Enlist different Irrigation acts is state of Maharashtra & highlight salient features of any one of them. [8] Differentiate[8]

Q11)a)

b)

i) Artesian well and Flowing well. ii) Confined aquifer and Water table aquifer. State Darcys law and assumptions made in it. Also, state procedure of pumping test with help of sketch. [8] OR Differentiate[8] i) Tube wells and Open wells. ii) Specific yield and safe yield. Derive an expression for steady state discharge through a tube well fully penetrating a confined aquifer. [8]

Q12)a)

b)

[3764]-101

Total No. of Questions : 10]

[Total No. of Pages : 2

P 1598

[3764] - 1011

B.E. (Civil) CONCRETE COMPOSITES & PRECAST CONCRETE (Elective - I) (1997 Course)
Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answers to the two sections should be written in two separate answer books. 2) Solve any three questions from each section. 3) Neat diagrams must be drawn wherever necessary. 4) Assume data if required.

SECTION - I Q1) a) What are important parameters while making good concrete? Elaborate each point and discuss how each parameter affects quality of concrete. [8] Enlist the types of cement stating the advantage and application of each. [8] Enlist the tests to be carried out for evaluation of quality of concrete. [2] Enlist different concreting techniques & its suitable applications. What are admixtures, what are its advantages & optimal dosage? What are types of admixtures? [6] [7] [3]

b) c) Q2) a) b) c) Q3) a) b) c)

Explain with neat sketch the advances in mixing, handling, placing and compaction of fresh concrete. [8] Explain advantages and disadvantages of ready mix concrete. [4] Explain with example or application where pumping of concrete is required. [4] What are factors affecting shrinkage of concrete, modulus of elasticity of concrete? [6] Explain relation between modulus of elasticity and strength of concrete. [6] Explain creep in concrete and how it can be measured. [4]

Q4) a) b) c)

P.T.O.

Q5) a) b) c)

Explain accelerated curing of concrete. [4] Explain how flexural strength of concrete, can be tested in laboratory.[6] Explain ultrasonic - pulse test on concrete. [6] SECTION - II

Q6) Design the concrete mix for following data a) Air field pavement concrete for 25 N/mm2 strength at 28 days is to be designed. b) The laboratory standard deviation of concrete strength is 4 Mpa. c) The specific gravity of C.A. = 2.68 & dry rodded density is 16 KN/m3 Max. size of C.A. = 40 mm. d) Specific gravity of F.A. = 2.64 its fineness modulus = 2.8. e) A slump of 25 mm be maintained. f) Use O.P.C. [16] Q7) Write short note on any four : a) Polymer concrete composite. b) Fiber reinforced concrete. c) Glass fiber reinforced concrete. d) Light weight concrete. e) High density concrete. f) Ferro - Cement. Q8) a) b) c) Q9) a) b)

[16]

Explain precast railway sleepers with respect to its manufacturing. [4] Explain analysis and design of railway sleepers. [8] Explain precast units used in precast construction. [4] Explain different types of joints in precast construction, draw neat sketches of each and explain. [8] Explain erection and assembley techniques of precast units at site. [8]

Q10)Write short note on : a) Rehabilitation of damaged / old concrete. b) Re-cycling of concrete. c) Non-distructive testing of concrete using hammer.

[6] [6] [6]

[3764] - 1011

-2-

Total No. of Questions : 10]

[Total No. of Pages : 2

P1451

[3764] - 1013
B.E - (Mechanical Engg) MICROPROCESSOR APPLICATIONS (1997 Course) (Elective - I) (402045)

Time : 3 Hours] Instructions: 1) 2) 3) 4) 5) Answers any three questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I 1 ) a) b) c) 2 ) a) b) 3 ) a) b) 4 ) a) b) 5) a) b) What are the main differences between RAM,ROM,PROM, and EPROM? Describe suitable applications for each. [10] Explain static and dynamic RAMs. [4] How does a microcontroller differ from a microprocessor? Explain. [4] Explain various ports in 8051. Why pull - up resistors are required for port 0? [8] Describe the internal architecture of 8051. Why 8051 is called harvard architecture? [8] How timers are useful in generating software delays in 8051? Explain with suitable example. [8] How can be 8051 operated in low power modes? Explain. Describe different addressing modes of 8051 in detail. Explain serial communication using 8051. Explain interfacing of DAC to 8051 with suitable diagram. [8] [8] [8] [8]

Explain with suitable example, working of ADC in a microprocessor based system. [8] P.T.O.

SECTION - II 6 ) a) b) Describe the architecture of PLC with suitable block diagram. Draw common notations for PLC ladder diagram for following. i) ii) iii) iv) v) 7 ) a) b) 8) ) b) 9) ) b) 10) ) b) Fused disconnect. Thermal circuit breaker. Three-phase motor. Indicating lamp Push button. [8] [8] [10]

Explain in detail different types of input devices used in PLCs.

Describe RS232C standard used in data transmission and reception.[8] Explain application of PLCs as front-end pre-processors in factory information systems. [8] What is the difference between polling and interrupts? How different types of interrupts are handled by a microprocessor. [8] Describe data acquisition system with suitable block diagram. Explain different applications of data acquisition system. Discuss the working of differential pressure transmitter. [8] [8] [8]

With help of suitable block diagram, Explain use of microprocessor in weighing machine. [8]

*****

[3764] - 1013

-2-

Total No. of Questions : 10]

[Total No. of Pages : 3

P1599

[3764]-1019 B.E. (Production Engg.)


(1997 Course) (Elective - II)

PRODUCTION PROCESSES AND DESIGN


Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answer any 3 questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, electronic pocket calculator is allowed. Assume suitable data, if necessary. [Max. Marks : 100

SECTION - I Q1) a) State & explain in brief desirable properties of design specification. [6] b) What is analysis of interconnected decision areas (AIDA)? How will it be useful to product design? [6] c) Explain product life cycle in brief. Q2) a) What are the considerations of good product design? b) What are various phases in product development process? c) Explain the basic structure of product innovation process. [4] [6] [6] [4]

Q3) a) State design rules for plastic moulded parts. Discuss the design factors for plastics. [6] b) Discuss process selection parameters essential for the success of the design. [4] c) State the role of aesthetic in product design. d) What is product message? State its importance with example. [3] [3]
P.T.O.

Q4) a) Prepare development plan for product Washing machine using QFD method. [8] b) Explain Classification of casting according to metal to be cast with example. [4] c) What are composites? What are the aspects of design with composites? [4] Q5) Write short note on: (Any 3) a) Analysis of interconnected decision areas (AIDA). b) Functional attributes in product design. c) Tolerance build up in assemblies. d) Design of M/c tool parts. e) Quality function deployment(QFD). SECTION - II Q6) a) Define system reliability. Explain four significant reliability factors. Explain following types of configurations: i) ii) Series configuration. Parallel configuration. [10] [18]

iii) Mixed configuration. b) If the device has a failure rate of 2 106 failure/hours what is its reliability in an operating period of 500 hours. If there are 2000 items in the test, how many failures are expected in 500 hours? Assume a constant failure rate. Also calculate the MTBF. [6] Q7) a) Explain tolerance built up in assemblies with example. [8]

b) Determine the control limits for X & R charts if sum of X = 909.170 and sum of R = 6.250, Number of subgroup = 20. It is given that A2 = 0.18, D3 = 0.41, D4 = 1.59 and d2 = 3.735. Also find process capability. [8]
[3764]-1019 -2-

Q8) a) Explain Manufacturing of glass. Discuss Problem of manufacturing ceramic parts. [6] b) Explain Role of allowance, process capability and tolerance in detail to design and assembly. [4] c) What is DFM? Give benefit of DFM. [6]

Q9) a) Explain buffing & lapping. Which process gives a higher grade of finish & why? [4] b) Why investment casting is preferred for manufacturing asymmetric complicated shapes? [4] c) What do you mean by design for uniform strength? Explain with example. [4] d) What is difference in strength & hardness of a plastic injection moulded part & a compression moulded part? [4] Q10) Write short note on: (Any 3) a) Dimensional tolerances and customer preferences. b) Statistical consideration for factor of safety. c) Economics of tooling. d) Rapid prototyping. e) Design of brazed joints. rrr [18]

[3764]-1019

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1463

[3764]-102
B.E. (Civil)
ENVIRONMENTAL ENGINEERING - II (2003 Course)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5) 6)

[Max. Marks : 100

Solve Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from Section I and Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Explain giving reasons, when to adopt separate and combined systems.[6] Design a sanitary sewer for following data: i) ii) Population = 120000 persons. Rate of water supply = 200 Lpcd. [6]

iii) Value of N = 0.013. iv) Peak factor = 3. v) c) Q2) a) b) c) Slope = 1 in 700. [4] [6] OR Describe the procedure for laying and testing of sewers. The BOD5 of a waste has been measured as 500 mg/l. The rate constant is 0.12. Determine ultimate BOD and 3 day BOD at 27C. [6] Explain the necessity of DO fixation while determining DO in water and state procedure for the same. [4] Differentiate Dry Weather Flow and Wet Weather Flow.

P.T.O.

Q3) a) b) c) Q4) a)

Draw a figure showing different zones of stream pollution and discuss in detailed about zone of active decomposition. [6] What are the natural forces acts for the purification for streams? Write short note on Oxygen sag curve. OR A screen consisting of 10 mm diameter bars, at a clear spacing of 40 mm, treats a maximum hourly flow of 1200m3. Velocity of flow through the screen chamber is 0.75 m/ sec. [6] Work out: i) ii) Length and number of bars. Head loss in the chamber. [6] [4]

b) c)

Explain the purpose of providing grit chamber and give design criteria for grit chamber. [6] What is the difference between preliminary and primary treatment of wastewater? [4] Explain with the help of a flow diagram, the essentials of activated sludge process. [6] Design an activated sludge process for following data: i) ii) Municipal wastewater flow rate = 12,000 m3/day. BOD of settled effluent = 150 mg / lit. [12]

Q5) a) b)

iii) BOD of treated effluent = 5 mg/lit. iv) Yield coefficient, Y = 0.5 kg/kg. v) Endogenous decay coefficient, kd = 0.05 d1. vi) MLSS, X = 3000 mg/lit. vii) Return sludge solids concentration, Xr = 15,000 mg/lit. viii) Mean cell residence time, c = 10 days. Determine: a) c) e)
[3764]-102

Volume of reactor. Volumetric loading rate. Recycle ratio.


2

b) d) f)

F/M ratio. Oxygen requirement. BOD removal efficiency.

OR Q6) a) Design a high rate trickling filter using N.R.C. equation for following data. [10] i) ii) Sewage flow = 8 Mld. Recirculation ratio = 1.5.

iii) BOD of raw sewage = 300 mg/lit. iv) BOD removal in primary clarifier = 30%. v) b) Final effluent BOD desired = 30 mg/l. [8] Explain with sketch the biological process in trickling filter. SECTION - II Q7) a) b) c) Q8) a) b) c) Q9) a) Distinguish clearly between the working of an oxidation ditch and oxidation pond. [6] Explain algae bacteria symbiosis. Classify the different types of oxidation ponds. OR Write the design steps required for oxidation pond. What are the advantages and disadvantages of aerated lagoons? How the detention period of oxidation pond is estimated? [6] [6] [4] [6] [4]

Design a septic tank for a hostel housing 200 persons. Also design the soil absorption system for the disposal of the septic tank effluent, assume the percolation rate as 1500 minutes per m, L/B ratio = 4 and De-sludging period = 1 year. [10] Draw a neat figure of septic tank. Show plain sectional elevation with baffle walls, inlet outlet positions in detail. [6] OR Write the various design parameters of anaerobic digesters. [6]

b)

Q10)a) b) c)

What are the advantages and disadvantages of anaerobic treatment? [6] What are the different stages of digestion in case of anaerobic digesters? [4]

[3764]-102

Q11)a) b) Q12)a) b) c)

Draw a flow chart for treating sugar mill and dairy wastewater. What are the characteristics of distillery spend wash? OR Explain any one method of hazardous waste treatment. What are the benefits of hazardous waste reduction? Explain Ignitability and toxicity in hazardous waste.

[12] [6] [6] [6] [6]

[3764]-102

Total No. of Questions : 8]

[Total No. of Pages : 2

P1505

[3764]-1023
B.E. (Prod. / SW)

INDUSTRIAL RELATIONS & MANUFACTURING MANAGEMENT (411125) (1997 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) What are the characteristics of Indian industrial labour? Discuss. [8]

What is a meaning of labour relations? What are the causes & effect of strained relations? [8] Define the term Industrial Dispute as per Industrial Dispute Act, 1947. Explain the various methods of settlement of it. [8] What do you mean by trade union? What is its need? Distinguish between a Recognised Trade Union and Registered Trade Union.[8] What are financial and non-financial incentives? How they improve the industrial relations? [8] What is collective bargaining? Why it is important? Explain the essentials of successful collective bargaining. [8] [18]

Q2) a) b)

Q3) a) b)

Q4) Write short notes on any three of the following: a) Grievance Handling. b) Wage administration. c) ILO d) Industrial psychology. e) Lay-off & retrenchment.

P.T.O.

SECTION - II Q5) a) In manufacturing management, state the role played by the following departments. [9] i) b) Materials. ii) HR. iii) Finance. M/s. Tasty Foods Ltd. Produces two types of cakes viz - Milk & Fruit. Decide the product mix for maximisation of profit with the following dataOven Processing Time (min.) for Milk cake Fruit cake 20 25 12 30 15 15 Capacity available (min). 1200 1500 [7]

Oven A Oven B Profit Rs./Unit

Also compute the capacity utilisation of both ovens. Q6) a) b) Q7) a) b) c)

Define Production Planning & Control. Explain the main functions in it. [8] Discuss Break-Even analysis in detail. Maintenance is not a fire fighting technique - Comment. [8] [4]

State the factors contributing towards enhanced productivity in a medium scale engineering industry. [6] What is material handling? State the principles of material handling.[6] [18]

Q8) Write short notes on any three of the following: a) c) e) Product layout. Plant layout. Forecasting. b) d) Job production. JIT.

[3764]-1023

Total No. of Questions : 10]

[Total No. of Pages : 3

P1453

[3764]-1024
B.E. (E & TC)
COMPUTER ARCHITECTURE (1997 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6) 7) 8) Answer any 3 questions from each section.

[Max. Marks :100

Answer 3 questions from Section I and 3 questions from Section II. Attempt not more than six questions of which at least 3 questions must be from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Your are advised to attempt not more than six questions. Your answers will be valued as a whole. Assume suitable data, if necessary.

SECTION - I Q1) a) b) State computer architectural classification schemes, and explain Flynns classification in brief. [8] State and explain the trends of sophistication being used in computers from application point of view. [8] Define Parallel Processing. State and explain four programmatic levels in which parallel processing can be challenged. [8] Explain Memories in a hierarchy can be classified on the basis of several attributes. [8] Justify that virtual memory gives programmers the illusion that there is a very large memory at their disposal, irrespective of the small actual (Physical) memory available. [8] State and explain classification scheme for pipeline processors, according to the levels of processing. [8]

Q2) a) b)

Q3) a)

b)

P.T.O.

Q4) a) b)

With proper block diagram explain in brief any one of cache organizations. [8] Describe the following terminologies associated with pipeline computers. i) ii) Unifunctional pipeline. Instruction pipeline. [8]

iii) Pipeline efficiency. iv) Pipeline throughput.

Q5) a) b)

Compare the advantages and disadvantages of the three interleaved memory organizations. S-access, C-access and C/S - access. [10] With the help of block diagram explain the characteristics of I/O subsystem in dual processor system. [8] SECTION - II

Q6) a) b)

What are Array Processors? Explain SIMD computer organizations.[8] Consider an array of n n data elements; A = {A(i, j), 0 i, j n 1}; then show how indexing can be used to address the local memories. [8]

Q7) a)

Explain the following terminologies associated with SIMD computers. i) ii) Masking of processing elements. Barrel-shifting functions.

iii) Associative Memory. iv) Recirculating Networks. b) [8] Explain with proper block diagram the communication between processes in a multiprocessor environment. [8] Compare loosely coupled multiprocessors with tightly coupled multiprocessors. [8] Classify multiprocessor operating systems. Explain in brief the Masterslave operating system. [8]

Q8) a) b)

[3764]-1024

Q9) a) b)

Classify the various types of Parallel Algorithms, and explain in brief Synchronized Algorithms. [8] Describe the following terms associated with data flow computers. [8] i) ii) Data-driven computation. Control flow computers.

iii) Static data flow computers. iv) Dynamic data flow computers. Q10)Write short notes on (Any three): a) b) c) d) VLSI Algorithmic Processors. Space-time diagram for pipelined and Non pipelined processors. Parallel Memory Allocation. Cube-routing functions in SIMD computers. [18]

[3764]-1024

Total No. of Questions : 10]

[Total No. of Pages :2

P1571

[3764] - 1030 B.E. (E & T/C)

VLSI DESIGN
(1997 Course)
Time : 3 Hours] Instructions: 1) 2) 3) 4) 5) Answer any three questions from each section. Answers to the two sections should be written in separate answer books. Neat diagrams must be drawn wherever necessary. Use of electronic pocket calculator is allowed. Assume suitable data, if necessary. [Max. Marks : 100

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) b) Explore the architectural building blocks of FPGA in detail. List the specifications and features of any CPLD family. [12] [4]

Draw FSM diagram and VHDL code to detect 1011 Moore sequence.[12] Compare and contrast synchronous and asynchronous sequential machines. [4] What the different dissipations in CMOS logic? Derive the expression for dynamic power dissipation. [8] Design CMOS logic for F= ABC +DE. Compute area on chip. [8] Staring with the operating regions of CMOS Inverter, explain voltage transfer curve in detail. [8] What is meant by power delay product? Explain in brief. [8] [18]

Q5) Write short note on any three. a) Noise margin. b) Hazards. c) Fan in. d) ASIC versus FPGA. e) Moore and Mealy machines. P.T.O

SECTION - II

Q6) Explore high level design flow in detail. Brief every stage of design.

[16]

Q7) Write VHDL code for divide by 5 counter. Also write test bench for it. [16] Q8) a) b) Q9) ) b) Write VHDL code for 16 bit ALU for 6 different operations. Write full test bench for it. [8] Explore synthesis in detail. [8] What are the advance tools available for different stages in chip design. [8] What is place & route? Explain in brief. [8] [18]

Q10)Write short notes on any three. a) Attributes in VHDL. b) Delays. c) CLK skew. d) RTL. e) Functions.

*****

[3764] - 1030

-2-

Total No. of Questions : 10]

[Total No. of Pages : 2

P1572

[3764] - 1031 B.E. (E & TC) ROBOTICS (404185) (1997 Course) (Elective - I)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answer any three questions from each section.

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of electronic pocket calculator is allowed. Assume suitable data, if necessary.

SECTION - I 1 ) a) Define the terms. i) Payload. ii) Degree of Freedom. iii) Resolution. iv) Tip speed. [8] Explain different types of robots based on major axes with neat sketches. [8] Explain rotary to non linear motion conversion technique. [8] Explain the principle of operation of harmonic drive. [8] Draw the basic building blocks of robotic system and explain. Explain E-L equation for a robotic manipulator. [8] [8]

b) 2 ) a) b) 3 ) a) b) 4 ) a) b) 5 ) a) b)

Draw a neat sketch showing joint and link parameters. And explain. [8] What is symbolic T network? How it can be used to find orientation of tool tip frame with respect to base frame? [8] Explain the direct approach for obtaining inverse solution. Explain the term - Homogeneous Transformation. [10] [8]

P.T.O.

6) a) b) 7 ) a) b) 8) ) b) 9) ) b) 10) a) b) c) d)

Draw the schematic diagram of a typical hydraulic position servo and explain. [8] Explain the principle of working of a stepper motor. [8] Explain internal and external state sensor. Explain any one in detail. [8] Explain how synchros can be used in robot. [8] Explain different types of motion that are used while motion planning.[8] Explain the term task planning. [8] Explain SCARA robot and its applications, in detail. Discuss futute generation Robot Programming languages. es on: Palletizing. End effectors. Teach Pendant. Robot Vision System [10] [8]

[16]

*****

[3764] - 1031

-2-

Total No. of Questions : 10]

[Total No. of Pages : 2

P1600

[3764] - 1032
B.E. (Electronics and Telecommunications/Electronics) INFORMATION TECHNOLOGY (1997 Course) (Elective - I)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answer any three questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I 1 ) a) b) 2 ) a) b) 3 ) a) b) c) 4 ) a) b) Draw and explain in detail OSI model used in networking. Explain wired, wireless and optical medias used in networking. [10] [8]

Draw the block diagram and explain the functions of each block of video capture card. [8] What are the different file formats used in storing and displaying images. Compare .bmp and .tiff file format. [8] Explain structure of CD ROM media. How data is written and read out on CD ROM? What is the difference between CD and DVD media. [8] Calculate the size of sound file if it recorded for 30 seconds with two channels (stereo) and 8kHz sampling frequency. [4] Calculate the size of .bmp file which contains gray image data for 256256 pixels with one pixel equal to 8 bits. [4] With suitable block diagram explain working of internal modem. [8] What is DSL technique? What are the different variants of DSL techniques? Explain. [8] P.T.O.

5) a) b)

Draw the block diagram and explain the functions of each block of network interface card. [8] Explain .WAV file format for storing audio files. [8] SECTION - II

6 ) a) b) 7 ) a) b) 8) )

What are the different hardware and software challenges faced by designer while developing an embedded systems. [10] What are the different hardware and software development tools used by an embedded engineering during development of an embedded system. [8] What is real time operating system (RTOS)? Explain different components of RTOS. [8] Explain the importance and usefulness of the timer functions in RTOS.[8] With respect to RTOS explain the following. i) Pipes ii) Message Mailboxes and. iii) Queues. [8] Define interrupt latency? What are the different ways of minimizing interrupt latency? [8] What are different ways of saving memory space during embedded system development? [8] What are the different task states? Explain in detail? [8] short notes on any four: POP and SMTP. Multimedia authoring tools. Satellite networks. Events in RTOS. Embedded system classifications. Modem commands. [16]

b) 9) ) b) 10)Write a) b) c) d) e) f)

*****
[3764] - 1032 -2-

Total No. of Questions : 8]

[Total No. of Pages : 2

P1573

[3764]-1033
B.E. (E & TC)
COMMUNICATION NETWORKS (404188) (1997 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6)

[Max. Marks :100

Answer any 3 questions from Section I and 3 questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) c) Q3) a) b) c) Compare SMDS and X.25 technology. Explain ATM header in detail. What is B-ISDN? Draw & explain HDLC & PPP frame format in detail. What is 802.x Vs 802.y Bridge? Compare repeater Vs layer-2 Switch. [8] [8] [8] [4] [4]

Draw & explain IEEE-802.3 frame format. Also explain significance of PAD field. [8] Explain any one framing technique used at LLC layer. Explain IEEE-802.6-DQDB technique in brief. [4] [4] [18]

Q4) Write a short note on any three: a) b) c) d) 802.3 Vs. 802.5 technique. LEO Vs MEO Vs GEO. Ad-Hoc Wireless networks. FDDI backbone.

P.T.O.

SECTION - II Q5) a) b) c) Explain the applications of ICMP, IGMP, ARP and RARP protocols.[8] Compare IPV4 Vs IPV6. Compare virtual circuit Vs Datagram. [4] [4]

Q6) a) b) c) Q7) a)

Explain Transport layer functions & Transport layer Primitives in detail. [8] Draw & Explain UDP header in detail. Explain any Traffic shaping algorithm. [4] [4]

Messages independently arrive to a system at the rate of 10 per minute. Their lengths are exponentially distributed with an average of 3600 characters. They are transmitted on a 9600 bps channel. A character is 8 bits long. Calculate i) ii) Average service time Ts. What is arrival rate A. [8] [4] [4] [18]

iii) What is Service rate D. iv) What is utilization of server U. b) c) Explain RSA algorithm with example. Explain Erlang-B function.

Q8) Write short note on any three: a) b) c) d) SNMP system. HTML programming. Socket programming. Explain M/M/1 queue system.

[3764]-1033

Total No. of Questions : 10]

[Total No. of Pages : 2

P 1839

[3764] - 1036
B.E. AGRICULTURE ELECTRONICS (Elective - II) (1997 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate answer books. 3) Figures to the right indicate full marks. 4) Neat diagrams must be drawn wherever necessary. 5) Use of log tables, slide rule, Mollier charts, steam tables is allowed. 6) Use of non programmable scientific calculator is allowed. 7) Use of electronic gazettes like mobile phone, diary etc not allowed. 8) Assume suitable data if necessary.

SECTION - I Q1) a) b) Explain system for drying process & packing automation in the Seed process industry. [8] Give details of electrical and electronic control panel of a automated Green House. [8] Give details of how CO2 control can be achieved for growth of plants in a Green House. [8] Give details of milking a Cow and the method of control. [8] Explain effect of a solar light on a green house internal temperature, give the sensor & system adopted for management of internal humidity and temperature. [8] Explain principle pH measurement with a block diagram of the instrumentation of a pH meter. [8] Explain how humidity control helps growth of plants and system adopted for control. [8] Give process of a milk collection center and data base management software for such center. [8]

Q2) a) b) Q3) a)

b)

Q4) a) b)

Q5) Write short notes on any three : [18] a) Principle of photometry & application. b) Automated Grading system for selection of proper seeds for plantation.
P.T.O.

c) d)

Need of Testing Soil conductivity & Instrumental tool available. Automatic seeding machines electronics controller system. SECTION - II

Q6) a) b)

Explain fan & Pad method of the temperature control. [8] Explain frequency used & specifications of remote controllers used in agriculture field control. [8] 3 phase motor, electronic starter used give details of features and specifications. [8] Explain concept of earth leakage current give details of the electrical and electronics devices required for motor over load current. [8] Explain the term Turbidity, how it is measured, gives specifications of instrument. [8] Explain optimized operating point for maximum energy conversion of solar energy by solar cell. [8] How Sun Light is controlled by mesh filter method in a Green House? [8] Give details of temperature & humidity sensors used in closed lab environment. [8]

Q7) a) b)

Q8) a) b)

Q9) a) b)

Q10)Write short note on any three : [18] a) Microprocessor use in drip irrigation control system. b) Remote sensing of rain fall & irrigation control. c) Foggers & Motors used for a green house. d) Wind mill energy and Solar energy combination for power generation.

[3764] - 1036

-2-

Total No. of Questions : 10]

[Total No. of Pages : 3

P1456

[3764]-1041
B.E. (Electronics)
ELECTRONICS COMMUNICATION - II (1997 Course)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5) 6) Answer any three questions from each section.

[Max. Marks :100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Calculate: i) v) Cut off frequency. Characteristics Impedance. ii) Guide wavelength. iii) Phase velocity. iv) Group velocity. [10]

for a rectangular air filled X-band Copper waveguide with dimension 6 c.m x 3 c.m cross section and 30 c.m length is used to propagate TE11 mode at 10 GHz. b) Q2) a) b) Explain the operation of an Isolator with simple diagram. [6]

By means of construction details and applegate diagram, explain the operation of a Reflex Klystron Oscillator. [8] Explain the operation of a Gunn diode. Discuss the constructional details, equivalent circuit. [8] What is Horn Antenna? Illustrate its types and list their common features. [8] Write brief notes on LASERS and MASERS. [8]
P.T.O.

Q3) a) b)

Q4) a) b)

Define pattern multiplication. Explain the principle of pattern multiplication with examples. [8] What is an antenna array? Explain any one of the arrays in detail. [8]

Q5) Write short notes on any THREE: a) b) c) d) e) Optical Amplifier. Mobile Assisted Hand-Off (MAHO). SIM Card. ISI and Eye Pattern. SONET. SECTION - II Q6) a) b)

[18]

Explain the basic functions of search radars and tracking radars. Discuss various scanning and tracking methods. [10] Assume that a civilian radar has a maximum range of 80 kms. Determine, i) ii) Maximum range with an equivalent echoing area of 81 times & Effect of doubling the transmitter power on the range. [8]

Q7) a) b)

With neat and necessary diagrams explain the concept of micro and macro bending losses in fiber. [8] A certain optical fiber has an attenuation of 0.25dB/km at 1300 nanometers and 0.2 dB/km at 1500 nanometers respectively. Suppose, two optical signals are launched simultaneously into the same fiber with an optical power of 300 micro watts at 1300 nm and 200 micro Watts at 1500 nm, calculate the power levels in microwatts of these two signals at (i) 20 km and (ii) 50 km. [8] Define and explain the following terms of optical fiber communication:[8] i) ii) Numerical Aperture. Modes in fibers.

Q8) a)

iii) Index Profile. iv) V-number.

[3764]-1041

b)

For a multimode graded index fiber, Calculate: i) ii) Relative Refractive Index Difference.

[8]

Delay difference between slowest and fastest modes at the output.

iii) RMS pulse broadening. iv) Maximum Bit Rate, whose refractive index of the core is 1.65 and the refractive index of cladding is 15% less than that of its core with the fiber length of 15 k.m. Q9) a) b) What is meant by Doppler effect? Derive the expression for the same. [8] Draw the basic block diagram of the Mobile Cellular Systems and explain each blocks briefly. [8] List and explain various value added services in mobile communication system. [8] What are Home Location Registers (HLR) & Visitor Location Registers (VLR)? Explain the significance briefly. [8]

Q10)a) b)

[3764]-1041

Total No. of Questions : 10]

[Total No. of Pages : 3

P1588

[3764]-1042
B.E. (Electronics)

DIGITAL SIGNAL PROCESSING & APPLICATION (404203) (1997 Course)


Time : 3 Hours] [Max. Marks :100 Instructions to candidates : 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) What is stability of system? Explain stability criteria for LTI system. Also explain the same in terms of Z - domain. [6] Explain three properties of convolution. [6]

Test the following systems for time invariance, causality & linearity. i) ii) y(n) = 5nx2(n) y(n) = 3x( n + 4) [6]

iii) y(n) = cos (x(n)).

Q2) a)

Find the response of the system described as y(n) y(n 1) = x(n) for i) ii) x(n) = u(n). x(n) = 2n u(n).

[8]

b)

State convolution property in Z - domain & explain its advantage. Find convolution of signal using Z.T. [8] x1(n) = (0.25)n u(n 1) x2(n) = [1 + 0.5n] u(n).
P.T.O.

Q3) a)

Compute 8 point DFT of sequence 1 1 1 1 , x(n) = , , , , 0 , 0 , 0 .0 2 2 2 2 Using the inplace Radix-2 decimation in time algorithm. Follow exactly the corresponding signal flow graph & keep track of all intermediate variables. [8]

b)

Bring out difference between fourier transform & discrete fourier transform. State formula for DFT & IDFT and hence calculate IDFT of following sequence. X(k) = {4, 1 j, 2, 1 + j}. [8] What is ROC? What is its importance? Find ROCs of different finite & infinite duration non-causal sequences. [10] Determine the direct form I & II realization of the following LTI system. 2y(n) + y(n 1) 4y(n 3) = x(n) + 3x (n 5). [6] Determine circular convolution using stockhams method (DFT IDFT approach) for following sequence: [8] x1(n) = {2, 1, 2, 1} x2(n) = {1, 2, 3, 4} Explain following: [8] i) Overlap add and overlap - save method. ii) Antialiasing filter. SECTION - II

Q4) a) b)

Q5) a)

b)

Q6) a)

The desired frequency response of a low pass filter is given by d ( ) = ej 2 =0 4

otherwise

Design the filter using Hann window for N = 5 and also find out equation for ( ) . [8] b) Explain windowing technique of FIR filter design in detail. Also explain Gibbs phenomena and how it can be reduced. State different types of windows used with their window function & shape. [10]

[3764]-1042

Q7) a)

Explain impulse invariance transformation and its draw back. An analog filter has transfer function. H(s) = 10 (s + 7s +10 )
2

Design a digital filter equivalent to this using. Impulse invariance method for T = 0.2 sec. [8] b) For the given specification design an digital Butterworth filter using BLT. [8] Ap = 2 dB As = 10 dB Q8) a) b) p = 20 rad / sec s = 30 rad / sec

With a neat block diagram explain the architecture of DSP processor. Compare it with micro-processor. [8] Explain application of DSP in digital image processing with atleast on actual application case. [8] Explain the relationship between fourier and Z - transform. [6]

Q9) a) b)

Write formula for convolution & correlation. How does convolution program differ from correlation. Find out the convolution & correlation of following sequences:

{ } h (n ) = {1, 2, 1}
x (n ) = 1, 2, 3, 2, 1

[10]

Q10)a) b)

Obtain Direct form I & II realization of following system. y(n) + 0.1 y(n 1) 0.72 y(n 2) = 0.7 x(n) 0.95 x(n 2) [10] Explain freqn transformation in IIR filter design. [6]

[3764]-1042

Total No. of Questions : 10]

[Total No. of Pages : 2

P1457

[3764] - 1043 B.E. (Electronics Engg.) PROCESS INSTRUMENTATION (1997 Course) (404205)
[Max. Marks : 100

Time : 3 Hours] Instructions: 1) 2) 3) 4) 5) 6) Answer any three questions from each section.

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I 1 ) a) b) Define the term control system. With the help of block diagram explain closed loop control system in detail. [8] Define the term transducer. Explain in detail piezoelectric type pressure transducer. [8] Explain electromagnetic type flowmeter in detail. [8] Define the term strain gauge. What do you mean by temperature compensation of strain gauge? Explain full bridge circuit. [8] Explain in detail voltage to current converter. Why it is required? [8] Explain voltage to frequency converter. List the applications of V/F converter. [8] Explain in details 2- wire transmitters. Explain in detail any one method for conductivity measurement. P.T.O. [8] [8]

2 ) a) b) 3 ) a) b)

4 ) a) b)

5) Write a short note on [any three]: a) b) c) d) LVDT. Hydraulic PID controller. Electropneumatic converter. Square root extractor. SECTION - II 6 ) a) b) 7 ) a) b) With suitable diagram explain electronic P + I controller. Explain the factors for selection of control valve.

[18]

[8] [8]

With suitable diagram explain electropneumatic actuator. [8] A LVDT with secondary voltage of 10 volts, is having range of 50 mm. Find the output voltage when the core is 10mm from centre towards S1. Also find the sensitivity of transducer. [8] With suitable example explain feed forward control system. [8] Define the term heat exchanger. Explain any one type of heat exchanger in detail. [8] Define the term PLC. Draw the ladder diagram for bottle filling plant.[8] What do you mean by SCADA. Explain it with suitable example & block diagram. [8] [18]

8) ) b)

9) ) b)

10)Write a short note on [any three]: a) b) c) d) Distributed control system. Instrument control panel. Adaptive control system & its applications. Control valve noise.

*****
[3764] - 1043 -2-

Total No. of Questions : 10]

[Total No. of Pages : 2

P 1602

[3764] - 1045
B.E. (Electronics) MEDICAL ELECTRONICS - I (1997 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) Name the different types of electrodes used for ECG measurement. Explain any one in detail. [8] Draw the explain the working of ECG Machine. [8] Explain the origin of the bioelectric signal. Explain the direct method of Blood pressure measurement. Explain how to calculate the following parameters i) Mean cell volume. ii) Mean cell hemoglobine. iii) Mean cell hemoglobine concentration. iv) Mean platelet volume. Explain the working of blood cell counter. [8] [8]

b) Q4) a) b)

[8] [8]

Explain the PQRST waveform with time intervals. [8] Describe the strain gauge pressure transducer with the help of neat diagram. [8] [18]

Q5) Write short notes on : a) Korotkoff sounds. b) Action and Resting potential. c) Micro electrodes.

P.T.O.

SECTION - II Q6) a) b) What is Cardiac Pacemaker? Explain any one in detail. [8] Explain the working of Blood gas analyser with the help of neat diagram. [8] State the properties of X-rays and explain how X-rays are produced.[8] Explain the working of muscle stimulator with the help of neat diagram. [8] What is a Diathermy unit? Explain with proper application in medical field. [8] Explain the working principle of spectrophotometer with necessary diagram. [8] What are the different types of Recorders? Explain any one type in detail. [8] Explain electronic switching system for simultaneous display of several signals on CRT. [8] [18]

Q7) a) b)

Q8) a) b)

Q9) a) b)

Q10)Write short notes on : a) X-Ray image intensifier. b) Colorimeter. c) Ultrasonic Doppler shift principle.

[3764] - 1045

-2-

Total No. of Questions : 10]

[Total No. of Pages : 2

P1841

[3764]-1052 B.E. (Electronics)


POWER ELECTRONICS - III
(1997 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables & non- programmable electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) With the help of a neat circuit diagram and waveforms, explain the operation of single phase separately excited DC motor drive using full converter. Derive the expression for average output voltage. Mention important features of the system. [16] Q2) With the help of neat circuit diagram and waveforms, explain the operation of three phase semiconverter driven separately excited DC motor drive. [16] Q3) Explain ideal dual converter. What is the difference between ideal and non-ideal dual converters? What is circulating current? [16] Q4) What is braking of a DC motor? Mention various braking techniques. Explain any one in details. [16]

P.T.O.

Q5) Write notes on (any three) a) Traction drive. b) Dual mode dual converter. c) Reversible drive. d) Performance parameters for DC drive. SECTION - II Q6) Explain various speed control techniques for induction motor.

[18]

[16]

Q7) With the help of neat diagram and waveforms explain the operation of a stepper motor drive. [16] Q8) What are resonant converters? Explain the operation of series resonant converter. [16] Q9) a) Explain various protection circuits used for AC motors. b) Explain vector control induction motor drive. Q10) Write notes on (any two): a) Synchronous motor drive. b) Digital control of DC motor. c) Class E resonant inverter. d) Microstepping in stepper motors. rrr [8] [8] [18]

[3764]-1052

-2-

Total No. of Questions : 10]

[Total No. of Pages : 2

P1603

[3764] - 1054 B.E. (Electronics) ADVANCED COMPUTER PROGRAMMING (1997 Course) (404210)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) Answer any three questions from each section.

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks.

SECTION - I 1) a) b) 2 ) a) b) 3 ) a) b) 4 ) a) b) c) 5) a) b) c) Compare the spiral and waterfall models of software design. Explain the unit testing with an example. Explain the exception handling in Java. Discuss the synchronization of threads. Write a program in Java to read data from keyboard. Explain overloading and overriding of methods in Java. Write a note on Java packages. Explain the access control specifiers. What is the significance of thread priority. Explain the architecture of an Applet. Write an applet program to display a given message. Explain the Java data types. [10] [8] [8] [8] [8] [8] [6] [6] [4] [8] [4] [4]

P.T.O.

6 ) a) b) 7 ) a) b) 8) ) b) 9) ) b) 10) )

Compare a table and view. List the different previleges in SQL. Explain data base update statements. Explain summary queries of SQL. Write an embedded SQL program to delete rows of a table.

[8] [8] [10] [8]

What is a view? Explain the advantages and drawbacks of views. [10] Explain the search tests used in sub-queries. [6] What do you mean by a multitable join in SQL? Explain with suitable example. [8] Explain GRANT and REVOKE statements. [8] Create the following table using HTML tags. Col.1 100 200 300 Col.2 A B 50 10 80 30 90 40 Col.3 X Y 4 20 6 30 8 40

[8]

b)

What are the advantages of using frames in HTML documents? Explain the tags and their attributes to create frames. [8]

*****

[3764] -1054

-2-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1300

[3764]-106
B.E. (Civil)

SYSTEMS APPROACH IN CIVIL ENGINEERING (2003 & 1997 Course) (Elective - I)


Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) Solve using Big M or Two - Phase Method, Maximize Z = 2x1 + 3x2 Subject to x1 6 x1 + 2x2 10 x1 + x2 2 x1, x2 0 b) Q2) a) b) c) Explain convex and concave functions. OR Solve the problem in Q1(a) above by graphical method. What are the applications of L.P. in Civil Engineering. [6] [4] Explain the role of artificial variables and decision variables in L.P. [6] [4] [12]

Q3) Solve the following Transportation problem in which the quantity available at the source, the demand at the destination and the unit cost of transportation are given in the following table. [18] a) Find the initial basic feasible solution by N-W Corner method and Least cost method.
P.T.O.

b)

Using the solution obtained by LCM, find the optimal solution. Source 1 A B C Demand 21 17 32 6 Destination 2 16 18 27 10 OR 3 25 14 18 12 4 13 23 41 15 11 13 19 Supply

Q4) a) b)

How will you formulate a Transportation problem as an L.P model?[6] Explain how you will solve an assignment problem where a particular assignment is restricted? How will you maximize the objective function in an Assignment Model. [4] A company has four machines on which three jobs have to be done. Each job can be assigned to one and only one machine. The cost of each job on each machine is given below. What are the job assignments which will minimize the cost? [8] Jobs 1 A B C 18 8 10 Machines 2 24 13 15 3 28 17 19 4 32 19 22

c)

Q5) a) b)

Explain Dichotomous search technique for one dimensional optimization problems. [6] Use the golden section method to minimize Z = 2x2 16x in the range of 0 to 10. Carry out the first four iterations only. [10] OR Use steepest gradient technique to maximize
2 2 f(x) = 6x1 + 4x2 2x1 2 x1 x 2 2x 2 . Take the starting point as (1, 1). Carry out the first two iterations only. [10]

Q6) a)

b)

Explain the algorithm of Newtons method. What are its advantages over steepest gradient technique? [6]

[3764]-106

SECTION - II Q7) a) b) Explain the algorithm of Lagrange Multiplier Technique. [6]

2 2 Use Lagrange Multiplier Technique to minimize = x1 + x2 2x 2 + 1 2 subject to x12 + x2 = 4 , x1, x2 0.

[10]

OR Q8) a) A promoter builder has 3 money units which he wishes to utilize in developing 3 projects. Depending upon the amount invested, the resulting profits expected are given below. Determine the optimal allocation to each of the projects which will maximize the total expected returns. [12] Investment 1 0 1 2 3 b) Q9) a) 0 4 8 12 Projects 2 0 2 10 12 3 0 6 10 12 [4]

What is Bellmans principle of optimality?

Vehicles arrive at a service station in a Poisson fashion at an average rate of 45 minutes. The average time taken for service is 30 minutes with an exponential distribution. [10] Determine: i) ii) The chance that a vehicle will be serviced straight away. The proportion of time the service station is busy.

iii) The average number of vehicles in the queue and the system. iv) The average time spent by the vehicle waiting in the queue and the system. v) b) c) The probability that there are two vehicles in the queue. [4] Explain the Monte Carlo method of simulation.

Give any two applications of simulation in the field of Civil Engineering. [4] OR

[3764]-106

Q10)a) b)

Explain in brief the various components of a queueing system. What is Kendell - Lee Notation? [6] A company has 6 jobs which are to be processed on 3 machines A, B & C in the order ABC. The processing time in minutes for each job on each machine is as given below. Find the optimal sequence of the jobs so as to minimize the total time elapsed. Also find the idle time on each machine. [12] Jobs 1 2 3 4 5 6 Machines A B C 36 14 38 24 24 24 58 22 46 72 4 94 86 12 56 74 24 72 [8]

Q11)a)

Explain the following terms: i) Two person zero-sum game. ii) Pure strategy. iii) Mixed strategy. iv) Minimax and maximin principle.

b)

Solve the following game whose payoff matrix is given in the following table. [8] Player A Player B B1 B2 B3 A1 11 17 12 A2 16 12 17 A3 15 12 16 Determine the strategies of each player and the resulting payoff. OR What criteria are considered for selection of a project amongst various alternatives available? [6] Distinguish between mutually compatible projects and mutually exclusive projects. [4] Explain the following terms: [6] i) Amortization. ii) Salvage value. iii) Discount Rate. Y

Q12)a) b) c)

[3764]-106

Total No. of Questions : 10]

[Total No. of Pages : 2

P1589

[3764]-1062
B.E. (Industrial Electronics)

POWER ELECTRONICS DRIVES AND APPLICATIONS (1997 Course)


Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5) 6) Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of electronic pocket calculator is allowed. Assume suitable data, if necessary. [Max. Marks :100

SECTION - I Q1) a) b) Draw a neat circuit diagram of 1 semiconver drive for separately excited dc motor. Explain its operation with suitable wave forms. [10] Draw a neat circuit diagram of chopper fed dc drive. Explain its operation with suitable waveforms. [8]

Q2) a) b)

What are the advantages and disadvantages of 3 dc drive over 1 dc drive. [6] Draw a neat circuit diagram of 3 full converter dc drive. Explain its operation with suitable waveforms. [10]

Q3) a) b)

Explain the principle of Induction heating. State its application and advantages. [8] Explain the operation of Brushless DC motor drive. [8]

Q4) a) b)

Explain PF improvement using Multistep converters. State advantages and disadvantages of HVDC transmission.

[8] [8]
P.T.O.

Q5) Write short note: a) b) c) d) Traction Drive. Dielectric heating. DC motor performance parameters. PWM converter drive. SECTION - II Q6) a) b) What is static Kramer drive and static Scherbius drive?

[16]

[6]

What are the different speed control methods of Induction motor. Explain it in brief. [12]

Q7) a) b)

What are the various types of synchronous motors? What is self controlled mode of synchronous motors? [4] Why CSI drive is preferred for synchronous motors? Explain the operation of CSI drive of a synchronous motor. [12] Explain the driver circuits of permanent Magnet and hybrid stepper motor. [8] Explain microstepping in stepper motors. [8]

Q8) a) b) Q9) a) b)

Draw the circuit diagram and explain the operation of rotor resistance control using chopper. [8] Explain with suitable block diagram the control of induction motor using microprocessor. [8] [16]

Q10)Write short note (any three): a) b) c) d) VCVF drives. Motor drives in steel industry. Microprocessor based stepper motor drive. Start up consideration of Induction motor.

Y
[3764]-1062 2

Total No. of Questions : 12]

[Total No. of Pages : 2

P1464

[3764]-107
B.E. (Civil)
FINITE ELEMENT METHOD (Elective - I) (2003 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4)

[Max. Marks : 100

Solve Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from Section I and solve Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 from Section II. Answers to the two sections must be written in separate books. Figures to the right indicate full marks. Use of pocket calculator is allowed.

SECTION - I Q1) A pin jointed truss ABCD, AB = 3m, BC = 2m, consists of five members AB, BC, CD, DA & AC. The truss is hinged at A & D and roller supported at B such that UB is allowed. A load of 100 kN acts vertically downward at C. If AE is same for all members, develop overall matrix equation. [16] OR Q2) State the principle of minimum Potential Energy & hence derive any two equations of matrix equations for a truss member of length l of extensibility AE. Member makes an angle with x axis. [16] Q3) a) b) Explain direct & variational approach in deriving matrix equation in finite element method use suitable example. [8] A propped cantilever of length l & uniform flexural rigidity EI is subjected to moment M at propped end. Using single element analyse the beam & draw B.M. diagram. [10] OR Q4) A continuous beam ABCD is fixed at A & D and roller supported at B & C such that AB = 6m, BC = 4m & CD = 6m. EI is uniform. It is subjected to udl of 30 kN/m on entire length ABCD. Find unknown DOFs. Use structure approach. [18]
P.T.O.

Q5) a) b)

What do you know by transformation? Explain taking suitable example. [8] Explain procedure for finite element analysis of single bay, single storey portal frame. [8] OR

Q6) Explain following: a) Effective node numbering. b) Assembly process. c) Characteristics of matrix [K]. SECTION - II

[6] [4] [6]

Q7) Taking two dimensional triangular element for constant strain, explain procedure to obtain its stiffness matrix. Use polynomial for displacement function. [16] OR Q8) Explain & derive shape functions for three noded triangular element using area coordinates. [16] Q9) For four noded isoparametric quadrilateral element derive shape functions in natural coordinates & obtain Jacobian matrix. The element is used for plane stress condition. [16] OR Q10)What are the advantages of isoparametric element? Derive shape functions for 8 noded serendipity quadrilateral for one corner & one midside node. Use natural coordinates. [16] Q11)Write short notes on: a) Axisymmetric element & its use. b) Elasticity matrix in various problems. OR Q12)Write short notes on: a) Three dimensional element & its use. b) Shape functions for Hexahydron element. Y
[3764]-107 2

[9] [9]

[9] [9]

Total No. of Questions : 10]

[Total No. of Pages : 2

P1607

[3764] -1096 B.E. (Computer) ADVANCED UNIX PROGRAMMING (1997 Course) (Elective - II) (410251)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Attempt any three questions from section - I and three questions from section - II. Figures to the right indicate full marks. Draw neat diagrams wherever necessary. Make suitable assumptions wherever necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) b) Explain the execution of fork() call. Which properties are inherited by the child process from the parent process? [8] List and explain the important features of Unix System V file system.[8] What is the roll of macros in Unix Programming? How macros can be used to check the status of the process? [8] How shell script can be used in system administration? [8] Explain the need of background and foreground processes in Unix Programming with proper examples. [8] Why process accounting is needed? How operating system makes the use of it? [8] What are the disadvantages of slow system call? What action is expected to overcome the problems occurred by system call? [8] Describe the architecture of NFS file system. [8] [18]

Q5) Write short notes (any three): a) Race Condition. b) Unbuffered I/O. c) System Tuning. d) Job control Signals.

P.T.O.

Q6) a) b) Q7) a) b) Q8) a) b) Q9) a) b)

What is the role of shared memory in group communication? Explain with suitable example. [8] Compare between the simple piles and FIFO. [8] List the pros and cons of stream pipes and sockets [8] How many messages a message queue can handle? How these messages are stored? [8] Give the advantages and disadvantages of IPC structures. [8] What is the primary motivation behind the development of a RPC system? Give the advantages and disadvantages of RPC. [8] What are the differences between stream and datagram mode provided in socket programming? [8] What is the difference between binary semaphore and general semaphore? How will you make the use of these semaphores? [8] [18]

Q10)Write short notes on: a) Light weight process. b) Terminal Driver. c) AWK. d) Unreliable Signals.

*****

[3764] - 1096

-2-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1466

[3764] - 117 B.E. (Civil) INTEGRATED WATER RESOURCES PLANNING AND MANAGEMENT (2003 Course) (Elective - II)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answer any three questions from each section.

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I 1) a) b) 2 ) a) b) 3 ) a) b) 4 ) a) b) Explain the need of conservation of surface water by presenting the distribution of world water resources. [8] Explain present institutional framework for water management. [8] OR What are the constitutional provisions of ground water ownership. Also, explain the riparian rights. [8] Explain scope of privatization in water resources sector in India. [8] State salient features of national water policy. Enlist different laws related to water resources. OR Explain principles of water allocation. Explain briefly the following probabilistic distributions. i) Normal. ii) Log Normal. iii) Poission. iv) Extreme Value. P.T.O. [8] [8] [8] [8]

5) a) b)

Explain concept of system engineering and explain any three conventional optimizing techniques. [9] What are different simulation techniques? How they can be applied to water resources planning. [9] OR Write concept of regression and correlation analysis. Explain concept and application of. i) Genetic Algorithm. ii) Fuzzy Logic. [9] [9]

6 ) a) b)

7 ) a) b)

Explain criterion for flood damage assessment. [8] What is geoinformatics? What are its applications in flood management? [8] OR Explain salient features of drought mitigation plan. What is severity index? How drought forecasting is done? [8] [8]

8) ) b) 9) ) b) Q10)a) b) Q11)a) b) Q12)a) b)

Write short notes on: i) Interbasin water transfer. ii) Surface water storage potential. [8] Explain: Water logging - phenomenon - causes - controlling measures.[8] OR How estimation of surface water and ground water recharge is done?[8] Explain social impact of water resources development. [8]

What are salient features of perspective plan for basin development?[9] Explain use of ANN in water resources planning. [9] OR Explain concept and application of Decision Support System in I.W.R.P.M. [9] Explain management of rehabilitation and resettlement. [9]

[3764] - 117

*****
-2-

Total No. of Questions : 6]

[Total No. of Pages : 4

P1308

[3764]-121
B.E. (Civil)
FOUNDATION ENGINEERING (401010) (2003) (Theory)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer 3 questions from Section I and 3 questions from Section II . 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data, if necessary.

SECTION - I Q1) a) Compare in tabular form static and dynamic cone penetration tests in respect of i) ii) b) Sketches with component parts. Procedure. [6]

iii) Limitations. In connection with standard penetration test, answer the following: i) ii) Draw a sketch and indicate dimensions. Procedure in short.

iii) Relation of corrected blow count (N) with recorded blow count (NR) for saturated silt and fine sand. [6] c) Calculate corrected blow count for recorded blow count of 32 and comment on results. [5] OR a) For Seismic method answer the following: i) ii) Principle. Procedure with a sketch. [6]

iii) Interpretation of test result.

P.T.O.

b)

For resistivity method discuss the following: i) ii) Principle. Procedure with a sketch.

[6]

iii) Interpretation of test result. c) Find out depth of overburden from the following data: i) ii) Velocity V1 in upper strata 600 m/s. Velocity V2 in lower strata 4000 m/s. [5]

iii) Distance D from graph - 30 m comment on result. Q2) a) b) State and explain Janbus equation for average settlement of finite thickness of foundation bed. [6] Show by means of two sketches pressure distribution for point load and distributed load on surface. Upto what extent the pressure bulbs are considered to be significant? What is the specific use of pressure bulbs.[6] Determine the elastic settlement of square footing from the following data: i) ii) Load on foundation 2250 kN. Width of foundation 1.5 m.

c)

iii) Depth of foundation 1.0 m. iv) Modulus of elasticity 50,000 kN/m2. v) Poissons ratio = 0.25. vi) Use IS = 0.82. For this case workout load on foundation if settlement is limited to 10mm. [5] OR a) b) c) Explain with sketches spring analogy method of consolidation process.[6] Explain with a sketch determination of coefficient of consolidation by using square root of time fitting method. [6] Define preconsolidation pressure and explain with a sketch how would you determine the same. [5] State and explain Hansens bearing capacity equation.
2

Q3) a)
[3764]-121

[6]

b)

Explain with a sketch effect of water table on bearing capacity of soil by considering two conditions namely water table above / below foundation. [6] Explain with a sketch the effect of biaxial eccentric loading on bearing capacity of soil. [4] OR

c)

A plate load test (gravity loading) is to be conducted on soil to estimate allowable soil pressure. For this proposal. a) b) c) Draw a neat sketch of layout in section and name components. Indicate stepwise procedure. [6] [6]

Plot load settlement curves for C & Q soil and state how would you calculate safe load from the same. [4] SECTION - II

Q4) a) b) c)

With a neat sketch explain the load carrying mechanism of friction piles and end bearing pile. [6] With a neat sketch explain construction of bored cast-insitu concrete piles. [5] A group of 10 piles 300 mm 8 m arranged in three rows (3 + 4 + 3) are spaced at 1.0 m centre to centre. Determine the group capacity using converse -Labarres formula and Loss Angeles formula. [6] OR Draw a neat sketch of well foundation showing its different component parts. [6] Explain sand island method for Caisson sinking, with a neat sketch. [6] What is Caisson disease? Mention what precautions should be taken to avoid Caisson disease. [5] What is a sheet pile wall? Explain cantilever sheet pile wall and anchored sheet pile wall with sketches. [6] Draw a pressure distribution diagram for a cantilever sheet pile wall in granular soil. [6] With examples, explain the application of sheet pile walls. OR [5]

a) b) c)

Q5) a) b) c)

[3764]-121

a) b) c) Q6) a) b) c) a) b) c)

With a neat diagram of experimental setup, explain how swelling pressure of soil is determined. [6] Enlist the design principles & techniques to be adopted for construction on black cotton soils. [5] With a neat sketch explain construction of under reamed concrete piles. [6] Enlist the types of earthquakes and the Seismic waves due to earthquake. [6] What is liquefaction? Explain effect of liquefaction on built environment. [6] Write briefly on liquefaction hazard mitigation. OR What are geosynthetics? Enlist various functions that can be performed by geosynthetics. [6] What is reinforced earth wall? Draw a neat sketch of reinforced earth wall. [6] Enlist different types of Geosynthetics, their functions & applications in a tabular form. [4] [4]

[3764]-121

Total No. of Questions : 12]

[Total No. of Pages : 7

P1310

[3764]-132
B.E. (Mech. and Mech./SW)
DYNAMICS OF MACHINERY (402042) (2003 Course)

Time : 3 Hours] [Max. Marks :100 Instructions to candidates : 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Unit - 1 Q1) a) A four wheeled trolley car has a total mass of 3000 kg. Each axle with its two wheels and gears has a total moment of inertia of 32 kg.m2. Each wheel is of 450 mm radius. The center distance between two wheels on a axle is 1.4 m. Each axle is driven by a motor with a speed ratio of 1:3. Each motor along with its gear has a moment of inertia of 16 kg m2 and rotating in the opposite direction to that of the axle. The centre of mass of the car is 1 m above the rails. Calculate the limiting speed of the car when it has to travel around a curve of 240 m radius without the wheels leaving the rails. [12] Explain the effect of gyroscopic couple on swinging table fan. OR Q2) a) A uniform disc of diameter 125 mm and mass of 12 kg is mounted on one end on a frame such that the disc rotates at uniform speed of 15000 rpm with its axis horizontal. The other end of horizontal frame is pivoted to a vertical spindle which is free to turn in bearings. The frame is free to swing in vertical plane. The C.G. of the disc is at 450 mm from the pivot and C.G. of the frame of mass 5 kg is at a distance of 375 mm from the pivot. Find the velocity with which the system will precess about the spindle. Sketch the arrangement. [10] b) What do you understand by gyroscopic couple? Derive a relation for its magnitude. [6]
P.T.O.

b)

[4]

Unit - 2 Q3) a) A shaft has three eccentrics each 7.5 cm diameter and 2.5 cm thick machined in one piece with the shaft. The central planes of the eccentrics are 6 cm apart. The distance of the centres from the axis of rotation are 1.2 cm, 1.8 cm and 1.2 cm and their angular positions are 120 apart. The metal weighs 0.007 kg/cm 3. Find the amount of the out of balance force and couple at 600 rpm. If the shaft is balanced by adding two weights of radius 7.5 cm and at a distance of 10 cm from the central plane of the middle eccentric, find the amounts of the weights and their angular positions. [12] What do you mean by balancing? Why it is necessary for high speed engines? [4] OR Q4) a) b) What are V-engines? How do they differ from the rest of the reciprocating engines. [4] Fig.1 shows the arrangement of the cranks in a 4 crank symmetrical engine, in which the masses of the reciprocating parts at cranks 1 and 4 are each equal to m1 and at cranks 2 and 3 are each equal to m2. Show that, the arrangement is balanced for primary forces and couples and for secondary forces provided that, m1 cos , x1 tan = = m2 cos x2 tan and cos cos = 1 . 2 [12]

b)

[3764]-132

Unit - 3 Q5) a) A combination of seven number of identical springs, each having a stiffness of K, supports a mass m as shown in Fig. 2. If the mass is slightly displaced from the mean position and released, find the natural frequency of the oscillations. [8]

b) c)

Discuss about Coulomb Damping. A vibrating system is defined by the following parameters: m = 3kg, k = 100 N/m, c = 3 N s/m. Determine: i) ii) the damping factor. the natural frequency of damped vibrations. OR

[6] [4]

Q6) a) b)

What is logarithmic decrement? Derive the relation for the same.

[6]

Show that for finding natural frequency of a spring mass system, the mass of the spring is taken into account by adding one-third (1/3) its mass to the main system. [6]
3

[3764]-132

c)

A rod of circular cross section and of uniform diameter 100 mm is fixed at one end. A disc of mass 500 kg is attached at the other end. Radius of gyration of the disc is 250 mm. Length of rod is 100 cm. E = 3 x 10 5 MN/m2 and G = 8 x 10 4 MN/m 2. Find the frequencies of natural longitudinal and torsional vibrations in Hz. [6] SECTION - II Unit - 4

Q7) a)

A single cylinder engine of total mass 20 kg is to be mounted on an elastic support which permits vibratory movement in vertical direction only. Elastic support consist of 3 springs of stiffness K N/m each. If unit operates at 580 rpm. What should be the value of spring constant K, if only 10% of the shaking force of unit is to be transmitted to the support structure? [8] Derive graphically the expressions for i) ii) amplitude of steady state vibrations and phase angle

b)

for a spring mass - damper system subjected to an external periodic force f0 sin t . [8] OR Q8) a) A vehicle has a mass of 1000 kg. The suspension system has a spring constant 500 kN/m and damping ratio of 0.5. If the vehicle has a speed of 80 km/hr. Determine the displacement amplitude of the vehicle. The road surface varies sinusoidally with an amplitude of 10 cm and a wavelength of 5m. [6] Investigate the terms involved in the equation of motion of one degree of freedom system as given by 5 + 3 x + 12 x = 10 sin t . [10] x

b)

[3764]-132

Unit - 5 Q9) a) What do you understand by a semi-definite or degenerate system? Give two examples of systems that are degenerate? [8] A system is shown in Fig. 3. Find the equation of motions of masses for the condition if m = m1 = m2, if both the masses are displaced in the downward direction and released k1 = k3 = k. [8]

b)

OR

[3764]-132

Q10)a)

Determine the frequency of torsional vibrations of the disc shown in Fig. 4 if both the ends of the shaft are fixed and diameter of the shaft is 40 mm. The disc has a mass of 96 kg and a radius of gyration of 0.4 m. Take modulus of rigidity for the shaft material as 85 GN/m2 l1 = 1m and l2 = 0.8 m. [6]

b)

A reciprocating IC engine is coupled to a centrifugal pump through a pair of gears. The shaft from the flywheel of the engine to the gear wheel has a 48 mm diameter and is 800 mm long. The shaft from the pinion to the pump has 32 mm diameter and is 280 mm long. Pump speed is four times the engine speed. Moments of inertia of flywheel, gear-wheel, pinion and pump impeller are 1000 kgm 2, 14 kg.m 2, 5 kg.m 2 and 18 kg.m 2 respectively. Find the natural frequency of the torsional oscillations of the system. G = 80 GN/m2. [10] Unit - 6

Q11)a)

Explain with neat diagrams any two of the following: i) ii) Single Reed frequency meter. Piezoelectric Accelerometer.

[10]

iii) Vibration model of seismic pickup.

[3764]-132

b)

A rotor has a mass of 12 kg and is mounted midway on a 24 mm diameter horizontal shaft supported at the ends by two bearings. The bearings are 1m apart. The shaft rotates at 2400 rpm. If the center of mass of the rotor is 0.11 mm away from the geometric centre of the rotor due of a certain manufacturing defect, find the amplitude of steady state vibrations and the dynamic force transmitted to the bearing E = 200 GN/m2. OR [8]

Q12)a)

A seismic instrument having vibrating mass 5 kg is supported by a spring having stiffness 1000 N/m with negligible damping. A pen is attached to the mass which draws a curve on paper which is mounted on a rotating drum. The instrument is placed on a vibrating surface vibrating at frequency 5 rad/sec having amplitude of 10 mm. Find out amplitude of curve traced on paper if the vibrations are sinusoidal. [8]

b)

Explain the term whirling speed of a shaft. Derive an expression for the same. [10]

[3764]-132

Total No. of Questions : 12]

[Total No. of Pages : 4

P1467

[3764]-140
B.E. (Mech. S/W)
COSTING AND COST CONTROL (2003 Course) (Elective - I)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5) 6) Answer any one question from each unit.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of electronic pocket calculator is allowed. Assume suitable data, if necessary.

SECTION - I Unit - I Q1) a) b) c) Distinguish between financial accounting and cost accounting? What are the limitations of financial accounting? Indicate whether the following statements are True or False. i) ii) Cost audit is a part of financial accounting. Cost is a fact, price is a policy. [6] [4] [6]

iii) All costs are controllable. iv) Fixed cost per unit is always constant. v) Variable cost per unit is always constant. OR Q2) a) b) Distinguish between direct labor and indirect labor cost? Give four examples of indirect labor that may arise in factory? [8] Distinguish between Balance sheet and P&L account with an example?[8] Unit - II Q3) a) Indicate whether the following statements are True or False. i) Variable overheads vary with time.
P.T.O.

vi) Standard cost means what cost should be.

[6]

ii)

The terms depreciation and obsolescence are synonymous.

iii) Factory rent is a direct cost to the factory but indirect to the departments. iv) Overheads are also called chargeable expenses. v) Semi-variable and semi-fixed overheads are the same. vi) Rent is not included in cost when premises are owned by the company. b) Explain the following with examples: i) ii) Q4) a) Controllable cost and Non-controllable cost. Direct material cost and Indirect material cost. OR M/s. XYZ Ltd. are the manufacturers of moon-light torches. The following data relate to manufacture of torches during the month of March 1991:[12] Raw material consumed Direct wages Machine-hour worked Machine-hour rate Office overheads Selling overheads Units produced Units sold : : : : : : : : Rs. 20,000 Rs. 12,000 9,500 hours Rs. 2 20% of works cost. Rs. 0.50 per unit. 20,000 18,000 @ Rs. 5 per unit. [10]

Prepare cost sheet showing the cost and the profit per unit and the total profit earned. b) Distinguish between cost control and cost reduction. Unit - III Q5) a) What do you understand by overhead cost? Explain briefly the meaning of the terms fixed, semi-fixed and variable overhead cost giving one example of each? [10] Distinguish between cost allocation, cost apportionment and cost absorption? [8] OR
[3764]-140 2

[4]

b)

Q6) a) b)

Distinguish between standard costing system and budgetary control? [8] Indicate whether the following statements are True or False. i) ii) Variance is the difference between budget and actual. Standard costing and budgetary control systems are identical. [4]

iii) A budget manual is the summary of all functional budgets. iv) Zero base budgeting eliminates the weaknesses of functional budgets. c) What are the different types of labor variances? How are they calculated? [6] SECTION - II Unit - IV Q7) What is by-product and how is it different from joint product? What are the various methods of accounting for by-products? Explain each of the methods? [16] OR Q8) a) State whether the following statements are True or False. i) ii) Process costing is suitable for chemical factories. Normal loss is absorbed in good units in process costing. [4]

iii) The main product of one industry may be the by-product in another. iv) Raw material costs are always post-separation costs. b) c) Discuss the distinguishing features of process costing system? [6] What are the two most common methods of apportioning joint costs. Explain any one in brief. [6] Unit - V Q9) a) b) Explain the terms Margin of Safety and Angle of incidence in break even analysis. Illustrate your answer graphically? [8] The profit/volume ratio of Escorts Ltd. is 50% and the margin of safety is 40%. Calculate the net profit and the break even point if sales volume is Rs. 10,00,000. [10] OR

[3764]-140

Q10)a) b)

Construction of Break Even Point depends on certain specific assumptions. What are those assumptions? [6] The following data is given: Fixed expenses = Rs. 1,00,000. Variable expenses = Rs. 10 per unit; Selling price = Rs. 15 per unit. Evaluate the number of units to be manufactured and sold. i) ii) To Break even. To earn a profit of Rs. 10,000.

What additional units be necessary to increase the above profit by Rs.5,000? [12] Q11)a) b) Q12)a) Distinguish between standard cost and estimated cost? Explain the advantages of standard costing? [10] What is Activity Based Costing? Explain its significance? OR Write short note on: i) Material usage variance. [9] [6]

b)

ii) Overhead variance. iii) Sales variance. Explain the technique of marginal costing and state its importance in decision making? [7]

[3764]-140

Total No. of Questions : 12]

[Total No. of Pages : 7

P1314

[3764]-143
B.E. (Mechanical)
INDUSTRIAL FLUID POWER (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer Q.1 or Q.2; Q.3 or Q.4; Q.5 or Q.6 from section I and Answer Q.7 or Q.8; Q.9 or Q.10; Q.11 or Q.12 from section II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Q2) a) b) c) Q3) a) b) What are the important advantages and applications of fluid power?[4] Which are the three types of hydraulic fluids commonly used, based on the major constituents. Bring out the salient features of each. [6] What is a bypass filter? State its advantages and disadvantages. OR Enumerates the functions of reservoir in fluid power system. Explain its design considerations with neat sketch. [6] Classify the types of seals. Explain types of seals used in hydraulic systems. Enlist various materials of seal. [4] Write note on hydraulic hoses. [6] [6]

What are the most important factors one should considered while selecting a hydraulic pumps for specific application? [6] What is side loading or thrust in an unbalanced vane pump design? Explain with the help of neat sketch. [10] OR Explain with the help of neat sketch working of radial piston pump. In multi piston pump whether you will select odd number or even number of pistons and why? [10]
P.T.O.

Q4) a)

b)

What size of accumulator is necessary to supply 10000 cm3 of fluid in a hydraulic system of maximum pressure of 200 bar to 100 bar minimum. Assuming N2 gas pre-charged pressure of 80 bar find adiabatic and isothermal solution. [6]

Explain with the neat sketch 4/3 closed center lever operated direction control valve. Also state its advantages and disadvantages. [6] b) Explain with a neat sketch pilot operated pressure relief valve and state its advantages and disadvantages over direct operated pressure relief valve.[6] c) Compare the advantages and disadvantages of meter in and meter out flow control valve. [6] OR Q6) Write note on any three: [18] a) Pressure compensated flow control valve. b) Pilot operated check valve. c) Pressure sequence valve. d) Counter balance valve. SECTION - II Q7) a) A circuit for clamping and punching operation is shown in figure. An intensifier is incorporated in the circuit to get an increased pressure at a punch cylinder. Explain the operation of the circuit. [10]

Q5) a)

[3764]-143

b)

Describe the purpose and function of check valve inserted in the circuit as shown in Fig. [3]

c)

Identify the components shown by graphic symbols.

[3]

OR

[3764]-143

Q8) a)

A regenerative circuit for hydraulic output using an additional 3/2 pilot operated DCV is shown in Fig. The view shows the initial fast movement of the piston during extending as there is no external load on the cylinder. Draw the views of the circuit during the following stages:i) ii) When the full load acts on the cylinder. The cylinder is retracting. [10]

Comment on the speed of piston during extension and retraction strokes.

[3764]-143

b)

Study the circuit shown in Fig. A and B are push buttons for energizing solenoids X and Y. Make suitable assumptions, if required, and answer following questions. i) ii) Label all components of the circuit. Describe the operation of each cylinder with sequential details. [6]

iii) Indicate difference between the valves numbered 7 and 8.

Q9) a)

Distinguish between pneumatic pressure relief valve and pneumatic pressure regulator. Locate their positions in pneumatic circuit. Indicate the standard graphic symbols for both the items. [4] Explain the meaning of conditioned air used in pneumatic system. Discuss the components used to get conditioned air. Is separate air dryer also an essential component of the system? [6] Compare in brief electric, hydraulic and pneumatic motors in the context of speed, load, efficiency, application and any other feature you think of. [6] OR

b)

c)

[3764]-143

Q10)a) b)

Sketch a layout of a typical power supply unit used in pneumatic system. How does it differs from the one used in hydraulic system. [6] Draw circuit to show the applications of i) ii) Shuttle / Or gate valve. Twin pressure / And gate valve. (No description required). [6]

iii) Quick exhaust valve. c) Instead of an electric motor an air motor is used as prime mover in hydraulic power supply. See schematic diagram. Is it possible to have such an arrangement? Explain the merit and demerits of this system.[4]

Q11)a)

Sequential operations of two pneumatic cylinders are required as follows:i) Cylinder A extends. ii) Cylinder B extends. [10] iii) Cylinder B retracts. iv) Cylinder A retracts.

Develop a pneumatic circuit using starting valve, pilot operated 4/2 directional control valve and cam / roller operated valves to maintain proper sequence. Do not use solenoid-operated valves. b) Design the hydraulic circuit for the following operations:The circuit is required for press operation. An accumulator will supply the necessary flow once the power is shut off by pressure switch at the end of advance stroke. Locate the pressure relief valve, check valve and other essential components of the circuit. Describe the operation of the circuit. Indicate the function of the accumulator during the operation.[8] OR
[3764]-143 6

Q12)a)

Obtain the probable specification details of high-low pumps required for the following output of double acting cylinder:Cylinder bore 40 mm, piston to advance initially at 0.8 m/s and at 0.25 m/s at full load (corresponding to 60 bar pressure on the piston). Assume volumetric efficiency of pump 90% and running at 1000 rev/min. Make suitable assumptions and suggest pressure ratings of relief valve and pilot operated unloading valve. [10] Study the pneumatic circuit shown in Fig. and explain the operation of double acting cylinder. What happens if there is sudden built up of pressure, due to obstruction occurring in between during the advance of piston. Comment on the result. Explain the purpose of the vent item no 6 of the circuit. [8]

b)

[3764]-143

Total No. of Questions : 12]

[Total No. of Pages : 4

P1556

[3764]-144 B.E. (Mech.)


ROBOTICS
(402050) (2003 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

[Max. Marks : 100

Answer 3 questions from Section-I and 3 questions from Section-II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicates full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator is allowed.

SECTION - I Q1) a) Explain the relation between industrial automations and robotics. [4] b) A robot is less accurate but has good repeatability; another robot is accurate but poor in repeatability. Which robot will you select fori) ii) spray painting operations, spot welding operations. [6]

Justify your answers.

c) A frame {UVW} is located at a point P (15, 20, 10) with respect to {XYZ} having axis U opposite to Z axis, axis X parallel to V axis. Both frames are right handed. Determine location of point Q which is XYZ Q = (5, 15,25). [8] OR Q2) a) Write a note on playback robots. [4]

b) Explain Denavit-Hartenberg parameters with suitable examples and sketch. [6]

P.T.O.

c) A moving frame is rotated about a fixed frame in the following manneri) ii) rotation of 90 about U. rotation of 180 about Z.

iii) rotation of 90 about Y. iv) rotation of 90 about X. v) rotation of 90 about V. vi) rotation of 90 about U. A point has co-ordinates (15, 27, 38) with respect to moving frame. Map the point in the fixed frame. [8] Q3) a) A camera locates an object by,

0 1 1 0 camera T object = 0 0 0 0

50 0 75 1 20 0 1

The camera is then translated by 15 units along Z-axis of the object, and then rotated about its own X-axis by -90. Determine the new relation between camera and object. [8] b) It is required to locate the end effector of the PUMA robot at (450, 550, 650) with orientation of axes as, i) ii) X-axis of the end effector makes 60 with the Z-axis of the base frame. Y-axis of the end effector is parallel to and in the same direction as X-axis of the base frame.

iii) Z-axis of the end effector makes 60 with the Y-axis of the base frame. Get the inverse kinematics solution, with the link lengths as, L1 = 100, L2 = 500, L3 = 350, L4 = 250, L5 = 50, L6 = 75 and the end effector distance from the wrist is L7 = 60. [8]
[3764]-144 -2-

OR Q4) a) Explain considerations while i) ii) [8] Attaching co-ordinate frames to the two distinct points for getting DH parameters. Attaching co-ordinates frame to a joint.

iii) Attaching a co-ordinate frame to a gripper with sliding fingers. b) A planner 3R manipulator has link lengths l1 = 100 mm, l2 = 80 mm and l3 = 60 mm. Determine its reachable workspace and state whether point (200, 100) is reached with 1 = 40. If yes, what are the values of 2 and 3? If No, what should be minimum value of 1 so that the point will be reached by manipulator? [8] Q5) a) Explain different steps in trajectory planning. [6]

b) A joint of six axis robot goes from initial angle of 20 to a final angle of 80 in 5 seconds. Using a third degree polynomial, calculate the joint angles at intervals of 1 second. Also calculate joints velocities and accelerations. Plot the joints angles, velocities and accelerations from 0 second to 5 second. [10] OR Q6) a) Explain the second order manipulator control system. b) Write a note on industrial robot control system. [6] [6]

c) A spring mass system has m = 2, b = 4, and k = 7. What is the natural response of the system? Determine the gain in the position and velocity controls, so that the system will be critically damped with closed loop stiffness as 8. [4] SECTION - II Q7) a) Explain vacuum grippers, with reference to the principle, use and applications. [6] b) Discuss various considerations for selection of a gripper. c) Explain typical vision system for a robot.
[3764]-144 -3-

[6] [6]

OR Q8) a) Write short note on, photosensors. [6] b) What is compliance? Explain active and passive compliance in brief. [6] c) A vacuum gripper is used to lift flat steel plate of dimensions 7 mm 600 mm 900 mm. The gripper uses to suction cups, 125 mm in diameter each, and they are located 450 mm apart for stability. Assume a factor of safety of 1.7 to allow for acceleration of the plate. Determine the negative pressure required to lift the plates if the density of steel is 8054.3 109 kg/mm3. [6] Q9) a) Explain with principle of operations, use of strain gauges for force sensing. [6] b) Write a note on redundant Robot. c) Explain use of robot in plastic molding. OR Q10) a) Explain different types of speed reduction & transmission systems used in robots. [6] b) Explain use of robot in the welding. [6] c) Write various technical features required of robot for spot welding and spray coating applications. [4] Q11) a) Explain various performance characteristics of hydraulic motors. [6] b) Write note on stepper motor. [6] c) Compare hydraulic & electrical actuator based on weight, resolution, operating pressure and cost. [4] OR Q12) a) Explain various methods used to enter the programming command into the controller memory. [6] b) Explain generations of robot programming languages. [4] c) Explain WAIT, DELAY, SIGNAL command with suitable examples. [6] rrr
[3764]-144 -4-

[4] [6]

Total No. of Questions : 12]

[Total No. of Pages : 3

P1315

[3764]-145
B.E. (Mech.)
COMPUTATIONAL FLUID DYNAMICS (2003 Course)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Unit - I Q1) a) b) Derive the continuity equation in differential form for in compressible flow. [10] Define & develop expression for substantial derivative. OR Q2) Derive an expression for energy equation for infinitesimally small, moving fluid element. [16] Unit - II Q3) List the full procedure for the solution of Blasius equation using shooting method. [16] OR Q4) How characteristics lines are related to Courant number from stability view? Explain. [16] Unit - III Q5) a) Derive 2u ui +3,j + 4ui +2, j 5ui+1, j + 2ui, j + O 2 . 2 2 = ( ) i, j

[6]

[10]

P.T.O.

b)

Write short note on: i) Consistency. ii) OR Stability. iii) Convergence.

[8]

Q6) a) b)

Derive the forward and central difference, approximations to the first derivative, along with the leading error term. [8] Derive the stability criterion (CFL conditions) for the first order wave equation. [10] SECTION - II Unit - IV

Q7) For the following equation: = t a) b) c) 2


2

[16]

Obtain discretised form of finite difference quotient. Using explicit method, write algebraic equations for 4 4 grid. Explain any numerical method to obtain solution for temperatures. OR [16]

Q8) Explain following with merits and demerits. a) c) Explicit method. Semi-implicit method. Unit - V b) Implicit method.

Q9) Describe the MacCormaks technique for evaluatory the density at time step.

(t + t ) .
OR Q10)a) Obtain following relation for nozzle flow-

[16]

[8]

( )
t b)

( V )
x

= 0.

For the quasi one dimensional, steady, isentropic flow through a converging diverging nozzle, write down the governing equations. [8]

[3764]-145

Unit - VI Q11)Outline the Mac algorithm and show how the incompressible flow field is obtained. [18] OR Q12)a) b) Describe the important features of finite volume method. Write down step by step procedure for SIMPLE algorithm. [8] [10]

[3764]-145

Total No. of Questions : 10]

[Total No. of Pages : 3

P1557

[3764]-147 B.E. (Mechanical Engineering)


RAPID PROTOTYPING
(402050) (2003 Course) (Elective)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) Solve any three questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate answer books. Figure to right indicates full marks. Neat diagram should be drawn wherever necessary. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain with block diagram classical steps in new product development according to German Society of Mechanical Engineering. [8] b) What are the requirements of new product development strategies. Explain the critical factors affecting success. [8] Q2) a) Explain influence of models to speed up product development process with neat sketch. [8] b) Explain with neat sketch SGC process. [8]

Q3) a) Explain principles of simultaneous engineering with neat sketch. [6] b) Explain method of layer projection with laser and without laser with examples of each type. [6] c) Explain various demands on CAD system used in Rapid Prototyping. [4]

P.T.O.

Q4) a) Explain the following terms; i) ii) Beam Compensation. Cure depth and over cure.

[6]

iii) Active and passive recoating. b) What are various data acquisition techniques in reverse engineering? [4] c) Compare FDM with MJM. Q5) Write Short notes: a) Advantages of Rapid Prototyping. b) Comparison of STL and SLC file format. c) RP and CNC. SECTION - II Q6) a) Classify Rapid Prototyping on the basis of materials used with example of each type. [6] b) What are the different types of materials used in FDM and LOM processes? [6] c) What are the major differences between mechanical properties of metals and plastics? [4] Q7) a) Explain the concept of Support structure and material in RP with neat sketch. [4] b) Differentiate between Direct Rapid Tooling and Indirect Rapid Tooling. [6] c) Briefly describe DSPC. Name four areas in which DSPC has been used. [6] [6] [18]

[3764]-147

-2-

Q8) a) Explain Strategic and Operative aspects in RP.

[8]

b) What are the latest trends in RP material development and RP process development? [8] Q9) a) Select three RT processes from the Direct method and establish a chart comparing them in terms of lead time, relative cost, material and tolerances. [8] b) Explain the application of RP technology in Art, Archeology and Architecture. [8] Q10) Write Short notes: a) Make or Buy decision in RP. b) Guidelines for implementation of RP. c) Metal Spraying. rrr [18]

[3764]-147

-3-

Total No. of Questions : 12]

[Total No. of Pages : 7

P1316

[3764]-148
B.E. (Mechanical)
RELIABILITY ENGINEERING (Elective - II) (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer three questions from each section. 2) Attempt Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from Section I. 3) Attempt Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 from Section II. 4) Neat diagrams must be drawn wherever necessary. 5) Assume suitable data, if necessary. 6) Figures to the right indicate full marks. 7) Use of non-programmable electronic calculators is allowed.

SECTION - I Q1) a) In a survival test conducted on 100 cardboard boxes for their strength under impact loading, the following results were obtained. [10] No. of impacts Number of boxes failed 20 7 22 10 24 15 26 14 29 15 32 13 35 13 37 8 40 5

Calculate failure density, hazard rate and reliability. b) The random variation w.r.t. time in the output voltage of systems are exponentially distributed with mean value of 100 V. What is the probability that the output voltage will be found at any time to lie in the range of 90-110V. [8]

Q2) a)

Explain availability and maintainability. Explain the types of availability in detail. [8]

P.T.O.

b)

The following data refers to an availability study in a flexible manufacturing system using identical FMM. Find the inherent and operational availability. Assume administrative logistic time as 150% of MTTR. [10] No.of months 1 2 3 4 5 6 Uptime (Hrs) 380 355 330 345 335 366 Occurrence of failure 3 2 2 1 2 2 MTTR (Hrs) 0.75 0.85 2.5 4.5 3.5 1.5 Spares Management Time (Hrs) 0.8 1.2 3.55 1.75 2 3.5

Q3) a)

Find the reliability of the system shown in Fig. 1. The reliability value of components 1, 2, 3, 4, 5 and 6 are 0.9, 0.85, 0.98, 0.87, 0.94 and 0.89 respectively. [8]

b)

The failure rates of three components are 0.05 f/yr, 0.01 f/yr and 0.02 f/yr respectively and their average repair times are 20 hrs, 15 hrs and 25 hrs resp. Evaluate the system failure rate, average repair time and unavailability if all three components must operate for system success.[8]
2

[3764]-148

Q4) a)

A manufacturing concern specializing in high pressure relief valve to a particular acceptance test before certifying it as fit to use. Over a period of time, it is observed that 95% of all valves manufactured pass the test. However the acceptance test adopted is found to be only 98% reliable. Consequently a valve certified as fit for use has a probability of 0.02 being faulty. What is the probability that the satisfactory valve will pass the test. [8]

b)

Explain the features of two parameter and three parameter weibull distribution. [8]

Q5) a)

Allocate failure rates and reliabilities for the following data if the reliability goal is 0.98. [8] i No.of modules Importance factor Operating time 12 9 10 12

1 2 3 4 b)

25 100 70 80

1 0.95 0.9 1

A system consists of ten components connected in series. The predicted reliabilities obtained from failure data are given in table. It is desired that the system reliability be 0.97. Determine reliability goal for all components. [8] Component No. Predicted reliability 1 2 3 4 5 6 7 8 9 10

0.95 0.98 0.96 0.99 0.97 0.99 0.98 0.98 0.97 0.98

[3764]-148

Q6) a)

Fig. 2 shows a system configuration. The block shows elements of system and each element has reliability. 0.95. Find the system reliability. [10]

b)

Define tie sets & cut sets. Write all possible tie sets and cut sets for the system shown in Fig. 3. Give minimal tie sets and minimal cut sets. [6]

SECTION - II Q7) a) b) What are the types of loads considered in designing machines and structures? [8] Tests conducted on a sample of 100 automobile breaks have yielded a mean value of 56,669.5 and a std. deviation of 12,393.64 miles for the life of brakes. Assuming normal distribution find the probability of realizing the life of brakes less than 50,000 miles. Table shows (z) values. [8] Z (z)
[3764]-148

0.53 0.7019
4

0.54 0.7054

Q8) a)

Fig. 4 Shows the fault tree diagram. The failure rates of each basic element is given. Find out the failure rate of the system. [8]

b)

Construct a fault tree for the system failure shown in Fig. 5. If all the elements are having failure probability of 0.1, calculate system failure using fault tree analysis. [8]

Q9) a)

Find the reliability and the corresponding central factor of safety of a system for which kg/cm2 and
L s

= 15000 kg/cm2 and

= 10000 kg/cm2.

= 3000 [8]

= 1000 kg/cm2 and S & L follows normal distribution.

The table shows normal variant (z) and (z). Z (z) 1.56 0.9406 1.58 0.9429 1.60 0.9452

[3764]-148

b)

Ten identical components are connected in parallel to achieve the system reliability of 0.9. Determine the additional number of components to be added in parallel to increase the reliability to 0.95. [8]

Q10)a) b)

Explain the procedure of Failure mode effects analysis.

[8]

In a short sample life testing of a system the following data are recorded. Component MTTF (Hrs) 1 10 2 15 3 12 4 24 5 18 6 22 7 30 8 38

Plot the variation of reliability against time using: i) Mean and ii) Median Ranking Method. [8]

Q11)a) b)

Explain the magnified loading and sudden death testing for any system.[8]

The fault tree diagram is shown in Fig. 6. The failure probabilities of the elements are as given below. E1 = E2 = 0.005, E3 = E4 = 0.02, E5 = E6 = 0.1. Find out the system reliability. Also draw reliability block diagram for the same.
[3764]-148 6

[10]

Q12)a)

Fig. 7 shows reliability block diagram of a system. The reliabilities of each elements are given as R(A) = 0.96, R(B) = 0.92, R(C) = 0.99, R(D) = 0.85 & R(E) = 0.90. Find the system reliability. Also state tie sets and cut sets for the system. [10]

b)

Determine the reliability of system using event tree diagram if four subsystems are connected in series and management considers the system giving satisfactory performance even if two out of four units remain out of order. The failure rate of each subsystem is 1 in 2000 and working hours are 400. [8]

[3764]-148

Total No. of Questions : 12]

[Total No. of Pages : 4

P1514

[3764]-152
B.E. (Mechanical Engineering) (Sandwich)

INDUSTRIAL HYDRAULICS AND PNEUMATICS (2003 Course) (402062)


Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer any three questions from each section. 2) Answer to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator is allowed. 6) Assume suitable data if necessary.

SECTION - I Q1) a) b) c) Q2) a) b) c) Q3) a) b) List and explain in short eight applications of Hydraulics and Pneumatics. [8] What is the difference between static and dynamic seal? [4] Name and explain four types of materials used for seals. [4] OR What are the three most common reservoir designs? [6] What are the ways in which hydraulic fluid becomes contaminated?[6] Explain basic types of filtering methods. [4] What are the basic types of accumulator and explain the three significant accumulator-operating conditions? [6] A pump has overall efficiency of 0.87 and a flow rate of 45 lpm is to be used in a system that has a maximum operating pressure of 25,000 kPa. What input power required? [5] Explain Cavitation and Aeration phenomenon of Pumps. [5] OR Name the important consideration when selecting a pump for a particular fluid power application. [4] How can displacement be varied in an axial piston pump? [6] Explain Performance characteristics of positive displacement pumps and compare it with Performance characteristics of Centrifugal pump. [6]
P.T.O.

c) Q4) a) b) c)

Q5) a)

Draw symbols of the following fluid power components: i) ii) Gravity type accumulator. Variable displacement pump.

[9]

iii) Single acting cylinder with gravity return. iv) Double acting double rod intensifier. v) Sequence valve. vi) Pressure relief valve. vii) Check valve. viii) Duel pressure valve. ix) Shuttle valve. b) What is cartridge valve? What is the difference between slip-in and screw type cartridge valve? Explain benefits of using cartridge valve. [9] OR How does pressure reducing valve differ from a sequence valve in mechanical construction? [9] Explain in detail ways in which directional control valves may be actuated. [9] SECTION - II Q7) a) A cylinder with 100 mm bore rotates an 300 mm lever arm in a system with a maximum operating pressure of 17,500 kPa. Determine the maximum force fo the lever when the angel between the cylinder axis and the perpendicular of the lever arm is 55. What is the maximum torque of the lever arm at this instant? [8] Draw and explain motor breaking circuit. [8] OR Draw and explain circuit for riveting machine. [8] A hydraulic motor has a displacement of 164 cm3 and operates with a pressure of 70 bar and a speed of 200 rpm. If the actual flow rate consumed by the motor is 0.006 m3/s and the actual torque delivered by the motor is 170 N.m, find: [8] i) Volumetric efficiency. ii) Mechanical efficiency. iii) Overall efficiency. iv) The actual kW delivered by the motor.
2

Q6) a) b)

b) Q8) a) b)

[3764]-152

Q9) a)

A pneumatic cylinder is needed to press fit a pin to a hole. Design a circuit diagram with a precondition that while actuating, both the hands of the operator should be engaged. [8] Why is pneumatic control system termed as low cost automation? [8] OR Draw and explain: [8] i) Quick exhaust valve. ii) Time delay valve. Explain working of a typical filter regulator and lubricator (FRL) unit used in pneumatics with the help of a sketch. [8]

b) Q10)a)

b)

Q11)A machine tool cross slide is moved by means of a hydraulic system. The motion of the cylinder is as follows: a) b) Initially it moves through a distance of 150 mm against a load of 15 kN in about 4 seconds. It is followed by a working stroke of another 150 mm against an effective load of 25 kN. The feed rate during this part of the stroke is required to be 1m / min.

c) The load during return stroke is 15 kN. A meter-out type of circuit is used. Draw a circuit which will fulfill these requirements. Select different components used in the circuit from the data given. Mention ratings of components in case it is not available in the given data. [18] OR Q12)A 50 kN hydraulic press has a stroke of 1 m. The main ram is required to move down with a velocity of about 5 m/min. for first 80 cm against a negligible load. The ram is slowed down to a velocity of 2 m/min. for next 12cm against a load of 12 kN, followed by the working stroke of last 8 cm developing a maximum force of 50 kN. The cylinder is returned as quickly as possible and is to be held at the top most position. Draw a circuit which will fulfill these requirements. Select different components used in the circuit from the data given. Mention ratings of components in case it is not available in the given data. [18]

Y
[3764]-152 3

[3764]-152

Total No. of Questions : 12]

[Total No. of Pages : 6

P1319

[3764]-153 B.E. (Mech. Sand)


(2003 Course)

REFRIGERATION AND AIR CONDITIONING


Time : 3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answer 3 questions from Section-I and 3 questions from Section-II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) Discuss the advantages of air as a refrigerant in air-craft. Explain necessity of air-craft refrigeration. [8] b) Explain Regenerative air-refrigeration system. Compare it with simple system. [8] OR Q2) a) An air craft refrigeration plant has a capacity of 30 TR. The ambient temperature is 17C. The atm.air is compressed to 0.95 bar and 30C due to ram action. The air is then further compressed in a compressor to 4.75 bar and then is cooled in a heat exchanger to 67C. It then expands in a turbine to 1 bar before supply to the cabin. Air leaves the cabin at 27C. The isentropic efficiency of the compressor and the turbine are 0.9. Determine i) mass flow rate circulated/min ii) COP iii) power required. [12] b) Explain the term Ram Efficiency. Q3) a) What are limitations of air refrigeration system? [4] [4]

b) What is difference between retrofitting and drop in? What are the modifications made in R-12 system to make it suitable for HFC-134a refrigerant? [4]
P.T.O.

c) An ice production machine produces 20 tons of ice in 24 hours when water is supplied at 0C. The temperature range of the machine is -15C to 25C. The vapour leaves the compressor in dry and saturated conditions and there is no under-cooling in the condenser. If the actual C.O.P., is 75% of theoretical, find the power required of a compressor. The properties of NH3 used in machine as refrigerant are given below: Temperature C 25 -15 hf (kJ/kg) 100.4 -54.77 OR Q4) a) Discuss briefly the factors affecting the choice of refrigerants commonly used in refrigerating plants. [8] b) Explain the effect of various operating parameters on performance of vapour compression system. [8] Q5) a) What is necessity of multi staging? Explain the analysis of two stage compression system with flash gas chamber as a liquid subcooler. [8] b) A refrigeration system using R-12 as refrigerant has three evaporators of capacities 30TR at -10C, 20 TR at 5C and 10 TR at 10C. The refrigerant leaving the evaporator is dry and saturated. The system is provided with compound compression, individual expansion valves. The condenser temperature is 40C. Assuming isentropic compression in each compressor, find the power required to run the system and COP of the system when the liquid refrigerant leaving the condenser is saturated. [10] OR Q6) a) In a vapour absorption refrigeration system, the refrigeration temperature is -15C. The generator is operated by solar heat where the temperature reached is 110C, the temperature of heat sink is 55C. What is the maximum possible COP of the system? [6] b) Explain with neat sketch lithium bromide refrigeration system. [6] c) Explain with neat sketch Cascade refrigeration system. Why CO2 is a suitable refrigerant for this system? [6]
[3764]-153 -2-

sf (kJ/kg-K) 0.349 -0.214

hg (kJ/kg) 1324 1310 [8]

SECTION - II Q7) a) Prove Enthalpy of moist air (h) = cpm x Td + w x (hfg)at 0C Where cpm = humid specific heat, Td = DBT, w = humidity ratio, hfg is enthalpy of evaporation. [4] b) Sketch comfort chart and show on it the comfort zone. [6] c) The air at 40C DBT and 35% R.H. is passed through adiabatic humidifier and it comes out with 26.4C DBT and fully saturated. Find the quantity of water vapour added per kg of dry air. Assume air pressure = 1.013 bar. [6] OR Q8) a) State and explain the factors affecting human comfort. [4] b) What is the effective temperature? What are the factors that influence the optimum effective temperature? [4] c) Room air at 26C DBT and 50% RH is mixed with outdoor air at 35C DBT and 23C DPT in the ratio of 2:1. The mixture is passed through a cooling coil whose temperature is maintained constant at 10C whose by pass factor is 0.2. Determine the following: [8] i) Condition of air before entering the cooling coil, ii) Condition of air leaving the coil and iii) Refrigeration load on cooling coil when 250m 3/min of air is supplied to the room. Q9) a) Explain RSHF, GSHF, ERSHF with illustrations. b) Explain air-water air-conditioning system with neat sketch. OR Q10) a) List the various equipments used in an air conditioning system. Explain the function of each. [6] b) Explain the working of an automatic expansion valve. Why it is called constant pressure expansion valve? [6] c) Explain the procedure of charging of refrigerant in the system. [4] [10] [6]

[3764]-153

-3-

Q11) a) Explain pressure losses in duct. b) Discuss the methods for sizing of ducts.

[6] [4]

c) Derive an expression for the equivalent diameter of circular duct corresponding to a rectangular duct of sides a and b for the same pressure loss per unit length when i) the quantity of air passing through both the ducts is same, and ii) the velocity of air flowing through both the ducts is same. [8] OR Q12) a) Discuss limitation of vapour compression systems for the production of low temperature. What are the applications of low temperature? [8] b) Explain construction and working of Claude system liquefaction of gas. [10]

[3764]-153

-4-

[3764]-153

-5-

rrr
[3764]-153 -6-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1320

[3764]-156 B.E. (Mechanical S/W)


AUTOMOBILE ENGINEERING
(402063) (2003 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answer any 3 questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) State the specifications of any one vehicle. [8]

b) Explain with sketch the layout of four wheel driven automobile. What are its advantages and disadvantages over the conventional layout of automobile? [8] OR Q2) a) Discuss with sketch the construction and working of Centrifugal Clutch. [8] b) Discuss with sketch the construction, working and characteristics of Fluid Fly wheel. [8] Q3) a) Discuss with sketch the construction and working of synchromesh Gear Box. [8] b) Discuss the necessity of Gear Box in automobile with vehicle performance curves. [8]
P.T.O.

OR Q4) For typical motor car, the rolling resistance is given by 23N per 1000N, the air resistance by the expression 0.0827 V2, transmission efficiency 88% in top gear, car weighs 19934 N which fully loaded. Calculate a) The engine brake power required for a top speed of 144 km/hr. b) The acceleration in m/sec2 at vehicle speed of 48 km/hr, assuming the torque at 48 km/hr in the top gear is 25% more than at 144 km/hr. c) The engine power required to drive the car up a gradient of 1 in 5 at 48 km/hr, the transmission efficiency 80% in bottom gear. [16] Q5) a) Discuss with sketch the working of Torsion Bar Suspension System. What are its advantages/disadvantages as compared to other suspension systems? [8] b) Explain with sketch the working of Air Suspension System. What are its advantages/disadvantages as compared to Leaf Spring Suspension System in Buses? [10] OR Q6) Write short notes on any three: a) Coil spring suspension system. b) The causes and remedies for the trouble Leakage of oil from the Gear Box. c) Helper Spring. d) Preventive maintenance Vs Breakdown maintenance in automobile. [18]

[3764]-156

-2-

SECTION - II Q7) a) Give the requirements of road wheels? How the wheels and tyres designated? [8] b) What are the different types of steering gears used in steering system? Indicate their differences. [8] OR Q8) a) Explain briefly: i) ii) Tilting steering wheel. Collapsible steering column. [8]

b) Discuss the various tyre troubles, likely to be encountered during running of the vehicle, their causes and remedies. [8] Q9) a) What two actions takes place as the rear spring compresses and expand, in so far as the propeller shaft is concerned? What two devices are used to take care of these actions? [8] b) What are the purposes of fine drive? Explain. How can the gear ratio of a final drive be determined? Explain. [8] OR Q10) a) Give the principal and working of a differential. Explain them with help of figure. [8] b) Explain briefly construction and working of propeller shaft used in automobiles. State purpose of slip joint and universal joint adopted on it. [8] Q11) a) Sketch the cross section of battery used in automobiles, describe the function of components of it and explain operation of it. [8] b) Explain briefly overrunning clutch drive type of starting system used in automobiles. [5]
[3764]-156 -3-

c) SI Engine does not crank or cranks too slowly. What are the causes and remedies? Explain. [5] OR Q12) Write short note on the following (Any three) : a) Testing of lead acid battery. b) Wheel cylinder and its construction. c) Air-brake system. d) Trouble shooting and diagnosis of automotive systems. e) Electronic Ignition System. rrr [18]

[3764]-156

-4-

Total No. of Questions : 6]

[Total No. of Pages : 3

P1515

[3764]-158
B.E. (Mech. / SW)
INDUSTRIAL ENGINEERING (Elective - II) (2003 Course) (402065)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5) 6)

[Max. Marks : 100

Answer to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data if necessary and state it clearly. All questions are compulsory.

SECTION - I Q1) a) b) Define & explain the term Industrial Engineering. Mention the contribution made by F.W. Taylor to the field of IE. [7] Define Method study. Discuss in brief the various steps involved in method study. [9] OR a) b) Q2) a) b) Discuss in brief various recording techniques / charts used in method study. [8] What is Micro motion study? Give any eight Therbligs with its symbol.[8] State the objectives of Work Measurement. Mention the steps in making the Time study. [10] Following data refers to a sampling study of production of one job. i) ii) Duration of data collection = 5 days @ 8 hours per day. No. of workers = 20.

iii) Allowances given for process = 10%. iv) Quantity produced during study = 12000 pieces. v) Sampling data collected =
P.T.O.

As per given in the following table. Day No. of observations Occurrence of activity (working) 1 460 400 2 480 380 3 400 340 4 360 300 5 450 420

a) b) c) Q3) a) b)

Calculate standard time of production of Job if average performance ratings of the operator is 110% with entire work is manual. [8] OR Write short notes on i) PMTS. ii) WFS. [10] [4] [4] [8] Define & explain standard rating & standard performance. What are the advantages of work sampling over time study. Explain the scope of Ergonomics in Industrial Engineering.

Explain the concept of workplace design. What are the various factors affecting the process of design? [8] OR Explain the man-machine system with its characteristics. Explain the difference between ergonomics & anthropometry. SECTION - II [8] [8]

a) b)

Q4) a) b) c) a)

Define Operations Research. Mention the phases of OR. Describe any two special cases in graphical solution of LPP. Dual of Dual is primal itself - Explain. OR Solve, To Maximise s.t.

[8] [4] [4] [10]

10x1 + 20x2 5x1 + 3x2 30 3x1 + 6x2 36 2x1 + 5x2 20 x1, x2 0.

Use simplex.
[3764]-158 2

b) c) d) Q5) a) b) a) b) Q6) a) b) c)

Write the dual of the above problem.

[2]

Write the values of dual decision variables from primal simplex solution of the above problem. [2] Which is the redundant constraint in above problem? Why? [2]

Explain with suitable examples the relation between plant layout & selection of Material Handling system. [8] Discuss the characteristics of good plant layout. OR Describe the quantitative methods available for deciding the plant location. [8] State & explain the important principles of material handling. Discuss the various costs involved in Inventory Management. Describe ERP in manufacturing organisation. Explain in detail the procedure of ABC analysis. OR [8] [6] [6] [6] [18] [8]

Write short notes on- (any three): a) b) c) d) e) Job sequencing. Production scheduling. JIT & KANBAN. P & Q system of inventory management. Disaggregation of Aggregate plan.

[3764]-158

Total No. of Questions : 12]

[Total No. of Pages : 3

P1322

[3764]-173 B.E. (Production & Prod. S/W)


(2003 Course)

MANUFACTURING AUTOMATION AND CONTROL


Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answer any 3 questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary. [Max. Marks : 100

SECTION - I Q1) a) A single acting up stroking press having cylinder bore diameter of 350 mm and cycle time of 50 seconds has rapid approach of 200 mm in 8 sec. at 30 bars, pressing operation for 50 mm in 10 sec. at 300 bars and curing in 16 sec. Draw a suitable hydraulic circuit using accumulator and also calculate the size of accumulator and efficiency of circuit. The return is by gravity. [12] b) Explain with neat sketch the gear pump and also derive an expression for its flow. [6] OR Q2) a) Explain the procedure to design the reservoir used in hydraulic circuit. [10] b) Explain with neat sketch the circuit showing the application of deceleration valve. [8]

P.T.O.

Q3) a) A double acting cylinder is hooked up in the regenerative circuit. The relief valve setting is 100 bar. The piston area is 130 cm2 and the rod area is 65 cm2. If the pump flow is 95 l/min, find the cylinder speed and load carrying capacity for the extending and retracting stroke. [8] b) Draw a neat sketch and explain the working of sequencing circuit. [8] OR Q4) a) For a meter in hydraulic circuit, calculate the pump pressure required to achieve 50 bar pressure at full bore end of cylinder if the pressure loss across various elements is as below: Flow control valve = 12 bar, direction control valve (both side) = 4 bar, filter = 3 bar. [8] b) Sketch various types of cylinder mountings. [8]

Q5) a) Explain with neat sketch the construction and working principle of two stage air compressor. [8] b) Draw a pneumatic circuit showing the application of twin pressure valve and explain its working. [8] OR Q6) a) Explain the working of FRL unit used in pneumatic system. [8]

b) Draw a pneumatic circuit for a machine operated either by manual switch or automatic switch and to ensure that the work piece is properly clamped and door of the machine is not open. [8] SECTION - II Q7) a) What are factors required to be considered while selecting a microcontroller for a specific application? [8] b) Construct a ladder diagram for following Boolean equations: i) ii)
[3764]-173

[8]

y = (x1 + x2 ) (x3 + x4 )

y = x1 x2
-2-

OR Q8) a) Explain with neat sketch various components of PLC. [8]

b) Sketch the general architecture of microprocessor and explain the function of various parts. [8] Q9) a) Draw the neat sketches showing the control actions of various controllers and write the equations for their output. [10] b) What do you understand by accuracy and resolution of a digital to analog conversion? [6] OR Q10) a) Discuss the basic requirements of an interfacing circuit. b) Explain dual slope analog to digital converter. [8] [8]

Q11) a) Explain the effect of part population, effect of speed, and effect of number of reciprocating strokes on the feed rate in case of reciprocating fork feeder used in automated assembly systems. [12] b) Explain various transfer mechanisms used in automated systems. [6] OR Q12) Write short notes on: a) Centrifugal feeders. b) Robot configurations. c) Design for automated assembly. rrr [18]

[3764]-173

-3-

Total No. of Questions : 11]

[Total No. of Pages : 7

P1468

[3764]-175
B.E. (Production / Production S/W)
RELIABILITY ENGINEERING (411085)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5) 6) 7) Answer any 3 questions from each section.

[Max. Marks : 100

Question No. 11 is compulsory. Out of the remaining attempt 3 questions from section I and 2 questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. You are advised to attempt not more than 3 questions. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) A series of tests conducted under certain stipulated conditions on 800 electronic components. The total duration of tests is 15 hrs. The number of components that fail during each hourly interval is noted. The results obtained are tabulated as shown in table. Time (t) No. of failures 00 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 00 120 85 71 62 53 45 41 37 35 29 50 45 63 35 29

Based on the failure data or survival test results shown in table. Define & calculate failure density (fd) : failure rate (Z) and Reliability (R). [12] b) Q2) a) Explain with neat sketch different failure modes of Bath tub curve.[4] OR In order to test the strength of a new glue, ten similar structures constructed using the glue were subjected to a continuous vibratory load, and the duration of survival of each structure was noted, the values obtained the following: Specimen Number Hours of Survival 01 02 03 04 05 06 07 08 09 10 60 62 58 50 61 55 59 62 54 55 [6]
P.T.O.

Calculate the mean time to failures (MTTF) from this data.

b)

In a test involving continuous satisfactory performance of 110 electronic instruments under excessive vibration conditions, the following failure frequencies were observed, the total test period being 8 hrs. Time interval Number of failures 0-1 1-2 2-3 3 16 22 3-4 4-5 5-6 6-7 7-8 42 11 09 04 03 [6] [4]

Calculate the mean time to failures (MTTF) from this data. c) Q3) a) Define MTBF & MTTR.

The power required for the total operation is provided either from the mains or if the mains fail, from an auxiliary genset (or from an uninterrupted power supply unit). The cooling system consist of a compressor unit, a heat exchanger and an expander with coolant pipes. The compressor unit receives its power either from the mains or from the genset. The heat exchanger receives its water supply from one of the three alternative sources namely metro, overhead tank or sump and pump system. The pump is supplied power either from the mains or from the genset. The computer is not allowed to function if there is no supply of cold air. Construct a fault tree from Fig. 1. [8]

A) Genset. C) E) I) Compressor. Expander. Metro.

B) F) J)

Mains. Blower. Computer.

D) Heat exchanger. H) Overhead.

G) Sump Pump. K) Uninterrupted Power Supply.


[3764]-175 2

b)

For an emergency operation theatre in a hospital, the power is obtained from the main city supply through a transformer connected in series. To ensure an uninterrupted supply, an auxiliary generator is also connected with a suitable switch over. The probability of failure of the city supply is 0.01 and the transformer reliability is 0.996. The auxiliary power generator has a reliability factor of 0.99. Draw schematic diagram and block diagram for the system. Construct the fault tree and based on this calculate the reliability of the system. [8] OR Explain the concept of Techno-Physico Constraints with a conceptual system. [4] Construct fault tree and find system reliability of Fig. 2. [6]

Q4) a) b)

c)

Construct fault tree and find system reliability of Fig. 3.

[6]

[3764]-175

Q5) a) b)

What do you mean by the term redundancy? Explain active and passive redundancy. [6] For the system represented by Fig. 4. Calculate the reliability using tieset and cut-set methods. [6]

c)

Find the system reliability of the following series parallel configurations. Component reliabilities are given in Fig. 5. [6]

[3764]-175

OR Q6) a) Explain with sketch: i) ii) b) Series configuration. Mixed configuration. [6]

Find the system reliability of the given configurations. Component reliabilities are given in Fig. 6. [6]

c)

For the block diagram shown in the Fig. 7, write down the minimal tiesets and minimal cut-set. Using these, calculate the reliability of the system, assuming the elements to be independent and identical. [6]

[3764]-175

SECTION - II Q7) a) b) Differentiate between : Design FMEA and Process FMEA. Explain methodology of system analysis. [8] A company is planning to acquire a truck. Two makes of trucks are available in the market. The cost of garaging and the drivers wages are same for both. The other data on cost are provided in the table. Parameters Capital cost Annual Road Tax & Insurance Operating Cost a) fuel consumption b) oil consumption c) fuel cost d) oil cost Maintenance Cost a) service interval b) cost of service c) random breakdown d) cost of breakdown Expected life Every 5,000 km. Every 6,000 km. Rs. 4,000 Rs. 6,000 10 yrs. Rs. 2,000 Rs. 10,000 10 yrs. Every 8,000 km. Every 30,000 km. 20 km/lit. 2 lit/1000 km Rs. 4/lit. 20/lit. 24 km/lit. 2 lit/1500 km Rs.4/lit. 20/lit. Truck A Rs. 2 Lakhs Rs. 7,000 Truck B Rs. 3 Lakhs Rs. 8,000

Calculate annual maintenance cost for a period of 30,000 km & find out which truck is advantageous? [8] OR Q8) a) b) Explain mean, median and mode ranking method. [8] The following data refer to Mean time to failure of a equipment used in electric power house installation. No. of failure MTTF/MTBF (Hrs) 1 2 3 4 5 6 7 8 9

31.3 45.9 78.3 22.1 2.3 4.8 8.1 11.3 17.3

Plot the reliability against time using the method median statistics. How will values changes with mean statistics? [8]
[3764]-175 6

Q9) a)

Explain: i) ii) Inherent availability. Achieved availability.

[6]

iii) Operational availability. b) If two components having failure rates 1, 2 respectively are connected in parallel show that the Reliability of this parallel configuration at time t is given as. Rp(t) = e
1t + e 2t e( 1 + 2)t

[10]

OR Q10)a) b) Explain the term availability and maintainability of system. The following data have been collected at the plant: Mean time before failure = 60 hrs. Mean time to repair = 30 hrs. Administrative logistic time is 30% of Mean Down Time (MDT). Calculate the operational availability and inherent availability of the plant. [5] c) Explain different types of maintenance system. [5] [6]

Q11)Write short note on (Any 3): a) b) c) d) e) f) Tie-set & cut-set. Reliability - Quality & cost. Grouped, ungrouped and censored data. Logic gates. (RPN) Risk priority number in FMEA. Quality & safety.

[18]

[3764]-175

Total No. of Questions : 12]

[Total No. of Pages : 3

P1326

[3764]-178 B.E. (Production)

MATERIALS HANDLING TECHNOLOGY & EQUIPMENT DESIGN


(411085) (2003 Course) (Elective - I)
Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answer any 3 questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary. [Max. Marks : 100

SECTION - I UNIT - I Q1) a) Why is it necessary to develop material handling system or equipment in the organisation? Explain. [8] b) Explain basic storage methods and equipments used for material storage. [8] OR Q2) a) Explain Unit load concept. What are the different types of material handling equipment which can handle an unit load? [8] b) Explain the various factors are to be considered while selecting the material handling equipment. [8]

P.T.O.

UNIT - II Q3) Explain various principles of material handling. OR Q4) Explain the following with neat sketches: a) Line restricted Material handling system. b) Position restricted Material handling system. UNIT - III Q5) a) Explain the continuous loop conveyor system with proper flow diagram. State the important process parameters of the system. [10] b) Write short note on: i) ii) Wheel Conveyor. Fork lift truck. OR Q6) Write short note on: a) Types of Pallet. b) Roller Conveyor. c) Types of Cranes. SECTION - II UNIT - IV Q7) a) Explain hydraulic, pneumatic and electrical drives used to operate material handling system. [8] b) Explain in detail various design considerations of bulk material handling equipments. [8]
[3764]-178 -2-

[16]

[10] [6]

[4] [4]

[18]

OR Q8) a) Explain the different factors to be considered during automation of material handling system. [8] b) Explain robot assisted material handling system. UNIT - V Q9) a) Explain various types of AS/RS with their applications. b) Explain different types of AGVs and their applications. OR Q10) a) Explain various components and operating features of AS/RS system. [10] b) Write short note on: i) ii) Anti Collision System. Vehicle guidance technology in AGV. UNIT - VI Q11) Write short note on: a) Computer applications in material handling. b) Automatic Identification system. c) RFID. OR Q12) a) Explain different safety considerations while designing material handling system. [8] b) Explain with suitable illustration how productivity is improved with the use of material handling equipments. [8] rrr
[3764]-178 -3-

[8]

[10] [8]

[4] [4]

[6] [4] [6]

Total No. of Questions : 12]

[Total No. of Pages : 3

P1613

[3764]-182 B.E. (Production Engg.)


ROBOTICS
(411090) (Elective - II) (2003 Course)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

[Max. Marks : 100

Attempt Q1 or Q2, Q3 or Q4, Q5 or Q6 from Section-I and Q7 or Q8, Q9 or Q10, Q11 or Q12 from Section-II . Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks.

SECTION - I Q1) a) Explain the following terms associated with robot: i) ii) Robot Work Envelop. Accuracy. [8]

iii) Repeatability. iv) Payload capacity. b) Explain the six degrees of freedom associated with the manipulator. [8] OR Q2) a) Define Robot. Explain with time period the development process in each robot generation. [8] b) Find the worst spatial resolution of a spherical robot with 800 mm arm length. The robot is equipped with three encoders emitting 1200 pulses per revolution. The linear axis is actuated with the aid of 200 mm pitch lead screw having the encoder mounted on it. [8]

P.T.O.

Q3) a) For a pick and place type of robot, the link parameters table is given below: i i1 a i1 di i 1 2 0 90 0 0 0 2 30 0

3 0 3 0 90 Determine the location of the end point of the link 3 with respect to the base. [8] b) Explain the Inverse kinematics associated with planar 3R manipulator. [8] OR Q4) a) For a pick and place type of robot, the link parameters table is given below: i i1 a i1 di i 1 2 0 90 0 0 0 2 45 90

3 0 5 0 60 Determine the location of the end point of the link 3 with respect to the base. [8] b) Explain the forward kinematics associated with planar 3R Robot. [8] Q5) a) Describe Proximity and Range sensors used in robot. [8] b) The following data represent a 88 array of pixel. Each element in array indicates the gray level of pixel. 10 13 14 13 12 11 12 17 17 15 10 12 12 18 19 19 11 11 12 12 18 17 18 19 2 2 19 18 19 19 19 20 21 19 19 17 19 15 11 12 12 18 20 19 18 10 11 11 10 20 22 12 13 14 13 12 12 11 12 [10]

12 19 19 18 19 Convert it into black and white image.


[3764]-182 -2-

OR Q6) a) With neat sketch explain any two electro-mechanically actuated grippers. [8] b) Explain the concept of low vision and high vision associated with robot vision system. [10] SECTION - II Q7) a) Explain the various programming methods used in robots. b) Explain with neat sketch hydro-pneumatically actuated robot. OR Q8) a) Explain WAIT , DELAY, SIGNAL , DEPART commands. [8] b) Describe the structure of any robot programming language with example. [8] Q9) a) Explain the working of RS 232C interface. b) Describe the following applications of robot: i) ii) Spray painting. Machine loading and unloading. OR Q10) a) What is handshaking? Explain hardware handshaking of robot. b) What do you understand from robot economics? Q11) Write a note on: a) Walking robots. b) Safety measures in Robotics. OR Q12) Write a note on : a) Underwater robots. b) Robots used in mines. rrr
[3764]-182 -3-

[8] [8]

[8] [8]

[8] [8] [18]

[18]

Total No. of Questions : 12]

[Total No. of Pages : 2

P1332

[3764] - 185 B.E. (Production Engineering) ADVANCED PRODUCTION TECHNOLOGY (2003 Course) (Elective - II)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Attempt one question of each unit from Section-I and Section - II Answer to the questions should be written on separate books. Neat diagrams must be drawn wherever necessary. Assume suitable data, if required.

SECTION - I 1 ) a) b) 2 ) a) b) 3 ) a) b) 4 ) a) b) UNIT-I What are the key features of Toyotas strategy. [8] Explain in detail KANBAN system. [8] OR Differentiate Toyota production system and other production system.[8] Explain the concept of automation in TPS. [8] UNIT-II What is benchmarking? Explain its process. [8] What is performance of manufacturing? Explain the type of data and its collection for measuring the performance of manufacturing. [8] OR Explain the concept of business process re-engineering. [8] What is value stream mapping? Explain the importance of it in todays manufacturing system. [8] UNIT-III What is productivity? Explain different types of productivity in manufacturing industry and different ways for improving it. [9] Explain with suitable example how you will improve the productivity in small scale industry. [9] OR P.T.O.

5 ) a) b)

6) a) b)

Explain Productivity measurement tools. Explain the role of MBO in productivity measurement.

[9] [9]

7 ) a) b) 8) ) b) 9) ) b)

UNIT-IV Explain the concept of simulation in manufacturing industry. Explain how Artificial Intelligence is used in manufacturing. OR Explain how data collection will be done in expert system. With suitable example explain the use of simulation. UNIT-V What is System? Explain the basic concepts of system design. What is feasibility analysis? Explain why it is carried out.

[8] [8] [8] [8] [9] [9]

OR Q10) ) Explain the concept of product design based on design attributes. [9] b) What is systematic design? Explain the basic steps of it. [9] UNIT-VI Q11)a) Define the technology? Explain its characteristics. [8] b) What is innovation? Explain its importance for surviving the industry with suitable example. [8] OR Q12) ) Explain the role of technology management in todays manufacturing era. [8] b) Explain which factors to be considered for the change of technology. [8]

*****

[3764] - 185

-2-

Total No. of Questions : 6]

[Total No. of Pages : 7

P1591

[3764]-191 B.E. (Prod/SW)


(411126) (2003 Course)

OPERATIONS RESEARCH & MANAGEMENT


Time : 3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answers to the two sections should be written in separate answer books. 2) Figures (in bracket) to the right indicate full marks. 3) Assume suitable data, if necessary & state it clearly. 4) All units are compulsory. 5) Use of pocket calculator, log tables, stats tables, graph paper is allowed.

SECTION - I Unit - I Q1) a) Given - Minimize Zy = 30y1 + 36y2 + 20y3 S.t. 5y1 + 3y2 + 2y3 10 3y1 + 6y2 + 5y3 20 & y1, y2, y3 0 Write the dual form of above problem. [2] Solve this dual by Simplex Method. [8] Write also values of primal variables from above final simplex table.[2] What is the advantage of solving dual of above original primal problem? [2] In above dual, which is redundant constraint? Why? [2] For the above dual, do the RHS ranging for the first constraint. [2] OR Explain in brief the Methodology of OR. [6] A dairy firm has two milk plants with daily milk production of 6 million litres & 9 million litres respectively. Each day the firm must fulfil the needs of its three distribution centres which have milk requirement of 7, 5,& 3 million litres. Cost of shipping one million litres of milk from each plant to each distribution centre is given, in hundreds of rupees below. Formulate only the L.P. model to minimize the transportation cost, having only two variables. [7]
P.T.O.

b) c) d) e) f) a) b)

Plants 1 2 Demand

Distribution Centres 1 2 3 2 3 11 1 9 6 7 5 3

Supply 6 9 [5]

c) Explain in brief wrt LPP. i) Unrestricted variable. ii) Unbounded solution. iii) Basic solution. iv) Infeasibility. v) Degenerate solution. Unit - II

Q2) a) Write the LP form of transportation problem. [2] b) The captain of a cricket team has to allot five middle batting positions to five batsmen. The average runs scored by each batsman at these positions are as follows. Batting Positions Batsman I II III IV V P Q R S T i) 40 42 50 20 58 40 30 48 19 60 35 16 40 20 59 25 25 60 18 55 50 27 50 25 53

Find the assignment of batsmen to positions which would give the maximum number of runs. [5] ii) If another batsman U with the following average runs in batting positions as given below : Batting position - I II III IV V Average runs - 45 52 38 50 49 is added to the team, should he be included to play in the team? If so, who will be replaced by him? [7] c) What is degeneracy in transportation problem? [2]
[3764]-191 -2-

OR a) For square assignment problem, how many constraints are there in LP form? How many decision variables are there? What are the values of decision variables? While solving assignment problem by simplex, how many total variables are involved? [5] b) The following table shows all information about transportation problem, with cost figures in Rs. The shipping clerk has worked out schedule as: 12 units from A to Q, 1 unit from A to R, 9 units from A to S, 15 from B to R, 7 from C to P & 1 from C to R. Check the schedule of the clerk whether optimal or not, otherwise suggest the suitable schedule for minimum cost. [8] Market P Q R S Supply Ware house A 6 3 5 4 22 B 5 9 2 7 15 C 5 7 8 6 08 Demand 7 12 17 9 c) What are trans-shipment problems? How they are solved? Unit - III Q3) a) Find the optimal order quantity for a product when the annual demand is 500 units, the cost of storage per unit per year is 10% of the unit cost and ordering cost per order is Rs. 180. The unit costs are given below: Order Quantity Unit Cost 0 q < 500 Rs. 25.00 500 q < 1500 Rs. 24.80 1500 q < 3,000 Rs. 24.60 3,000 q Rs. 24.40 [10] b) Mention the costs involved in inventory control models & sketch the cost-quantity trade-off. [3] c) Mention any three optimality criteria in sequencing problems. [3] OR a) A manufacturing company processes 6 different jobs on two machines A & B. Number of units of each job and its processing times on A & B are given below. Find the optimum sequence, the total minimum elapsed time & idle time for both machines. [9]
[3764]-191 -3-

[3]

Job No. 1 2 3 4 5 6

No. of Units of each Job 3 4 2 5 2 3

Processing Time (min.) Machine A Machine B 5 8 16 7 6 11 3 5 9 7.5 6 14

b) A firm uses every year 12,000 units of raw material costing Rs. 1.25 per unit. Ordering cost is Rs. 15.00 per order and the holding cost is 5% per year of average inventory. i) Determine E.O.Q. & corresponding cost. [2] ii) The firm follows E.O.Q. purchasing policy. It operates for 300 days per year. Procurement time is 14 days and safety stock is 400 units. Find the reorder point, the maximum inventory and the average inventory. [3] iii) Sketch the inventory cycle you used in above problem. [2] SECTION - II Unit - IV Q4) a) State the advantages & limitations of simulation. [6] b) The occurance of rain in a city on a day is dependent upon whether or not it rained on the previous day. If it is rained on the previous day, the rain distribution is as Event - No rain 1 cm rain 2 cm rain 3 cm rain 4 cm rain 5 cm rain p 0.50 0.25 0.15 0.05 0.03 0.02 If it did not rain the previous day, rain distribution is as Event - No rain 1 cm 2 cm 3 cm p 0.75 0.15 0.06 0.04 Simulate the citys whether for 10 days and determine by simulation the total days without rain as well as the total rainfall during the period. Random Nos. :- 67, 63, 39, 55, 29, 78, 70, 06, 78, 76. [12]

[3764]-191

-4-

OR a) A taxi owner estimates from his past records that the cost/year for operating a taxi whose purchase price when new is Rs. 60,000 is as Age 1 2 3 4 5 Operating cost (Rs.) 10,000 12,000 15,000 18,000 20,000

After 5 years, the operating cost = 6000 K, where K = 6, 7, 10 (K is the age in years). If resale value decrease by 10% of purchase price each year, what is the best replacement policity? Cost of money is zero. [6] b) The following rates have been observed for certain items. End of month p (failure) 1 0.10 2 0.30 3 0.55 4 0.85 5 1.00

The cost of replacing an individual item is Rs. 1.25. The decision is made to replace all the items simultaneously at fixed interval and also to replace individual items as they fail. If the cost of group replacement is 50 paise, what is the best interval of group replacement? At what group replacements price per item, would a policity of strictly individual replacement become preferrable to the adopted policy? Assume that the items failing during a month are replaced at the end of the month & there are 1000 items in use. [12] Unit - V Q5) a) Explain Kendalls notation for representing queing models. [6] b) Goods trucks arrive randomly at a stockyard with a mean of 8 trucks/ hour. A crew of four operatives can unload a truck in 6 minutes. Trucks waiting in queue to be unloaded are paid a waiting charge at the rate of Rs. 60/hour. Operatives are paid a wage rate of Rs. 20/hour. It is possible to increase the number of crews to 2 or 3 (of four operatives per crew). When the unloading time will be 4 minutes or 3 minutes respectively per truck. Find the optimal crew size. [8] c) Define Row & Column Dominance. OR [2]

[3764]-191

-5-

a) In a small town there are only two stores. ABC & XYZ that handle sundry goods. The total number of customers is equally divided between the two, because price & quality of goods sold are equal. Both stores plan to run yearly pre-Natal sales during the 1st week of December. Sales are advertised through a local news paper/radio and cable TV. With the aid of an advertising agency, store ABC constructed a game matrix given below. (figures in matrix represent a gain or loss of market share). Strategies of XYZ Newspaper NP Strategies of ABC R. TV 30 0 90 Radio 40 15 20 TV 80 20 50

Determine optimal strategies for both ABC & XYZ & value of game.[9] b) For the following 2 2, game without saddle point, find the optimal mixed strategies & value of the game. [7] Unit - VI Q6) a) A small project has the following data to offer. Activity time Optimistic Pessimistic i) (weeks) Most likely 1-2 1-3 1-4 2-5 3-5 4-6 5-6 1 1 7 1 4 7 2 2 8 1 1 1 2 5 14 2 5 8 3 6 15

Draw the network, identity expected duration of project & critical path. [4] ii) What is the probability that the project will be completed 4 weeks latter that expected? [2] iii) What is the expected duration for 75% chance of project completion? [2] iv) Which activities will cause more uncertainity in meeting the due date of project? Why? [2]
-6-

[3764]-191

b) Explain in brief. i) ii) Earliest start & Earliest finish time for activity. Latest start & Latest finish time for activity. OR a) A small project has following data. Activity Time Normal

[6]

iii) Total & Free float.

1-2 1-3 1-4 2-4 2-5 3-6 4-6 5-6 6 4 8 4 5 3 3 3 5 3 12 8 8 5 6 6 -

(days) Crash

Cost penalty / day (Rs.)

2400 2700 1500

1200 6000 1500

The cost of completing all activities in normal time is Rs. 1,74,000/without over heads. The overhead cost is Rs. 4,800 per day. i) ii) Identity critical path for project completion, find out normal duration and the corresponding cost for project. [4] Find out optimum duration & minimum cost of the project. [4] [4]

iii) Find out minimum duration & corresponding cost of project.[4] b) Explain briefly. (any two) i) ii) Significance of slack. 0.67 0.25 rrr 1.00 0.16 1.33 2.00 +1.645 0.95 Earliest occurrence & latest allowable occurrence time for event.

iii) Dummy activity. Given Data : Z = 0.50 p = 0.3085 0.0918 0.028

[3764]-191

-7-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1335

[3764]-195 B.E. (Production S/W)


DIE AND MOULD DESIGN
(411122) (2003 Course) (Elective - I)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) From Section-I solve Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6, and from SectionII solve Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12. 2) Answers to the two sections should be written in separate answer book. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I UNIT - I Q1) a) Explain briefly the theories of plastic yielding. b) Explain defects their causes and remedies in rolling. OR Q2) a) Explain the following. i) ii) CCD. Shape Factor. [8] [8] [8]

iii) Porthole dies. iv) Hookers Process. b) Derive the equation for drawing stress developed during operation.[8] UNIT - II Q3) a) What is OBI? Explain its working with merits and demerits. [8] b) How presses are classified on the basis of frame? Explain with neat sketch. [8]
P.T.O.

OR Q4) a) Explain difference between compound and combination die with neat sketch. [8] b) What is strip layout? What factor should be considered for drawing strip layout? And what are the different types of strip layout? [8] UNIT - III Q5) Design a blanking die for the component shown in Figure 1. a) Draw strip layout and find out material utilization. b) Find out press tonnage with full shear. c) Design blanking die and draw the same. d) Draw neat sketch of press tool. [4] [4] [4] [6]

OR Q6) Design a progressive die for the component shown in Figure 2. Given: Stock thickness = 1 mm, Shear strength of material = 198 MPa. a) Draw best strip layout and find material utilization. [4] b) Find out press tonnage with staggering for above layout. [4] c) Design and draw die block. [4] d) Draw assembly drawing. [6]

[3764]-195

-2-

SECTION - II UNIT - IV Q7) Explain the following. a) Isothermal forging and its advantages. b) Upsetting c) Forgability OR Q8) Explain the following. a) Effect of grain flow lines in forging. b) Powder forging. c) Orbital forging. UNIT - V Q9) Explain with neat sketch: a) Transfer moulding. b) Blow moulding. c) Injection moulding for thermoplastics. OR Q10) a) Explain difference between thermosetting plastic and thermoforming plastic. [8] b) How injection moulding machines are specified? [8] [16] [16] [16]

Q11) Design an integer injection mould for the component shown in fig. 3. [18]

[3764]-195

-3-

OR Q12) a) What is bolster? What are their functions? Explain different types of bolster with neat sketch. [10] b) Explain any four types of gate with neat sketch. rrr [8]

[3764]-195

-4-

Total No. of Questions : 8]

[Total No. of Pages : 2

P1469

[3764]-196
B.E. (Prod / SW)
ADVANCE PRODUCTION TECHNIQUES (Elective - I) (2003 Course) (411122)

Time : 3 Hours] Instructions to the candidates : 1) 2)

[Max. Marks : 100

Answers to the two sections should be written in separate books. Solve any three questions from both sections.

SECTION - I Q1) Write the basic frame-work for Toyota Production System. Explain the different systems in TPS & methods used in TPS. [16] Q2) a) b) Explain the Business Process Reengineering term with its need in competitive manufacturing system. [8] Define & explain in brief Bench-marking. Mention only its benefits, levels & types. [8] Explain the various ways to improve Hard & Soft factors in productivity. [8] Explain with the help for schematic diagrams SMED. [8] [18]

Q3) a) b)

Q4) Write short notes on (Any three): a) Role of JIT in TPS. b) KANBAN. c) Role of Information Technology in BPR. d) ILO approach for productivity improvement. SECTION - II Q5) a) b)

Define simulation. Explain the steps involved in simulation study.[8] Define the term Artificial Intelligence. Also list the task domains of AI with explanation. [8]
P.T.O.

Q6) a) b) Q7) a) b)

Explain the scientific method & design method. Also explain problem solving methodology which is usefull in design. [8] Explain the Morphology of Design with suitable diagram. [8]

Define in brief the term Transfer of Technology with its model, methods and scope. [8] Explain in brief each element of strategic considerations of Management of Technology. [8] [18]

Q8) Write short notes on (Any three): a) b) c) d) Simulation packages. Propositional logic & Predicate logic. Product Design specifications. Historical background of Management of Technology.

[3764] - 196

Total No. of Questions : 6]

[Total No. of Pages : 2

P1336

[3764] - 198 B.E. (Production / Sw) SUPPLY CHAIN MANAGEMENT (2003 Course) (411125) (Elective)
[Max. Marks : 100

Time : 3 Hours] Instructions: 1) 2) 3) 4) 5) 6)

Answers to the two sections should be written in separate answer books. Neat diagrams must be drawn wherever necessary. figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary. All questions are compulsory.

SECTION - I 1) a) b) a) b) 2 ) a) b) Identify cycles and push-pull boundary in supply chain when you are purchasing NOKIA cell phone from a shop in your city. [9] Discuss the phases in decision in supply chain. [8] OR List the drivers affecting the supply chain performance and discuss in brief the obstacles in achieving the performance. [9] Discuss the role of sourcing in supply chain and list the sourcing related metrics (performance measures). [8] Discuss the steps involved in forecasting the demand. [7] Discuss aggregate planning problems. Which type of information is needed to aggregate planner? Which decisions are based on this information?[10] OR By managing capacity and inventory, how the firm can control the supply? [7] What is adaptive fore casting? Discuss in brief steps involved in it. [6] Katraj Milkbooth has experienced weekly demand of milk of 120,127,114and 122 liters overlost four days. Forecast the demand for period 5 (5th day) using four-period moving average. What is the forecast error if the demand in period 5 turns out tobe 125 liters? [4] P.T.O.

a) b) c)

3) a) b) a) b)

When the quantity discounts are justified in supply chain? Differentiate between lotsize based and volume based quantity discounts. [8] Discuss the role of safety inventory in supply chain How the appropriate level of safety inventory is decided? [8] OR What is the product availability? How it is measured? Describe the two types of replenishment policies. [8] How the postponement of product differentiation can be used to improve supply chain profitability. [8]

4 ) a) b)

) b) 5) ) b) ) b) 6) ) b)

Discuss the role of transportation in SC Network Mention the various modes of transportation with their strengths and weakness. [9] Discuss various options available for designing the transportation Network. [8] OR Discuss the importance of information and IT in supply chain. [9] Discuss the role of IT in forecasting and in inventory management. [8] What is bull whip effect and how does it relate to luck of co-ordination in SC? [8] What are different CPFR scenerios and how they benifit SC partners?[9] OR How the design of distribution network in various types of industry has been affected due to evolution of E-business? [8] Discuss the actions taken by manager to overcome the obstacles and to achieve co-ordination in supply chain. [9] Discuss the role and importance of revenue management in SC? [8] Mention the ideas considered by managers to make better Network design decisions under uncertainity. [8] OR Discuss - changing the distribution network affects the supply chain cost. [8] What is a Decision Tree? Summarise the basic steps in decision tree analysis. [8]

) b)

*****
-2-

[3764] - 198

Total No. of Questions : 6]

[Total No. of Pages : 2

P1516

[3764]-200
B.E. (Production / S/W)
PROJECT MANAGEMENT (411125) (2003 Course)

Time : 3 Hours] [Max. Marks :100 Instructions to candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) Define project. Explain with suitable example difference between standard routine Production and Projects. [12] b) Explain in detail various aspects of completion of Project. [4] OR Explain differences in projects under private, public & joint sector. [16] Why Modernization and replacement is required in projects? What are the considerations involved in decision making? [14] Explain the term diversification. [2]

Q2) a) b)

OR For the automobile company producing cars explain following aspects involved. [16] a) c) Q3) a) b) Balancing. Replacement. b) d) Modernization. Expansion.

Explain in detail various steps in Project formulation involving importsubstitution projects. [14] What are the methods of formulating budgeting in projects. [4] OR
P.T.O.

Write short notes on following: a) Pre-investment decisions in project. b) Incentives from government for import-substitution. c) Project feasibility report formulation. SECTION - II Q4) a) b) a) Explain various sources for raising finance? Explain impact of local & foreign investment in raising projects. OR Explain Project Appraisal for following aspects: i) ii) b) Techno-commercial. Financial discounted cashflow.

[18]

[12] [4] [12]

How the rate of Return on investment is calculated? Explain socioeconomic cost-benefit analysis. [4] [16]

Q5) Explain formulation of Project costing for a) b) c) Cost of contracting. Labor & Equipment costs. Development & Codification of cost - data. OR

Explain the accounting procedures involving Activity - Based Costing in detail. [16] Q6) a) b) Explain Project Administration involving cash - flow planning. Write a note on Project Scheduling. OR Write a short note on any three: a) c) PERT. GANTT charts. b) d) CPM. Project overruns costs. [18] [12] [6]

Y
[3764]-200 2

Total No. of Questions : 12]

[Total No. of Pages : 3

P1470

[3764]-205
B.E. (Electrical)
ROBOTICS & AUTOMATION (Elective - I) (2003 Course)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5) 6) 7) Answer three questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Your answers will be valued as a whole. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Write the RIA definition of Robot and explain clearly the operational features of industrial robots which make them different from fixed automation. [8] With the help of a neat diagram, explain the basic components of a typical robotic system. [8] OR Q2) a) b) With the help of a neat diagram explain the concept of CNC machine. Differentiate CNC machine from a robot system. [8] Write a note on: i) ii) Prosteses. Telecherics. [18] b) d) f) OR
P.T.O.

b)

[8]

Q3) Explain the following terms: a) c) e) Work envelope. Degrees of freedom. Compliance. Spatial Resolution. Roll, pitch, yaw. Repeatability.

Q4) a) b) c)

Compare hydraulic drives with electrical drives for robotic applications. [6] Explain the concept of servocontrolled and non-servo controlled robots. [8] Draw work envelopes for i) Cylindrical robot. ii) Cartesian robot. [8] [8] [4]

Q5) a) b)

Explain the methods for rotary to rotary motion conversion. Explain working of the following types of grippers. i) Vacuum type. OR ii) Magnetic type.

Q6) a) b)

Explain the concept of Lagrangian and how it can be used for deriving dynamic equations for a typical revolute joint. [10] With the help of a neat diagram explain the working of harmonic drive.[6] SECTION - II

Q7) a) b)

Draw a neat diagram of Stanford Robot explaining the degrees of freedom. Also show all the co-ordinate frames attached to the robot.[10] The co-ordinates of a point are (2, 2, 0) w.r.t. a movable cartesian frame OUVW. Find the co-ordinates of the point w.r.t. the fixed cartesian frame OXYZ if the movable frame is obtained by a rotation of 60 about the Z axis followed by a translation of 5 units along the rotated V axis. [6] OR With the help of a neat diagram, define all D-H parameters. [8]

Q8) a) b)

In a three axis RRR robotic arm, the shoulder joint is arranged on the axis of a rotary base and the axes of rotation of shoulder and elbow joints are parallel to each other. The D-H parameter table for the arm is given below: Link 1 2 3 ai 0 a2 a3 i 90 0 0 di 0 d2 0 i 1 2 3

Draw the diagram showing the link co-ordinate system and link parameters. [8]
[3764]-205 2

Q9) a)

Given the transformation between the wrist and the base of a 4DOF RPPR manipulator as [10] c1c 4 s1c4 s Tsym = 4 0 where c1 = cos Determine
1, 1

c1s 4 s1s4 c 4 0

s1 c1 0 0
1

d 3s1 + 5c 1 d3 c1 + 5s1 d2 1 c4 = cos


4

s1 = sin
4

and s4 = sin

d2, d3,

if T is expressed numerically as

0 . 2 5 0 . 4 3 3 0.866 89.10 0.433 0.75 0.5 45.67 Tnum = . 0.866 0 . 5 0 50 0 0 0 1 b) Write a short note on the following robotic applications. i) Q10)a) Spray painting. OR Explain with the help of a neat diagram, the concept of inverse kinematics. Explain following methods for the solution of inverse kinemics. [12] i) ii) b) Q11)a) b) Direct method. Geometric method with coordinate transformation. ii) Part sorting. [8]

iii) Manipulation of symbolic T & A matrices. Explain in details how robots can be used for welding application. [6] Derive an expression for a differential rotation rot (k, d ). What are the assumptions in the derivation? [8] Explain Resolved Motion Position Control (RMPC) for controlling robot manipulator. [8] OR Explain the concept of manipulator jacobean, jacobean inverse and singularities in brief. [8] Discuss any two robot programming languages. [8] Y
[3764]-205 3

Q12)a) b)

Total No. of Questions : 12]

[Total No. of Pages : 2

P1471

[3764]-208
B.E. (Electrical Engg.) (Sem. - II)
PROJECT MANAGEMENT (Elective - I) (2003 Course) (403143) (Theory)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4)

[Max. Marks : 100

Section I & Section II should be solved on separate answer sheets. Solve 3 questions from Section I & 3 Questions from Section II. Figures to the right indicate maximum marks for the respective questions. Use of scientific calculator is allowed.

SECTION - I Q1) Elaborate the Need of Project Management? State its characteristics in Detail? [16] OR Q2) Write short notes: a) b) c) Project Life Cycle. Project Appraisal. Types of Project Organisation. [6] [5] [5]

Q3) Write short notes: a) b) c) Project selection. Costs Associated with Project. Return on Investment (ROI). OR Q4) Explain various causes of Project failure. Q5) Write short notes: a) b) c) Critical Path Method (CPM). Programme Evaluation & Review Technique (PERT). Graphical Evaluation & Review Technique (GERT). [6] [6] [6]
P.T.O.

[6] [5] [5] [16]

OR Q6) Write short notes: a) b) c) Gantt chart. Activity on Arrow Diagram (AOA). Activity on mode (AON). SECTION - II Q7) Define Material Management? Explain its functions & objectives? OR Q8) Write short notes: a) b) c) Purchase cycle. 5 Rs of Purchasing. Vendor Rating. [6] [5] [5] [16] [6] [6] [6]

Q9) Write short notes: a) b) c) Selective Control of Inventories. E.O.Q. with discounts. Inventory of Finished goods. OR Q10)Explain the Meaning & Importance of stores Management in detail. [16] [6] [5] [5]

Q11)What do you mean by Tendering? Explain its importance? Explain various Types of Tenders with suitable examples. [18] OR Q12)Write short notes: a) b) c) Risk management. Adjusted discount rate Method of Risk. Capital Asset Pricing Model (CAPM). [6] [6] [6]

Y
[3764]-208 2

Total No. of Questions : 6]

[Total No. of Pages : 3

P1576

[3764]-210
B.E. (Electrical)
ENERGY MANAGEMENT (403147) (2003 Course)

Time : 3 Hours] [Max. Marks :100 Instructions to candidates : 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data, if necessary.

SECTION - I Q1) a) Explain in detail various energy sources with examples: i) Commercial and non-commercial energy. [8]

b)

a) b) Q2) a) b) a) b)

ii) Primary and secondary energy. Explain the term Energy Security and importance of Energy conservation from Energy Security point of view. [8] OR Explain various provisions of Electricity Act 2003. [8] Explain in detail long term policies of Government of India. [8]

Explain supply side and demand side management with their advantages and disadvantages. [10] Explain TOD and ABT tariff and its impact on Energy management.[6] OR Explain Energy Management term and structure of energy management group. [8] Explain responsibility of Energy Manager as per Energy Conservation Act 2001. [8]
P.T.O.

Q3) a)

Explain following techniques: i) Sankey diagram. ii) Cusum technique. Explain various instruments used to carry out Energy Audit. OR Explain step wise procedure to carry out detailed Energy Audit. Explain objectives of Preliminary Energy Audit. SECTION - II

[10]

b) a) b)

[8] [10] [8]

Q4) a)

Explain following financial analysis techniques with advantages and disadvantages. i) ii) Simple pay back period. Return on Investment. [8]

b)

Calculate simple payback period and % Return on Investment (% ROI) for a waste heat recovery system that cost Rs. 50 lakhs and Rs. 2.5 lakhs per year on average to maintain and operate and is expected to save annually Rs. 15.00 lakh. Please comment based on ROI whether to implement the project. [10] OR Explain Net present value method and time value of money. [6]

a) b)

Using the Net present analysis technique evaluate the financial merit of proposed project shown in table below. Consider an annual discount rate of 7.5% for each project. [12] Project I Capital Cost (Rs.) Year 1 2 3 4 5 6 7 Rs. 1,00,000.00 Net Annual Saving (Rs.) + 9,500 + 9,500 + 9,500 + 9,500 + 9,500 + 9,500 + 9,500
2

Project II Rs. 1,00,000.00 Net Annual Saving (Rs.) + 10,000 + 8,500 + 8,500 + 8,200 + 8,000 + 7,500 + 7,000

[3764]-210

Q5) a) b)

Explain various Energy conservation opportunities in Heating, Ventilation and Air conditioning. [8] Explain with advantages and disadvantages of various cycles of cogeneration. [8] OR Explain various heat recovery systems used in Boiler. [8]

a) b)

Explain various Energy Conservation opportunities in pumping system. [8]

Q6) Explain Energy audit case studies in following sector with various energy saving opportunities: [16] a) b) Steel Industry. IT Industry. OR Explain Energy audit case studies in following sector with various energy saving opportunities. [16] a) b) T & D sector. Agricultural sector.

[3764]-210

Total No. of Questions : 12]

[Total No. of Pages : 3

P1344

[3764]-214
B.E. (Electrical)
HIGH VOLTAGE ENGINEERING (403150) (2003 Course) (Elective - II)

Time : 3 Hours] [Max. Marks :100 Instructions to the candidates : 1) Answer any THREE questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed.

SECTION - I Q1) a) Explain the term Ionisation. With reference to breakdown in gases, discuss the following ionization processes. [9] i) Ionisation by Collision. ii) Photo - ionisation and

iii) Secondary ionisation. b) Define Townsends first and second ionisation coefficients. How is the condition for breakdown obtained in a Townsend discharge? [7] OR Q2) a) b) What is Paschens law? How do you account for the minimum voltage for breakdown under a given p d condition? [8] What will the breakdown strength of air be for small gaps (0.2 cm) and large gaps (10 cm) under uniform field conditions and standard atmospheric conditions? [8]

Q3) a)

With reference to conduction and breakdown in commercial liquids explain: [9] i) ii) Suspended Particle Mechanism. Cavitation and Bubble Mechanism.
P.T.O.

iii) Stressed oil volume Mechanism.

b)

Draw a neat sketch of Liquid purification system with test cell and discuss function of i) ii) Distilation column. Cooling Tower.

iii) Filter. iv) Reservoir. v) Vacuum pump and [9]

vi) Test cell with electrodes. OR Q4) a) b)

What is a composite dielectric and what are its properties? Describe the mechanism of short term breakdown of composite insulation. [9] What do you understand by intrinsic strength of a solid dielectric? How does breakdown occur due to electrons in a solid dielectric? [9]

Q5) a) b)

What are the causes for switching and power frequency overvoltages? How are they controlled in power systems? [8] What are the mechanisms by which lightning strokes develop and induce overvoltages on overhead power lines? [8] OR

Q6) a) b)

Explain the different aspects of insulation design and insulation co-ordination adopted for EHV systems. [10] How are the protective devices chosen for optimal insulation level in a power system? [6] SECTION - II

Q7) a) b)

Describe, with a neat sketch, the working of a Vande Graaff generator. What are the factors that limit the maximum voltage obtained? [8] Describe, with a neat sketch, the working of a 3-stage cascade transformer for producing very high a.c. voltages. [8] OR

[3764]-214

Q8) a)

An impulse generator has eight stages with each condenser rated for 0.16 Micro Farad and 125 kV. The load capacitor available is 1000 pico Farad. Find the series resistance and damping resistance needed to produce 1.2 / 50 Microseconds impulse wave. [10] Describe, with a neat sketch, the working of a trigatron gap? [6]

b) Q9) a)

Describe, with a neat sketch, the principle and construction of an electrostatic voltmeter for very high voltages. What are its merits and demerits for high voltage a.c. measurements? [8] Describe, with a neat sketch, the basic circuit for measuring the peak voltages of impulse voltage. [8] OR Describe, with a neat sketch, the principle of operation of Hall generator for measuring high d.c. currents. [8] Explain how a sphere gap can be used to measure the peak value of voltages. What are the parameters and factors that influence such voltage measurements? [8] What are the different power frequency tests done on insulators? Mention the procedure for testing. [9] Explain the method of impulse testing of high voltage transformers. What is the procedure adopted for locating the failure? [9] OR Explain the partial discharge tests on high voltage cables. How is a fault in the insulation located in this test? [9] What is an operating duty cycle test on surge diverter? Why is it more significant than other tests? [9]

b)

Q10)a) b)

Q11)a) b)

Q12)a) b)

[3764]-214

Total No. of Questions : 12]

[Total No. of Pages : 3

P1472

[3764]-221
B.E. (E & TC)
COMPUTER NETWORKS (2003 Course) (404214)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6)

[Max. Marks : 100

Answer 3 questions from Section I and 3 questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Q2) a) b) c) What are the design issues for the layers? What is acknowledged Datagram? What is unreliable datagram? Explain Host, Subnet, Service primitives, CSMA/CA technique. OR Explain mesh topology and its applications. What is extended Star topology. [4] Explain Broadcasting and Multicasting in Networks. [4] Explain Cut through and Store-forward modes in layer-2 switch. Show the position of Repeater, Bridge, Router and Application gateway wrt ISO - OSI reference model. [8] Draw & Explain the setup required & steps required for establishing internet communication using Dial up modem. [4] Explain Circuit Switching Vs Packet Switching. [4] What is ADSL technology? Also define VDSL, HDSL, SDSL, & DSLAM. [8] [4] [4] [8]

Q3) a) b) c)

P.T.O.

OR Q4) a) b) c) Draw and Explain typical cable TV system. How cable video signal and Internet data can be send over the same cable. [4] Compare LEO Vs MEO Vs GEO. [4] Explain Nyquist theorem and Shanon capacity theorem. What are different line codes used in Ethernet, Fast Ethernet & Gigabit Ethernet communication. [8] Explain Go-back-N and Selective repeat techniques. What is the concept of Window size. [6] Explain Aloha, CSMA/CD & CSMA/CA briefly. Explain the DQDB system Vs LAN system. OR Q6) a) b) c) Explain any one collision free protocol? What is full duplex switched Ethernet? [6] Explain the Gigabit Ethernet system and its requirements in detail. [6] Draw frame formats of IEEE 802.3 and IEEE 802.5. Also draw the connection between IEEE 802.3 and IEEE 802.5 networks through suitable device. [6] SECTION - II Q7) a) b) Explain Distance vector routing algorithm & Link state routing algorithm. [8] Consider a TCP connection is transferring a file of 7000 bytes. The first byte is numbered 11001, what are the sequence numbers for each segment if data are sent in five segments, each carrying 1000 bytes? [4] Draw and explain the TCP header in detail. OR Q8) a) b) c) Draw and explain the IP header in detail. What is fragmentation? Explain with example. [8] Draw and explain the UDP header in detail, list the different TCP port addresses used in Internet communication. [4] What is network congestion? What are the reasons? How one can overcome it? [4]
2

Q5) a) b) c)

[6] [6]

c)

[4]

[3764]-221

Q9) a) b) c)

Explain the RSA algorithm with example. Also explain the DES algorithm briefly. [8] What are the types of firewall? How proxy server acts as Firewall? [4] Compare public key Vs private key cryptography? What is passive and active intruder? [4] OR Draw & Explain the Local client communicating with Google.com website through college proxy server without college DNS server installed in college Campus LAN. Also explain the component of DNS System. [8] What is sockets address? Write Socket address of web server for PRIVATE IP addresses in class - B & class-D IP version-4 addresses. [4] Write a simple HTML program to host your own web page on Local web server as index.html or home.html. [4] Draw & Explain the use of port 20 and port 21 in FTP communication between system-A and system-B connected via layer-2 switch in LAN environment. Compare FTP and TFTP briefly. [6] Role of SMTP in Email System? What are SNMP components? [6] What are multicasting applications? Write details of the respective protocol? [6] OR Draw & Explain the DHCP set-up among 7(Seven) computer systems on LAN using layer-2 CISCO switch. Consider Class-A private IP version-4 addresses are to be allocated. Explain importance of Traceroute utility in Internet communications? [6] Explain the IPV-6 specialities about jumbogram, address range & Fragmentation. Also explain the details of service field in IPV - 4 header. [6] Explain the role of NFS and RPC in TCP/IP communication specially in LAN environment. [6]

Q10)a)

b) c)

Q11)a)

b) c)

Q12)a)

b)

c)

Y
[3764]-221 3

Total No. of Questions : 12]

[Total No. of Pages : 3

P1473

[3764]-222 B.E. (E&TC)


VOICE NETWORKS (404215) (2003 Course)
[Max. Marks : 100

Time : 3 Hours]

Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Assume suitable data, if necessary.

SECTION - I Q1) a) Explain in detail various subscriber loop signaling systems used in Telephone Switching. [8] b) Describe role of redundancy in Stored Program Control Electronics Switching systems. How it is achieved in its different configuration?[6] c) Enlist four distinct points between Singlestage and Multistage network.[4] OR Q2) a) Describe with necessary diagram the working of Time multiplexed space switch. Calculate the number of trunks that can be supported on a time multiplexed space Switch, given that [8] i) 64 channels are multiplexed in each stream. ii) Control memory access time is 50 ns. iii) Bus switching and transfer time is 50 ns per transfer. b) List at least six differences between the postal and telephone systems and bring out the analogy between S&F and circuit switched connections. [6] c) What are the differences between common control and direct control? [4] Q3) a) Explain typical traffic distribution for central processors and peripheral processors. [8] b) A call processor in an exchange requires 100 ms to service a complete call. What is the BHCA rating for the processor? If the exchange is capable of carrying 800 E of traffic, what is the call completion rate? Assume an average call holding time of three minutes. [8]
P.T.O.

OR Q4) a) Explain the Service Level for telecommunication traffic. How Traffic usage is defined? [8] b) State and explain Erlang B and Poissons formula. A trunk accumulated 0.75 Erlangs of usage while 9 calls were carried in a hour with no overflow. What is the average holding time per call in seconds, CCS and Erlangs? [8] Q5) a) Describe in detail transmission structure of ISDN. [8]

b) Draw ISDN reference points and Functional groupings model and explain user-network interface. [8] OR Q6) a) Explain in detail the architecture of ISDN and its objectives. [8] b) With the help of neat sketches explain different services supported by ISDN. [8] SECTION - II Q7) a) With the help of neat block diagram explain GSM architecture and its evolution. [6] b) Explain different interference reducing mechanism in GSM. [6] c) Enlist Speech Codec attributes and describe Half Rate and Full Rate codec used in GSM. [6] OR Q8) a) Explain with the flow diagram and various channel association to originate a call in GSM network. [6] b) Describe in detail various techniques in GSM to enhance spectral efficiency. [6] c) Explain various data services in GSM system. [6]

Q9) a) With the help of neat diagram describe DSSS system transmitter. Calculate the processing gain for a DSSS system that has a 15 Mega chips per second (Mcps) code clock rate and 9.6-kbps information rate. How much improvement in the processing gain will be achieved if the code generation rate is changed to 60 Mcps? [8] b) Describe various Logical Channels in CDMA.
[3764]-222 -2-

[8]

OR Q10) a) Compare GSM and IS-95 CDMA architecture w.r.t. following parameters: [8] i) Frequency Band. ii) Voice Quality. iii) Handoff. iv) System capacity. b) Explain Walsh Code and how it is incorporated in CDMA. Q11) a) Describe Real time protocols used in VoIP. [8] [8]

b) Describe in detail MEGACO/H.248 Protocol. [8] OR Q12) a) Define VoIP. Draw and explain the various elements of Voice over IP network. [8] b) Explain the architecture of Session Initiation Protocol and SIP session setup. [8] rrr

[3764]-222

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1438

[3764]-223 B.E. (E & TC)


ELECTRONIC PRODUCT DESIGN (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answer 3 questions from Section-I and 3 questions from Section-II. 2) Answers to the two sections should be written in separate books. 3) Figures to the right indicate full marks. 4) Use of electronic pocket calculator is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) Draw a sketch of front panel of a Laboratory CRO and explain how ergonomic and aesthetic design considerations are taken care of this instrument. [10] b) Explain the Bathtub curve for reliability indicating all its regions. Also explain how failures are reduced prior to shipment of the product. [8] OR Q2) a) Discuss the noise coupling mechanisms and also explain how to minimize these at board level. [6] b) For following situations, suggest suitable suppression device or component/mechanism and also explain how it is effective in suppressing the EMI. [12] i) The power transformer in PLC fails due to 1800 V transient present on AC mains due to switching off a DC motor. ii) When these is a call on cell phone of a person operating PC, the monitor looses synchronization. iii) In a multi PCB industrial DC converter housed in 19" rack, the CPU gets reset whenever one the driver circuit switches on four or more electronic relays.
P.T.O.

Q3) A mixed signal system on single PCB contains the following sub circuits. a) Power supply for analog section. b) Power supply for digital circuits. c) Signal conditioning circuit. d) ADC. e) Microcontroller. f) LCD display circuit. g) Clock for digital circuits and microcontrollers. Then discuss in detail the recommended PCB design practices for each of above and draw sketch indicating relative placement of these subcircuits. Justify your answer for placement. [16] OR Q4) a) For a standard 35 copper clad laminate, calculate the inductance of 25 cm long track on PCB having width 0.6 mm. [6] b) Calculate the characteristic impedance for i) Stripline geometry when the PCB laminate thickness is 1.6 mm and its relative permittivity is 4.2. The width of track is 1 mm and thickness 70 m. What should be the width of track of microstrip geometry that will result in 75 characteristic impedance when PCB laminate thickness is 1.6 mm and its relative permittivity 4.2. Assume thickness of track 70 m. [10]

ii)

Q5) a) What are the issues to be considered in ensuring signal integrity in high speed circuits? [8] b) SD RAM interface on microcontroller based circuit is suspected to be malfunctioning due to setup and or hold time violation. Suggest the type of diagnostic instrument with schematic arrangement to find the fault. [8]

[3764]-223

-2-

OR Q6) a) Explain limitations of following hardware diagnostic instruments for their use in mixed signal, high speed designs where signal integrity is important. i) ii) Analog oscilloscope Digital storage oscilloscope [8]

iii) Logic analyser. Hence establish the need of MSO. b) Explain the use and limitations of i) ii) Operating point analysis AC analysis with the help of one circuit. SECTION - II Q7) A 8 channel data logger has following components: a) Two RTD and two thermocouples. b) Four level sensors. c) Signal conditioning circuit. d) ADC. e) Microcontroller. f) LCD display. g) Data memory. Explain in detail software design using top-down approach. Explain function of each software module, also indicate which modules will be coded in Assembly language and which ones in C. Justify your answer. [18] OR Q8) a) Explain with the help of real life microprocessor based product how all recommended steps in software development are implemented. [12] b) In finding software faults explain features and limitations of debugger, simulator and emulators. [6]
[3764]-223 -3-

[8]

Q9) Explain how environmental tests are related to warrantee of a product. What are different environmental tests performed on an electronic product? How severities of different tests are decided? [16] OR Q10) Explain the need for performing different EMI/EMC tests on an electronic product. Discuss various types of EMI and EMC tests carried out on them. Also explain how location and application of product will effect the nature and type of test. [16] Q11) For an universal counter, draw the block schematic and produce all necessary formatted documents that will be send to production department for manufacturing. [16] OR Q12) Give reasons: (any 4) a) A good service manual gives Fault tree. b) Bare board testing is essential for PCBS with high track density. c) Bill of material is considered to be basic document. d) Multilayer PCBS must be used for ICS package as PLCC. e) Engineering notebook is a foundation of any engineering work. f) Paper phenolic laminates are not suitable for industrial products. rrr [16]

[3764]-223

-4-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1517

[3764]-224
B.E. (E & TC)
VLSI DESIGN (404217)

Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) What is significance of following terms in VHDL? [8] i) Library. ii) Use. Write VHDL code & test bench for 2-input Ex-NOR gate design with minimum number(s) of 2-input NAND gate (only) as a component using structural modelling. [10] OR Explain two main processes by writing VHDL code(s) for D-Flip-Flop. What happens if VHDL designer do not assigns an output signal a value in a clocked process? [10] Write the following things in tabulated form i) Synthesiable & Non-synthesiable VHDL statements. ii) Concurrent, sequential and both concurrent plus sequential VHDL statements. [8]

Q2) a)

b)

Q3) a)

Draw FSM for (i) D-Flip Flop (ii) J-K Flip Flop and write VHDL code and test bench which will cover all state table conditions. [12] b) Explain the term Metastability with example. [4] OR Q4) Draw FSM and write VHDL code for a system which has a single bit input X and two single bit outputs Y and Z. The output of system is asserted logic 1 to Y and Z when system detects in input stream of serial bits ...... 1001.... or .... 1010 ... respectively. Comment on the hardware infered due to Gray state encoding instead of Binary state encoding in above system design. [16]
P.T.O.

Q5) a) b) Q6) a)

Differentiate CPLD, FPGA & ASIC. Explain antifusiable generic FPGA architecture. OR Explain the following terms: i) ii) LUT. CLB.

[8] [8] [4 x 2 = 8]

iii) IOB. iv) Switch matrix. b) Draw generic CPLD architecture & explain its functions? SECTION - II Q7) a) Write short notes on: i) ii) b) SRC. DRC. [3 x 3 = 9] [8]

iii) Write parasitics. Draw circuit diagram, waveform and explain the operation of 6T SRAM cell. [9] OR Explain dynamic ROM architecture? Why NAND is prefered over NOR gate? [9] Explain with waveform that how much clock skew between CLK1 & CLK2 can be tolerated in following circuits in Fig. (8.b) when i) CLK1 is delayed after CLK2 ii) CLK2 is delayed after CLK1. [9]

Q8) a) b)

[3764]-224

Q9) a) b)

Explain the principal and types of scaling. Explain the following terms: i) Body effect. ii) Drain punch through. iii) Hot electron. iv) CMOS parasitics.

[8]

[4 x 2 = 8]

Q10)a) b)

OR Explain in detail static and dynamic power dissipation. What are main components which makes power dissipation in CMOS circuit. [8] Explain with neat legends n-well CMOS layout design rules w.r.t. i) Maximum size & ii) Minimum spacing for 1) n-well. 2) active area. 3) 4) poly - 1. metal - 1. [4 x 2 = 8]

Q11)a)

What do you mean by path sensitizing? Which input logic level is considered to sensitize a path through following logic gates: [8] i) AND iii) OR Explain the terms: i) Testing. iii) Validation. ii) NAND iv) NOR. [8] ii) Verification.

b)

Q12)a) b)

OR Explain TAP controller with state diagram. Explain the following: i) DFT. ii) BIST.

[8] [8]

[3764]-224

Total No. of Questions : 12]

[Total No. of Pages : 3

P1346

[3764]-226
B.E. (E & TC)
ADVANCED POWER ELECTRONICS (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer Q.1 or Q.2, Q.3 or Q.4, Q.5 & Q.6 questions from Section I and Q.7 or Q.8, Q.9 or Q.10, Q11 or Q12 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) Draw the circuit diagram of three - phase fully controlled converter feeding a resistive load and the following: Waveforms for = 30. [10] i) Supply phase voltages. ii) Supply line voltages. iii) Output voltage. iv) Supply Current (any one phase). v) Current through SCR (any one). Explain the effect of source inductance on the performance of a single phase full converter with waveforms. Derive expression for its output voltage interms of maximum voltage (vm), filing angle , and overlap angle . [8] OR Explain with a neat circuit diagram and relevant waveforms, the operation of a three-phase circulating current type dual converter. Derive an expression for the peak circulating current in terms of the filing angle.[10] With the help of a neat circuit diagram, explain the technique for achieving equal voltage sharing of two series connected diodes. Derive the relationship between the current sharing resistors in terms of the diode parameters. [8]
P.T.O.

b)

Q2) a)

b)

Q3) a)

With the help of a neat circuit diagram, relevant waveforms and mode equivalent circuits, explain the operation of a three phase, 120 mode, voltage source inverter feeding a balanced, star - connected resistive load. Also derive an expression for R.M.S. phase output voltage. [10] Briefly explain any one technique for output voltage control and harmonic reduction in inverters. [6] OR With the help of circuit diagram explain the circuit of Boost inverter circuit with analysis. [8] A three-phase bridge inverter is fed from a d.c. source of Edc volts. The inverter is operated in 180 conduction mode and it is supplying a purly resistive star connected load with R / phase. Determine the ratings of thyristors. [8] With the help of a neat circuit diagram, relevant waveforms including capacitor (switch) voltage and inductor (load) current and mode equivalent circuits, explain the operation of a class E resonant converter. [10] What are the advantages of resonant, converters over switched mode converter. [6] OR With the help of neat circuit diagram and relevant waveforms, explain the Symmetrical Angle Control (SAC) technique for power factor improvement in AC-DC converters. [8] How will you measure. i) ii) Sinusoidal voltage and current. Nonsinusoidal voltage and current. SECTION - II [8]

b)

Q4) a) b)

Q5) a)

b)

Q6) a)

b)

Q7) a)

With the help of a neat circuit diagram and relevant waveforms, explain the operation of a bipolar voltage chopper drive for P. M and hybrid stepper motor. [10] What are the effects of discontinuous armature current for dc motor drive. [4] Explain Field failure and under voltage protections for D.C. motor.[4] OR
2

b) c)

[3764]-226

Q8) a)

Draw and explain the power circuit of semiconverter feeding a separately excited d.c. motor. Explain with typical voltage and current waveforms, the operation in continuous armature current mode. [8] A 210 V, 1200 rpm, 10A separately excited motor is controlled by a single phase fully controlled converter with an a.c. source voltage of 230 V, 50Hz. Assume that sufficient inductance is present in the armature circuit to make the motor current continuous and ripple free for any torque greater than 25 percent of rated torque Ra = 1.5. i) What should be the value of the filing angle to get the rated torque at 800 rpm? ii) Compute the filing angle for the rated braking torque at - 1200 rpm. iii) Calculate the motor - speed at the rated torque and = 165 for the regenerative braking in the second quadrant. [10]

b)

Q9) a) b) c)

Q10)a) b)

With the help of a circuit diagram and the motor torque - speed characteristic, explain stator voltage speed control of induction motors.[8] What do you understand by soft start? State and explain the soft start methods employed for motors. [4] Justify The speed range of an induction motor is restricted to above 30% of full range while operating with slip power regulation system. [4] OR Draw and explain the operation of three - phase brushless d.c. motor drive. Also explain the related waveforms. [8] Explain the induction motor operation, when the V/f ratio is held constant. Also derive the expression for maximum torque. [8] What is energy audit? Explain the required procedure of energy audit.[8] Define the term Voltage Sag? Explain different sources of Sags and interruptions. [8] OR What is power quality? Why it is required? Explain different types of power line disturbance. [8] Explain probable preventive solutions to control the factors contributing the power quality distartions. [8] Y

Q11)a) b)

Q12)a) b)

[3764]-226

Total No. of Questions : 12]

[Total No. of Pages : 4

P1347

[3764]-228
B.E. (E & T C)
ARTIFICIAL NEURAL NETWORKS (404218) (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from Section I. Q.7 or Q.8, Q.9 or Q.10, Q11 or Q12 from Section II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Use of electronic pocket calculator is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) Compare the performance of a computer and that of a biological neural network in terms of speed of processing, size and complexity, storage, fault tolerance and control mechanism. [6] Compare LMS, perceptron and delta learning laws. [6] A 2 input neurons with the following parameter is given : = 1.2, W = [3, 2] and I = [5, 6]. Calculate the neuron output for the following transfer function. [6] i) ii) Q2) a) b) c) d) Q3) a) Symmetrical hard limit function. Saturating linear function. OR What are the main differences among the three modes of artificial neuron, namely, McCulloch-Pitts, perceptron and Adaline? [6] What is reinforcement learning? In what way is it different from supervised learning? [6] What is meant by operating range of neuron? Explain what is Hebbian learning. Draw the architecture of multilayer feedforward network. [3] [3] [4]
P.T.O.

b) c)

b) c)

Explain the training of multilayer feedforward networks by BPN algorithm. [8] Show that a multilayer network with linear transfer functions is equivalent to a single layer linear network. [4] OR Explain the architecture of adaline. Explain the training algorithm used in adaline. [8] Given I1 = [1 1]T, t1 = 1 I2 = [1 1]T, t2 = 1 represents input and target pairs, train the network using the delta rule with initial weight set to zero and a learning rate of 0.5. [4]

Q4) a) b)

c) Q5) a) b) c)

How is Madaline different from adaline? Explain with diagrams. Describe the Boltzmann machine.

[4] [4]

Distinguish between clamped and free running conditions in Boltzmann machine during learning. [6] How to perform the following tasks by a Boltzmann machine? i) ii) Pattern completion. Pattern association. OR [4] [6]

Q6) a) b) c)

Explain the term feedback network.

Explain the architecture and training algorithm used in Hopfield network. [8] Explain the term energy function. Explain the energy function associated with Hopfield network. [4] SECTION - II

Q7) a) b)

Draw the architecture of ARTI network. Explain the same.

[6]

Explain the training algorithm in ART with significance of vigilance parameter. [8]

[3764]-228

c)

For the Kohonen network with two cluster units and five input units, find the new weight vector for the winning unit. Given initial weight, W = 1.0 0 . 5 0.6 0 . 4 0.2 0 . 2 0 . 4 0 . 6 0 . 8 1.0

If input pattern given is X = [0.5 1.0 0.5 0.0 0.0] and learning rate of 0.2. [4] OR Q8) a) b) c) d) e) Q9) a) Draw the architecture of Maxnet and explain. How does Maxnet act as subnet. Compare SOFM with LVQ. What is Hamming net? What is plasticity with reference to neural network? [4] [3] [6] [3] [2]

Explain the following with reference to memory in Artificial neural networks: [6] i) ii) Transient memory. Temporary memory.

iii) Short time memory. iv) Long term memory. b) c) d) What is an associative memory? What are the requirements of an associative memory? [4] What is a recurrent autoassociative memory? [3] How is noise suppression achieved in a recurrent autoassociative memory? [3] OR Q10)a) Explain BAM architecture and explain the difference between BAM and other neural network architectures. [6]

[3764]-228

b) c) Q11)a) b) c)

Explain the distinction between: Pattern association and pattern classification tasks. Give the architecture of Radial basis function network. What is the problem in the recognition of handwritten digits? What is image segmentation problem?

[4] [6] [5] [5]

What is time delay neural network architecture? How is it suitable for classification of CV segments? [6] OR Explain how neural network principles are useful in control applications. [6] Explain the difficulties in the solution of travelling salesman problem by a feedback neural network. [5] What is the significance of neural networks in the NET talk application.[5]

Q12)a) b) c)

[3764]-228

Total No. of Questions : 12]

[Total No. of Pages : 3

P1476

[3764]-230
B.E. (E & TC)
ELECTRONIC MEASUREMENT SYSTEMS (2003 Course)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5) 6)

[Max. Marks : 100

Answer Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 questions from Section I and Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) b) What is nonconfirmity in error specification? How is it taken into consideration in error studies and instrument specifications. [8] The output of a pressure transducer is recorded over its full scale range of 50 bars as shown below: [8] Calibration pressure 0 5 10 15 20 25 30 35 40 45 50 O/P Reading Bars 0 5 9.8 14.8 19.9 25.1 30.1 35.3 40.2 45.1 50.0
P.T.O.

i)

Determine the static sensitivity of the device.

ii) Calculate the maximum non-linearity of the device. iii) If the relative error is observed to be 0.1 bar, calculate overall accuracy of the device. Q2) a) b) c) Q3) a) b) OR Why True RMS meter is always specified by crest factor? Explain. [3] Write short note on Vector Impedance Meter. [5] Explain in detail working of LCR - Q meter. [8] What do you mean by calibration? Explain calibration procedure for 3 1/2 digit display for 0 - 200 V AC with the help of neat block diagram.[8] List different statistical characteristics encountered to measure the central tendency of distribution. Calculate atleast two characteristics for the following voltage readings. [8] Voltage Frequency of reading Q4) a) b) 10 03 OR Explain totalizing mode of frequency counter. Describe various plug-in units in frequency counter. [8] Write detailed specifications of typical Universal / Frequency counter. Describe various errors in frequency measurement. [8] Explain the effect of resistive, inductive and capacitive load on CRO probes. List various types of CRO probes. Explain any one type of probe in detail. [10] Explain in detail Time Base Generator in CRO. [8] OR Suggest suitable instrument for the following measurement and explain its block diagram. [10] i) Peak value. ii) rms value. iii) Time interval. iv) Duty cycle. v) Windowing & FFT analysis. List typical specifications for the same and explain any two specifications in detail. Explain various sampling methods used in DSO. [8]
2

11 12

12 18

13 12

14 03

Q5) a)

b) Q6) a)

b)
[3764]-230

SECTION - II Q7) a) Suggest suitable instrument for following type of measurement. Give its block diagram * 1 mV AM signal for which channel Bandwidth and side band power, modulation index to be found out *. [6] What is the primary difference between harmonic distortion analyzer and wave analyzer? [4] With the help of neat block diagram explain the working of Logic Analyzer. [8] OR Q8) a) b) Q9) a) b) Give typical specifications of Logic Analyzer. Explain how logic analyzer can be used in fault finding in digital circuits. [10] Draw and explain block diagram of distortion factor meter. Explain test set up for conducted EMI. [8] [8]

b) c)

State and explain various measurements required for testing of receivers. [8] OR Draw and explain block diagram of network analyzer and state its applications. [8] What are the sources of errors to uncertainty in network analyzer system. [8] Explain Electrical, Mechanical and functional specifications of IEEE 488 interface standard. [8] In manufacturing setup, an audio system is to be tested with fast results. Suggest suitable method and explain its setup with block diagram. [8] OR

Q10)a) b)

Q11)a) b)

Q12)Write short notes on: a) b) Features of LABVIEW. Virtual instruments and its components. [8] [8]

Y
[3764]-230 3

Total No. of Questions : 12]

[Total No. of Pages : 5

P1477

[3764] - 233 B.E. (E & TC) ADVANCED COMMUNICATION SYSTEMS (404225) (2003 Course)
[Max. Marks : 100

Time : 3 Hours] Instructions: 1) 2) 3) 4) 5)

Answers to the two sections should be written in separate answer books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary. All quetions are compulsary

SECTION - I Q1) a) b) c) Q2) a) b) With the help of appropriate diagram describe the operational principle of WDM. [8] Briefly explain the working of Optoisolator. [4] Determine spectral bandwidth of optical fiber system, if usable spectral band = 105nM and operating center wavelength is 1550nM. [4] OR With the help of schematic diagram explain the working of 2*2 coupler, employing all glass optical fibre. Explain the purpose of tapered region in this coupler. [4] State the mathematical relation between input power, throughput power, coupled power and return loss for 2*2 coupler. State the relation of input with other outputs, considering coupling coefficients and axial distance. [4] With the help of neat diagram briefly explain Tap coupler. [2] Consider a commercially available 8*8 star coupler, made from 2*2 coupler, elements of 3 db attenuation. About 6% power is lost in each element. Find the excess loss, splitting ratio and total loss. [6] Explain how tunable light sources are useful in wavelength multiplexing. [6] Change of refractive index for a DFB laser is 0.75%. Determine the tuning rage (tune). If 60 channels are operating in this range, determine spectral width (SIGNAL) at 2.54Gbps. [6] P.T.O.

c) d)

Q3) a) b)

c)

Q4) a)

Prepare rise time budget for an optical fiber link operating on Long Haul network with following data. i) Source rise time = 1ns. ii) Detector rise time = 1.1ns. iii) Intramodal fiber rise time = 0.1ns/km. iv) Intermodal fiber rise time = 0.001 ns v) Optical link length proposed: 1) First system = 10km. 2) Second system = 50km. Estimate data rate using RZ format for both the systems. [6] OR DFB laser transmitter is proposed to be used in 565 Mbps optical fiber trunk system operating at 1550 nM. Two types of receivers, one with Pi-N type and the other with APD type are planned. Using the data given in the Table -1 prepare optical link power budgets for systems using both the types of detectors. Determine if any excess margin is available. If yes, determine the extension of the link length. If No, Appropriately reduce the link lengths. Present the iterations and give final result graphically along with budget calculations. [18] Table - I DESCRIPTION TYPE OF RECEIVER WITH WITH P-i-N APD -3 -5 -36 -45 4 4 5 5 50 70 0.35 0.25 1 1 2 2 0.1 0.1

SR.NO.

1 2 3 4 5 6 7 8 9 Q5) a)

Transmitter output,dbm Receiver sensitivity,dbm Dispersion equalization penalty in dBs System safety margin dBs Link length in KMs Link loss in dB/km Attenuation per connectors dB Extinction ratio penalty Splice loss per splice per km

Explain in details any two of the following for orbital satellites: i) Communication Subsystems. ii) Power Subsystem. iii) Telemetry, Tracking and command systems. [8] b) A satellite is in circular orbit. The altitude of the satellites orbit above the surface of earth is 1400km. [3764] - 233 -2-

Q6) a) b) c)

Determine the centripetal and centrifugal accelerations. In Mts/sec2, acting on the satellite. ii) What is the velocity, in Mts/sec in, of the satellite in orbit? iii) Determine the orbital period, in hrs, min and seconds of the satellite in the orbit. [8] OR Explain with mathematical expressions how orbital height r is related with orbital period T [4] Explain briefly various look angles for satellite earth station. [4] A geostationary satellite working in Ku band is used to provide communication in United States of America. The Antennas on the satellite have bandwidth of 6 degrees in E-W direction and 3 degrees N-S direction. Separate Antennas are used for transmitting at 11 GHz and receiving at 14 GHz.Determine the dimensions and Gains of transmitting and receiving antennas in N-S and E-W directions. [8]

i)

Q7) a)

b)

Q8) ) b)

[3764] -

Write short notes on any two of following. i) Preemphasis and de-emphasis in FM systems. ii) Psophometric weighting in communication system. iii) Energy dispersal in FM/FDM satellite communication systems. [10] A television transmissions in NTSC format uses C Band transponder of 36 MHz bandwidth. The maximum video frequency is 4.2 MHz. The system uses frequency modulation with standard signal processing techniques. At the receiving earth station clear Air C/N ratio possible is 15dBs. Determine video S/N ratio achievable at the earth station output. If downlink attenuation doubles due to worst atmospheric condition, estimate the new video S/N ratio, under such adverse conditions.Assume preemphasis improvement factor of 9.0dB and subjective video improvement factor of 8.0dB in the calculations. [8] OR With help of neat diagrams briefly explain generation and coherent detection for QPSK modulation realized as a combination of two BPSK streams. [5] With the help of neat diagram briefly explain Raised Cosine Filtering (RCF) based signal shaping techniques used in digital satellite communication systems. Illustrate the trade-off between usable bit rate and rolloff factor for RCF signal shaping. [5] 233 -3-

c)

Adigital satellite system Ku band uses QPSK modulation with raised cosine signal shaping with roll off factor 0.25. The computer data at 8.0 Mbps is transferred through this link. Satellite link provides Eb/No of 10.16 dBs. Determine the following:i) Symbol transmission rate, occupied bandwidth and C/N ratio in dBs for the digital satellite link. ii) Effective Bit error rate that the system can provide. assume erfc (4.07 ) = 0.001*10-6 [8] Explain the meaning of Noise temperature of receiver. With the help of overall noise model of the receiver, derive the expression for effective system noise temperature Ts for the receiving earth station. [6]

Q9) a)

A satellite in geostationary orbit is at a distance of 39000km from earth station. The required flux density at the satellite to saturate the transponder at frequency of 14.3 GHz is stipulated as -90.0 dBw/mts2. The transmitting earth station provides gain of 52.0 dBs. Determine EIRP of earth station in dBW, minimum output power of earth station transmitter in watts to saturate the transponder. Also determine the diameter for parabolic antenna for the earth station, assume antenna aperture efficiency 60%. [10] OR Q10) ) Explain the significance for any two of the following: i) G/T ratio for the earth station. ii) Antenna noise temperature for the earth station antenna. iii) C/N ratio in satellite communications. [6] b) A geostationary satellite carries a transponder with a 20 watt transmitter at 4.0GHz. The output back off in the satellite is set at 3.0dB. Transmitting Antenna of the satellite provides gain of 1000. Determine the following of the earth station terminal, located at the center of the coverage zone, at a distance 38500km. i) The flux density in dB W/mts2, at the earth station. ii) The power received in dBW by antenna with a gain of 8000. iii) EIRP of satellite in dBW. [10] Q11) ) What does the acronym VSAT stand for and explain how does it justify the underlying technology? What is the typical range, in meters, of the aperture diameter for a VSAT operating with Ku band satellite? [6] b) Explain what MESH and STAR architectures are in a VAST network. Give two advantages and disadvantages of MESH and STAR architectures. [6] c) Explain with neat diagram the TDMA frame structure. [4] [3764] - 233 -4-

b)

OR Q12)a) Describe CDMA system and discuss its advantages over other multiple access systems. [8] b) A36 MHz C-Band transponder has output spectrum for downlink in the range 3705-3742MHz. It carries two unmodulated carriers at 3718 and 3730 MHz with equal magnitude at the input to HPA. i) Show that intermodulation frequency will be within transponder bandwidth. ii) If carriers are modulated and modulated signal has a bandwidth of 8 MHz around exact centre frequency, find the intermodulation products. [8]

*****

[3764] - 233

-5-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1478

[3764] - 234 B.E. (E & TC) DIGITAL IMAGE PROCESSING (2003 Course)
[Max. Marks : 100

Time : 3 Hours] Instructions: 1) 2) 3) 4) Answer any three questions from each section.

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Assume suitable data, if necessary.

SECTION - I 1 ) a) Briefly explain the following. i) Brightness adaptation. ii) Simultaneous Contrast. What is false contouring? Explain.

b) 2 ) a) b) 3 ) a) b)

[8] [8]

4 ) a) b)

OR With the help of block diagram explain monochrome vision model of human eye. [8] Explain Mach band effect. [8] Explain KL transform with its properties. Give applications of KL transform. [8] Explain DCT. Why DCT is preffered in JPEG Compression compared to other transform. [8] OR Write equation for 2D Hadamard transform and give the basis image for N=4 [8] Explain following properties of 2D fourier transform. i) Translation. ii) Rotation. iii) Periodicy. iv) Symmetry. [8] P.T.O.

5) a) b) 6 ) a) b) 7 ) a) b)

Explain wiener filtering. Give its advantages over inverse filtering. [9] Explain HSI color model. Give its advantages and applications. [9] OR Explain edge detection for color image. [9] What is image restoration? How it differes from image enhancement.[9] Explain JPEG compression standard. [10] 44 image is represented by following matrix. Determine entropy of the image. Give huffman coding table.
2 2 4 4 4 4 8 8 8 8 8 8 4 4 4 4

[6]

8) ) b) 9) ) b)

OR With the help of block diagram explain transform coding. Explain bit plane coding.

[8] [8]

10) ) b) 11) ) b)

What is boundary representation? Explain how chain codes are used for boundary representation. [8] With the help of appropriate masks explain the following. i) Point detection. ii) Line detection. iii) Edge detection. [8] OR Explain edge detection procedure using sobel mask. Discuss the problems in presence of noise. [8] Explain edge linking using Hough transform. [8] Explain median filtering and average filtering. Give its applications. Compare median filter with averaging filter. [9] A gray level transform is given by T (i) = ai +b. Where i is the original gray value. What are transform coefficients (a&b) if we are inverting image. Give applications of image inversion (negation). [9] OR Explain Homomorphic filter. [9] What is Laplacian? Explain the use of laplacian for enhancement. [9]

12) ) b)

*****
-2-

[3764] - 234

Total No. of Questions : 12]

[Total No. of Pages : 3

P1614

[3764]-235 B.E. (E & T/C)


BIOMEDICAL ENGINEERING
(404225) (2003 Course)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

[Max. Marks : 100

Answer 3 questions from Section-I and 3 questions from Section-II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) Discuss 10 most important factors to be considered in the design of medical instrumentation. [8] b) State measurement range and frequency of following physiological parameters and sensors used in biomedical engineering. [8] i) ii) Blood Flow Arterial and Venous blood pressure

iii) PO 2 iv) ECG OR Q2) a) What is use of isolation amplifier in biosignal amplification? Explain working of such amplifier with necessary diagram. [8] b) Explain optical fiber sensors for various measurements in bio medical. [8]

P.T.O.

Q3) a) Explain Einthoven triangle concept with necessary diagram. b) Lead I amplitude is 4 mm. Lead III amplitude is 7 mm. What is Lead III amplitude? If sensitivity is 100 mm/mV, calculate aVR, aVL and aVF. OR

[8]

[8]

Q4) a) What are the different problems frequently encountered in the measurement of ECG? [8] b) What are the different protections provided in the ECG machine? [8] Q5) a) What are effects of electric current on the biological tissues? [8]

b) Draw block diagram and explain essential features of central monitoring system for an critical care unit in the hospital. [10] OR Q6) a) What is Let go current? Explain macroshock and microshock hazards of electricity in medical instrumentation. [10] b) Explain operation of Lead Fault indicator in a bedside monitor. SECTION - II Q7) a) What is the basic photometric technique used in bio-analytical instruments? [6] b) Draw and explain different components of an blood oxygen electrode. [6] c) State the chemical reaction between electrode and electrolyte in the measurement of PO2. [4] OR Q8) a) State the Beard-Lambards law that govern the operation of analytical instruments. [4]
[3764]-235 -2-

[8]

b) Why it is necessary to have a monochromatic light source in analytical instruments? [4] c) Explain different methods to generate monochromatic light source.[8] Q9) a) State the ideal specifications of an recorder to be used in medical instrumentation. [8] b) What is open circuit (No-load) voltage across the patient electrodes of a defibrillator using 16 F capacitor and charged to 200 w-s normally? [4] c) In the above example if patient resistance is of 500 and internal resistance of instrument is 20 , calculate the electrode voltage when discharge button is pressed. [4] OR Q10) a) Draw different types of EEG waveforms in normal resting brain condition. State their amplitude and frequency range. [8] b) State the normal counts of different blood cells present in men and women. [4] c) Explain the principle of blood cell counting in a Coulter blood cell counter. [4] Q11) a) Draw block diagram of image intensifier in a X-ray machine and explain its working. [6] b) Explain principle of Ultrasonic doppler effect measurements. c) What is diabetic retiopathy? How it is cured with Laser? OR Q12) a) Explain gradient generation in reference to MRI technique. Draw neat block diagram of MRI. Show the relation between RF Transmitter, receiver chain, gradient generation and coil drive unit. [16] b) Explain long forms of He-Ne Laser Nd-YAG Laser rrr
[3764]-235 -3-

[6] [6]

[2]

Total No. of Questions : 12]

[Total No. of Pages : 3

P1350

[3764] - 236 B.E. (E & TC) AUDIO - VIDEO ENGINEERING (2003 Course) (Elective - II) (404225)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

Answer three questions from section - I and three questions from section - II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

Q1) a) b)

Q2) a) b) A c) Q3) a) b) Q4) a) b)

Explain basic principle of a colour camera. What are different characteristics of camera. [8] With reference to Television system, in short explain the following terms. i) Contrast. ii) Saturation. iii) Colour temperature. iv) Aspect ratio. v) Luminance. [10] OR Explain working and construction of a delta gun picture tube. Why this type of tube has been superseded by PIL picture tube. [8] What are advantages of using AM for video signals, AMSC for colour signals and FM for audio signals in TV system. [5] Compare various display devices for Television monitor. [5] Explain block diagram of Low level modulation TV transmitter. [8] Compare NTSC,PAL and SECAM system. [8] OR Explain use of wobbuloscope and TV pattern generator in TV alignment and fault finding. [8] With neat block diagram explain PAL receiver. [8] P.T.O.

Q5) a) b) Q6) a) b)

State advantages of Digital TV over analog TV. Compare the digital standards for ATSC, DVB, ISDB. [9] In detail explain MAC Technology. [7] OR With the help of block diagram explain DCT based image encoding (JPEG) - Encoder and Decoder. [8] Explain various MPEG Video compression techniques for Digital TV.[8] SECTION - II

Q7) a)

An International cricket match is to be telecasted LIVE, Show the placement of cameras, all other related equipment and explain the overall system with reference to above set - up. [10] Explain block diagram of set Top Box in context to direct to home service. State names of Direct to home service providers in India. [8] OR Explain the concept of 3D-stereoscopic technique. [8] With suitable block diagram explain CCTV system and state its advantages and applications. Also state reasons why generally audio is not transmitted in CCTV system. [10] Explain video recording and reproduction process of magnetic tape. Explain VHS format in detail. [10] Explain MP3 Audio compression format. [6] OR With block diagram explain working of CD player. Compare performance parameters of CD and DVD. [8] Explain in detail Dolby sound system and also state its advantages. [8] With block diagram explain chordless microphone P.A. system. State type of modulation technique used in this system and its approximate frequency band of transmission. [8] Define following terms: i) Phase delay. ii) Acoustic feed back. iii) Echo. iv) Sound reduction index. [8] -2-

b)

Q8) a) b)

Q9) a) b) Q10)a) b) Q11)a) b)

[3764] - 236

Q12)a) b)

OR Explain satellite Radio Receiver system with suitable block diagram. [8] Explain necessasity of Acoustical design for an auditorium and how it can be implemented. [8]

*****

[3764] - 236

-3-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1481

[3764]-245
B.E. (Electronics)
EMBEDDED SYSTEMS DESIGN (404205) (2003 Course)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5) Answer three questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Q2) a) What is an embedded system? How it differs from a general purpose computing system? [4] What are the special considerations in designing embedded systems.[6] Explain MODBUS message structure and device addressing. OR For a particular product the NRE cost and unit cost for three IC technologies are as follows: FPGA (Rs. 10,000, Rs. 50); ASIC (Rs. 50,000, Rs. 10) and VLSI (Rs. 2,00,000, Rs. 5). Determine precise volumes for which each technology yields the lowest total cost. [10] b) c) Q3) a) b) c) Explain time-to-market design metric. Explain the MAC protocol used in IEEE 802.11. [4] [4] [8]

What are the different categories of embedded operating systems? [3] Explain the architecture of digital signal processor. Explain the term interrupt latency with suitable example. OR
P.T.O.

[8] [5]

Q4) a) b) Q5) a) b)

Explain TCP / IP protocol suite. Explain the hardware architecture of an embedded system. Explain pre-emptive and non-pre-emptive multitasking.

[10] [6] [8]

Explain different productivity tools for developing software systematically. [8] OR Explain the process of creating MIDLet. [4]

Q6) a) b) c)

What is code optimization? Explain some important code optimization guidelines. [4] Explain round robin scheduling with interrupts with suitable pseudo code. [8] SECTION - II

Q7) a) b) c) Q8) a) b) Q9) a) b) Q10)a) b) c) Q11)a) b)


[3764]-245

What is the difference between semaphore and mutex? With suitable example explain deadlock during multitasking. OR How interrupt requests are served in RTOS environment.

[4] [4]

Explain the use of mailbox, message ques, pipes, and event registers.[10] [10]

Explain the use of semaphores to solve the problem of shared data. [8] Explain the waterfall model of development of embedded system? [10] List important features of VxWorks. OR Explain the requirement engineering phase of embedded system development. [8] Explain the semaphore related functions of MUCOS. Explain the timer related functions of VxWorks. [4] [4] [6]

With the help of flowchart explain the functioning of digital camera.[10] Explain the basic features of smart card.
2

[6]

OR Q12)a) b) Explain the functioning of RFID system with suitable block diagram. What are the frequency bands used in RFID systems? [10] Explain an embedded system for an adaptive cruise control system in a car. [6] Y

[3764]-245

Total No. of Questions : 12]

[Total No. of Pages : 3

P1353

[3764]-246
B.E. (Electronics)
PROCESS INSTRUMENTATION (Elective - I) (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Draw the block diagram of a SMART TRANSMITTER with differential pressure signal as its input. Explain the function of each block. [10] With suitable example distinguish between SERVO problem and REGULATOR problem in process control. [6] OR Explain any four sensors used for pressure measurement with sketches. [12] Sensor resistance changes linearly from 100 ohm to 180 ohm as temperature changes from 20C to 120C. Find the relationship between resistance and temperature. [4] Define the following for a control valve. i) ii) Actuator. Positioner. [8]

Q2) a) b)

Q3) a)

iii) Cavitation. iv) Flashing. b) Design a process control system that regulates light level by outputting 0-10V signal to a lighting system that provides 30-180 lux. The sensor has a transfer function of 120 ohm / lux with a 10 K resistance at 100 lux. The set point is 75 lux and proportional controller with a 75% proportional band has been selected. [8]
P.T.O.

OR Q4) a) b) Sketch a Digital Control valve and explain its working. Where it is used? [8] A temperature control system inputs the controlled variable as a range 0-2V. Final control element is a heater control module which requires 0-5V. Develop a PID controller for this application with K p = 2.4%/%, KI = 9% / min / % KD = 0.7% / % / min. The period of fastest expected change in process is estimated to be 8 sec. [8] Q5) a) b) c) Explain the term Statistical Process Control. Where it is applied? [6] With a block diagram explain Model Reference Adaptive Controller.[6] Draw the P & I Diagram of Feed forward Control of a Heat Exchanger. Write the specifications of the instruments used in it. [6] OR Q6) a) b) What is a Self Tuning Controller? Explain with a block diagram. [6] Draw the P & I Diagram for the cascade control scheme for a jacketed CSTR (Continuously Stirred Tank Reactor) write the specifications of the instruments used in it. [6] With a block diagram explain Programmed Adaptive Control. SECTION - II Q7) a) b) With a block diagram explain Feedforward Optimizing Control. [6] What are the different modelling approaches in Process Control? Compare among them. [10] OR Q8) a) b) What is meant by Constraint Handling. Explain any one method for the same. [8] Explain the following terms: i) ii) Model Predictive Control (MPC). Internal Model Control (IMC). [8] [6]

c)

[3764]-246

Q9) a) b)

Distinguish between Physical Ladder Diagram and Programmed Ladder Diagram. [4] Draw the event sequence and ladder diagram for a PLC system for a Bottle Filling Plant. Consider all sensors as direct inputs to PLC.[12] OR Draw the block diagram of a PLC and explain the function of each block. [6] Write the important specifications of a PLC having both Analog and Digital Inputs and outputs. [6] Define the following terms with respect to a PLC. i) ii) I/O scan mode. Execution mode. [4]

Q10)a) b) c)

Q11)a)

Develop a supervisory control flow chart of a system to increase the set point of a process reaction Vessel to a new value TSPNU. The temperature set point (TSP) is to be increased in steps of 0.2% with 5 sec delay between increases. If the pressure (P) rises above critical value (PCR), then TSP should be decreased by 0.1% until P falls below PCR. Then the set point increases can begin again. [10] Explain the functions of the following in a Distributed Control System (DCS). [8] i) Local controller. OR ii) Co-ordinating controller. iii) Data Links. iv) Central Information Display. [18] b) d) Alarm Annunciator. Classification of Control Panels.

b)

Q12)Write short notes on (any three): a) c) e) Flow Totaliser. Square root extractor. Digital Recorders. Y

[3764]-246

Total No. of Questions : 12]

[Total No. of Pages : 3

P1354

[3764]-247
B.E. (Electronics)
ADVANCED DIGITAL SIGNAL PROCESSING (2003 Course) (404205)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer Q1 or Q2, Q3 or Q4, Q5 or Q6, from Section I and Q7 or Q8, Q9 or Q10, Q11 or Q12 from Section II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Use electronic pocket calculator is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Obtain the spectral density, autocorrelation and signal energy when x(t) = A sinct. [8] Explain with proof how autocorrelation and energy spectral density form FT pair and also explain Rayleighs energy theorm. [8] OR Explain sampling rate conversion by a rational factor I/D. [6] Design a two stage decimator for the following specifications: D = 100 Passband : 0 F 50 Transitionband : 50 F 55 Input sampling rate : 10,000 Hz Ripple : S1 = 101, S2 = 103. [10] Explain basic LMS adaptive algorithm along with a flow chart. Explain practical limitations of the basic LMS algorithm. Explain the main components of adaptive filter. OR Q4) a) Explain how adaptive filters are useful for the following applications:[10] i) ii) b) Adaptive Jammer suppression. Adaptive telephone echo cancellation. [7] [6] [3]

Q2) a) b)

Q3) a) b) c)

Explain RLS algorithm and compare its performance with LMS algorithm. [6]
P.T.O.

Q5) a)

Define the following: i) ii) Autoregressive (AR) process. Moving average (MA) process. [6] [6]

iii) Autoregressive, moving average (ARMA) process. b) c) Explain prediction error filter with the help of neat diagram.

Derive the optimum reflection coefficient for the lattice Forward & Backward predictors. [6] OR Explain the Levinson Durbin algorithm for the solution of the normal equations. [8] Explain any two properties of the linear prediction error filters. Explain AR Lattice structure. SECTION - II [6] [4]

Q6) a) b) c)

Q7) a) b)

Compare the computational requirements of non parametric power spectrum estimate. [10] Determine the mean and autocorrelation of the sequence x(n) generated by the MA(2) process described by difference equation: x(n) = w(n) 2w(n 1) + w(n 2) Where w(n) is a white noise process with variance OR
2 w.

[8]

Q8) a) b)

Explain with an application how to estimate power spectrum using autoregressive modelling. [10] Explain the effect of spectral leakage and spectral smearing with an example. [8] Explain SHARC architecture with neat block diagram. [10]

Q9) a) b)

State and then discuss four key factors, apart from execution speed, that should be considered in choosing a DSP processor for each of the following application. [6] i) ii) High fidelity digital audio. Physiological signal processing for diagnosis.
2

[3764]-247

OR Q10)a) Explain how Harvard architecture as used by TMS 320 family differs from the strict Harvard architecture. Compare this with the architecture of a standard Von Neumann processor. [8] Explain the concept of pipelining with an example and appropriate timing diagram. [8] Explain the speech production mechanism with the help of a neat diagram. [8] What is formant? Draw the block diagram of formant synthesizer and explain. OR Q12)a) b) c) Explain the LPC model of speech. Explain the difference between Vowel and Consonant. Define the following terms: i) ii) Bilabial. Glottal. [8] [4] [4] [2] [6]

b)

Q11)a) b) c)

[3764]-247

Total No. of Questions : 12]

[Total No. of Pages : 2

P1559

[3764] - 250 B.E. (Electronics Engineering) ELECTRONICS MEASUREMENT SYSTEMS (2003 Course)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6)

Answer three questions from section I and three questions from section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Your answers will be valued as a whole. Assume suitable data, if necessary.

1 ) a) b) 2 ) a) b) 3 ) a) b)

With neat diagram explain working of vector volt meter. Explain the working principle of Q meter with phasor diagram.

[12] [6]

OR What errors are associated with the measurement of Q using LCR - Q meter? Explain in detail. [12] Explain with neat diagram working of phase meter. [6] Explain working of frequency counter with diagram. [8] Explain functions of time base generator in frequency counter. What is a criteria for selection of period measurement or frequency measurement in measurement of unknown frequency? [8] OR Explain Gating Error in frequency measurement using frequency counter. [8] Explain with neat diagram how to increase the frequency range of frequency counter? [8] P.T.O.

4 ) a) b)

5 ) a) b) 6 ) a) b)

Explain with neat diagram frequency selective wave analyzer. [8] Explain with neat diagram superheterodyne spectrum analyzer. [8] OR Explain fundamental suppression hormonic distortion analyzer. [10] Explain pretrigger, posttrigger and trigger modes of logic analyzer center. [6] SECTION - II Explain SMPTE method of intermodulation distortion measurement.[8] Explain direct method for measurement of complex gain of an amplifier. [8] OR Explain impedance measurement using dual channel network analyzer. [8] Explain with neat diagram SINAD sensitivity test. [8] Explain with block diagram Digital Storage Oscilloscope. With neat diagram explain digital data acquisition system. OR : . . . [9] [9] [18]

7 ) a) b)

8) ) b) 9) ) b) 10)

) ) )

11) ) b) 12) ) b)

Explain how to test an audio amplifier using computer controlled measurement system. [8] What are the advantages and disadvantages of virtual instruments. [8] OR Give setup for computer controlled testing of radio receiver. [8] Explain PCI interface. [8]

*****

[3764] - 250

-2-

*3764252*

[3764] 252
B.E. (Electronics) Examination, 2010 BIOMEDICAL ELECTRONICS (2003 Course)

Time : 3 Hours

Max. Marks : 100

Instructions : 1) Answers to the two Sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Black figures to the right indicate full marks. SECTION I 1. a) Explain the meaning of action potential, resting potential, depolarization and repolarization of a cell with necessary diagram. b) Explain the application of microelectrode, skin surface electrode and needle electrode. OR 2. a) Give the classification of transducers with examples. Explain the strain guage pressure sensor in detail. b) State and explain the sensor performance characteristics in detail. 3. a) Draw and explain the cardiovascular circulation in detail. b) Describe the Einthorens triangle and its use in interpreting ECG waveforms. OR 4. a) Draw the schematic design of the main stages of a bio-potential amplifier and explain the functioning of a preamplifier and filter. b) What is the input guarding used in instrumentation amplifier ? Explain the instrumentation amplifier providing input guarding. 5. a) Explain the concept of phonocardiography with the help of basic heart sounds and primary signal characteristic. b) State any six points which are available from Echo-cardiogram analysis. Comment on the resolution obtained due to Echo-cardiogram. OR 6. a) Describe the intensive care unit monitoring architecture with the help of neat diagram. b) What are the basic requirements of implantable pacemaker ? With the help of block diagram, explain the operation of ventricular synchronous demand pacemaker. 9 9

9 9 8 8

8 8 8 8

P.T.O.

[3764] 252 SECTION II

*3764252*

7. a) Show the different arrangements for a basic colorimeter analysis and a schematic for measuring the concentration of a substance in a solution. Explain the basic colorimeter analysis. b) Explain the basic working principle of spectrophotometry with the help of neat diagram. OR 8. a) Draw and explain the working of flame photometer. Also show the essential parts of flame photometer in schematic form. b) What are the problems in the measurement of PO2 . Explain the principle of operation with the help of a diagram of PO2 electrode with platinum cathode. 9. a) Draw and explain the working of electroencephalograph machine with necessary waveform. b) With the help of neat sketch, explain the 10-20 system of electrode placement. OR 10. a) State the four major types of continuous rhythmic sinusoidal EEG activity. Explain any one in detail. b) Explain the anatomy of the central nervous system with necessary diagram. 11. a) State the three processes to form laser beam. Explain any one in detail with the help of neat diagram. b) Give the comparison between Ruby laser and He-Ne laser. OR 12. a) Explain the basic working principle of Magnetic Resonance Imaging System. b) What is a CT scanner ? Explain the technique of producing CT images.

9 9

9 8 8

8 8 8 8

8 8

B/I/10/1,355

Total No. of Questions : 12]

[Total No. of Pages : 3

P1560

[3764]-253 B.E. (Electronics)


REAL TIME OPERATING SYSTEMS
(404212) (2003 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

[Max. Marks : 100

Answers to the two sections should be written in separate answer books. In Section-I attempt Q.1 or 2, Q.3 or 4 and Q.5 or 6 in Section-II attempt Q.7 or 8, Q.9 or 10 and Q.11 or 12. Neat diagrams, flow charts must be drawn and well commented pseudo code written wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain memory requirements in foreground/background and multi tasking kernel. [8] b) What are common methods of obtaining exclusive access to shared resources? Explain with suitable example and diagram. [8] OR Q2) a) Discuss advantages and disadvantages of RTOS. [8] b) Discuss interrupt and interrupt timings for foreground/background, non-preemptive and preemptive kernel. [8] Q3) a) Explain the ready list in uCOSII with following: i) ii) Making a task ready to run. Removing a task from the ready list. [8]

iii) Finding the highest priority task ready to run. b) Explain uCOSII initialisation along with variables, data structures and free pools. [8]
P.T.O.

OR Q4) a) How uCOSII handles critical section of code? Explain all the available methods. [8] b) Explain ECB and event wait list with following: i) ii) Making a task wait for an event. Removing a task from an ECB wait list. [8]

iii) Finding the highest priority task waiting on an ECB. Q5) a) What is semaphore? Explain diagram showing relationship between tasks, ISR, and semaphore. [6] b) Explain in detail OSMutexCreate(). [6]

c) Explain relationship between event flag group, event flag nodes, and TCBs. [6] OR Q6) a) Explain in detail OSSemQuery(). [6]

b) Explain the use of MUTEX using example pseudo code. What are MUTEX configuration constants? [6] c) Explain in detail OSFlagCreate(). SECTION - II Q7) a) What are Mailbox services and configuration constants provided in uCOSII? Explain relationship between tasks, ISR and MailBox. [8] b) Explain the data structure used in message queue. OR Q8) a) What are message Queue services and configuration constants provided in uCOSII? Explain relationship between tasks, ISR and message Queue. [8] b) Explain OSMboxQuery() in detail. [8] [8] [6]

[3764]-253

-2-

Q9) a) Define porting of uCOSII. Discuss general requirements of processor to port uCOSII along with hardware/software architecture. [8] b) What is Memory Control Block? Explain its data structure. OR Q10) a) What is the need of memory management services in uCOSII as compare to compiler functions? [8] b) Discuss testing of port with reference to uCOSII port. [8] [8]

Q11) Design the chocolate vending machine using uCOSII considering following points. a) Hardware and software architecture of the system. [6]

b) Define the tasks, assign the tasks priority and enlist objects of uCOSII required for system implementation. [6] c) Write the application software for the system. OR Q12) Answer the following by considering the implementation of temperature controller. a) Hardware and software architecture of the system. [6] [6]

b) Define the tasks, assign the tasks priority and enlist objects of uCOSII required for system implementation. [6] c) Write the application software for the system. rrr [6]

[3764]-253

-3-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1632

[3764]-255 B.E. (Electronics)


(404212) (2003 Course) (Elective - II)

ROBOTICS & INDUSTRIAL AUTOMATION


Time : 3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Attempt Q1 or Q2, Q3 or Q4, Q5 or Q6 in Section-I and Q7 or Q8, Q9 or Q10 and Q11 or Q12 in Section-II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) Explain how robots can be classified based on the types of joints with the help of neat sketches. [10] b) Define the terms: i) ii) Degree of Freedom Work envelope [8]

iii) Payload iv) Kinematics OR Q2) a) Draw neat sketch showing basic building blocks of a robotic system. Explain the function of each block. [10] b) Discuss various specifications of a robotic system. [8]

Q3) a) Explain the terms - Forward & Backward Solution. What is its significance? Give typical set of Forward & Backward equations. [8] b) Explain the Direct approach for obtaining Inverse Solution. [8]
P.T.O.

OR Q4) a) What is D-H representation? Discuss D-H algorithm. [8] b) Explain the term - Robot arm dynamics. Discuss the E-L formulation used for a robotic manipulator. [8] Q5) a) Explain the role of actuator in a robot. Explain any one with neat sketch. [8] b) Give various types of gripper. Explain the end effector with bilateral gripping action with a neat sketch. [8] OR Q6) a) Explain the Lift & Tray technique for slip detection with the help of neat diagram. [8] b) Explain the Pneumatically controlled prismatic joint with the help of neat sketch. [8] SECTION - II Q7) a) Explain the types of motion used while trajectory planning. [8]

b) What is Jacobian Control used in robotics? Explain the Jacobian in terms of D-H matrices. [10] OR Q8) a) R-R-R manipulator is at initial position (45, 90, 45) degrees. It is required to move to (135, 0, 0) degrees. Assume that the joints have maximum absolute acceleration/decceleration of (40, 80, 160) degrees/ sec2 & maximum velocities of (20, 40, 80) degrees/sec. Calculate the travel time for each joint using slew motion. [10] b) Explain how obstacle avoidance can be achieved in robotics. [8]

Q9) a) What are different types of vision sensors used in robotics? Explain any one of them with the help of neat sketch. [8] b) Name various segmentation techniques used in robot vision system. Explain any one of them. [8]
[3764]-255 -2-

OR Q10) a) Explain the applications of Machine Vision System. b) Discuss the use of Inteligent Sensors in robotics. [8] [8]

Q11) a) What do you mean by Nanorobot? Name its various fields of application. Explain any one application, in detail. [8] b) Explain the terms - MEMS and Microsystems. Discuss their applications. [8] OR Q12) Write notes on: a) Link and Joint Parameters. b) Pitch, Roll & Yaw. c) H matrix. d) Teach Pendent. rrr [16]

[3764]-255

-3-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1358

[3764]-288
B.E. (Instrumentation & Control)
BUILDING AUTOMATION - I (2003 Course)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answer to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) b) Q5) a) b) Q6) a) b) What is fire? Explain fire modes. Explain FAS components. OR Enlist types of FAS architecture. Explain any one. Describe various stages of fire. Explain FAS loops with suitable example. Enlist various automatic fire detectors. Explain any one. OR Explain 2-wire & 4 -wire smoke detectors. Describe addressable pull stations. Enlist various heat detectors & explain any one. Discuss non-alarm pull stations. OR Discuss manual initiating devices. Describe air sampling detector. [8] [8]
P.T.O.

[8] [8] [8] [8] [10] [8] [10] [8] [8] [8]

SECTION - II Q7) a) b) Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b) Q12)a) b) What is security system. Discuss on importance & applications of security system. [10] Describe access control devices. OR Explain authentification with suitable example. Explain various wiring standards. Explain various components of CCTV system. Discuss video broadcast standards. OR Describe image capture phenomena in camera. List & Explain types of data compression in video processing. [8] [8] [10] [8] [8] [8] [8]

What is perimeter intrusion? Explain its importance & applications.[8] Draw the block diagram of perimeter intrusion system & explain it. [8] OR Explain architecture of PJDS. Explain CCTV control room. [8] [8]

[3764]-288

Total No. of Questions : 12]

[Total No. of Pages : 3

P1439

[3764]-290
B.E. (Instrumentation & Control)

COMPUTER TECHNIQUES AND APPLICATIONS (2003 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) Four processes (P1, P 2, P 3, P 4) arrive at time 0, 2, 4, 5 with their CPU bursts of 7, 4, 1 and 4 respectively. For each of the following CPU scheduling algorithms, draw the Gantt chart and determine the average turn around time and average waiting time, showing all the calculations in detail. [12] i) ii) First Come First Serve (FCFS). Shortest Job First (SJF) (non preemptive).

iii) Shortest Job First (SJF) (preemptive). iv) Round Robin (RR) with a time quantum of 4 CPU bursts. b) With neat diagrams explain the following Disk scheduling algorithms.[6] i) ii) SCAN. C-SCAN. OR Q2) a) b) Explain the different types of Operating Systems (any four): Explain the following with respect to process management: i) v) Job Queue. Context Switch.
P.T.O.

iii) C-LOOK. [8] [10]

ii)

Device Queue.

iii) Ready Queue.

iv) Mid term scheduler.

Q3) a) b) Q4) a)

With the help of neat diagram, explain the concept of thrashing. OR With neat diagrams explain the following page table structures. i) ii) Hierarchical paging. Inverted page table structure.

[8]

With neat diagrams, explain any four types of Directory Structures. [8] [8]

b)

List the various file allocation methods and explain the working with neat diagrams. [8] Write a note on Systolic Arrays on the basis of following points: i) ii) Functional block diagram. Working. [8] [8] OR [8]

Q5) a)

b) Q6) a)

Explain Flynns classification of Parallel computers. Compare the following with respect to parallel computers: i) ii) Loosely Coupled and tightly coupled systems. UMA and NUMA parallel computers.

b)

Design a Huffman code for a source that puts out symbols a1, a2, a3 and a4 with their respective probabilities of occurrence as 0.1, 0.3, 0.2 and 0.4. [8] SECTION - II

Q7) a)

Write a note on IEEE 802.3 with respect to following points: i) ii) Data Frame. Description of Working.

[8]

b)

Explain LAN and LAN topologies. OR

[8] [16]

Q8) Write short notes: a) b) Q9) a) b)


[3764]-290

Industrial Ethernet. TCP / IP reference model. Discuss the various levels of CMM. List and explain the basic operating modes of ARM processors.
2

[8] [8]

Q10)a) b) Q11)a) b) Q12)a) b)

OR Discuss the architectural overview of ARM 922. Write a short note on IEEE 1394.

[8] [8]

Explain white box and black box testing. Discuss the advantages and limitations of each. [10] Discuss CASE and CASE tools. [8] OR What is software testing? Discuss the various software testing strategies. [10] Explain in brief the Software Development Life Cycle. [8]

[3764]-290

Total No. of Questions : 12]

[Total No. of Pages : 3

P1396

[3764]-291
B.E. (Instru.)
INDUSTRIAL AUTOMATION (1997 & 2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) With an example explain. How Industrial Automation helps industry? [8] Explain the role of each layer in Automation Pyramid. OR Justify the Automation system for following production systems. i) ii) Continuous Production system. Mass manufacturing of discrete products. [8] [10]

iii) Batch Production. iv) Job shop production. b) Q3) a) b) Explain the role of each layer in Automation Pyramid. With an example explain different Action Qualifiers in SFC. [10] [8]

With reference to following points differentiate between Modbus (ASCII) and Modbus (RTU) transmission modes. i) v) Characters. Gaps in Message ii) Error check. iii) Frame Start. vii) Stop Bit. iv) Frame end. vi) Start bit. viii) Parity. [8]
P.T.O.

OR Q4) a) b) With an example explain different Action Qualifiers in SFC. [8] Write a program to control a temperature loop using PID in PLC system with ladder programming language. Write the details of each instruction that you have used in your program. [8] What is LAS? Explain the role of LAS in FF network. Explain any four basic function blocks in FF. OR What is LAS? Explain the role of LAS in FF network. Write a short note on: i) Profibus. ii) HART. SECTION - II Q7) a) b) With an example explain at least four major components of the DCS system. [8] Give the detailed DCS specification for any food processing automation system. [10] OR List and explain the Logical function blocks in the DCS system. [8] Give the detailed DCS specification for any food processing automation system. [10] With the help of diagram explain the different stages involved in the DCS Automation Projects. [6] Write a program in DCS system (Any make) using FBD programming method to control the loop shown in Fig. below. Write the different steps involved in the configuration of function blocks. [10] [8] [8] [8] [8]

Q5) a) b) Q6) a) b)

Q8) a) b)

Q9) a) b)

[3764]-291

Q10)a) b)

OR Explain on what basis display hierarchy is created. [6] Write a program in DCS system (Any make) using FBD programming method to control the loop shown in Fig. below. Write the different steps involved in the configuration of function blocks. [10]

Q11)With the help of block diagram explain the implementation of DCS system in a thermal power plant. [16] OR Q12)With the help of block diagram explain the implementation of DCS system in a paper and pulp industry. [16]

[3764]-291

Total No. of Questions : 12]

[Total No. of Pages :3

P1485

[3764] - 292 B.E. (Instrumentation and Control) ADVANCED BIOMEDICAL INSTRUMENTATION (406720) (2003 Course) (406268) (1997 Course)
[Max. Marks : 100

Time : 3 Hours] Instructions: 1) 2) 3) 4) 5) 6) Answer any three questions from each section.

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I 1) a) b) c) What is the need of a Defibrillator? [4] Write down the specifications of a typical Pacemaker. [4] Describe different modes of Electrosurgical unit along with its waveforms. [8] OR It is required to set up an ICU for 8 beds. Elaborate the implementation plans. [8] Discuss different types of defibrillators and explain any one of them with the help of neat diagram. [8] With the help of graph, explain the basic working principle of a pulse oximeter. [4] Explain the working of an In-Vivo type of oximeter with the help of a suitable diagram. [6] Explain the need and working of an Autoanalyser. [8] OR P.T.O.

2 ) a) b) 3 ) a) b) c)

4) a) b) 5) a) b) 6 ) a) b) c)

List and explain various methods used for glucose measurement. [10] Describe system components for a typical Telemedicine System. [8] What is the role of Image Intensifier in X-ray imaging. Explain its working with the help of suitable diagram. [10] List specifications of X-ray Machine and explain their importance. [6] OR How X-rays are generated and used for visualizing internal organs? [4] Describe different types of detectors used in Computed Tomography.[8] What is Image Artifact and how to take care of that? [4]

7 ) a) b) c)

Explain how Ultrasound is suitable for Biomedical Imaging.

[4]

State the equation used for image reconstruction in MRI. [4] Draw a diagram, explaining what is meant by spin - spin relaxation time and spin lattice relaxation time. What is the importance of it? [8] OR What are the advantages of thermography over other imaging techniques. State the applications of it. [8] With the help of a suitable block diagram, explain the working of a Gamma Camera. [8] List various applications of lasers in Opthalmogy. [2] Explain any one of them in detail. [8] What is an Endoscope? With a simplified block schematic describe its functioning. [8] OR Explain the working of gastro-endoscope with the help of a suitable diagram. [8] What are different types of Diathermy? [2] Explain principle and working of Microwave Diathermy. [8]

8) ) b)

9) ) b) c)

10) ) b) c)

[3764] - 292

-2-

11) ) b) 12) ) b)

With the help of neat diagram describe the setup and operation of a Hemodialysis machine. [8] Define Lithotripsy. Explain in detail Shock Wave Lithotripsy. [8] OR Define Prosthetic and Orthotic Devices. Following devices fit into which category? * Dialyser. * Pacemaker. * Tooth Implant. * Walking Stick * Artificial heart valve. * Heart lung machine. What are different types of dialysers? Compare them based on size, efficiency, resistance and cost. [4] [6]

c) d)

[2] [4]

*****

[3764] - 292

-3-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1563

[3764]-293 B.E. (Instru.)


POWER PLANT INSTRUMENTATION (1997 & 2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answers to the two sections should be written in separate answer books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Assume suitable data, if necessary. 5) All questions are compulsory.

SECTION - I Q1) a) Draw the block diagram of the Hydroelectric Power station. Explain the same in brief. [9] b) What is the meaning of National Grid & Regional Grid? Explain. [7] OR Q2) a) Draw the Block schematic of Nuclear Power plant & explain its working. [10] b) Enlist the major conventional & Non-conventional sources of electricity. [6] Q3) a) What are the various types of boilers used in industry? Draw the near sketch of any one boiler. [9] b) Explain three element Boiler Drum Level Control with Steam Density Compensation. [9] OR Q4) a) What is Burner Management System? Explain in detail. [9]

b) Explain Air to Fuel ratio control method using O2 & CO2 measurement in flue gases. [9]
P.T.O.

Q5) a) Why the Thermal Stress measurement is essential in turbine? How it is measured & Controlled? [8] b) Why winding temperature measurement is essential for generator? Draw & explain the same. [8] OR Q6) a) Draw & explain the HP/LP heater level control scheme in detail. [8] b) Draw & explain feed tank level control in detail. SECTION - II Q7) a) What are the various types of water turbine? Draw neat sketch of the same. [8] b) Explain surge tank level control scheme for hydroelectric power plant. [8] OR Q8) a) What is atomic fission? How energy can be generated by fission? [8] b) Explain the Atomic Power Station with block schematic. [8] [8]

Q9) a) What are the factors affecting the efficiency of the power plant? Explain. [9] b) What is energy audit? How it is done? What are its benefits? OR Q10) a) What are the names of pollution control authorities for State & Central Government? Comment upon Boiler Regulation. [9] b) Draw & explain electrostatic precipitators. Q11) a) Write short note on Hydrogen Cell. b) Explain working of photovoltaic Cell in detail. OR Q12) a) What are incinerators? How power can be generated from the same? [8] b) Draw the block diagram & explain Wind power plant in detail. rrr
[3764]-293 -2-

[9]

[9] [8] [8]

[8]

Total No. of Questions : 12]

[Total No. of Pages : 3

P1519

[3764] - 294 B.E. (Instru.) FIBER OPTIC INSTRUMENTATION (2003 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Answer three questions from Section -I and three questions from Section -II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Assume suitable data, if necessary.

SECTION - I 1) a) With the aid of simple ray diagram, describe: i) Multimode step index fiber. ii) Single-mode step index fiber. Compare the advantages and disadvantages of these. [8] A silica optical fiber with a core diameter enough to be considered by ray theory analysis has a core refractive index of 1.49 and a cladding refractive index 1.40. Determine the critical angle at the core-cladding interface, numerical aperture for the fiber and the acceptance angle in air for the fiber. [9] OR Describe the mechanism for the transmission of light within the optical fiber using simple ray theory. Briefly discuss with the aid of a suitable diagram what is meant by the acceptance angle for an optical fiber. Show how this is related to the fiber numerical aperture and the refractive indices for the fiber core and cladding. [9] Describe with the aid of suitable diagrams, the following concepts in optical fiber transmission: (any two) [8] i) Evanescent field. ii) Goos-Haenchen shift. iii) Mode coupling. P.T.O.

b)

2 ) a)

b)

3) a) b)

4 ) a) b) 5) a) b)

6 ) a) b)

Explain Microbending and Macrobending in optical fiber. Also explain what is meant by the critical bending radius for an optical fiber. [9] Describe various attenuation mechanisms in optical fiber transmission in detail. [8] OR What are the reasons for pulse broadening in optical fiber. [8] Write a note on Optical Time Domain Reflectometer (OTDR). Also describe the role of OTDR in distributed optical fiber sensing. [9] Describe three types of fiber misalignments, which may contribute to insertion loss at an optical fiber joint. [8] With the aid of suitable diagrams, discuss the principles of operation of the injection laser [8] OR Explain detection process in p-n photodiode. Compare this device with the p-i-n photodiode. [8] Describe with the aid of suitable diagrams the mechanism giving the emission of light from the LED. What are the advantages and drawbacks of the LED in comparison with the injection laser for use as a source in optical fiber sensing? [8]

7 ) a) b)

Write short note on Encoding-based Position Sensors.

[8]

Enlist the characteristics of the light, which may be monitored in sensing applications. What are the advantages and drawbacks of Optical Fiber Sensors. [8] OR What are the advantages of Intensity Modulated Optical Sensors? Describe one technique of sensing which is based on intensity modulation. Also enlist various parameters, which can be sensed by using this technique. [8] What do you understand by intrinsic and extrinsic Optical Fiber Sensors? With the aid of suitable diagrams describe one intrinsic Optical Fiber Sensor. How do you calibrate this sensor? [8] Write a note on Fiber Grating Manufacturing. [9] Explain working of Fiber Bragg Grating. Also explain one optical fiber sensor in which Fiber Bragg Grating is used. [9] OR 294 -2-

8) )

b)

9) ) b) [3764] -

10) )

b) 11) ) b)

What are the advantages of Distributed Optical Fiber Sensing? Explain Distributed Optical Fiber temperature Sensing. What are limitations of this type of sensing? [10] Explain different performance parameters, which characterize any Distributed Optical Fiber Sensing. [8] Give major reasons which have led to the development of optical amplifiers, outlining the attributes and application areas for these devices. [8] Explain with the aid of suitable diagrams, following integrated optical devices: i) Beam splitter. ii) Directional coupler. [8] OR Sketch the major elements of a fiber amplifier and describe the operation of the device. Indicate the benefits of fiber amplifier technology in comparison with that associated with silicon laser amplifiers (SLAs). [10] Write a note on Integrated Optics. [6]

12) )

b)

*****

[3764] - 294

-3-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1360

[3764] - 296 B.E. (Instrumentation & Control) BUILDING AUTOMATION - II (2003 Course)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

Answers to the two sections should be written in separate answer books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I 1) a) b) Define air conditioning. Explain various process of air conditioning in HVAC. [8] Differentiate with suitable example:Heat intensity and heat Quantity. [8] OR 2 ) a) b) 3 ) a) b) 4 ) a) b) Explain following terms:i) Latent Heat. ii) Sensible Heat. Explain psychometric chart. Explain process of heating and cooling in HVAC. Explain basic heating circuit of HVAC. OR Enlist steam distribution system. Explain any one. Describe AHU of HVAC. [10] [8]

[8] [8] [10] [8]

P.T.O.

5) a) b) 6) a)

Describe the functions of DDC in Building automation. Explain functions of BMS. OR Explain: i) Optimum start. ii) Night cycle. iii) Load reset. iv) Power demand. Discuss advantages and disadvantages of DDC.

[8] [8]

b)

[8] [8]

7 ) a) b) 8) ) b) 9) ) b)

Describe Motor Control Center. Describe LON. OR Describe the elements of BACnet. Describe MODBUS. Draw and explain ASHRAE symbols. Describe energy saving methods. OR

[10] [8] [10] [8] [8] [8] [8] [8] [8] [8]

Q10) ) Explain advantages of BMS. b) How to increase the efficiency of building automation system. Q11) ) Explain functions of IBMS. b) Explain BMS Verticles. OR Q12) ) Describe IBMS architecture. b) Explain benefits of IBMS.

[8] [8]

*****
[3764] - 296 -2-

Total No. of Questions :6]

[Total No. of Pages : 2

P1489

[3764] - 311 B.E. (Printing) STUDY OF ADVERTISING AND MULTIMEDIA (2003 Course) (Elective - II)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) All questions are compulsory. Figures to the right indicate full marks.

SECTION - I 1) What is integrated media or multimedia approach for advertising? Explain its specific benefits in details. [18] OR 1 ) What is advertising campaign? What specific benefits can be achieved if advertising is done in terms of campaign? 2 ) Market research helps the manufacturer to launch a product ___ Justify.[16] OR 2 ) What are different methods of market survey? Discuss each method and support with suitable example/case. 3 ) Write notes on: a) Methods of advertising budget. b) Financial advertising c) USP. d) Role of copywriter in advertising industry. OR [16]

3) Mention different types of advertising and explain each with suitable example.

P.T.O.

SECTION - II 4 ) Which different media are used for advertising. Explain features, advantages and limitations if any of any three media used for advertising. [18] OR 4) Write notes on: a) b) c) 5) a) b) 5 ) a) b) 6 ) a) b) Market segmentation. Brand equity and brand personality. ABC and NRS. Explain advertising as a model of communication. Discuss AIDA model used for advertising. OR Compare between public relations advertising and public service advertising. Compare between advertising and personal selling. What is product research? Why it is necessary? Explain PLC in details. OR 6 ) What is consumer behaviour? In what way it can affect design of advertisement in any media.

[16]

[16]

*****

[3764] - 311

-2-

Total No. of Questions :6]

[Total No. of Pages : 2

P1615

[3764] - 312 B.E. (Printing) STUDY OF PACKAGE DESIGN AND MATERIALS (2003 Course) (Elective - II)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) All questions are compulsory.

Answers to the two Sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks.

SECTION - I 1) a) b) Explain difference between commercial printing paper and packaging paper. [10] Discuss pulp ingredients and properties for craft paper manufacture.[6] OR Explain structure and working of fourdrinier paper machine. 2 ) Write notes on : a) Properties of duplex boards. b) Properties of craft papers. OR a) b) Discuss printing problems of Duplex Boards and Craft papers. Discuss applications of various Duplex Boards in packaging. [16] [8] [8] [8] [8] [18] [18]

3 ) Explain the equipments involved in a universal type carton factory. OR Explain corrugation process and discuss types of fluting in detail.

P.T.O.

4) Discuss manufacturing of a jigged die and punching process. OR Compare economics of universal process with punching process. 5 ) Calculate the following for a universal type carton: 15000 QTY. a) Cost of each carton. b) Total paper required. c) Weight of each carton. Given Data: i) LBH: 12 x 10 x 9. ii) 5PLY. iii) GSM: 180. iv) Paper: Rs. 25000/MT v) Conversion: Rs. 5000/MT (Assume suitable data if necessary). OR : 5000 .

[16]

[16] [18]

[18]

) . ) Cost of carton. c) Weight of each carton. Given Data: i) LBH: 12 x 10 x 9. ii) 3PLY. iii) GSM: 450. iv) Paper: Rs. 45000/MT. v) Punching: Rs. 500/1000 impressions (Assume suitable data if necessary). 6) OR Discuss 4 vital tests for raw materials and finished cartons in detail. [16] . [16]

*****
[3764] - 312 -2-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1490

[3764]-322 B.E. (Chemical Common to Biotechnology)

CHEMICAL REACTION ENGINEERING - II (2003 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) The reduction of iron ore of density B = 4.6 gm/cm3 and size R = 5 mm by hydrogen can be approximated by unreacted core model. 4H 2 + Fe3O 4 4H 2O + 3Fe With rate approximately proportional to the concentration of hydrogen in
RT cm/sec . Taking D = 0.03cm2/ the gas stream. ks = 1.93 105 e e sec, calculate the time necessary for complete conversion of a particle from oxide to metal at 600 oC. Does any particular resistance control? If not what is the relative importance of various resistance? [18] OR Q2) A solid feed consisting of 20 % of 1 mm particles 30 % of 2 mm particles and 50 % of 4 mm particles is to be passed through a rotating tubular reactor, some what like a cement kiln, where it reacts with gas of uniform composition to give hard nonfriable solid product. Experiments show that the progress of conversion can reasonably represented by reaction control for unreacted core model and that the time for complete conversion of 4 mm particles is 4 hrs. Find the residence time needed in the tubular reactor for (a) 75% conversion of solids (b) 95% conversion of solids and (c) 100% conversion of solids. [18] 24000

P.T.O.

Q3) The concentration of an undesirable impurity A in air is to be reduced from 0.1% to 0.02% by absorption in pure water. Find the height of tower required for counter current operations. All the data is in moles meters and hr. For packings : kAga= 32000 mol/hr.m3 atm kALa = 0.1/hr, HA=125 106 atm.m3/mol, L= L = 7105 mol/hr.m2, G= G =1105 mol/hrm2 at = 1 atm, molar density of liquid CT = 56,000 mol/m3.. [16] OR Q4) For the problem given in Q.3 replace the unreactive absorbent with reactive liquid which contains a high concentration of reactant B, CB1 = 800 mol/m3 (0.8N). A(g) +B(l) Product. The reaction takes place in the liquid and extremely rapid. Assume diffusivities of A and B in water are the same. kAl = kBl = kl. Determine height of column. [16] Q5) a) The chemisorption of hydrogen on copper is given as below at 25oC. What kind of isotherms fit these results. [8] H2 Pressure 1.05 2.95 5.40 10.65 21.5 45.1 95.8 204.8 mm Hg
Vol. adsorbed cm3 at 0oC & 1 atm 0.239 0.564 0.659 0.800 0.995 1.160 1.300 1.471

b) Derive expression of effectiveness factor for cylindrical pore in a catalytic pellet with 1st order irreversible reaction. State the assumptions. [8] OR Q6) a) A gaseous reaction with a solid catalyst is carried out in a flow reactor. The system is isothermal, but it is believed that mass transfer resistance are important. (i) Would increasing the turbulance in the gas region next to the catalyst surface increase or decrease the global rate? (ii) If the system is not isothermal and reaction is exothermic would increasing the turbulance increase or decrease the global rate? [6] b) Describe determination of surface area by BET method. c) Write short note on poisoning of catalyst. [6] [4]

[3764]-322

-2-

SECTION - II Q7) a) For the catalytic reaction A + B C derive the rate expression for the case of surface reaction as rate controlling step. [8]

Cat

1 1 1 Cl2 + H 2O with CuCl 2, KCl, b) For the reaction HCl + O 2 4 2 2 SnCl2 on silica catalyst, in differential and integral reactors. The rate of disappearance of HCl could be correlated by

r=

4 K CHCl CO2 1

[1+ K

( K )C

Cl2

CH

2 2O

CHCl + K 2 CCl2

]2

Devise series of fundamental steps of adsorption and surface reaction which will give above rate expression. [10] OR Q8) a) For the catalytic reaction A + B C + D derive the rate expression for the case of adsorption of A is rate controlling step. [8] b) What is Thieles modulus? When is mass transfer resistance is greater?[6] c) Explain preparation of Catalyst. [4]

Q9) The liquid phase hydrogenation of -methyl styrene to cumene has been studied in a recycle batch reactor at 80 lb/in2 at s and 55oC. [16]

H 2 (dissolved) + C6H5C(CH3 ) = CH2 (l) C6H5 CH(CH3 )2 (l )


The reactor was packed with 18 in Al2O3 spheres containing 0.5 at % palladium on the outer surface of catalyst. Data for two runs with different initial styrene concentration is follows. Run C4 Run C5 Moles of -methyl styrene t = 0 29.0 27.9 Moles of catalyst in reactor, 9 30.7 30.7 t, h Mole fraction cumene 0 0.0264 0.1866 4 0.0530 0.2114 8 0.0810 0.2332 10.5 0.0995 0.2552 17.5 0.1518 21.5 0.1866
[3764]-322 -3-

For the integral changes in composition (during a run) shown, a plot of cumene mole fraction V/s time might be expected to be curved, yet the data show a linear relationship. What does this signify about the kinetics of the reaction? Calculate rates of hydrogenation from the data given. The solubility of hydrogen in the liquid is very low. OR

4R is studied in a plug flow reactor using Q10) The Catalytic reaction A various amounts of catalyst and 20 lit/hr of pure A feed at 3.2 atm and 117oC. The concentration of A in the effluent stream is recorded for the various runs as follows. Runs 1 2 3 4 5 Catalyst used, kg 0.02 0.04 0.08 0.12 0.16 CA,out , mol/liter 0.074 0.060 0.044 0.035 0.029 Find the rate for the reaction using differential and integral method of analysis. [16]

Q11) The second order reaction A R is studied in a recycle reactor with very large recycle ratio and the following data are recorded:
Void volume of the reactor: 1 liter, Weight of catalyst used : 3 gm, Feed to the reactor CA0 = 2 mol/liter, V0 = 1 liter/hr, CA, out = 0.5 mol/liter. Find the rate constant for this reaction. How much catalyst is needed in a packed bed reactor for 80% conversion of 1000 liter/hr of feed of concentration CA0 = 1 mol/liter. [16] OR Q12) a) Derive Michaelis-Menten kinetics. How the constansts Vm and Km are determined? [8] b) Discuss design of adiabatic reactor. rrr [8]

[3764]-322

-4-

Total No. of Questions : 12]

[Total No. of Pages : 2

P 1592

[3764] - 331
B.E. (Chemical) PETROLEUM REFINING (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answer three questions from Section I and three questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) What is refining of crude oil? [4] Discuss various specifications of following petroleum products : i) LPG ii) Diesel Oil. [12] OR Q2) a) b) Explain specifications of kerosene and engine oil. What is straight run gasoline? [12] [4] [18]

Q3) Discuss in details : Vacuum Distillation. OR Q4) Explain Atmospheric Distillation. Q5) Describe hydrocracking with neat diagrams. OR Q6) Explain with sketches : Reforming. SECTION - II Q7) With neat diagrams, explain hydro-desulphurization. OR

[18] [16]

[16]

[16]

P.T.O.

Q8) Describe in details : Acid Refining. Q9) a) b) Discuss transportation methodologies of petroleum products. Enlist various additives in petroleum processes. OR Q10)Write down safety norms in refining process. Q11)a) b) Explain settling and moisture removal in pre-refining. What are various packing materials for petroleum products? OR Q12)a) b) Note different catalysts used in refining. Discuss recent trends in worldwide refineries.

[16] [8] [10]

[18] [8] [8]

[10] [6]

[3764] - 331

-2-

Total No. of Questions : 12]

[Total No. of Pages : 5

P 1616

[3764] - 333
B.E. (Chemical) CHEMICAL PLANT ENGINEERING (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Your answers will be valued as a whole. 4) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) Explain the importance of following general design considerations in the design of chemical plant. [6] i) Plant operation and control. ii) Maintenance. iii) Utilities. iv) Structural Design. Explain the importance of pilot plant trials in the chemical equipment and plant design. List the chemical equipment which require pilot plant trials. [6] Write short note on P & I diagram and process flow diagram. [6] OR Q2) a) Explain the importance of consideration of [6] i) Safety Aspects. ii) Environmental protection aspects in design of chemical plant. Write short note on [6] i) Project documentation. ii) Project organisation. Explain in detail significance of codes and standards in chemical plant design. List some international and national codes and standards. [6] Write short note on thermodynamic and kinetic feasibility of chemical process. [4] Explain in detail various material of construction used in construction of chemical plant. [6]
P.T.O.

b)

c)

b)

c)

Q3) a) b)

c)

Write specification sheet for i) Packed column. ii) Shell & Tube heat exchanger. OR

[6]

Q4) a)

b) c) Q5) a) b)

Write specification sheet for [6] i) Centrifugal pumps. ii) Plate type Heat Exchanger. iii) Mixed Flow Reactor. What are the various factors to be considered during preparation of plant and site layout. [6] Write short note on selection of plant location. [4] What are the various secondary refrigerant used in chemical plant. Give advantages and disadvantages alongwith their temp. range. [8] Write short note on [8] i) Forced draft & induced draft cooling towers. ii) Water softening. OR Explain in detail various chemical methods used in waste water treatment. [6] Write short note on [6] i) Make up water in cooling operation. ii) Use of inert gas in chemical plant. Explain in detail use of steam in chemical plants. [4] SECTION - II

Q6) a) b)

c)

Q7) a) b) c)

Explain water hammer in process piping. Explain in detail use of Pneumatic conveying in chemical plant.

[4] [4]

Carbon dioxide is to be conveyed from the top of the stripper of ammonia plant to urea plant. Calculate the pipe size required based on following data : [10] Data : Flow rate of CO2 = 1000 tons/day, Total length of pipe = 800 m Available pressure at inlet of pipe = 24 kPa. Discharge pressure of CO2 from pipe required = atmospher pressure No. of 90o elbows in pipeline = 8 No. of butterfly valve = 1
-2-

[3764] - 333

No. of flow Nozzles = 1 Temp. of gas = 60oC. Viscocity of gas = 0.016 Mpa.s/Cp. Ki for butterfly valve = 0.24 Ki for 90o elbow = 0.75. OR Q8) a) Write short note on [9] i) Pipe supports. ii) Pressure drop in fitting and valves of process piping. iii) Natural gas piping. Calculate the pipe size based on following data. Fluid flowing through the pipe is carbon monoxide. Discharge pressure of carbon monoxide required from the pipe is atmospheric. [9] Available pressure at inlet of pipe = 50 kPa. Length of pipe = 4 km. Flowrate of CO = 1500 kg/hr. Temp. of gas = 50oC. No. of gate valves in pipeline = 2 No. of 45o elbow = 3 No. of 90o elbow = 6 Viscocity of CO = 0.018 MPa.s/Cp. Ki for gate valve = 0.17 Ki for 90o elbow = 0.75 Ki for 45o elbow = 0.35 A centrifugal pump draws benzene from an overhead tank. Operating pressure in the tank is 700 torr. Vertical distance betn. the free surface of liquid in tank and centerline of pump is 12 m. Maximum operating temp. is 50oC. Vap. pressure of benzene at 50oC is 280 torr. Density of benzene at 50oC is 870 kg/m3. Frictional loss in suctionline of pump is 1m. of benzene column. Calculate the NPSH of centrifugal pump. [6] Write short note on NPSH requirement of liquids saturated with dissolved gases. [5] Give classification of pumps. Explain in detail advantages & disadvantages of centrifugal and reciprocating pump. [5] OR

b)

Q9) a)

b) c)

[3764] - 333

-3-

Q10)a)

b)

c)

Write short note on [5] i) Routine / scheduled maintenance. ii) Preventive maintenance. A centrifugal pump is drawing methanol from an underground tank. Operating pressure in the underground tank is 1 atm. Vertical distance between centerline of pump and free surface of liquid in the tank is 3m. Maximum operating temp. is 50oC. Vapour pressure and density of methanol at 50oC are 400 torr and 785 kg/m3 respectively. Frictional loss is 1 m of liquid column. Calculate NPSH of centrifugal pump. [6] What are various types of compressor? Give advantages & disadvantages of each. [5] [16]

Q11)Write short note on : a) IBR & non IBR boilers. b) Factory Law. c) Hazop study. d) Petroleum rules. e) CPM & PERT Techniques. OR

Q12)A small engineering project consist of 9 activities. Three times estimates are given in following table. [16] a) Calculate values of expected time (te) standard deviation (St) and variance of each activity. b) Draw network diagram and mark te on each activity. c) Calculate EST & CFT & mark them on each activity. d) Calculate total slack for each activity. e) Identify critical path and mark on network diagram. f) Find the length of critical paths or the total project duration. g) Calculate variance of critical path. h) Calculate probability that the jobs on critical path will be finished by the due date of 38 days. i) Calculate the approximate probability that the jobs on next most critical path will be completed by the due date of 38 days. j) Estimate the probability that the entire project will be completed by due date of 38 days. k) If the project due date changes to 35 days. What is the probability of not meeting due date.

[3764] - 333

-4-

l)

Find the due date which has a probability of 94.5% of being met. Data : tm tp Activity to 1-2 2 5 14 1-6 2 5 8 2-3 5 11 29 2-4 1 4 7 3-5 5 11 17 4-5 2 5 14 6-7 3 9 27 5-8 2 2 8 7-8 7 13 31 Data : Standard Normal distribution Z Probability of meeting due or scheduled date 1 0.841 1.22 0.888 0.4 0.655 1.6 0.945

[3764] - 333

-5-

Total No. of Questions : 12]

[Total No. of Pages : 7

P1491

[3764]-334
B.E. (Chemical)
PROCESS MODELING & SIMULATION (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer any 03 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data if necessary.

SECTION - I Q1) a) Draw the flow chart of a systematic approach to process modeling showing the interrelations between the flow chart stages. Alongside each major step, list in point form the key issues for each major modeling task. [8] Provide a classification of the major categories of equations in process model. What are the subclasses in each major category. [8] OR Q2) a) b) What is process model? What points should be considered to form the model? [8] Give the classification of model. What is the difference between linear and nonlinear model? Explain with suitable examples. [8] Consider the following dynamic model of a constant volume, isothermal continuous stirred tank reactor, dVC A = q (CAO CA) V (K1 CA K3 C 2 ) = f1 (CA, q, CAO) A dt dVC B = q CB + V (K1 CA K2 CB) = f2 (CA, CB, q). dt
P.T.O.

b)

Q3) a)

Where CA, CB are the concentrations of component A & B respectively, V is reactor volume, q and C AO are the volumetric flow rate and concentration of the inlet stream, respectively. K1, K2 and K3 are reaction constants. Assume both q and CAO vary with respect to time. Find linear deviation model. [8] b) Consider the following dynamic model. dx1 = x1 + (1 + x1 ) u( t t0 ) = f ( x1 ,u(t t0 )) dt dx 2 2 = x1 x2 = f 2 ( x1 , x 2 ) dt Find the deviation model at the point x1 = x2 = u = 0. OR Q4) The following diagram shows the scenario of an evaporating pool of a volatile liquid. [8]

This is typical of an accident spill from storage facility. In this case the liquid is unsymmetric dimethyl hydrazine, a component of rocket fuel. Develop the problem description if we are interested in the dynamics of pool evaporation under the influence of different environmental conditions. You should consider the key issues of: [16] a) b) c) d) e) f)
[3764]-334

The modeling definition. The principle mechanism. The key assumptions. The principle balance volume of the system. The convective flows in the system. The key data that might be needed.
2

Q5) Write the component continuity equations describing the CSTR with a) Simultaneous reactions (first order, isothermal) k k2 1 C b) k1 Reversible (first order, isothermal) k2

c)

Write the component continuity equations for a perfectly mixed batch reactor (no inflow or outflow) with first order isothermal reactions. i) ii) Consecutive. Simultaneous. OR [18]

Q6) Benzene is nitrated in an isothermal CSTR in three sequential irreversible reactions. k Benzene + HNO3 1 nitrobenzene + H2O. k2 Nitrobenzene + HNO3 dinitrobenzene + H2O. k3 Dinitrobenzene + HNO3 trinitrobenzene + H2O. Assuming each reaction is linearly dependent on the concentrations of each reactant, derive a dynamic mathematical model of the system. There are two feed streams, one pure benzene and one concentrated nitric acid, 98% by wt. Assume constant densities and complete miscibility. [18]

[3764]-334

SECTION - II Q7) Consider a perfectly mixed stirred-tank heater, with a single feed stream and a single product stream as shown in figure given below. Assuming that the flowrate and the temperature of the inlet stream can vary, that the tank is perfectly insulated and that the rate of heat added per unit time (Q) can vary. Develop a model to find the tank temperature as a function of time. State your assumptions. [16]

OR Q8) Develop the equations for a double pipe heat exchanger where in the resistance to heat transfer from the condensing fluid to inner fluid can be represented by convective heat transfer coefficients on both sides of the heat transfer wall. Assume that the resistance of the wall is negligible but the wall has finite heat capacity. [16]

Q9) Consider the continuous stirred tank reactor system shown in figure. Stream 1 is a mixture of A & B with composition CA , CB (moles / volume) and has 1 1 a volumetric flow rate F1 and a temperature T1. Stream 2 is pure R. The reaction taking place are k A + R 1 P1 k2 B + R P2 1 2

[3764]-334

Both reactions are endothermic and have second order (reaction 1) and third order (reaction 2) kinetics. Heat is supplied to the reaction mixture by steam which flows through the coil immersed in the reactors content with a heat transfer area at. a) b) c) d) What are the state variables describing the natural state of the system. What are the balances which you should consider. Develop the state model for CSTR system. Define the assumptions that should be consider in order to have an isothermal reactor. [16]

OR k Q10)An isothermal irreversible reaction takes in a liquid phase in a constant volume reactor. The mixing is perfect. Observation of flow pattern indicates that a two tank system with back mixing as shown in fig. below, should approximate the imperfect mixing.

Assuming F and FR are constant give the mathematical model describing the system. [16]

[3764]-334

Q11)An ice cube is dropped into a glass of water at room temperature and then stirred. Develop a mathematical model describing the time varying behaviour of the system. This model should predict. The behaviour for both short term and long term dynamics. Typical values for the problem are 28C ambient temperature, glass liquid volume of 250 ml at an initial temperature of 24C and an ice cube of 25 cm3. Typical aspect ratio of the ice cube is 1:1.25 : 2.5 your tasks are to: [18] a) Prepare a model definition for this scenario in the form of modeling goal statement. Set out key controlling factors. Provide a labelled drawing of the balance volume and relevant flows. State all modeling assumptions. What data might be necessary? Where it can be obtained? Develop a mathematical model. Analyse the degrees of freedom. OR Q12)A biochemical reaction is carried out in a CSTR to convert a substrate being fed to the reactor into useful product. The substrate consumption follows variation of Micheles - Menten type Kinetics. [18]

b) c) d) e) f) g)

S1.5 . KS + S Where S is the substrate concentration in mol/L. Rate of substrate depletion (moles / L-min) =
max

[3764]-334

The following operational and Kinetic parameters are given. F/V = 5 min1, SO = 3 mol L1. KS = 1 mol L1,
max

= 2 mol0.5 L0.5 . min1.

Calculate the rate of substrate consumption (in md/s) under the given operating conditions.

[3764]-334

Total No. of Questions : 12]

[Total No. of Pages : 4

P 1629

[3764] - 335
B.E. (Chemical) COMPUTER AIDED PROCESS CONTROL (2003 Course) (Elective - II) (Semester - II)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Q2) a) b) c) Q3) a) Explain advantages of using digital computer in process control. [6] Distinguish between batch and continuous processes from process control view point. [6] With neat block diagram, explain DDC system in detail. [6] OR Explain the domain of various levels involved in heirarchical computer control systems. [6] Explain functions of HMI in detail. [6] Give historical background of use of computers in process control. [6] Explain state-space model of a m x n MIMO system. Define controllability and observability of such systems. Also state mathematical conditions for the same. [6] The input-output model for distillation column is given as follows x D (s) = x B (s) =

b)

0.5exp(s) 0.6 exp ( 1.1s ) R(s) V(s) (6s + 1)(3s + 1) ( 5s + 1) ( 2s + 1)


0.5exp(s) 0.3exp ( 1.3s ) R(s) V(s) (5s + 1)(s + 1) (5s + 1)(s + 1)

Where the vapour flow rate V(s), reflux rate R(s) are the input variables and the distillate composition x D (s), the bottom product composition x B (s) are the output variables.
P.T.O.

i) ii)

Find RGA for this system. Based on the RGA, select the best pairing of input-output variables which will result in control loops having minimum input-output interactions. iii) If the resulting control loops still possess significant interaction between them, design two decouplers that will produce noninteracting control loops. [10] OR Q4) a) i) Draw block diagram showing input-output interactions for a 2 x 2 system having 2 inputs u1 , u2 and 2 outputs y1 & y2 . State inputoutput model for this system. Define RGA for the above system. State properties of RGA and explain the rules for selecting the best pairing of input-output variables that will result in minimum interaction between the loops. [6] State mathematical conditions for the observability and controllability of a MIMO system modeled as X = AX + Bu, Y = CX. Test controllability and observability of the system having statespace matrices.
6 18 6 2 B= 3 2 A= 3 1 , , C = [1 3 1] 4 8 3 7

ii)

b)

i)

ii)

[10]

Q5) a)

b)

A discrete time signal is represented by following sequence of sampled values Time (t) 0 T 2T 3T 4T 5T 6T Signal y*(t) 1 2 4 8 16 32 64 Where T is sampling interval in sec. i) Sketch the above signal. ii) Construct the original continuous - time signal using ZOH and FOH elements. Sketch the signals so obtained. State mathematical equations for the signals. [10] State the stability criteria for the system having discrete time transfer function.

D(z) =

c(z) a0 + a1z 1 + a2 z 2 +.... +am z m = e(z) 1 + b1z 1 + b2 z 2 +..... +bn z n

Also state the graphical stability criteria in Z-domain. Compare the stable and unstable regions in s-plane and z-plane. [6]
[3764] - 335 -2-

OR Q6) a) A DDC system has


G P (s) = 10 ( 0.1s + 1) ( 2s + 1)

H(s) =
D(z) =

1 exp( Ts ) s
kc T 1 + z 1 1 1 z I

b)

Find pulse transfer function HGP(z) and hence the characteristic equation. ii) Comment on nature of roots of characteristic equation and hence on stability of the system for kc = 0.1, I = 1, T = 1 [12] kc = 0.1, I = 1, T = 50 Compute initial and final values of continuous-time signal y(t), which has z-domain transfer function in the form. y (z) = 0.39z 1 (1 z1 ) (1 0.61z1 ) SECTION - II [4]

i)

Q7) a) b)

State importance of interface in computer-control system. Explain different types of process-related interfaces. [8] State importance of communication in computer-control systems. Explain communication heirarchy for process control. [8] OR Explain different topologies used in networking computers used for process control purpose. [8] Explain data transfer techniques-polling and interrupt. [8] Explain basic components of a DCS system. With neat block diagram, explain basic components of a PLC. OR [8] [8]

Q8) a) b) Q9) a) b)

[3764] - 335

-3-

Q10)a) b)

Explain the following protocols used in DCS communication systems CSMA / CD, token ring, token bus. [8] Distinguish between PC & PLC. State advantages of using PLC for process control over DDC systems. [8] Explain the distinguishing features of process control design problem. Explain the sequence of steps followed in process control, design. [10] Explain temporal heirarchy of control structures in plantwide control systems. [8] OR [18]

Q11)a) b)

Q12)Write short notes on the following : a) Integration of control design methods. b) Definition of design problem.

[3764] - 335

-4-

Total No. of Questions : 10]

[Total No. of Pages : 4

P1523

[3764]-354
B.E. (Polymer)
MOULD AND DIE DESIGN (2003 Course)

Time : 4 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer question 1 or 2 and 3 or 4 from Section I. Answer 5 or 6, and 7 or 8 and answer question 9 or 10 from Section II. 2) Figures to the right indicate full marks. 3) Use of calculator, log paper and log-log paper is allowed. 4) Draw neat sketches wherever required. 5) Assume suitable design data, if required.

SECTION - I Q1) a) Design and draw a two cavity two plate mould for the component shown in Fig. 1. Draw at least two views with one cross sectional view to bring out all the details of feed system, ejection system and cooling system. Material : HDPE. Cavity pressure = 300 kg/cm2. [35] Calculate and justify the size and type of runner and gate used in (i) above. [5] Design and draw a two Cavity three plate mould for the component as shown in Fig. 2. Draw at least two views with one sectional view to bring out all the details of feed, ejection and cooling system. Material : ABS Cavity pressure : 300 kg/cm2. [35] Calculate and justify the size and type of runner and gate used in (i) above. [5] Draw neat sketches of any two plastic products which require split mould construction. Indicate clearly on the drawing split portion. [6] Explain with a neat sketch spring loaded plunger design for split safety. [4]

b)

Q2) a)

b)

Q3) a) b)

Q4) List the various methods for split actuation. Explain any one in detail with a neat sketch. [10]
P.T.O.

SECTION - II Q5) a) Write a process sheet for parallel blocks. Assume the drawing and details. Also give process sheet for locating ring assuming suitable drawing. Draw neat sketches of parallel block and locating ring. [10] Explain why it is important to maintain parallelity of mould faces. [6] Explain the process of wire cutting EDM. Explain polishing and buffing operations. Discuss mould maintenance practices. Explain antechamber nozzle design with a neat sketch. [8] [4] [4] [8]

b) Q6) a) b) c) Q7) a) b)

Explain various types of shut off valves used in hot runner moulds with neat sketches. [8] State important design features and factors taken into account for hot runner moulds. [8] Give merits of hot runner mould over underfed moulds. [4] Explain how expansion of manifold is taken care of in hot runner mould design. [4]

Q8) a) b) c)

Q9) Write in short about different types of blown film dies. Draw neat sketches. Write in short about major parts and their function. [18] Q10)a) b) Draw a neat proportionate sketch of cross head type pipe die and write in short about major parts and their function. [10] Give mathematical formulae for pressure drop due to shear, due to elongation and pressure drop at entry in case of wedge shaped die. [8]

[3764]-354

[3764]-354

[3764]-354

Total No. of Questions : 12]

[Total No. of Pages : 7

P1493

[3764]-361
B.E. (Polymer)

INDUSTRIAL MANAGEMENT AND PROCESS ECONOMICS (2003 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Attempt Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from Section I. Attempt Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) What are the elements of costing? Explain each of them. Explain: i) ii) P/V Ratio. Break even point. Rs. 20,000. Rs. 10,000. Rs. 5,000. OR Q2) a) b) What are the factors which must be taken into account before selecting a plant location? List and discuss each of them. [9] Per unit cost structure of a single product manufacturing company is as below: [8] Selling Price Direct Material Direct labour Variable overheads Rs. 100 Rs. 60 Rs. 10 Rs. 10
P.T.O.

[8] [9]

Following details are available for ABC Company Ltd. Actual Sales Break even sales Fixed cost

Find P/V ratio and profit at actual sales.

Number of units sold in the year are 5035. If there is an increase of 10% in direct labour Find i) ii) How many more units to be sold next year to maintain the same profit. By what percentage the selling price has to be raised to maintain same P/V ratio.

Q3) a)

A machine costing Rs. 1,00,000 is to be purchased as below: Rs. 20,000 - Down payment out of own contribution. Rs. 80,000 - Borrowing by way of term loan. To be paid in four equal annual instalments alongwith the interest @ 15% p.a. (the interest being computed on opening outstanding balance). Calculate present value of the cash out flow. [5]

b) c)

What are the factors affecting fixed capital requirement? Explain. [6] What is accounting rate of return? A project involves the investment of Rs. 5,00,000 which yields profits after depreciation and tax as stated below: Years 1 2 3 4 5 Profits Rs. 25,000 Rs. 37,500 Rs. 62,500 Rs. 65,000 Rs. 40,000

At the end of five years, the machineries in the project can be sold for Rs. 40,000. Find the accounting rate of return. [6] OR Q4) a) Calculate net present value of a project involving initial cash outflow of Rs. 1,00,000 and generating annual cash inflows of Rs. 35,000, Rs. 40,000, Rs. 30,000 and Rs. 50,000. Discounting rate is 15%. [5]
2

[3764]-361

b) c)

What is capital structure? Which factors affect the capital structure decisions? [6] Explain: i) ii) Preference shares. Debentures. [6]

Q5) a) b)

Explain the need for depreciation.

[5]

Calculate the amount of depreciation for the following data using straight line method. [5] Cost of asset Estimated scrap value Estimated life Rs. 3,00,000. Rs. 20,000.

10 years. [6]

c)

Describe the types of budgets. OR

Q6) a) b)

Explain the production hour method for depreciation.

[5]

The cost of machine is Rs. 1,10,000 and its estimated scrap value is Rs. 10,000. The estimated number of units to be produced during the life of the asset is 50,000 units. If 7,000 units are produced in a particular year, find the depreciation value using production unit method. [5] What are the merits of budgetary control? SECTION - II [6]

c)

Q7) a)

Solve the following LP problem using simplex method. Maximize Subject to Z = 4x1 + 3x2 + 6x3 2x1 + 3x2 + 2x3 440 4x1 + 3x3 470 2x1 + 5x2 430 x1, x2, x3 0

[9]

[3764]-361

b)

Find the sequence that minimizes the total elapsed time required to complete the following tasks: Tasks : A 2 6 B C 5 8 4 7 D 9 4 E 6 3 F 8 9 G H 7 3 5 8 I 4 11

Time on machine I : Time on machine II :

Calculate the minimum elapsed time corresponding to optimal sequencing. Calculate the total idle time for the machines in this period.[8] OR Q8) a) Solve the following transportation problem: Destination A I Source II III Requirement b) 21 17 32 6 B 16 18 27 10 C 25 14 18 12 D 13 23 41 15 11 13 19 43 [8] 4 11 8 11 9 Availability [9]

Solve the following assignment problem. 1 A B C D 10 5 12 8 2 12 10 14 15 3 19 7 13 11

[3764]-361

Q9) a)

A project has the following time schedule: Activity (1-2) (1-3) (2-4) (3-4) (3-5) (4-9) (5-6) Time in weeks 4 1 1 1 6 5 4 Activity (5-7) (6-8) (7-8) (8-9) (8-10) (9-10) Time in weeks 8 1 2 1 8 7

[9]

Construct PERT network and compute. i) ii) b) Total float for each activity. Critical path and its duration.

A company manufactures goods for a market in which the technology of the products is changing rapidly. The research and development department has produced a new product which appears to have potential for commercial exploitation. Further Rs. 60,000 is required for development testing. The company has 100 customers and each customer might purchase, at the most, one unit of the product. Market research suggests a selling price of Rs. 6,000 for each unit with total variable costs of manufacture and selling estimate are at Rs. 2,000 for each unit. As a result of previous experiment of this type of market, it has been possible to derive a probability distribution relating to the proportions of customers who will buy the product as follows: Proportion of customers : Probability : 0.04 0.10 0.08 0.10 0.12 0.20 0.16 0.40 0.20 0.20

Determine the expected opportunity losses, given no other information than that stated above, and to state whether, or not, the company should develop the product. [8]

[3764]-361

OR Q10)a) A small marketing project consists of the jobs in the table given below. With each job is listed its normal time and a minimum or crash time (in days). The cost in (Rs. per day) of crashing each job is also given: [10] Job (i j) (1-2) (1-3) (1-4) (2-4) (3-4) (4-5) i) ii) b) Normal duration (in days) 9 8 15 5 10 2 Minimum (crash) Cost of crashing duration (in days) (Rs. per day) 6 5 10 3 6 1 20 25 30 10 15 40

What is the normal project length and the minimum project length. Determine the minimum crashing costs of schedules ranging from normal length down to, and including, the minimum length schedule.

For the following pay off matrix for firm A, determine the optimal strategies for both the firms and the value of the game? [7] Firm B
3 1 16 1

1 8 8 11

4 2 6 4

6 4 14 2

7 12 12 1

Firm A

Q11)a)

A XYZ company has to supply his customers 100 units of a certain product every monday. The company obtains the product from a local supplier at Rs. 60 per unit. The costs of ordering and transportation from the supplier are Rs. 150 per order. The cost of carrying inventory is estimated at 15% per year of the cost of the product carried. [7] i) ii) Find the lot size which will minimize the cost of the system. Determine the optimal cost.
6

[3764]-361

b)

A company uses annually 50,000 units of an item, each costing Rs. 1.20. Each order costs Rs. 45 and inventory carrying costs 15% of the annual average inventory value. i) ii) Find economic order quantity. If the company operates 250 days a year, the procurement time is 10 days and safety stock is 500 units, find the reorder level, maximum, minimum and average inventory. [9] OR

Q12)a)

Find the optimal order quantity for a product for which the price breaks are as follows: Quantity 0 q1 < 500 500 q2 Unit cost (Rs.) 10.00 9.25

The monthly demand for a product is 200 units, the cost of storage is 2% of unit cost and the cost of ordering is Rs. 100. [8] b) Perform ABC analysis on the following sample of items in an inventory: [8] Item name A B C D E F G H I J Annual consumption 300 2800 30 1100 40 220 1500 800 600 80 Price per unit (in Rs.) 10 15 10 5 5 100 5 5 15 10

Y
[3764]-361 7

Total No. of Questions : 12]

[Total No. of Pages : 4

P1565

[3764]-362 B.E. (Polymer)


SPECIALITY POLYMERS
(2003 Course) (Elective)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) 7)

[Max. Marks : 100

Answer 3 questions from Section-I and 3 questions from Section-II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Your answers will be valued as a whole. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Define Liquid Crystalline Polymers. Give their classification. b) List a few commercial Liquid Crystalline Polymers. c) What is a mesophase? d) List and show pictorially different types of mesophases. [5] [3] [2] [4]

e) Explain in brief structural factors responsible for liquid crystalline behaviour. [4] OR Q2) a) What is a mesogen? [2]

b) Classify LCPs based on presence of mesogen in a chain. Give suitable examples. [6] c) Draw typical structures of MCLCP and SCLCP. d) State the properties of LCPs. [6] [4]
P.T.O.

Q3) a) Explain in brief the band theory of conduction in conducting polymers. [6] b) Name a few conducting polymers and list their applications. c) Draw structures of 5 conducting polymers. OR Q4) Justify with suitable structures polypyrole and polyaniline are conducting polymers. [16] Q5) Answer the following questions: a) List the structural criteria required to get heat resistance in a polymer.[5] b) Give examples of heat resistant polymers with structure. At least three. [4] c) What are the applications of heat resistant polymers. [4] [5] [5]

d) Polyparaphenylene is the most heat resistant polymer but has no commercial significance. Why? [3] OR Q6) Discuss synthesis, properties and applications of any 4 heat resistant polymers. [16] SECTION - II Q7) a) What are photosensitive polymers? Give three examples of synthetic photopolymers. [4] b) What are photoresists? Explain what are positive and negative photoresists. Give applications of these. [6] c) With the help of a reaction show how photocrosslinking occurs in polyvinylcinnanate. [3] d) Define a membrane. Give the various methods for manufacturing membranes. [5]
[3764]-362 -2-

OR Q8) a) How is a photoresist applied on a substrate? [6]

b) State various applications of photosensitive polymers. Explain any one in detail. [6] c) Which polymeric materials are used in the making of membranes? [3] d) State the various applications of polymeric membranes. [3]

Q9) a) What are biopolymers? How are synthetic biopolymers made? Explain any two case studies. [6] b) What are the physical properties required to choose a polymer for use in biomedical application? [4] c) What is the role of polymer in drug delivery systems? Explain the mechanism. [6] OR Q10) a) List the various polymers used in biomedical devices with corresponding biomedical uses and properties. [6] b) State the different orthopaedic fixation devices with polymers used for the same. [6] c) Write a short note on biocatalysts. Q11) a) Write a note on polymers used in green house applications. [4] [5]

b) What are the reasons for increasing use of plastics in construction both structural and non-structural? State the share of various plastics in construction. Give corresponding applications of each plastic. [5] c) What is telecommunication? Define fiber optics. Where are they used? State the principle used in fiberoptic cables. [6]

[3764]-362

-3-

OR Q12) a) How are polymers used for controlled release of agricultural chemicals? What are its advantages and disadvantages? What are the desirable properties required of the polymer used in the coating? [6] b) What is a polymer concrete? State its advantages and disadvantages. State its applications. What are polymer impregnated concretes? [6] c) How are optical fibers made? What are its advantages? rrr [4]

[3764]-362

-4-

Total No. of Questions : 12]

[Total No. of Pages : 3

P 1595

[3764] - 363
B.E. (Polymer) FIBER TECHNOLOGY (2003 Course) (Elective)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answers to Section-I and Section-II should be written on separate answer books. 2) Solve 3 questions from Section-I and 3 questions from Section-II. 3) Neat diagrams should be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Assume suitable data, if necessary. 6) Use of electronic pocket calculator is allowed.

SECTION - I Q1) a) b) c) d) Briefly explain unique properties of Synthetic fibers. [5] Why polyester fabric/clothes do not need ironing while cotton fabrics/ clothes do? [2] What are the various Spinning techniques used in Fiber manufacture? With neat sketch, explain any one in detail. [6] What are the advantages and disadvantages of High Speed Spinning process? [5] OR Q2) a) b) c) d) What are the criteria for polymers to form fibers? [5] Explain in detail Classification of Fibers. [6] Compare between Wet and Dry Spinning processes. [4] Enlist 3 important coagulation and spinning variables directly related to fiber formation by Wet Spinning process. [3] What are the various sources of Natural fibers? Give at least one example of each. [4] Mention the advantages of Terephthalic acid (TPA) over Dimethyl terephthalate (DMT) in manufacture of polyethylene terephthalate (PET) polymer. [6] Write a short note on Side Reactions during PET Synthesis. [6] OR
P.T.O.

Q3) a) b)

c)

Q4) a) b) c) d)

Under which categories Cotton, Viscose Rayon and Carbon fibers are classified? Justify. [3] In PET synthesis, why 2 step reaction is preferred. Give its advantages. [5] Comment about the effect of Diethylene Glycol (DEG) formation on PET polymer, and its fiber properties. [5] Give the list of raw materials used to synthesize Nylon 66 and Nylon 6 polymers used for fiber applications. [3] Why man-made fibers can neither be produced or processed through textile operations without Spin Finish? [3] Enumerate any 6 desirable properties of Spin Finish. [5] Give various techniques to produce Textured Yarns. Explain any one in detail. [5] Why is it necessary to carry out stretching or drawing of synthetic fibers? [3] OR

Q5) a) b) c) d)

Q6) a) b) c) d)

What are the various ingredients of Spin Finish? Give one example of each. [4] What are the different methods of application of Spin Finish? Explain any one in detail. [4] Briefly explain Texturing Process Variables. [5] Synthetic fibers/filaments need texturing or crimping while in natural fibers it is not necessary. Explain. [3] SECTION - II

Q7) a) b) c)

Give in detail the steps involved in Staple Fiber production. [6] Explain the structural changes that take place during spinning. [6] Explain why drawing and heat setting is required for fibers, and what properties are enhanced by carrying out these two processes? [6] OR

Q8) a) b)

Give the steps involved in Yarn production for Natural fibers. [6] Define Staple Yarn and Filament Yarn. What is meant by Filament Denier? If 100 denier is produced by 20 filaments and also by 60 filaments, then, find Filament Denier. Which one will be used for rugged application fiber? [6]
-2-

[3764] - 363

c)

Give the importance of Identification of Fibers and what are the methods used for identification? [6] What is meant by Mass Colouration? What are the advantages and disadvantages of this process? [6] Give the difference between Dyes and Pigments. Explain the following terms (Any 5) :[10] Mordant. Direct Dyeing. Reactive Dyes. Vat Dyes. Chromophore. Acid Dye. Basic Dye. OR

Q9) a) b)

Q10)a) b)

Explain all the 6 methods of Mass Colouration in detail. [8] Explain Carrier dyeing, High temperature dyeing and Thermosol dyeing. [8] Explain in detail why fibers need modification. Explain the following : Acrylan. Casein. Cuprammonium. Saran. Modacrylic. Spandex. Give methods to modify Nylon. OR [6] [6]

Q11)a) b)

c)

[4]

Q12)a) b)

Give all the modifications done to Polyester fiber to improve it in all its drawbacks. [12] Explain the term Barriness. Why does it happen and how to avoid it? [4]

[3764] - 363

-3-

Total No. of Questions : 12]

[Total No. of Pages : 5

P1566

[3764]-364
B.E. (Polymer)
MECHANICS OF COMPOSITES (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer any 3 questions from Section I and 3 questions from Section II. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) d) Write in short about E and S type of glass fibres used in fibre reinforced composites. [3] Write Griffiths formula for strength of brittle fibres. [3] Give theoretical formulae for calculation of fibre content, density and void content. [4] Discuss resin transfer molding. Give schematic sketch of the process and discuss process variables. [8] OR Q2) a) b) c) Draw a schematic sketch of polar winding and give process variables for fibre met out. [6] Write in brief about hand lay up and spray technique and its applications. [6] Give Darcys equation for resin flow and explain gel time test for determining Curing characteristics of resin catalyst combination. [6] A unidirectional glass epoxy lamina as shown below has following allowable stresses. i) ii) Tensile failure strength in the longitudinal direction
LU

Q3) a)

= 106 2MPa.

Compressive failure strength in longitudinal direction LU = 610MPa.


TU

iii) Tensile failure strength in transverse direction

= 31a .
P.T.O.

iv) Compressive failure strength in transverse direction TU = 118a . v) Shear strength


LTU

= 72 MPa.

Determine if, according to maximum stress theory, the lamina will fail under applied stress. [6]

Applied stresses are

x y xy

= 50 MPa = 25 MPa = 50 MPa

b)

State Tsai - Hill failure criteria for biaxial stress system. Explain how failure strength parameters are related to uniaxial failure strength. Reduce the criteria to unidirectional lamina. [8] Define coefficient of mutual influence of first kind by Lekhnitski. [2] OR

c)

Q4) a) b) c)

Explain the concept of invariant form of stiffness and compliance. Give example of any one invariant in terms of stiffness. [5] Explain how you will determine the strength tensor of fourth order as defined in Tsai - Wu tensor theory. [6] Explain the limitation of maximum stress and minimum strain failure criteria for biaxial stress system. [5]

[3764]-364

Q5) a) b)

Derive an expression for longitudinal Youngs modulus E11, in terms of fibre and matrix modulus. [8] Prove the rule of mixture for major Poissons ratio 12 in terms Poissons s ratio for fibre and Poissons ratio for matrix using mechanics of materials approach. [8] OR

Q6) a)

Explain how you will calculate following elastic constants of a unidirectional discontinuous 0 lamina. [8] i) E11 ii) iv) E22
12

iii) G12 b)

For a sheet molding compound, data for the fibre and matrix is as follows for fibre. Ef = 68 GPa; for matrix Em = 3.45 GPa;
m
f

= 2 . 5 4 kg/mm3;

lf = fibre length = 25 mm; df = fibre diameter 2.5 mm. = 1.1 kg/mm3 [8]

Calculate tensile modulus, shear modulus and Poissons ratio. SECTION - II Q7) a) For a laminate with following configuration calculate extensional stiffness [A], coupling stiffness [B] and bending stiffness [D] matrices. Each lamina is 1 mm thick and has 50.% fibre. Following properties of the lamina are known. [12] E11 = 100 GPa; G12 = 5 GPa E22 = 10 GPa;
12

= 0.2

b)

Give features of symmetric laminate with multiple generally orthotropic layers. Give features of symmetric angle ply laminate comment on elements of stiffness matrix. [6]
3

[3764]-364

OR Q8) a) A two ply laminate is as shown below: [12]

Both the laminae have identical [Q] matrix as given below: 20 0 . 7 0 0 GPa 0 . 7 2 0 0 0 . 7 i) ii) b) Calculate [A] [B] & [D] matrix. If force of Nx = 1000 N/mm is applied.

Calculate stresses and strains in the individual plies. Give examples of symmetric laminate with multiple specially orthotropic lamina. Comment on elements of the [A], [B] & [D] matrix. [6] A sandwich molding is made up of were and inner / outer skin material. The [Q] matrix for were as well as skin material is given below: [12] 4 10 3 1.5 103 0 gN 3 4 10 3 0 2 [Q]were = 1.5 10 3 m 0 1.2 10 0 75 30 0 30 75 0 0 0 20

Q9) a)

[Q]skin =

Each 1 mm thick, if moment of 400 N m/m is applied to this sandwich structure, find resulting curvatures and stresses and strains. Show stress - strain variation graphically. b) Explain the benefit of using sandwich structures in place of solid sections in structural applications of beam. [4] OR

[3764]-364

Q10)a)

Obtain the deflections of a beam clamped at both ends as shown below.

Assume that the beam of length L has a symmetric lay up and carries a uniformly distributed lead P0. [8] b) Give stepwise design procedure for design of a torsional member like automotive shaft. [8] Give test configuration of 10 off axis test to measure in - plane shear properties. Explain the strain gauge rosette arrangement and how measured. b)
12

Q11)a)

is [8]

Give schematic arrangement for charpy, Izod and drop weight impact tests. [8] OR Give test arrangement for Celanese compression test. Show schematically various failure modes in pin bearing test. [6] [4]

Q12)a) b) c)

Give average strength and variance formulae for two parameter Weibull distribution. [6]

[3764]-364

Total No. of Questions : 8]

[Total No. of Pages : 2

P1494

[3764]-375
B.E. (Petroleum)

REFINING AND PETROCHEMICAL TECHNOLOGY (Elective - I) (2003 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed.

SECTION - I Q1) a) b) With the help of diagram, describe two stage electrostatic desalting of crude oil in detail. [12] Enlist desirable as well as undesirable reactions taking place in a catalytic reformer. [6] Describe with flow sheet the process of catalytic hydrodesulfurization. [10] Define and explain each of the following: [6] i) API Gravity of crude oil. ii) Diesel Index. With the help of flow sheet, discuss the process of delayed coking in detail. [10] Elaborate on 'Types of Petroleum Coke'. [6]

Q2) a) b)

Q3) a) b)

Q4) Write short notes on (Any 4): a) Composition of Petroleum. c) Gasoline e) Asphalt.

[16] b) d) f) Crude oil properties. Diesel Additives. Bitumen Blowing.


P.T.O.

SECTION - II Q5) a) b) With the help of flow sheet, explain the production of ethylene oxide from ethylene and oxygen. [10] Give end uses of each of the following: i) ii) Methanol. Butadiene. [6]

iii) Formaldehyde. Q6) a) b) c) Q7) a) b) With the help of flow sheet, describe the process for conversion of ethylene to polyethylene. [10] Mention health and handling precautions and applications of acetic acid. [6] Give at least two end uses of ethylene glycol. [2]

Describe with flow sheet any one process for manufacture of isopropyl alcohol. [10] Mention health and handling precautions and applications of acetone.[6] [16]

Q8) Write short notes on (Any 4): a) b) c) d) e) f) Aromatics production in petroleum refineries. Steam cracking of gas oils and naphthas. Industrial manufacture of cumene. Acetaldehyde. Acrylonitrile. PVC.

[3764] - 375

Total No. of Questions : 8]

[Total No. of Pages : 5

P1617

[3764]-378
B.E. (Petroleum Engineering)
RESERVOIR ENGINEERING - II (2003 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6) 7)

[Max. Marks : 100

Answers to the two sections should be written in separate answer books. Question No. 4(four) and 7(seven) is compulsory. Figures to the right indicate full marks. Neat diagrams must be drawn wherever necessary. Use of a non-programmable calculator, log-log, semi-log paper is allowed. Assume suitable data, if necessary. If you attempt Question No. 7 (seven), detach Figure one (1) from the question paper and attach it inside the answer booklet.

SECTION - I Q1) Derive the Buckley Leverette equation. What are the assumptions? Explain the usefulness of this equation. [16]

Q2) a) b) c)

Explain all the thermal EOR techniques. What is the screening criteria for steam flooding? Explain why such a screening criteria is necessary.

[6] [4] [6]

Q3) a) b) c)

What is the screening criteria for Surfactant Polymer flood.

[4]

Draw and explain a surface equipment layout for the above process.[6] Explain why you require this screening criteria for part Q3a. [6]

Q4) a) b) c)

State four elements of Polymer Design and In-Situ Combustion? Name and explain any one model in Thermal EOR. Define MMP, CDC, Cosurfactant, Cosolvent, UL and LL phases.

[6] [6] [6]


P.T.O.

SECTION - II Q5) a) b) c) When is reservoir simulation done? Explain gridding and grid refinement.
2

[2] [2]

p
2

p = x

p is the given equation for flow in porous media. t

Formulate the discretised equation using a 3 point stencil for the second derivative and use it to solve the PDE using the crank nicolson method. [12] Q6) a) Given a one-dimensional reservoir, with the following data, set up the matrix using the Implicit method. L = 400 ft, ct = 5E-6, P(x, 0) = 5000 psi, P (400, t) = 0 psi, P(0, t) = 5000 psi, viscosity = 5 cp, permeability = 5 md, porosity = 20%. [12] Show the solution profiles for different times on a P-x diagram and the steady state solution. [4]

b)

Q7) Hanofer Oil Field, Eastern Europe, has an isopach map and production history from one of its wells given in Figure 1 and 2. In figure 2, series 2 denotes actual production and series 3 denotes simulated production. Assume any other data and clearly state it. If you attempt this question, attach figure 1 inside the answer booklet. Discovery Date : No. of Producing wells Formation type Depth Average Porosity Average Permeability Average Water saturation Reservoir Temperature Residual Oil Saturation Oil viscosity at reservoir temperature Water viscosity at reservoir temperature Initial Reservoir Pressure Oil Gravity IFT between oil and water
[3764] - 378 2

Jan, 86 One (shown by triangle) sandstone 5000 ft 11% 43 md 17% 154 F 0.27 6 cp 1 cp 2422 psia 25 API 23 dyne/cm

a) b)

Where will you drill the next well? To what depth? Explain.

[4]

What waterflood pattern do you recommend? Show it on the isopach map stating clearly injectors and producers. When do you recommend the initiation of the water flood project? Why? [4] After waterflooding the field, the residual oil saturation is as above. A salesperson proposes a new chemical which may increase oil recovery after waterflooding. Properties of the chemical are in table 1. Evaluate the potential of this chemical to mobilize this residual oil. Table 1 : New Chemical pH Viscosity Density IFT 9.4 40 cp 68.6 1bm/cuft 0.1 dyne / cm [10]

c)

Write no more than 200 words for your analysis.

Q8) Write an essay on Reservoir Simulation. Mention different software packages and their drawbacks. [16]

[3764] - 378

[3764] - 378

[3764] - 378

Total No. of Questions : 12]

[Total No. of Pages : 6

P 1618

[3764] - 379

B.E. (Petroleum) PETROLEUM PRODUCTION ENGINEERING - II (2003 Course) (412389)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Q. No. 1 or 2, Q. No. 3 or 4, Q. No. 5 or 6 from Section-I Q. No. 7 or 8, Q. No. 9 or 10, Q. No. 11 or 12 from Section-II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) Derive an equation and show that for a properly counterbalanced unit the unbalanced force is equal during the upstroke and downstroke and is equivalent to one-half the fluid weight. [8] Draw the schematic sketch and show various factors influencing the shape of dynomometer cards. [8] OR Q2) a) A well is to be put on sucker rod pump. The proposed pump setting 7 depth is 7200 ft. in 2 inch tubing O.D./I.D. is 2.875 / 2.441 inch. The 8 3 7 unit utilizes a rod string consisting of inch and inch rods and operates 4 8 at 17 spm. Calculate, effective plunger stroke, tubing and rod stretch, polished rod stroke and overtravel if 60 bbls/day are to be produced. Assume volumetric efficiency of 0.8. Oil is having a Sp. gravity of 0.83 is at a level of 5,900 ft in the casing annulus. The elastic constant for the rod string is 0.774 x 106 in/lb/ft. Modulus of elasticity for steel, 30 x 106 psi. [14] Explain the meaning of pumping unit designation, in case of SRP. [2]

b)

b)

P.T.O.

Q3) a)

b)

c) Q4) a)

Following data is given. Draw the graph and find the point of gas injection (only one point). Also calculate the required gas volume daily injection rate. Perforation depth is 7000 ft. Formation pressure is 2,500 psi. Wells P.I. is 2.5 bpd/psi. The well produce daily 600 barrels with a formation GLR of 100 scf/ bbl. (gradient 320 psi/1000 ft). 3 Existing tubing size is 2 inch. O.D. and a WHP of 200 psi. 8 Lift gas of 0.75 gravity is injected with surface injection pressure of 800 psi and gas gradient 26 psi / 1000 ft. GLR belonging to expected pressure traverse connecting injection point and WHP is 250 scf/bbl. [8] Draw the typical design sheet of an intermittent gas lift, pressure-depth relationship. Show various features on this graphical construction. Also, write the general design procedure in brief. [8] Draw the neat schematic sketch of, any one type of gas lift valve. [2] OR Explain in brief (any two) i) gas slippage. ii) liquid holdup. iii) liquid fallback. [4] What is spread for a casing pressure operated valve? Derive the equation to calculate spread for any one type of unbalanced bellows valve and explain the significance of it. [6] Suppose the surface opening pressure of a pressure valve is 750 psi. Find the opening pressure at depth, the closing pressure at depth and the surface closing pressure. Given the following :Tubing pressure = 500 psi. Valve depth = 6000 ft. R = 0.1. Average temperature = 110 oF. Gas Sp. gravity = 0.6. F = 0.133. [8] Describe various artificial lift methods other than ESP, SRP and gas lift. [8] Draw the neat schematic sketch and show various stages in a subsurface pumping cycle for SRP. [4] Explain the working of any one type of gas lift valve. [4]

b)

c)

Q5) a) b) c)

[3764] - 379

-2-

OR Q6) a) Draw the neat schematic sketch of a typical set-up for surface and subsurface operations of an electrical submersible pump and explain the purpose of protector, pump intake and valves used in the assembly. [8] Refer the given data and calculate total dynamic head, no. of stages required and motor horsepower required for an ESP. Given data : Desired rate = 9,000 b/d. P.I. = 9 b/d/ft. of drawdown. Static fluid level 400 ft. from the S/C Surface flowline = 2,500 ft. of 4 inch, with elevation rise of 40 ft. For this friction loss is 40 ft./ 1000 ft. Perforations = 1850 - 2300 ft. Wellbore depth = 2300 ft. Tubing friction loss given = 19.5 ft./1000 ft. From the performance curve, it is recommended to use the pump which gives 62.50 ft. of head per stage; while horsepower required is 6 hp per stage. [8] SECTION - II Q7) The following data apply to the gas well. Determine the flow capacities and gravel pack pressure drops for 4, 12 and 24 perforations per foot for two tubings. pwfs Vs qsc and pwf variation for tubing size 1.995 and 2.441 in. tubing is given in following tables for further calculations. g = 0.82 Ts = 100 oF ptf = 1200 psia. H = 13350 ft. TR = 273 oF = 0.0006 in g = 0.012 Cp r = 1040 ft. r = 0.5 ft.
e w

b)

S=0 h = 20 ft.

P R = 5400 psia Perforation diameter = 0.7 inch.

Z = 0.97 (Compressibility factor) Formation permeability = 130 md. Gravel permeability = 45 darcys. Screen O.D. = 3.06 inch. Hole diameter = 12.25 inch.

[3764] - 379

-3-

qsc Mscfd 5,000 10,000 20,000 30,000 qsc Mscfd 5,000 10,000 15,000 20,000 30,000

pwfs psia 5384 5364 5317 5257 pwf. (psia) d = 1.995 inch. d = 2.441 2385 1974 3786 2606 5358 3405 6987 4168 10080 5998 OR

[18]

Q8) What is problem well analysis? Describe the same for various workover jobs. Write the step wise approach to identify the productivity problem for an oil and gas well. Explain in detail the overall system analysis to be applied for a self flowing field. Draw necessary graphs. [18] Q9) a) Use any two standard equations and calculate pressure drop in 6 inch. gas pipeline. Following data is given. Gas flow rate = 20 MMscfd. Viscosity = 2.7 Cp. Gas gravity = 0.80. Z = 0.69 Pipe line length = 6,500 ft. Inlet pressure = 850 Psi. Temperature = 85 oF. Assume friction factor = 0.0182 for old steel pipe line. Quote the assumptions of the equations you have used. [8] Use Hazen-Williams equation to calculate the pressure drop in a liquid pipe line. Given data : Oil flow rate = 900 bpd. Water = 220 bpd. Sp. gravity oil = 0.89 Water = 1.07 Viscosity = 6 Cp Length = 8,500 ft. Inlet pressure = 850 psi. Temp. = 85 oF. [4] Assume friction factor constant, dimensionless as 120, for an old steel pipe line of diameter 4 inch. Write Bernoullis equation and explain the three heads in it. [4] OR
[3764] - 379 -4-

b)

c)

Q10)A 0.55 - gravity gas flowing at 100 MMscfd is to be transported via long pipe line. The upstream pressure is 1000 psia, and down stream pressure is to be 800 psia. Gas temperature is 45o F. Recommend pipe size. Neglect the change in elevation. Average pressure = 904 psia. Zm = 0.87. Assume pipe roughness = 0.001 in. While selecting diameter roundup in inches and explain how will you verify whether allowable pressure is more than the design pressure or not? [16] (Refer Fig. 1)

[3764] - 379

-5-

Q11)Write short notes on : a) Workover problems and solution in brief. (at least six). b) Selection criteria for artificial lift methods. c) Optimum gas liquid ratio. d) Formation damage measurement and solution. OR Q12)a) b) c)

[16]

Describe the Production advantages of horizontal wells, with reference to reservoir aspect of horizontal well technology. [6] Explain, effective wellbore radius and drainage area in brief. [4] Write the pipe line design considerations in brief. [6]

[3764] - 379

-6-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1496

[3764]-383
B.E. (Petroleum)
DEEPWATER TECHNOLOGY (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data if necessary.

SECTION - I Q1) a) b) Discuss different classes, selection criteria & uses of ROVS in brief.[9] Write the importance of pre spud activity as penetration test and exploration test in details. [9] OR Q2) a) What is centre of gravity? Discuss the effect of following on C.G. [8] i) ii) b) c) Effect of adding weight. Effect of shifting weight.

iii) Effect of removing weight. Draw sketch of an offshore drill ship, indicate different translational & rotational motions and types of environmental forces acting on it. [6] Explain: i) Q3) a) b) c) Ballast control. ii) Metacentre. [4]

Discuss different types of mooring lines and forces acting on mooring lines. [2] Discuss following riser components. i) LMRP. ii) Lower flex joint. iii) [6] Mud boost line.

Discuss structural design & forces acting on legs of jack up rig in brief.[8]
P.T.O.

OR Q4) a) b) Discuss different tubular joints to form a truss structure of a platform with suitable sketch. [6] A two cylinder drilling motion compensator, shown in the following figure is used to support 12000 ft of drill pipe in a vertical well. The adjusted weight of the drill pipe is 21.6 ppf in air, buoyed weight is 17.6 ppf. The outside dia of each motion compensator piston is 12 inches & the piston rod are 6 inches O.D. The density of steel is 65.5 ppg. i) ii) What regulated air pressure is needed for the compensator to support? The buoyed weight of drill collar? [6]

iii) What is the mud weight in the hole?

c) d) Q5) a)

Find % offset if displacement is 100 ft & water depth is 2000 ft. Sources of error in GPS system.

[2] [2]

Discuss step by step operations in lowering of temporary guide base, 36 hole drilling, lowering of casing & cementation. (36). [10]
2

[3764]-383

b)

What are different well design issues in deep water drilling? Discuss any one in detail. [6] OR Write short notes on: i) Gas hydrate. ii) Down hole problems. [6] Discuss formation integrity test and its importance in detail. SECTION - II [10]

Q6) a) b)

Q7) a)

Explain Drillers method of well control for subsea operations. If SICP = 700 psi choke line friction loss is 200 psi. How to carry out CLFL reduction? Calculate SICP. [9] Discuss different types subsea vertical trees for completion, compare with suitable sketch. [9] OR Draw subsea BOP stack and procedure for pressure test. [9]

b)

Q8) a) b)

A liner is planned for well. A 30 bbl cement excess volume will be used, cement will be pumped at 5 bbl/min, which generate 1000 & 200 psi friction pressure in the drill string and annulus respectively, above the liner top. The mud & cement densities are 14.4 & 16.4 ppg respectively. Determine if lost circulation will occur at any of the following conditions. i) ii) The 30 bbl excess volume is above the liner top in static condition. The 30 bbl excess volume pumped out of the hole via annulus.

iii) The 30 bbl excess volume is pumped out of hole via drill pipe. Data: Drill pipe = 9,400 ft, 4.5 OD, capacity 0.01422 bbl/ft. Liner top 9,400 ft, liner depth 12,000 ft, casing seat 10,000 ft. Annulus capacity 0.05 bbl/ft, fracture gradient at 10,000 ft = 16.8 ppg.[9]

Q9) a) b)

Compare the vertical & horizontal separators from the point of advantages, disadvantages & working principle. [8] Discuss the deep water field planning & development considerations.[8] OR

[3764]-383

Q10)a) b)

What is pressure maintenance? Discuss any one EOR technique in detail. [8] Write different types of production platforms. Discuss design criteria.[8]

Q11)a) b)

Discuss reservoir field development & planning in detail. Describe pipeline design consideration in brief. OR

[8] [8]

Q12)Write short notes on: a) b) c) d) Reservoir simulation. Storage tank. Logistic consideration in drilling, production. Handling & transportation of oil & gas.

[16]

[3764]-383

Total No. of Questions : 8]

[Total No. of Pages : 6

P1567

[3764]-398
B.E. (Petrochemical Engg.)
REFINERY PROCESS DESIGN

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) Answer any 3 questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) Distillate from butane-pentane splitter has the following molar composition. i - C4 : 24.5%, n - C4 : 66.5%, i - C5 : 6.59%, n - C5 : 2.42% Assuming total condenser in operation for the distillation column. a) b) [16] Calculate inlet and exit temperatures for the process stream in the condenser at 600 kPa. Assume saturated reflux. (Use Fig. A). Assuming minimum driving force of 10C between process and utility streams in condenser, calculate the possible temperatures for inlet and exit of cold utility stream. Comment on selection of column pressure in case of industrial distillation practice. [6] Comment on choice of partial Vs total condenser in operation of distillation column. [5] What is subcooled reflux? What is the effect of subcooling of reflux on column performance? [5]

Q2) a) b) c)

Q3) Answer the following questions with respect to multicomponent distillation. a) b) Define what you mean by light key and heavy key. How are the keys decided? [4] [3]
P.T.O.

c) d)

How many columns are needed to separate 5 components from each other in pure form? How are they arranged? [4] Distillate composition and relative volatilies (i) for the top product are reported below: Component Mol% i A 20 3.0 B 40 2.5 C 15 2.0 D 25 1.5 Assuming reflux ratio of 3, calculate molar composition of (i) liquid leaving the top plate and (ii) vapor and liquid leaving the plate below the top plate. [7]

Q4) From the following data determine the value of minimum reflux by using underword equation. Assume column pressure as 5200 mm Hg. Feed is 66% vaporized and reflux is a bubble point liquid. [16] Component xF xD xB i a 0.26 0.434 100.00 b 0.09 0.150 24.60 (LK) c 0.25 0.411 0.010 10.00 (HK) d 0.17 0.005 0.417 4.85 e 0.11 0.274 2.08 f 0.12 0.299 1.00 SECTION - II Q5) Based on the assay given in Fig. (B), carryout material balance for 15 MMTPA capacity crude distillation unit. Boiling range specifications for the products are given as follows: Product Boiling Range F A Gas - 200 B 200 - 350 C 350 - 500 D 500 - 650 Residue 650+ For all the products, report the sulfur % and API. For products A, B, C and D. Calculate minimum kg of hydrogen required to remove sulfur to 50 ppm level per kg of product. [18]
[3764] - 398 2

Q6) a) b)

Differentiate between rating and design problems.

[4]

State the design procedure adopted for thermal design of shell and Tube heat exchanger. [12] A refinery furnace is fired with natural gas containing 90% CH4 and 10% CO2 in presence of 20% excess air. Calculate partial pressure (P) of CO2 and H 2O together assuming complete combustion and for furnace inside pressure of 1 atm. For box furnace assume mean beam length (L) of 5m. Calculate emissivity of burner gas (g) by linear interpolation of the following data at 1000C. [12]
PL

Q7) a)

(atm - m) 0.8 1.8

g 0.42 0.58

b)

State the situations in which fired heaters are employed in refinery. [4] [16]

Q8) Write notes : a) b) c) Concept of pinch. (L/G)min for multicomponent gas absorption. Flash calculations for complex mixtures.

[3764] - 398

[3764] - 398

[3764] - 398

[3764] - 398

Total No. of Questions : 10]

[Total No. of Pages : 4

P1620

[3764]-399
B.E. (Petrochemical)
NATURAL GAS TECHNOLOGY (2003 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6) Answer any 3 questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Give the Indian Scenario of natural gas with respect to production and utilization. [8] Discuss the origin of hydrocarbons of natural gas in detail. [8]

With the help of diagrams, discuss the Coalbed methane production technologies. [8] Elaborate on 'Indian Scenario of Gas Hydrates'. Elaborate on 'Basic structures of Gas Hydrates'. [8] [8]

With the help of phase diagram of a reservoir fluid explain each of the following: [8] i) ii) Critical point. Cricondentherm.

iii) Cricondenbar. iv) Retrograde condensation.

P.T.O.

Q4) Write short notes on following (Any 4): a) b) c) d) e) f) Q5) a) Sampling of Natural Gas. Solubility of Natural Gas in Water. Determination of Hydrate Formation point. Hydrate Prevention. Oil and Gas Reserves. Origin of Non-Hydrocarbon components of Natural Gas.

[16]

A natural gas has a heating value of 1600 Btu/scf. If this gas is combusted to generate power of 1000 kW, what is the required gas flow rate in Mscf/day? Assume that the overall efficiency is 80%. [5] (1 kW = 1903 Btu / hr). For the gas composition given below, determine apparent molecular weight, pseudocritical pressure and pseudocritical temperature of the gas. [8] Component Mole fraction yi 0.771 0.087 0.021 0.006 0.002 0.003 0.008 0.001 0.001 0.055 0.025 0.020 Critical Pressure Pci, psia 673 709 618 530 551 482 485 434 361 227 1073 672 Critical Temperature Tci, R 344 550 666 733 766 830 847 915 1024 492 548 1306

b)

C1 C2 C3 i - C4 n - C4 i - C5 n - C5 C6 C+ 7 N2 CO2 H2S
[3764] - 399

Take molecular weight of C + as 114. 7


2

c)

A 0.65 specific gravity natural gas contains 10 mole % N2, 8 mole % CO2 and 2 mole % H2S. Estimate viscosity of the gas at 10000 psia and 180F. [5] Data: i) ii) The atmospheric pressure viscosity (1) = 0.013 cp. Reduced viscosity (r) at 10000 psia and 180F = 1.602. Make use of following equations 1) TPC = 326 + 315.7 (
g

0.5) 240 YN2 83.3 YCO2 + 133.3 YH2S

Where TPC = Pseudo critical temperature in R.


g 2

= Gas - specific gravity.


2 2S

YN , YCO , YH respectively. 2)
r

= Mole fractions of N2, CO2 and H2S

= ln

T pr 1

Where TPr = Pseudo reduced temperature. Where g = Gas viscosity in cp SECTION - II Q6) a) b) c) Q7) a) b) Give the significance of natural gas processing. Also give the typical specifications of a commercial gas. [6] With the help of diagram, discuss multistage separation of condensates from natural gas. [8] Draw a well labelled sketch of a vertical gas-liquid separator. [4]

Enlist at least eight desirable properties of a solvent used for dehydration of natural gas. [8] Enlist at least four points for each of the following: i) ii) [8] Desirable properties of an adsorbent for dehydration of natural gas. Main characteristics of an adsorption process for dehydration of natural gas.
3

[3764] - 399

Q8) a) b) Q9) a) b)

Describe with flow sheet the process for acid gas removal from natural gas by amine scrubbing. [12] Explain the role of methanol in an integrated natural gas processing.[4] Elaborate on 'Pipes' as one of the natural gas pipeline components. [8] Give the significance of 'Pigging' and discuss any four safety precautions associated with natural gas pipeline in brief. [8] [16]

Q10)Write short notes on following (Any 4): a) b) c) d) e) f) Cold - Box shuttle. LNG Terminals in India. LNG Boil - off Gas. Methane Conversion Technologies. Natural Gas Storage in an Aquifer. LNG carriers with self-supporting Tanks.

[3764] - 399

Total No. of Questions : 12]

[Total No. of Pages : 6

P1394

[3764]-400
B.E. (Petrochemical)

PROCESS ECONOMICS AND PROJECT ENGINEERING (2003 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Answer any 03 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) Answer Any Four from the following: a) b) [18]

Discuss breakdown of Fixed Capital Investment (FCI) items for a chemical process. Define the following and give examples of each: i) ii) Current assets. Current liabilities.

iii) Fixed assets. c) d) Draw a break-even chart and write the advantages of Break-even chart on managerial decision. A central air-conditioning unit is purchased for Rs. 2,50,000 and has an expected life of 10 years. The salvage value for the unit at that time is expected to be Rs. 40,000. What will be the book value at the end of 7 years. Use sum of years digits method of depreciation. Often it is said, Depreciation and taxes are irrevocably tied to each other. Give your comment on this statement. Recently a cast iron leaf pressure filter with 9.29 m2 was purchased for clarifying an inorganic liquid stream for Rs. 7,50,000. In a similar application, the company will need a 41.80 m2 cast iron leaf pressure filter. The size exponent for this type filter is 0.6. Estimate the purchased price of the 41.80 m2 unit.
P.T.O.

e) f)

OR Q2) a) A process plant has an initial investment of Rs. 50 lakhs. The estimated salvage value is Rs. 2 lakhs. It has a life of 8 years. Estimate the book value of the plant after 5 years by (i) Straight line depreciation method. (ii) Declining balance method and (iii) Sinking fund method with a sinking fund interest rate of 10%. [9] Discuss the tree diagram showing cash flow for industrial operations.[9] Discuss the types of cost indices available in the Chemical Engineering literature. Discuss the importance of these cost indices for cost estimation of chemical engineering equipment. [6] A furnace installation A costs Rs. 12 lakhs with operating cost at Rs. 1,20,000 per annum. It has a life of 10 years. The installation B guarantees same performance with an operating cost of Rs. 96,000 with an initial cost of Rs. 25 lakhs. Salvage value for both is Rs. 1,90,000. What increase in life would be required for plan B to warrant its selection if money is worth 10%. [10] OR Q4) a) b) Discuss in brief the various components of a balance sheet and Profit and Loss account statements. [8] Company X is considering the Projects that have the following costs: (All costs are in Rupees): Item First cost Annual Operating Costs Salvage Value Life, years i) ii) Project A 1,50,000 35,000 10,000 6 Project B 1,80,000 31,000 20,000 9

b) Q3) a)

b)

Using money worth 15% per year, determine which alternative should be selected on the basis of a present-worth analysis. Company X has a standard practice of evaluating all projects over a 5-year period. If a study period of 5 years is used and the salvage values are expected (to be Rs. 15,000 and Rs. 30,000 for A and B respectively, which project) should be selected? [8]

[3764]-400

Q5) a)

A company proposes to install a dryer and has received the following offers: Item Installation Cost Operational and maintenance costs Salvage Value Service life in years Spray Dryer Rs. 15 lakhs Rs. 1 lakh Rs. 2 lakhs 10 Fluidized bed Dryer Rs. 10 lakhs Rs. 1.5 lakhs Rs. 1 lakh 8 Moving bed Dryer Rs. 8 lakhs Rs. 2 lakhs Nil 6

Money is worth 10%. Which offer should be accepted, for minimum annual cost? [10] b) A project expected to have cash flow for five years as follows after all expenses and taxes. The initial fixed capital investment is Rs. 10,00,000 and the working capital investment is 15% of the fixed capital investment. Time (Years) 0-1 1-2 2-3 3-4 4-5 OR Q6) a) The following data are available for two reactors from a petrochemical plant: Item Installed cost Salvage value Service life Interest rate (i) Reactor (Mild Steel) Rs. 5,00,000/0 3 12% Reactor (Stainless Steel) Rs. 1,50,000/0 ? 12% Cash Flow (Rs.) 2,00,000 2,70,000 3,30,000 4,00,000 4,75,000 [6]

Determine the payout time required for given project.

If the capitalized cost is same for both the reactors, estimate service life for stainless steel reactor. [8]

[3764]-400

b)

A plant is designed to produce 1.2 108 kg/hr of an agrochemical. The estimated fixed capital investment is Rs. 1.5 109. The working capital is 2 108 and startup cost (only in the first year of commissioning and to be accounted for in the first year) is 1.5 10 8. The following cost data are available: [8] i) ii) Raw material : Rs. 0.8 / kg product. Labor and Utilities, etc. : Rs. 0.25 / kg product.

iii) Selling price of product : Rs. 20 / kg. iv) Other costs (on year basis) including Maintenance, insurance, etc., @ 10% of fixed capital. Indirect cost of administration, R & D, marketing, etc. 20% of sale proceeds. The plant will be fully depreciated over a period of 5 years using the straight-line method. The rate of income tax is 40%. Calculate: 1) 2) The net profit at the end of first year. The payout period. SECTION - II Q7) a) Synthesis gas may be prepared by continuous, non-catalytic conversion of any hydrocarbon by means of controlled partial combustion in a fire - bride line reactor. The hydrocarbon and oxidant (oxygen or air) are separately pre heated and charged to the reactor. Before entering the reaction zone, two feedstocks are intimately mixed in a combustion chamber. The heat produced by combustion part of the hydrocarbon pyrolyzes remaining hydrocarbons into gas and a small amount of carbon in a reaction zone. The reactor effluent then passes through a waste heat boiler, a waste-wash carbon removal unit, and water cooler-scrubber. Carbon is recovered in equipment of simple design in a firm, which can be used as fuel, or in ordinary carbon products. [14] i) ii) b)
[3764]-400

Prepare a simplified equipment flow sheet in the process, with temperature and pressure. Draw a typical P & ID for fire-bride line reactor.

Explain in brief the plant-design project stages with suitable example.[4]


4

OR Q8) a) Discuss in brief the anatomy of Chemical manufacturing process. What are the standard references / resources are available for chemical engineers working in Projects? b) [8]

Make a proforma for the specifications for shell and tube heat exchanger. [10]

Q9) a)

Explain the items that should be considered in making a feasibility survey of a typical refinery project. [8] [8]

b)

Discuss in brief the following safety terms: i) ii) Flash and Smoke Point. Fault tree analysis.

iii) Trip and interlock system. iv) HAZOP and HAZAN. OR Q10)a) Explain Plant shutdown and emergency procedure with suitable example. [8] b) What are process utilities? Briefly discuss important utilities required in a typical petrochemical complex / refinery unit. [8]

Q11)a)

Discuss in brief the following (Any Two): i) ii) Piping Specifications.

[8]

Engineering flow diagram and Piping and Instrumentation Diagram.

iii) Plot plan and equipment layout. b) Discuss in brief Bar Chart, Milestone chart and Gantt Chart for Petrochemical Engineering Project analysis. OR [8]

[3764]-400

Q12)a)

A project has the following activities, activity duration and predecessors. Activity Duration (days) A B C D E F i) 6 10 12 9 8 5 A A B, C C D, E Predecessor

Draw the CPM / PERT chart for this problem and determine the critical path.

ii) b)

Indicate the critical path on the CPM/PERT chart.

[10]

Any successful design project depends on effective project management. There is no single correct way to manage a project but there are four basic steps: i) Define the project. ii) Create a project plan. iii) Track and maintain the project plan. iv) Close the project. You are a Process Engineer Incharge of preparing the process design report for methanol from syngas unit. Give a description of how you would manage this project giving some detail of the various aspects of a modern environmentally acceptable design. [6]

[3764]-400

Total No. of Questions : 12]

[Total No. of Pages : 3

P1541

[3764]-411
B.E. (Computer)
DESIGN AND ANALYSIS OF ALGORITHMS (2003 Course)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) Answer THREE questions from each section.

[Max. Marks : 100

Answers to the TWO sections should be written in SEPARATE answer books. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Prove by generalized mathematical induction that every positive integer can be expressed as a product of prime numbers. [8] Consider the recurrence: T(n) = O(n) T(l) = (l) Show that above recurrence is asymptotically bound by (n). c) [8] State whether the following function is e CORRECT or INCORRECT and justify your answer. [2] 3n+ 2 = O(n) OR Q2) a) b) c) Prove by contradiction : There exist two irrational numbers X and Y such that Xy is rational. [8] Prove by mathematical induction that the sum of the cubes of the first n positive integers is equal to the square of the sum of these integers. [8] State whether the following function is e CORRECT or INCORRECT and justify your answer. [2] 10n2+ 4n + 2 = O(n2) Q3) a) Write an algorithm for sorting n numbers using Quick sort method. Determine its time complexity. [8]
P.T.O.

b) Q4) a)

Write Kruskals algorithm. Comment on its time complexity. OR

[8]

With respect to greedy method define the following terms and explain briefly their significance. i) ii) Feasible solution. Optimal solution. [8]

iii) Subset Paradigm. b)

Write an algorithm for recursive binary search. What is the time complexity for successful search and unsuccessful search? [8] Write a function to compute length of shortest paths of a given graph.[6] Write a short note on worst case optimal algorithm. Enlist and briefly explain elements of dynamic programming. OR [6] [4]

Q5) a) b) c) Q6) a)

Prove if l1 l2 ........... ln then the ordering ij = j, l j n minimizes.


k =1

lij
j =1

over all possible permutations of the ij. b)

[8]

Two jobs have to be scheduled on three processors. The task times are given by matrix: 2 0 J= 3 3. 5 2 Show all possible schedules for the jobs. Prove that there exists an optimal schedule. [8] SECTION - II

Q7) a) b)

Write a Recursive Backtracking algorithm for sum of subsets of a problem. [8] Explain how branch and bound can be used to solve Knapsack problem? [8]
2

[3764]-411

OR Q8) a) b) Explain in detail control abstraction of L.C. search. [8]

Write recursive back tracking schema for m coloring of the graph. [8]

Q9) a)

Consider the following expression: ((7 (21/3))* 3) + ((9* (10 8)) + 6). Explain how it can be evaluated parallely. [8]

b)

Explain in detail parallel sorting. OR

[8]

Q10)a) b)

Prove that Hamilton cycle is in NP.

[8]

State halting problem and prove that it is undividable. To which category (P or NP) does it belong to? [8] What is Satisfiability problem? Explain in detail. Write Non deterministic Knapsack algorithm. State True or False: Satisfiability problem is NP complete. OR [8] [8] [2]

Q11)a) b) c)

Q12)Write short notes on any three: a) b) c) d) Cooks Theorem. AND/OR graph problem. 8 Queens Problem. Hamilton Cycles.

[18]

[3764]-411

Total No. of Questions : 12]

[Total No. of Pages : 4

P1498

[3764]-413 B.E. (Information Technology)

OBJECT ORIENTED MODELING AND DESIGN (410443) (2003 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Answer Q1 or Q2, Q3 or Q4, Q5 or Q6 in Section-I and Q7 or Q8, Q9 or Q10, Q11 or Q12 in Section-II. 3) Figures to the right indicate full marks. 4) In design questions you are encouraged to make further suitable assumptions on scope of the systems given wherever necessary. Highlight the assumptions.

SECTION - I Q1) a) Explain in detail model driven architecture and its applications. c) Explain: i) Importance of XML in XMI. ii) Minor features of Object Oriented Programming. OR [6] [6]

b) What is CORBA? What are the basic elements of CORBA? Explain.[6]

Q2) a) What is the purpose of an Interaction diagram? Explain with suitable example the different types of Interaction diagrams in UML 2.0. [8] b) Why object oriented approach is superior to procedural approach? [6] c) Explain 4+1 view architecture. [4] Q3) a) For a Online Railway Reservation System. Identify the various use cases and draw the use case diagram. [8] b) What is the importance of a state diagram in a Embedded application. [4] c) Explain with example different types of Relationships in UML. OR [4]
P.T.O.

Q4) a) Draw a class diagram fragment for a banking system with two classes. Account and customer and the relation that customer opens Account. Further the Account may be of type saving or current. Assume suitable attributes for the classes. [8] b) Compare ACCESS and IMPORT stereotypes for a package diagram.[4] c) What is forward Engineering of a USECASE from a USECASE diagram. [4] Q5) a) Consider a marksheet class with attributes Aggregate marks, unit test marks, bonus marks and a operation calculate marks (). Also consider that there is a student class with the relationship that a student gets marksheet. Specify the following constraints in OCL. [8] i) A student can get at max 80%. ii) A class variant that the aggregate marks cannot be < 40%. iii) A post condition for calculate marks () operation that aggregate marks are increased by bonus marks. iv) All instances of students objects, the bonus marks should be > 10. b) What do you understand by Instance level deployment diagram? [4] c) What is CRC? Explain with example. [4] OR Q6) a) Consider a Student Attendance System having use cases like View Attendance, View Practical Attendance, Input Student-Id, Attendance Report etc. Make use of use case relationships to model above usecases and their relationships in context of use case diagram.[8] b) Explain in detail different types of advance Relationships by giving suitable example. [8] SECTION - II Q7) a) Draw a class diagram for a College Library. Make suitable assumptions regarding the scope and functionality of the system. [12] b) What is the need of composite structure diagram. OR
[3764]-413 -2-

[4]

Q8) a) A Experts group guides the students in their institute. The guidance is given for two activities namely Programming Skills and Communication Skills. The Experts are specialized in either activity. The sessions on specific topics in specific activity are announced and the students need to register for the session. Assume suitable classes, attributes, operations and relationships that may exist between them and draw an object diagram showing clearly the attributes and relationship details. [12] b) What is a Event? Explain with example different types of Events. [4] Q9) a) Explain the concepts and notations through simple examples for following terms in UML: [8] i) Concurrent States. ii) Substate. iii) History State. iv) Exceptions in activity diagram. b) Model a software system for controlling a water purifier which can be either ON or OFF. In the ON state it can be in ARO or UV mode. There are buttons to change from one mode to other or this mode can change automatically based on the hardness of the water cutoffs. (ARO when pH value < 1.5 and UV when pH value > 1.5). User can manually override any modes through by pressing appropriate buttons. All the buttons function only if power is on. For the above described system draw state machine diagram. [8] OR Q10) a) Explain the concepts and notations through simple examples for following terms used for activity diagram: [8] i) Action states. ii) Activity states. iii) Transitions. iv) Fork and Join. b) Draw an activity diagram to explain the way one would create a presentation for a seminar using power Point. Show the activities that are optional. [8]
[3764]-413 -3-

Q11) a) Draw a communication diagram for a schedule of one day workshop in the Information Technology department of a Engineering Institute organized for the students of Final year. Make assumptions of possible classes. [8] b) Compare synchronous and Asynchronous messages. [6] c) How does one model parallel message flows in a sequence diagram.[4] OR Q12) a) What is recursion? How do we represent recursion in a sequence diagram? Consider a suitable example and draw a complete sequence diagram. [8] b) Consider a online webbased Computer Rental System. Draw a sequence diagram for Rent a computer use case with the following assumptions. The customer needs to first select the type of computer he wants to rent. The computer system database is maintained in the system organized in to types like: Desktop, Laptop, Notepad, Pocket PC etc. Based on the availability of the computer system, the rates of rent are displayed, the booking is done, confirmed, the booking details are stored and the customer is issued an electronic confirmation of the booking. [10] rrr

[3764]-413

-4-

Total No. of Questions : 12]

[Total No. of Pages :3

P1376

[3764] - 415 B.E. (Computer) IMAGE PROCESSING (2003 Course) (410445) (Elective - I)
[Max. Marks : 100

Time : 3 Hours] Instructions: 1) 2) 3) 4) 5)

Attempt Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from Section-I and Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 from Section - II Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Define 1 - D and 2 - D DCT Transform. Explain the features and use of DCT Transform. [8] What is Fuzzy logic? How it can be used in Image processing? Explain with one application. [8] OR Q2) a) b) What are the features of Hadamad Transform? Represent Hadamad matrix of size 88. [8] For the given orthogonal matrix A and image U, obtain the transformed image V and basis images A = Q3) a) b)

1 1 1 U = 1 , 3 2 1 1

2 4

[8]

What is the difference between uniform and non-uniform sampling? Explain the process of sampling and quantization in image digitization. [10] What is the use of distance function? State any two such functions giving its significance. [6] OR

P.T.O.

Q4) a) b) Q5) a)

Compare between Geometric model and Photometric model. Explain the Photometric model used for image formation. [10] State the various properties of digital images. [6] Explain the following point operations performed on the image with mathematical representation. [10] i) ii) iii) Contrast stretching. Bit extraction. Intensity level slicing.

b)

What is Homomorphic filtering? How it can be used for image enhancement? Explain. [8] OR What do you mean by lossy and lossless image compression? Explain Huffman encoding and decoding process used in image compression.[10] What is the objective of Image Restoration? Discuss the use of Wiener filter for the same. [8]

Q6) a) b)

Q7) a) b)

Compare and discuss different approaches used for texture analysis in image segmentation. [10] Discuss different forms of region representation useful in shape analysis of the object. [8] OR Write algorithmic steps for edge detection w.r.t. following masks: i) Robert Deterministic PR Clustering ii) Sobel ii) iv) Statistical PR Feature extraction [8] [8] [10] Discuss following terms w.r.t. Pattern Recognition: i) iii)

Q8) a) b)

Q9) ) b)

Explain in brief CMY and VIQ color models.

Write an algorithm for reading a RGB image. What is pseudo color processing. [8] -2-

[3764] - 415

OR Q10) a) Thinning. .

b) Pruning. c) Dilation. d) Crosion. Q11) ? ? . . . OR Q12) a) b) c) d) Pre-processing. Feature extraction. Training. Recognition. [16] : . [16] [16]

*****

[3764] - 415

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1378

[3764]-420
B.E. (Computer)

ADVANCED COMPUTER ARCHITECTURE AND COMPUTING (2003 Course) (410249)


Time : 3 Hours] [Max. Marks : 100 Instructions to candidates : 1) Attempt Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from Section I and Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Assume suitable data, if necessary.

SECTION - I Q1) a) How Feng has classified parallel computers? What is maximum Parallelism degree and how it is obtained? Why MISD Architecture suggested by Flynn does not popular? What is MISD? [8] State the EPIC features of Itanium Architecture. Why it is called as VLIW Architecture? [8] OR Q2) a) b) Define parallel processing. How parallel Computer Architectures are classified? Discuss the levels of parallel processing. [8] How the performance of parallel computer systems is measured in general? State and explain such parameters giving its significance. [8] For a unifunction pipeline, the forbidden set of latencies is given as follows: [10] F = {1, 3, 6} with largest forbidden latency = 6. i) ii) Define and obtain Collision vector. State the problem of Job sequencing / scheduling.

b)

Q3) a)

iii) Draw the state diagram. iv) Define latency & MAL. v) Obtain MAL. vi) State all simple and greedy cycles. vii) Define Greedy cycle.
P.T.O.

b)

What is Hazard? State and explain different types of data hazards. State how such hazards can be detected and resolved? [8] OR Consider a 4 stage pipeline processor. The number of clock cycles needed for the execution of four instructions I1, I2, I3, I4 in stages S1, S2, S3, and S4 is shown below [8] S1 I1 I2 I3 I4 2 1 2 1 S2 1 3 1 2 S3 1 2 1 2 S4 1 2 3 2

Q4) a)

Obtain the total number of clock cycles needed to execute the following loop for (i = 1 to 2) { I1; I2; I3; I4; } Draw the space time diagram showing execution of all instructions through successive pipeline stages. b) Explain loop unrolling technique with suitable example state its advantages and disadvantages. Compare it with software pipelining. What is trace scheduling? [10] State advantages of vector processing over scalar processing. What is vectorizing compiler? Explain any 2 vector optimizing functions. [8] Discuss with algorithm the problem of n n matrix multiplication on cube interconnection Network. Specify the complexity. [8] OR Q6) a) How 3-cube Network can be viewed as single stage recirculating Network? State the routing functions and permutation cycles for 3-cube Network. [8]
2

Q5) a) b)

[3764]-420

b)

With the algorithm discuss the problem of parallel sorting of N elements on n n mesh Interconnection Network. Obtain its time complexity.[8] . SECTION - II

Q7) a) b)

State the Cache write policies used in Cache coherency protocol. Discuss pentium MESI protocol with its state diagram. [8] With Neat diagram, compare and explain following bus Arbitration algorithms. [10] i) ii) Daisy chaining. Polling. OR

Q8) a) b)

What is chip-multiprocessing? With functional Block diagram, explain the architecture of IBM power 4 / power 5 processor. [10] What is interprocess communication and synchronization? Discuss any two machine instructions which provides Hardware support for interprocess communication and synchronization. [8] What is the necessity of memory consistency models? Explain in brief processor consistency models. [8] State the following terms w.r.t. multithreading. i) ii) Latency. Context switching overhead. [8]

Q9) a) b)

iii) Interleaved Multithreading. iv) Number of active threads. v) Q10)a) Latency Hiding. OR Explain use of following primitives w.r.t. parallel programming. i) ii) Send ( ) ; Receive ( ) ; [8]

iii) Fork ( ) ; iv) Join ( ) ; v)


[3764]-420

Lock ( ) ;
3

b)

What are features of Data Parallel programming. Explain the standard constructs available in data parallel programming. [8] What are features of PVM? How processes are created in PVM? Explain the communication functions defined under PVM. [8] With example, explain how parallel algorithms are written for Multiprocessor systems. [8] OR State and explain control and data Parallelism used in CCC by means of standard constructs. [8] Discuss and compare the architecture of Cluster and Grid computing.[8]

Q11)a) b)

Q12)a) b)

[3764]-420

Total No. of Questions : 12]

[Total No. of Pages : 4

P1510

[3764]-432
B.E. (IT)
ADVANCED DATABASE MANAGEMENT (414442) (2003 Course)

Time : 3 Hours] Instructions to candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Assume suitable data, if necessary. Section I : Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6. Section II : Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12.

SECTION - I Q1) a) b) c) Q2) a) b) Explain speed up and scale up with Parallel System. Describe the benefits and drawbacks of pipelined parallelism. Explain any two Parallel Database Architectures. OR Describe different approaches to handle cache coherency problem in Parallel Databases. [9] Write a short note on: i) ii) Q3) a) Hash Partitioning. Fragment and Replicate Join. [8] [5] [6] [6]

Explain the use of reduction techniques to generate and optimized query in distributed databases using different types of fragmentation with suitable examples. Draw relational algebra trees. [5] Write a short note on Persistent Messaging in Distributed Transaction Processing. [6] Explain Heterogeneous distributed databases. OR [6]

b) c)

P.T.O.

Q4) a)

Compute semi-join r s for the relations r and s. Relation r A 1 4 1 5 8 B 2 5 2 3 9 C 3 6 4 2 7 C 3 3 2 1 1 Relation s D 4 6 3 4 2 E 5 8 2 1 3

[5]

b) c)

Describe the voting and read-any-write-all approaches to synchronous replication. [6] Explain Optimistic methods for Distributed Concurrency Control. [6]

Q5) a)

Consider Relations for bibliography. Book (title, author, year, publisher, place) Article (title, author, journal, year, number, volume, pages) Author (lname, fname) Create DTD and XML Schemes. Write queries in XQuery on the bibliography fragment. i) ii)

[12]

Find all authors who have authorized a book and an article in the same year. Display books and articles sorted by year.

iii) Display books with more than one author. iv) Find all books that contain the word database in their title and the word Korth in an authors name. b) Explain advantages and disadvantages of the Web-DBMS approach.[4] OR Q6) a) b)
[3764]-432

Explain XML Applications for storing and communicating data and for accessing Web services. [8] Describe the various issues for efficient evaluation of XML Queries.[8]
2

SECTION - II Q7) a) Discuss the activities associated with a data warehouse for Financial Services with the help of following points. [10]
q

Business processes. Business Questions expected in data warehouse environment. Design schemes. Failures and Backup strategies. [7]

b)

Explain Kimballs nine steps design for Data Warehouse. OR

Q8) a)

Write short notes on: i) ii) Warehouse Manager. Materialized View.

[10]

b)

Explain different indexing techniques in Data Warehouse.

[7]

Q9) a)

Define with suitable example. i) ii) Entropy. Information Info(T).

[12]

iii) Information Gain. iv) Gain Ratio. v) GINI Index.

Write ID3 algorithm with student data set in details. Construct a decision tree for at least 15 records in data set using ID3. b) Write a short note on Text Mining. OR Q10)a) b) c)
[3764]-432

[5]

Explain data preprocessing in Data Mining. Explain clustering major approaches.

[6] [6]

Describe Bayesian classification approaches for Fraud detection application. [5]


3

Q11)a) b)

Define Information Retrieval System. Describe how it is differ from database system. [6] Write short notes on: i) ii) Signature Files. Ranking Document Similarity. OR [10]

Q12)a) b)

Describe distinct ways a user can find information on the web. Write short notes on: i) ii) Web Crawler. Retrieval Effectiveness.

[6] [10]

[3764]-432

Total No. of Questions : 6]

[Total No. of Pages : 2

P1380

[3764] - 437

B.E. ( I .T. ) ORGANISATIONAL BEHAVIOUR AND MANAGEMENT CONCEPT (2003 Course) (414445) (Elective - I)
Time : 3 Hours] Instructions to the candidates: 1) 2) 3) All questions are compulsory. Use two separate answer books for section-I & section - II Figures to the right indicate full marks. [Max. Marks : 100

SECTION - I Q1) Define the term organisational behaviour with its importance and nature in todays scenario. [16] OR Explain the models of OB with reference to supportive and collegial model of O.B, in detail. Q2) Compare A.H. Maslows theory of hierarchy with victor Vrooms Expectancy theory of motivation. [16] OR Discuss the impact of effects of stress on an individual. What is the significance of its impact? Q3) Write short notes on: (Any Three) a) b) c) d) e) Frustation. Decision - Making. Reward Systems. Morale. Levels of conflict. P.T.O. [18]

SECTION - II Q4) What are the qualities required for becoming a leader? Explain path-goal theory, in detail. [16] OR What is the meaning of the term conflict management? Discuss the tactics involved in handling conflict. Q5) Change gives positive results Do you agree? Justify. OR What is performance appraisal? Elaborate 360 method of performance appraisal. Q6) Write short notes on : (Any Three) a) b) c) d) e) Constructive Conflict. Organisational Culture. Team Behaviour. Attributions. Bench - Marking. [18] [16]

*****

[3764] - 437

-2-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1390

[3764]-463
B.E. (Biotechnology)
BIOMATERIALS (416286) (2003 Course) (Elective - II)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) All questions are compulsory.

SECTION - I Q1) a) Explain general properties of materials that are useful for medicine applications? Explain different classes of materials used in medicine.[10] b) List out three important common properties to all metals which are being used during implants. [6] OR Q2) Explain in details alongwith properties and functions of: [16] a) b) c) d) Biological functional materials. Smart materials. Porous materials. Biodegradable materials.

Q3) Explain structure, physical and chemical properties of polylactic acid? How method of synthesis differs from other common polymerization processes. With neat sketch detail out the synthesis procedure for the same. [16] OR Q4) a) Explain in detail fermentative production of polyesters like poly hydroxyalkonates. [10] b) Explain structure and properties of lactoyallatic acid, polycaprolactone. [6] Q5) How are shape memory alloys different from general metal alloys? Discuss their biomedical applications. [18]
P.T.O.

Q6) a) b)

OR Explain mass spectrometer and atomic forced microscopy for analysis of polymer structure. Biomedical application of pulluan write a note. SECTION - II [18]

Q7) Write a note on: a) Application of biocatalyst in biotransformation process. b) c) d)

[16]

L - homophenylanine production using membrane bioreactor. Biocompatible and bioinert materials. Ceramic and composite materials. OR Q8) Explain biocatalyst. How it works for production of polymer, aromatic precursors. Explain any one industrial application of biocatalyst with suitable example. [16] Q9) Separately list the type of materials used in each of the following medical applications alongwith feasibility of materials for said application. [16] a) c) Q10)a) b) Q11)a) b) Bone cement. Skin repair. b) Contact lenses.

OR List out typical materials used in making lenses. List out problems observed after the replacement of heat valves.

[8] [8]

How can we use stress strain diagrams in selecting the most appropriate materials for an orthopedic biomaterials. [14] Hydrogel applications in medicine explain. [4] OR [18] b) Polymer in Bioadhesives.

Q12)Write a note on (any two): a) Dental implants. c) DNA nanoparticles.

[3764]-463

Total No. of Questions : 12]

[Total No. of Pages : 3

P1610

[3764]-207 B.E. (Electrical)


ILLUMINATION ENGINEERING

(2003 Course) (403143)


Time : 3 Hours] [Max. Marks : 100 Instructions to candidates: 1) Answer 03 questions from Section - I and 03 questions from Section - II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) State and explain the laws of illumination. [5]

b) Deduce the relation to find the illumination at any point on the plane surface due to light source suspended at a height h meters from the plane surface. [5] c) Define the following terms: i) Illumination iii) Lamp efficiency v) Luminous intensity Q2) a) Explain the properties of light. c) What are the various methods of controlling natural light? Q3) a) Explain the working of fluorescent tube with neat diagram. b) Describe the construction and working of C.F.L. c) Write short note on L.E.D.s. OR Q4) a) What is stroboscopic effect? How it can be avoided? b) Write short note on High pressure mercury vapour lamp. [5] [5] ii) iv) vi) OR [6] [6] [5] [5] [5] b) Explain plane angle and solid angle. Also derive relation between them.[6] Reflection factor M.H.C.P. M.S.C.P.

[8]

c) Enlist the advantages of gas discharge lamp over incandescent lamp.[5]


P.T.O.

Q5) a) Discuss the importants of reflectors and refractors with reference to illumination. [5] b) Explain with neat sketch the starting ballast for i) i) Sodium vapour Specular reflection. OR Q6) a) Explain the dimming operation for i) iii) i) Incandescent lamp. Metal halide lamp. [8] ii) Concentrating reflector. Dispersive reflector. ii) Sodium vapour lamp. [9] ii) ii) Mercury vapour lamp. [6] Diffused reflection. c) Explain the following with neat sketches. [6]

b) Explain in brief the following:

SECTION - II Q7) a) What is polar curve? Describe its types. How it is helpful for an illumination engineer. [8] b) Explain the terms: i) iii) Beam factor. Payback Period. OR Q8) a) Discuss the factors of good lighting design in detail. [8] b) What is glare? Discuss the type of glare and the remedies over them.[8] Q9) a) Give the comparison between different types of light sources with reference to their lumens per watt and life. [8] b) What are the types of lighting fixtures according to installation type? [8] OR Q10) a) What is energy efficient lighting? Discuss its advantages, which are the difficulties related with energy efficient lighting. [8] b) Write short notes on: i) Street lighting. ii) Flood lighting. [8] ii) iv) Waste light factor. Space height ratio. [8]

[3764]-207

-2-

Q11) a) Explain photovoltaic lighting. b) Write short note on solar lighting. c) Write notes on Emergency lighting scheme for i) Central system OR Q12) a) Write short note on following: i) Cold lighting. ii) O.F.C. b) Explain the components of day light factor with neat diagram. ii) Stand alone system.

[4] [4] [10]

[10] [8]

[3764]-207

-3-

Total No. of Questions : 11]

[Total No. of Pages : 3

P1339

[3764] - 203 B.E. (Electrical)


INDUSTRIAL DRIVES & CONTROL

(2003 Course)
Time : 3 Hours] [Max. Marks :100 Instructions to the candidates: 1) Answer three questions from Section I and three questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed.

SECTION - I Q1) a) b) State essential parts of electrical drives state functions of different parts. [8] What is drive? Explain different types of drives and procedure for selection it. [8] OR Q2) a) b) Explain speed torque conventions and multiquadrant operation of drive. [8] A motor is used to drive a hoist. Motor characteristics are given by Quadrant I & II T = 200-0.2N N-m Quadrant III & IV T = -200-0.2N N-m Where N is speed in rpm, when hoist is loaded the net load torque Tl = 100 N-m and when it is unloaded net load torque is Tl = -80 N-m. Obtain the equilibrium speeds for operations in all quadrants. [8] Why braking is required for an electrical drive. What are advantages of electric braking. [8] A 230V 960 rpm and 200A d.c. separately excited motor has an armature resistance of 0.02 W . Motor is required to hold the rated load torque by dynamic braking at 1200rpm without emf exceeding 230V. Calculate the value of external resistance to be added with armature. [8]
P.T.O.

Q3) a) b)

OR Q4) a) b) Explain with neat circuit diagram and speed torque characteristics, d.c. dynamic braking of 3 phase Induction motor. [8] What is regenerative braking. How is it achieved in d.c. shunt motors? [8] Explain with neat circuit diagram how speed control is achieved by a 3 phase fully controlled converter. Draw o/p voltage waveforms for a = 30. Write the o/p equations of the converter. [10] A 220V 1200 rpm 15A separately excited motor has armature resistance and inductance of 1W and 52mH respectively. This motor is controlled by 1- phase fully controlled converter with an a.c. voltage source of 230V, 50Hz. Find speed at a = 30 a = 60 [8] OR Q6) a ) Discuss the operation of a separately excited d.c. motor fed from a two quadrant d.c. chopper. Draw the power circuit diagram and waveforms of motor armature voltage and current under motoring and regenerative braking condition. [10] What is dual converter? How it is used to drive d.c. motor? Explain circulating current mode of operation. [8] SECTION - II Q7) a ) Draw a circuit diagram of transistorized stator control of induction motor drive. Draw waveforms for output voltage, current and sequence of pulses. [8] Explain different PWM techniques used for speed control of induction motor. [8] OR Q8) a ) b) Q9) a ) b) What is V/f control in speed control of induction motor? Explain its limitations. [8] Compare VSI and CSI for induction motor drive. [8] Explain thermal model of motor for heating and cooling. [8] Explain different classes of motor duty and how it affects the choice of selection of motor rating. [8]
2

Q5) a)

b)

b)

b)

[3764]-203

OR Q10) a) Explain different measures for energy conservation in electrical drives. [8] b) Explain different methods to reduce the energy loss during starting of induction motor. [8] Q11) Explain any three applications of drives: a ) Commutator less D.C. motor. b) Rolling mills. c) Sugar mills. d) Machine tool application. [18]

TTT

[3764]-203

Total No. of Questions : 12]

[Total No. of Pages : 3

P1395

[3764] - 172 B.E. (Production Engineering/Sandwich)


MACHINE TOOL DESIGN (2003 Course)

Time : 3 Hours] [Max. Marks :100 Instructions to the candidates: 1) Attempt one question of each unit from Section - I and Section - II. 2) Answers to the two sections should be written in separate books. 3) Draw neat diagram wherever necessary. 4) Assume suitable data, if necessary.

SECTION - I Unit - I Q1) a) Design a six-speed gear box for a machine tool having a minimum speed 60 rpm, G.P ratio = 1.55, speed of motor = 1500 rpm. Draw the best possible Structural diagram, ray diagram, speed chart and gear layout. [14] Discuss the considerations of variator design. [6] OR Q2) a) b) c) For flat disc drive ,derive the equation for frictional torque. Discuss the designs features of feed gear box with Norton drive. Write a Short note on Ball variator. Unit - II Q3) a) b) What the design criteria for beds? How these are applied to for welded and cast beds. [8] Why stiffness is important consideration in machine tool structure? How stiffness is improved explain with figures. [7] OR [8] [8] [4]

b)

P.T.O.

Q4) a) b)

What are the functions of machine tool structures? Show the different types of cross sections used for machine tool beds and columns. [8] Discuss bed materials along with required properties. [7] Unit - III

Q5) a)

Estimate the total error in pitch of a lead screw working on sliding friction and show that it could be expressed as [10]
P2 1 1 + 2D 2 Where 1 = QP / AE Q - Axial load, P - Pitch,

b) Q6) a)

A - Cross section area, D - Effective diameter, - Efficiency Write a note on aerostatic slide ways. OR

[5]

b)

Discuss briefly the merits and demerits of Recirculating power screw in comparison to conventional lead screw. State its specific field of uses and application. [7] Discuss the design consideration in guideways. [8] SECTION - II Unit - IV

Q7) a) b) c)

Explain the design consideration of machine tool spindle [8] Explain different methods for preloading of ball bearing. [6] Describe the different types of bearing employed in machine tools. Give the importance of each. [6] OR Describe the various elements of a spindle unit used in a drilling machine. Draw the neat sketch of the arrangement. [7] Explain optimum spacing of support in spindle for good rigidity. [8] State and explain the functions of machine tool spindle. What are the desirable features of spindle units. [5]

Q8) a) b) c)

[3764]-172

Unit - V Q9) a) What do you understand by regenerative chatter in machine tool? State its causes and effects. [8] b) How vibrations of boring bar are damped. [7] OR Q10) a) Explain how electrical breaking system is used for control in machine tool. [8] b) Compare hydraulic control system with mechanical control system with reference to performance, cost ,reliability considerations. [7] Unit - VI Q11) Write a short note on following: a) Table feed control in planer machine. b) Layout of machine tool by matrices. c) Feed back devices used in CNC. OR Q12) a) Explain how and where a retrofitting is done in a old lathe machine tool. [8] b) What are the design considerations of Unit head machine tool. [7] [15]

TTT

[3764]-172

Total No. of Questions : 6]

[Total No. of Pages : 4

P1484

[3764] - 287 B.E. (Instrumentation & Control)


ADVANCED CONTROL SYSTEM (Elective - I) (2003 Course)

Time : 3 Hours] [Max. Marks :100 Instructions to the candidates: 1) Answer three questions from section I and three questions from section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary. 7) All questions are compulsory.

SECTION - I Q1) a) b) Explain Jump resonance with suitable example. [6]

Find the Describing Function for the Nonlinear system having characteristic as shown in figure 1. [12]

OR

P.T.O.

a) b)

What are different characteristics of Non-Linear system.

[6]

Find the Describing Function for the Nonlinearity as shown in Fig. Q.2. [12]

Q2) Obtain the range of gain K for which given system shown in figure 3 is stable G ( s ) =
10 K . Investigate the stability of the system for K = 0.l. s ( s + 1) ( s + 2)

[16]

OR Consider a System as shown in figure 4. Find the amplitude and frequency of limit cycles. Also Comment on nature of limit cycle(s) and Stability of system. [16]

[3764]-287

Q3) a) b)

Explain MIT rule for continuous time Model Reference Adaptive Control scheme with reference to first order system. [8] Explain different elements of Model Reference Adaptive Control (MRAC) system with neat block diagram. [8] OR What are the limitations of describing function. Explain each in short. [8] Explain Model Reference Adaptive Control using Lyapunov approach for stability analysis of continuous time system. [8] SECTION - II

a) b)

Q4) a)

In Self-Tuning Regulator (STR) following input output data has been obtained from real plant. [10] Time(t) 1 2 3 4 5 Input data [u(t)] 1.0 0.0 1.0 1.0 0.0 Output data [y(t)] 0.0 2.0 -1 2.5 0.750

Use any regression method to fit a model with the structure y(t) + a y(t -1) = bu(t -1)+ e(t) where e(t) is error signal b) Explain Self tuning regulator with reference to controller design and parameter estimation mechanism. [8] OR Consider the System G ( s ) =
1 s+a

[18]

where a is unknown parameter. Assume that the desired closed loop

2 . s 2 + 2s + 2 Construct continuous time and discrete time indirect self tuning algorithm for the system.
response of the system is Gm ( s ) =
[3764]-287 3

Q5) a) b)

Write a short note on: Linear Quadratic self tuning regulator. [8] Explain temperature control of a distillation column using adaptive control technique. [8] OR

Explain following industrial adaptive controllers with reference to parameter estimation, control design, prior information and industrial experiences. [16] a) EXACT: The Foxboro adaptive controller. b) Asea Brown Boveri (ABB) adaptive controller. Q6) Consider the system as shown in fig. 5 [16]

a) b) c)

Comment on stability of the closed loop system. Comment on controllability and observability of the system. Determine the optimal value of K such that

J = e 2 dt is minimum.
0

OR Consider the plant


dx1 dt 1 0 x1 1 + u = dx2 1 2 x2 0 dt

[16]

a) b) c)

Is the system is unstable? Is the system is controllable? Select the values for matrices Q and R with the constraint that they are positive definite and design a controller for the plant so as to minimize.

1 J = ( xT Qx + uT Ru ) dt 20 Check that the resulting overall system is stable.

TTT
[3764]-287 4

Total No. of Questions : 6]

[Total No. of Pages : 2

P1487

[3764] - 308 B.E. (Printing)


TECHNOLOGY OF GRAVURE & FLEXO

(2003 Course)
Time : 3 Hours] Instructions to the candidates:
1) 2) 3) Question Nos. 1 and 4 are compulsory. Out of the remaining attempt 2 questions from section I and 2 questions from section II. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks.

[Max. Marks :100

SECTION - I Q1) a) b) a) b) Q2) a) b) Explain in detail sections of a Gravure Press. Explain the Benefits and Limitations of Gravure Process. OR Explain in detail Configurations of a Flexo Press. Mention the applications and features of Flexo. [10] [8] [10] [8]

Explain in detail the relation between Speed and Viscosity on Gravure print quality. [8] Explain the loading systems for Doctor Blade. [8] OR

a)

b)

Write notes on i) Positioning of a doctor blade. ii) Reverse angle doctor blade. iii) Selection criteria for Gravure inks. iv) Back-up blades. Explain solvent and water based inks used in Gravure Process.

[8]

[8]

P.T.O.

Q3) Explain in detail web tension control system of a Gravure press. OR a) State Causes and Remedies of the following: i) Misregister ii) Wrinkles/Creases Write notes on i) Web Viewing System. ii) Splicing Mechanism. SECTION - II Q4) a) b) Explain in detail fountain roll inking system in flexography. Write notes on: i) Factors affecting Anilox selection. ii) Elastomers for Fountain Roller. OR a) b)

[16] [8]

b)

[8]

[10] [8]

Anilox plays an important role in ink transfer in flexography. Explain. [10] Write notes on: [8] i) Anilox Cell configurations. ii) Fountain Roller Loading. Explain in detail properties of elastomers for Gravure Impression System. [8] Explain Moving Impression and Moving Cylinder Impression System on a Gravure Press. [8] OR Explain in detail Impression Loading System for a Gravure Press. Write notes on: i) Impression Shore Hardness. ii) Sleeve Impression Roller. [8] [8]

Q5) a) b)

a) b)

Q6) Explain in detail optimization of a Flexo press. OR Explain in detail standardization of a Gravure press.

[16] [16]

TTT
[3764]-308 2

Total No. of Questions : 8]

[Total No. of Pages : 2

P1497

[3764] - 394 B.E. (Petrochemical)


PROCESS DYNAMICS & CONTROL

(2003 Course)
Time : 3 Hours] [Max. Marks :100 Instructions to the candidates: 1) Answers three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables, slide rule, Mollier Charts, electronic pocket calculator and steam table is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) c) Q3) a) b) c) Q4) a) Define following with help of neat diagrams: Decay Ratio, Damping Factor, Rise Time, Response Time. [8] Develop the mathematical expressions of two non-interacting tanks placed in series. Discuss the dynamics of the system. [8] What is linearization ? Why liberalized approximate models are useful for process control purposes? [6] Discuss the merits and usefulness of Feed-forward and Feed-back Control loops. [6] With help of neat sketch explain the proportional, derivative and integral modes of a PID controller. [6] What are Servo and Regulatory control problems - Discuss with help of neat diagram. [4] Derive the expression for overall transfer function of a simple thermometer. [6] Discuss the objectives and benefits of process control. [6] Solve the differential equation with help of Laplace Transform : [8]

d2y dy + 3 y = 3t where y (0) = 0 and y (0) = 2 2 dt dt


P.T.O.

b)

Find the overall transfer function of the following system :

[8]

SECTION - II Q5) a) b) c) Q6) a) b) Define Poles and Zeros of transfer function - Explain their significances. [4] nd Draw a representative Bode Plot for 2 order System. [8] Write a short note on Controller Tuning. [4] Describe with proper sketch the feed-back control scheme for a binary distillation column. [8] Oil and water are to be separated based on their differences in density. Develop a programmable logic control (PLC) algorithm for this industrially important process. [8] Explain Cascade Control Scheme with help of a suitable example. [6] With help of sketch explain transformations of Discrete Signals to Continuous and vice-versa. [6] With help of diagram explain Gain Margin and Phase Margin. [6] Calculate Amplitude Ratio and Phase Angle for overdamped 2nd order system with transfer function: G ( S ) = b)
12 . (4 s + 1) (6s + 1)

Q7) a) b) c) Q8) a)

[8]

Comment on the stability of the system represented by the closed loop transfer function as given below. [8]

TTT
[3764]-394 2

Total No. of Questions : 8]

[Total No. of Pages : 5

P1299

[3764] - 104 B.E. (Civil) STRUCTURAL DESIGN - III (2003 Course)

Time : 4 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer Q.1 or Q2, Q.3 or Q4 in Section - I. 2) Answer Q.5 or Q6, Q.7 or Q8 in Section - II. 3) Answers to the two sections should be written in separate books. 4) Figures to the right indicate full marks. 5) Use of Is 1343, IS 456, IS 3370 & non programmable calculator is allowed. 6) Neat diagrams must be drawn wherever necessary. 7) Assume any other data if necessary & mention it at the starting of the answer. 8) Mere reproduction from IS code as answer, will not be given full credit. 9) Assume any other data if required.

SECTION - I Q1) a) Explain in brief : i) ii) b) Lumped mass system in building frames. Single degree freedom. [8]

A post tensioned prestressed concrete beam section has top flange 550 150, web 150 550 and bottom flange 350 350 mm, is simply supported over a effective span of 16 m and carries a super imposed load of 12 kN/m over entire span. Calculate extreme fiber stresses in concrete at midspan at initial and final stage. Initial prestressing force is 1060 kN at eccentricity 450 mm at midspan and zero at support. Take loss ratio as 0.85 and unit weight concrete as 25 kN/m3. [17] OR P.T.O.

Q2) a)

A mild steel plate of cross section 10 mm 60 mm, of length 1100 mm is supporting a load of 160 N through a spring having stiffness K = 100 N/mm as shown in fig(1). Calculate the natural frequency of the system if modulus of elasticity of mild steel is 200 Gpa. [8]

b)

A post tensioned prestressed concrete beam section has top flange 500 150, web 125 600 and bottom flange 360 300 mm, is simply supported over a effective span of 16 m. The beam is prestressed with 4 No. of 12/5 Freyssinet parabolic cables with their c.g. at 120 mm from extreme bottom fiber, stressed one at a time from only one end to 900 Mpa. Calculate total loss of prestress at the age of 120 days, if k = 0.0026/m length of cable, slip of anchorage = 2 mm, Cc = 2.0, = 0.3, Es = 2 105 Mpa, concrete grade = M40, Creep and relaxation of steel = 2% of initial prestress. [17]

Q3) Design a post tensioned prestressed concrete rectangular or I section beam for flexure to carry a live load of 13.6 kN/m over entire simply supported span of 14 m with M45 grade of concrete and Freyssinet cables of 12/5 (fy = 1750 Mpa) or 12/7 (fy = 1500 Mpa), including the design of end block. Draw sketches showing cable profiles and end block reinforcement details. Check fiber stresses in concrete and deflection. [25] OR Q4) a) b) State remedial measures to be taken to reduce losses in continuous PSC beams. A post tensioned prestressed concrete continuous beam ABC of cross section 250 840 mm as shown in fig(2) is prestressed with initial prestressing force of 1500 kN. The loads shown are exclusive of dead load. Locate centerline of thrust under prestress plus dead load also & 2

[3764]-104

make it concordant stating the shift of cable at salient points find the stresses in concrete at extreme fibers at intermediate support take loss ratio of 0.85, AD = DB = BE = EC = 8m. The eccentricities at A & C = 0, at D & E = 220 mm (downwards), at B = 150 mm (upwards).

[25] SECTION - II Q5) a) b) Write detailed note on Horizontal forces on building and their calculation. [8] Analyze a rigid jointed frame shown in fig(3) by cantilever method for lateral loads. Flexural rigidity for all members is same. Analyze beam DEF using proper substitute frame, if it is subjected to vertical ultimate live & dead load incl. of its self wt. intensities of 12 kN/m & 15 kN/m on DE and 15 kN/m & 18 kN/m on EF respectively. Calculate max. span moment for span EF and support moment at E. Design section for combined effect of vertical and horizontal loads. Adopt 15% redistribution of moments for vertical load moments Use M20, Fe415. [17]

[3764]-104

OR Q6) a) b) Write detailed note on substitute frame method. [8]

Analyze a rigid jointed frame shown in fig(4) by portal method for lateral loads. Flexural rigidity for all members is same. Analyze beam GHI using proper substitute frame, if it is subjected to vertical ultimate live & dead load incl. of its self wt. intensities of 13 kN/m & 16 kN/m on GH and 18 kN/m & 20 kN/m on HI respectively. Calculate max. span moment for span HI and support moment at H. Design section for combined effect of vertical and horizontal Loads. Adopt 10% redistribution of moments for vertical load moments Use M20, Fe500 [17]

Q7) a) b)

Write detailed note on situation and necessity of combined footing.[5] Design circular reinforced concrete tank resting on ground to store 5 lakh liters of water the top of tank is open take the safe bearing capacity of the supporting strata as 220 kN/m2 Design the wall and bottom slab of the tank using IS code. Draw all details of reinforcements Use M20, Fe500. OR [20]

[3764]-104

Q8) Design a L shaped retaining wall for two layered leveled backfill for the following data Upper layer, height = 2.4 m, = 30, = 18 kN/m3 Lower layer, height = 3m, = 31, = 19 kN/m3 Safe bearing capacity of the underlying strata = 180 kN/m2, The coefficient friction between the base slab and the underlying strata = 0.55. Draw lateral pressure diagram and details of reinforcement of stem and base showing curtailment if any Use M20, Fe415. [25]

vvvv

[3764]-104

Total No. of Questions : 8]

[Total No. of Pages : 4

P1301

[3764] - 108 B.E. (Civil) STRUCTURAL DESIGN OF BRIDGES (2003 Course) (Elective - I)(401005)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) 7)

From Section - I answer Q.1 or Q2, Q.3 or Q4 and from Section - II answer Q.5 or Q6, Q.7 or Q8. Answers to the two sections should be written in separate answer books. Figures in bold to the right, indicate full marks. IS 456, IS 800, IS 1343 and steel table are allowed in the examination. Neat diagrams should be drawn wherever necessary. If necessary, assume suitable data and indicate clearly. Use of electronic pocket calculator is allowed.

SECTION - I Q1) a) b) c) Explain the various loads specified by IRC. superstructure. Explain with neat sketch T beam deck slab bridge. OR Q2) a) b) c) Explain IRC Class AA Tracked and Wheeled loadings with neat sketches. What are bridge bearings? Explain with neat sketches. [9] [8] Explain how the deck slab of a T beam deck slab bridge analyzed.[8] [9] [8] [8]

Classify bridges on the basis of materials of construction and forms of

P.T.O.

Q3) An R.C. T-Beam deck slab bridge shown in Fig. 3 has the following details : a) b) c) d) e) f) g) Thickness of railings - 100 mm. Thickness of footpath - 200 mm. Thickness of wearing coat - 80 mm. Span of main girder - 23.0 m. Spacing of cross-beams - 3.0 m c/c. Live load - IRC Class AA Tracked Vehicle. Materials - M30 grade of concrete and Fe 415 grade of steel Adopt m1 = 0.055 and m2 = 0.021. Design the interior panel and the cantilever slab. [25]

OR Q4) For the R.C. T-Beam deck slab bridge given in Q.3, design the intermediate post-tensioned prestressed girder. Use M45 grade of concrete and high tension strands of 7 ply 15.2 mm diameter having an ultimate tensile strength of 1600 N/mm2. Use Fe 415 steel for supplementary reinforcement. Consider loss ratio as 0.85. [25]

[3764]-108

SECTION - II Q5) a) b) Explain with neat sketches deck and through type truss girder steel bridges. [13] Explain the various loads acting on railway steel bridges. OR Q6) Design a rocker bearing for a 28 m span truss girder railway bridge with the following data. The reaction due to dead load, live load and impact load is 1250 kN. The vertical reaction due to overturning effect of wind at each end of the girder is 130 kN. The lateral load due to wind effect at each bearing is 75 kN. The tractive force and braking force are 981 kN and 686 kN respectively. Draw a neat sketch of detailing. [25] [12]

Q7) The Pratt truss through type railway bridge shown in Fig. 7 has the following details : a) b) c) d) e) f) [25] Weight of stock rail - 0.65 kN/m. Weight of check rail - 0.45 kN/m. Timber sleepers of size - (0.25 0.25 2.5) m @ 0.40 m c/c. Unit weight of timber - 7.5 kN/m3. Spacing of truss - 6.5 m c/c. The bridge supports a udl of 2950 kN. Design the members U3-U4, U3-L4 and U3-L3. Draw a neat sketch of the connection of members at U3.

OR [3764]-108 3

Q8) For the Pratt truss through type railway bridge shown in Fig. 7, design the top and bottom lateral bracing with the given data. The rails are 900 mm above the cg of bottom chord. The chord members are 450 mm deep and 500 mm wide. The end posts are 500 mm deep and 500 mm wide. The web members are 500 mm deep and 240 mm wide. [25]

vvvv

[3764]-108

Total No. of Questions : 12]

P1302

[Total No. of Pages :2

[3764] - 109 B.E. (Civil)


ARCHITECTURE AND TOWN PLANNING

(2003 Course) (Elective - I)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two section should be written in separate books. 2) Draw diagrams wherever necessary. 3) Maximum marks for each question is given in parentheses.

SECTION - I Q1) Describe activated sludge process for wastewater treatment. Mention the advantages and disadvantages. What factors influence the microbial composition in activated sludge process? [18] OR Q2) Describe the physical, chemical and biological characteristics of waste water. Why is it important to characterize wastewater? [18] Q3) a) b) Name the types of solids present in waste water. How would you determine the amount of suspended solids present in waste water? [8] Explain fixed film biological process for wastwater treatment with an example. [8] OR Q4) a) b) With the help of a neat sketch, discuss the working of a Grit chamber.[8] Differentiate between aeration mechanisms in aerated lagoons and RBC. [8] [16]

Q5) Differentiate ANY TWO : a) Unit operation and Unit Process. b) Aerated lagoons and trickling filters. c) Chemical Oxygen Demand and Biological Oxygen Demand. d) Neutralization and Proportioning.

P.T.O.

SECTION - II Q6) Write short note on : a) Composting. b) Bioremediation. c) Phytoremediation. OR Q7) a) b) c) Why are hydrocarbons slow to degrade? What is the role of surfactants in bioremediation of hydrocarbons? How does the addition of fertilizer to oil spills affect the growth of bacteria? [8] [18] [18]

Q8) Explain the disposal of solid waste by composting. OR

Q9) Describe the aerobic and anaerobic degradation of Polychlorinated Hydrocarbons. [8] Q10)What is the significance of Bioventing and Bioaugmentation in Bioremediation? [8] OR Q11)What is the difference between slurry phase and solid phase bioremediation? [4] Q12)Write short notes on ANY TWO : a) b) c) d) Applications of land farming. Advantages and limitations of Bioremediation. Methods for Waste minimization. Sampling techniques in waste water. [16]

kbkb

[3764]-455

Total No. of Questions : 12]

P1304

[Total No. of Pages :3

[3764] - 113 B.E. (Civil)


EARTHQUAKE ENGINEERING

(2003 Course) (Elective - II)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Solve Q.No. 1 or Q.No. 2, Q.No. 3 or Q.No. 4, Q.No. 5 or Q.No. 6 from section I and Q.No. 7 or Q.No. 8, Q.No. 9 or Q.No. 10, Q.No. 11 or Q.No. 12 from section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Use of logarithmic tables, slide rule and nonprogrammable electronic pocket calculator is allowed. 7) Assume suitable data, if necessary. 8) Use of latest IS codes. 9) All formulae used, numerical values substituted and answers at intermediate steps should be shown clearly.

SECTION - I Q1) a) b) Name the major plates of earth and explain the Plate Tectonic Theory.[6] What is intensity of earthquake? Describe Modified Mercalli Earthquake Intensity Scale and Magnitude of earthquake. [10] OR State the causes of earthquake and describe the nature of earthquake motion. [6] Classify and describe with suitable sketches different types of waves generated by an earthquake and their effects on structure. [10] Obtain expressions for dynamic amplification factor (DAF) for un-damped SDOF system subjected to harmonic loading. Also state when the displacement will remain in phase with applied load? [6] What is logarithmic decrement? Prove that logarithmic decrement = 2 for very small values of . [6] In a free vibration test on single storey RC structure following observations are recorded[6]
P.T.O.

Q2) a) b)

Q3) a)

b) c)

i) Lateral force = 36,000 kg. ii) Initial horizontal displacement = 50.8 mm. iii) Time required for 4 complete cycles = 2 sec. iv) Amplitude at the end of 4 complete cycles = 25.4 mm. Compute 1) damping ratio, 2) natural period of un-damped vibrations. OR Q4) a) b) c) For a single degree damped free vibration system, derive the expressions for damped frequency and critical damping. [6] Explain Transient and Steady State Vibrations. [6] A roof of one storey building has a mass of 1500 kg. All columns supporting roof together offer lateral stiffness of 20,000 N/m. The viscous damping coefficient is 500N/m/s. Calculate undamped natural frequency, damped frequency and period. [6]

Q5) Obtain natural frequency of vibrations and mode shapes. Write equations of motion considering the building to be shear building with EI for each column [16] 4.5 x 106 N/ m2. Refer Figure 5.1.

OR Q6) Calculate the normal frequency and mode shapes of a three storey building having equal floor masses and uniform stiffness of columns in each storey. The building consists of one bay only. [16] SECTION - II Q7) Single bay two storey portal frames are used for a building. Height of columns in each storey is 5.0 m and the span of beams is 8m. The frames are spaced at 5m c/c along length of the building. Calculate the lateral forces induced at each beam level due to an Earthquake force acting along the direction of beams. The building is in Zone IV. Each floor has a total Dead load of 5kN/m2 and is to carry an Imposed load of 3 kN/m2. Assume other data as required. [18] [3764]-113 2

OR Q8) Design a shear wall in an RCC portal frame. The wall is 5m long and 4.5m in height. It is to resist an axial load of 7000 kN, a shear of 2500 kN and a moment of 4000 kNm. design all details for the wall. Assume suitable other data as required. [18] Q9) Design an isolated column footing subjected to an axial load of 2000 kN and a moment of 100 kNm. along the longer side. Assume column section 400 mm by 600 mm. Use concrete of M25 grade and reinforcement of grade Fe 415. Take SBC of foundation strata as 250 kN/m2. Assume all other suitable data as required. [16] OR Q10)At a column beam junction at 3rd floor level has columns from 3rd to 4th storey of size 300 mm x 500 mm. connected to a beam of width 300mm and total dept of 800mm. Calculate the moment capacity of the joint and give all details of ductile provision according to IS code 13920. Take concrete of M25 grade and main reinforcement of Fe 415 grade. Assume suitable other data as required. [16] Q11)a) Give details of expected damages by Earthquake in structures with i) Soft storey ii) Floating columns iii) b) Building frames without shear panels. iv) Unsymmetric plan. [8]

Dampening percentage for a building frame and its consequences in seismic Analysis. Explain how variations in dampening can be accounted for. [8] OR [16]

Q12)Write short notes on : a) Base isolation. b) Retrofitting for bridges. c) Retrofitting for masonry houses. d) Tuned mass dampeners.

kbkb
[3764]-113 3

Total No. of Questions : 12]

P1307

[Total No. of Pages :4

[3764] - 120 B.E. (Civil)


TRANSPORTATION ENGINEERING - II

(2003 Course) (401009)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer Q1 or Q2, Q3 or Q4 and Q5 or Q6 from section I and answer Q7 or Q8, Q9 or Q10 and Q11 or Q12 from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, electronic pocket calculator and steam tables, is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) d) Q2) a) What are the various characteristics of Road Transport? Also, state clearly the scope of Highway Engineering for the present era. [5] Highlight the salient features of Bombay Road development plan. Explain how origin and Destination studies are carried out. Write a brief note on Road user and vehicular characteristics. OR Write short note on : i) Classification of Roads. ii) Different Road patterns. Write an explanatory note on 3rd 20 year Road development plan [4] [4] [4] [4]

b) c) d) Q3) a) b)

[5]

Explain how you will carry out spotspeed studies, by taking a suitable example. [5] State the data that are to be collected during Accident studies. [3]

Discuss the various factors controlling Highway alignment with suitable sketches. [6] Explain with suitable sketches, the various situations that are to be considered in the design for sight distance. [6]
P.T.O.

c)

Carry out the analysis of overtaking sight distance. OR

[5]

Q4) a) b) c)

What is an Ideal transition curve? State clearly and hence explain how the length of transition curve is determined? [5] Write short note on Highway drainage. [4] A valley curve is formed by a descending grade of 1 in 25 meeting an ascending grade of 1 in 30. Design the length of valley curve to ful fill both comfort condition and headlight sight distance requirements for a design speed of 80 KMPH. Assume allowable rate of change of centrifugal [8] acceleration = 0.60 m/sec2/sec. Discuss the various design factors to be considered in the design of pavement. [4] Ennumerate the various points recommended by IRC : 37 - 1970 for the C.B.R. method of design of pavements. [6] Explain the westergaards stress equations for wheel Loads at all the 3 regions of a cement concrete pavement. [6] OR Write a note on development of nursery for planting of trees on road sides for road side development. [4] With the aid of neat sketches explain the Design of Joints in cement concrete pavements. [6] Explain W.B.M road construction w.r.t the following : i) Gradation of aggregates. ii) Equipments and Machinery required. iii) Construction details. [6] SECTION - II

Q5) a) b) c)

Q6) a) b) c)

Q7) a)

Describe the following aircraft characteristics in detail i) Size of aircraft. ii) Minimum turning radius.

[6]

b)

Discuss the types of surveys to be carried out for site selection for an airport. [4]

[3764]-120

c)

The runway length required for Landing at sealevel in standard atmospheric conditions is 3000m. Runway length required for take off at a level site at sea level in standard atmospheric conditions is 2500m. Aerodrome reference temp. is 25C and that of the standard atmosphere at aerodrome elevation of 150 m is 14.025C. If the effective runway gradient is 0.5%, determine the runway length to be provided. [7] OR Discuss the general considerations during the selection of site for a heliport and Also, sketch a typical layout of Heliport. [6] Explain the following : i) Wind rose type II. ii) Factors affecting Airport capacity.

Q8) a) b)

[6]

c) Q9) a) b) c) d) Q10)a) b)

Classify the Airport as per ICAO and hence state the specifications for geometric design elements of runway as per ICAO. [5] Explain the Indirect method of Determining the maximum flood discharge. [5] State the preventive measures to minimise the effect of scour. [3] With the aid of a neat dimensioned sketch explain how IRC class A Loading is considered on bridges? [5] Give neat sketches of i) column bent pier ii) pile bent pier. OR Derive the formula for Economic span. Also state the assumptions. [5] A bridge is proposed to be constructed across an alluvial stream carrying a discharge of 250 m3/sec. Assuming the value of silt factor, f = 1.00, Determine the maximum scour depth when the bridge consists of i) 4 spans each of 20 mtr and ii) 3 spans each of 20 mtr. [6] Write an illustrative sketch of an abutmentpier. State the various forces acting on an Abutment. [3] [3] [4]

c) d) Q11)a) b) c) d)

State the functions of bearings used in bridges and also enlist the types of bearings. [4] Discuss the different techniques of errection of bridges. Draw a neat labelled sketches of i) Pipe culvert ii) Box culvert. Explain in brief i) continuous bridges ii) cable stayed bridges. 3 [4] [4] [4]

[3764]-120

OR Q12)a) b) c) d) Highlight the advantages of suspension bridges. Write short note on Maintenance of bridges. Differentiate between. i) ii) iii) iv) Free bearing and fixed bearing. Rocker bearing and Expansion bearing. Culvert and a bridge. Deck bridges and Through bridges. [4] [4] [1 each]

Draw a neat labelled sketches of i) cut boat bridges ii) swing bridges.[4]

kbkb

[3764]-120

Total No. of Questions : 12]

P1313

[Total No. of Pages :4

[3764] - 142 B.E. (Mechanical) POWER PLANT ENGINEERING (2003 Course)

Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables slide rule. Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Unit - I Q1) a) b) Q2) a) b) c) List and explain the factors affecting site selection for a thermal power plant. [8] Discuss the role of NTPC in the development of power in India. [8] OR Compare the merits and demerits of steam power plant and Gas turbine power plant. [6] With neat sketch explain the working of a pressurised water reactor (PWR). [6] Write a note on nuclear waste disposal. [4] Unit - II What do you understand by coal benefication? What are its advantages?[8] Coal Methanol Mixture (CMM) is considered more promising than Coal Oil Mixture (COM) and Coal Water Mixture (CWM). Discuss in detail.[8] OR With neat sketch explain : [8] i) Mechanical dust collectors. ii) Electrostatic precipitators. Write a note on inplant handling of coal. [8]
P.T.O.

Q3) a) b)

Q4) a)

b)

Unit - III Q5) a) b) What are the salient features of high pressure boilers? State their advantages. [6] In a steam power plant of 60MW capacity boiler supplies steam at 100 bar, 450C. The steam expands to 20 bar in HP turbine, and reheated to 400C in the reheater. There after steam expands to a condenser pressure of 0.04 bar. The pressure loss in the reheater is 1 bar. Assuming isentropic efficiency of expansion as 85% in HP stage and 82% in LP stage, find the steam generation capacity required in Tonnes/hour. Take transmission efficiency from turbine to generator as 97% and generator efficiency as 95%. Neglect feed pump work. Calculate overall efficiency. Draw a neat line diagram of the plant and represent the cycle on T-S diagram. [12] OR Q6) a) b) c) With a neat sketch explain the working of a schmidt-Hartman boiler. [6] What are the requirements of a steam piping system in a steam power plant? [6] Explain with a schematic and T-S diagram the working of a topping cycle. [6] SECTION - II Unit - IV Q7) a) b) c) Derive the relation between area, velocity and mach number for a varying cross section. [6] What do you understand by supersaturated flow? Explain. [4] Dry saturated steam at 5 bar enters a convergent-divergent nozzle at a velocity of 100 m/s and leaves at 1.5 bar . The throat and exit areas are 1200 mm2 and 1600 mm2 respectively. Assuming isentropic flow upto throat and taking critical pressure ratio as 0.58, estimate the mass flow rate of steam and nozzle efficiency. [8] OR Q8) a) What is the necessity of condensers in a steam power plants? Write its advantages. [6]

[3764]-142

b)

Define and explain with sketch. i) Degree of supersaturation. ii) Degree of undercooling.

[4]

c)

What are the sources of air in a condenser? Explain the working of an Edwards air pump. [8] Unit - V

Q9) a) b)

Derive an expression for diagram efficiency of a single stage impulse turbine. Obtain the condition for maximum efficiency and its value. [8] In a stage of an impulse turbine provided with a single row of wheel the mean diameter of the blade ring is 3000 rpm. The absolute velocity of steam at inlet to the blades is 300 m/s and the nozzle angle is 20. The rotor blades are equiangular and the blade velocity coefficient is 0.87. Determine the power developed in the blading if axial thrust on the blades is 150 N. [8] OR List the various losses in turbines and explain them briefly. [6]

Q10)a) b)

In a certain stage of a reaction turbine, steam leaves the fixed blade at a pressure of 2.8bar, 0.97 dry and a velocity of 150 m/s. The blades are 30 mm high and the discharge angle for both rings is 20. The ratio of axial velocity of flow to the blade velocity is 0.72 at inlet and 0.76 at exit from the moving blade. If the turbine uses 5kg/s of steam with 5% tip leakage, determine the mean blade diameter and power developed in the ring.[10] Unit - VI

Q11)a) b)

Explain how unit energy cost is calculated. Define : i) Load factor iii) Plant use factor ii) iv) Capacity factor Diversity factor

[5] [4]

c)

A power plant of 240 MW capacity (installed) has following particulars: Capital cost = Rs 20000 per kW installed capacity. Interest and depreciation = 12% Load factor = 0.6; capacity factor = 0.56 Annual running charges = Rs. 3108 Energy consumed in power plant auxiliaries = 8% Calculate the cost of power generation / kWh and reserve capacity. [7] OR 3

[3764]-142

Q12)a) b)

Draw and discuss the nature of load curves for atleast 4 types of consumers. [6] The maximum demand of a power plant is 96 MW and the daily load is give below. Time (hrs) Load (MW) 0-6 48 6-8 60 8-12 72 12-14 60 14-18 84 18-22 96 22-24 48

Draw load curve and load duration curve. Calculate the load factor of the power plant. What is the load factor of stand by equipment rated at 30 MW that takes up all load in excess of 72 MW. Also calculate use factor. [10]

kbkb

[3764]-142

Total No. of Questions : 12]

[Total No. of Pages : 3

P1317

[3764]-149 B.E. (Mechanical) AUTOMOBILE ENGINEERING (2003 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6)

Answer three questions from Section I and three questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain with help of neat sketch any one typical layout for an automobile engine and describe its advantages and drawbacks over other layouts.[8] b) List essential parts of the exhaust system. State their function each. [8] OR Q2) a) What are vehicle specifications? Explain classification of vehicles and chassis. Describe specification of any one light motor vehicle of your choice. [8] b) Explain classification of clutch. Describe with neat sketch function and working of multiplate clutch. [8] Q3) The coefficient of rolling resistance for a vehicle weighing 7500 kg is 0.016 and the coefficient of air resistance is 0.0028 in the formula R = kW + KaAV2 where Frontal area in M2, V is speed in kmph. The transmission efficiency in the top gear is 5.5 : 1 is 90% and that in second gear of 11 : 1 is 80%. The Frontal area is 5.57 M2. If the vehicle has maximum speed of 85 kmph in top gear, find engine power. If effective wheel diameter is 90 cm, find engine speed. Also determine the maximum grade the vehicle can negotiate at the above engine speed in second gear, as well as maximum draw bar pull on level at above engine speed in second gear. [16] OR

P.T.O.

Q4) a) Explain in detail various resistances to the motion of vehicle, tractive effort & performance curve for a vehicle. [8] b) Describe working of synchromesh gear box with neat diagram and also state its advantages. [8] Q5) a) Give the purpose of motor vehicle suspension. What are the advantages of independent suspension over solid axle suspension. [6] b) Explain briefly air suspension system used in automobiles. [6] c) Explain the constructional aspects of the rear leaf spring suspension system. [6] OR Q6) Write short note on the following (any three) : a) Sprung weight and on sprung weight. b) Torque convertor. c) Self levelling suspension. d) Automatic Transmission. e) Clutch lining material. SECTION - II Q7) a) Explain the steering geometry and the effect of any two angles on the dynamics of the vehicle. [8] b) Discuss the constructional details of cross play tyres. OR Q8) a) What are different types of wheels used in automobiles. Discuss their relative merits. [8] b) Describe with the help of sketch the working of power steering unit. [8] Q9) a) Explain with neat sketch construction of propellor shaft. [6] [8] [18]

b) Indicate the differences between semi floating axle, three quarter floating axle and full floating axle. [6] c) Describe constant velocity universal joint used in automobiles. OR [4]

[3764]-149

Q10) a) What is a non slip differential or differential lock? Describe its operation.[6] b) Explain with neat sketch construction of stub axle and wheel mounting.[6] c) How can gear ratio of a final drive be determined? [4]

Q11) a) With neat sketch explain the construction and operation of hydraulic brake system. [6] b) Sketch and describe the components and the operation of a battery used in automobile. [6] c) For following troubles describe in short what are causes and remedies.[6] i) Failure of the petrol engine to start. ii) Increased fuel consumption. OR Q12) Write short note on the following (any three) : a) Preventive maintenance in automobiles. b) Anti skid braking system. c) Vacuum Advance in Ignition system. d) Spark plug. e) Cut out. [18]

[3764]-149

Total No. of Questions : 12]

P1329

[Total No. of Pages :4

[3764] - 181 B.E. (Production Engineering) CAD/CAM/CIM (2003 Course)

Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Attempt one question of each unit form Section - I and Section - II. 2) Answers to the two sections should be written in separate books. 3) Draw neat diagram wherever necessary. 4) Assume suitable data, if required.

SECTION - I Unit - I Q1) a) Perform the following transformation if the co-ordinates of the vertices of the pentagon are A(4,1),B(8,1),C(10,4),D(6,7) and E (2,4) Determine the new position of Pentagon for following transformation- Scaling by 2 units in X and Y direction and rotate by 30 anticlockwise about A. [8] What are the salient features of half space boundary Representation solid modelling approach. [7] OR Explain the different technique for image generation on CRT. [7] Write a 3 X 3 transformation matrix for a line XY with end points X(3,3) and Y(7,7) ,find new co-ordinates of line for following transformation. i) Translate X and Y 2 unit. ii) Scale in X and Y direction by 2 unit. iii) Rotate by 45 degree in CCW. [8] Unit - II Q3) a) b) Write a short note on DNC. [5] Explain with sketch the positioning of tool in CNC-Vertical along with axis representation. [5]

b)

Q2) a) b)

P.T.O.

c)

Write a CNC program in G and M code for a part as shown in fig No.1. Also write a remark for each block [10]

OR Q4) a) b) Write a notes on : i) AGV system in FMS, ii) Peterinets. [12]

What do you understand by flexible manufacturing systems? Explain the different components in FMS. [8] Unit - III

Q5) a)

In CIM database comprise four classes of data : i) Product data. ii) Manufacturing data. iii) Operational data. iv) Resource data. Explain it. Explain CIM? Its evolution. OR

[8]

b)

[7]

Q6) a)

Explain following module of MRP-II : i) Capacity requirement. ii) Master Production schedule.

[8]

b)

Describe various elements of a robotic -system in brief Describe each element in brief. [7]

[3764]-181

SECTION - II Unit - IV Q7) a) b) With neat diagram explain the concept solid based curing process of RP. [8] Explain with reasons why rapid prototyping is necessary in todays manufacturing era. [7] OR Q8) a) b) Explain with neat sketch selective sintering process of RP. [8] Explain with neat sketch laminated object manufacturing technique of RP. [7] Unit - V Q9) a) b) c) Explain the FEA for analysis purpose. [6] Explain monocode and ploy code system for coding the parts in GT.[6] Consider the following part machine matrix. Apply rank order clustering algorithm to it and identify the part families and machine groups. [8] P1 M1 M2 M3 M4 M5 M6 M7 M8 1 1 OR 1 1 1 1 1 1 1 1 1 P2 P3 1 1 1 1 1 P4 1 P5 1 1 P6 1 1 1 P7 P8

[3764]-181

Q10)a)

A stepped bar is made of two materials joined together as shown in following figure. The bar is subjected to an axial pull of 15KN. Determine the displacement, reaction force at support, stress of each of the section using a ID spar element. [14]

A1 = 250 mm2, E1 = 180 GPa A2 = 150 mm2, E2 = 120 GPa. b) Explain why Group technology reduces production time. Unit - VI Q11)a) b) What is concurrent engineering? Explain the steps in sequential engineering. [7] Explain IBM concept of CIM related to Data and work flow integration and Enterprise optimization [8] OR Q12)a) b) Explain the scope of integration of CIM model of Digital equipment Corporation (DEC). [8] Discuss various difficulties encountered in carrying out concurrent engineering. [7] [6]

kbkb

[3764]-181

Total No. of Questions :12]

[Total No. of Pages : 2

P1330
[3764]-183 B.E. (Production) ERGONOMICS & HUMAN FACTORS IN ENGINEERING (2003 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answer three questions from section I and three questions from section II. 2) Figures to the right indicates full marks. 3) Neat diagrams must be drawn wherever necessary. 4) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Q2) a) b) c) Q3) a) b) c) Q4) a) b) c) What is cumulative trauma disorder? What are the causative factors of CTD? [8] Write a note on luminance ratio. Explain vasoconstriction due to cold stress. Write a note on concept of percentile. Describe the utility of work study in todays situation. What is biomechanics? Explain in brief. [4] [4] [4] [6] [6]

What are the requirements for designing a reasonably safe product? [8] Differentiate between static dimensions and dynamic dimensions. Discuss the effect of lighting on elderly. [4] [4]

Define anthropometry. What are the important objectives of anthropometry? [8] What are the types of data used in arranging components? Write a note on design of two hand controls. [4] [4]

P.T.O.

Q5) a) b) c) Q6) a) b) c)

Write a note on work and rest cycles. Explain any two anthropometric design principles.

[6] [6]

Explain heat exchange process in brief and discuss how sweating is helpful in maintaining body equilibrium. [6] Discuss how the noise can be controlled in different ways. Explain mirror image arrangements in brief in accordance to their applicability. SECTION - II [6]

Explain science of seating? How to promote lumbar lordosis? [6] [6]

Q7) a) b) Q8) a) b) c) Q9) a) b) Q10)a) b) c) Q11)a) b) Q12)a) b)

Describe cardiovascular and respiratory response in work physiology.[8] What are learning curves? Explain their use in HFE. [8]

Describe significance of special control devices in ergonomics design. [6] Define VO2max. How is the heart rate used for calculating VO2max? [6]

What do you mean by control response ratio? Explain its significance in designing of controls. [6] Discuss effects of noise on performance. Write a note on human factors application in systems design. Explain any two principles used in hand tool design. What are various criteria when designing for shift work? What is Hand Arm Vibration Syndrome. Explain in brief. [6] [10] [6] [4] [6]

Discuss in brief the steps involved in getting the standard time using MTM1. [8] Mention the benefits of Pre-determined time standards. What is MTM? Describe any four elements of MTM 1. [10] What is WFS? What are its types? Explain Detailed WFS in brief.[12] Explain the Reach element used in MTM 1? What are its classes? [6]

####
[3764]-183 2

Total No. of Questions : 12]

[Total No. of Pages : 3

P1334

[3764] - 193 B.E. (Production S/W) ERGONOMICS AND HUMAN FACTORS IN ENGINEERING (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer three questions from each Section - I and three questions from section II. 2) Figures to the right indicate full marks. 3) Neat diagrams must be drawn wherever necessary. 4) Assume suitable data if necessary.

SECTION - I Q1) a) b) Define Ergonomics. State the objectives, doctrines used. Explain significance of warnings in brief. OR Q2) a) b) c) Q3) a) b) Write a note on concept of percentile. Describe the utility of work study in todays situation. What are the requirements for designing a safe product? [4] [6] [6] [8] [8]

Explain the concept of work spaces and discuss the work space envelopes for seated personnel. [8] Explain the considerations for designing a seated work surface. [8] OR

Q4) a) b) c)

Explain the concept of backlash and deadspace in designing of controls. Explain the difference between them. [8] What are the types of data used in arranging components. [4] Write a note on design of two hand controls. [4] P.T.O.

Q5) a) b) c)

Explain different considerations for lighting of VDT. Write a note on individual differences and heat stress.

[6] [6]

Explain heat exchange process in brief and discuss how sweating is helpful in maintaining body equilibrium. [6] OR

Q6) a) b) c)

Discuss the concept of hearing loss and explain the types and effects of occupational hearing loss. [6] How is the noise controlled at the receivers end? [6] What do you mean by clo? Discuss the importance of proper clothing and clo value? [6] SECTION - II

Q7) a) b)

Explain various limits of MMH Task Design. What are learning curves? Explain their use in HFE. OR

[8] [8]

Q8) a) b) c)

Discuss effects of methods of work, work posture and work rate on energy consumption. [6] Define VO2max. How is the heart rate used for calculating VO2max? [4] Differentiate between aerobic glycolysis and anaerobic glycolysis. Explain their significance in physical work. [6] Write a note on Carpel Tunnel Syndrome. Discuss how it is minimized. [6] Write a note on Work Rest Cycle. [4] What are the design considerations for Accelerator and Brake Pedals of an Automobile. [6] OR

Q9) a) b) c)

[3764]-193

Q10)a) b) c) Q11)a) b)

What do you mean by tissue compression stress? Explain its significance in Hand Tool Design. [6] Explain significance of C/R Ratio in detail. [4] What is Hand Arm Vibration Syndrome? Explain in brief. [6] Discuss in brief the steps involved in getting the standard time using MTM - 1. [8] Mention the benefits of Pre-determined time standards. What is MTM? Describe any four elements of MTM - 1. [10] OR

Q12)a) b)

What is WFS? What are its types? Explain Detailed WFS in brief.[12] Explain the Reach element used in MTM - 1? What are its classes. [6]

vvvv

[3764]-193

Total No. of Questions : 12]

P1338

[Total No. of Pages :3

[3764] - 202 B.E. (Electrical)


UTILIZATION OF ELECTRICAL ENERGY

(2003 Course) (403142)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Discuss the different methods of electric heating and their relative merits. [8] Explain the various ways in which the temperature in resistance oven can be controlled. [8] OR Q2) a) b) What are the modern welding techniques? Describe them. [8] An insulating material 2 cm thick and 200 cm2 in area is to be heated by dielectric heating. The material has relative permitivity of 5 and power factor of 0.05 power required is 400W and frequency of 40 MHz is to be used. Determine the necessary voltage and the current that will flow through the material. If the voltage were to be limited to 700V, what will be the frequency to get the same loss? [8] What are the various applications of electrolysis? Explain extraction of [8] metals (Take example of any metal). Discuss the objective of electroplating and describe any one process for electroplating. [8] OR
P.T.O.

Q3) a) b)

Q4) a) b) Q5) a) b) c)

Explain faradays laws of electro-deposition. Also explain what is the need of electrodepositions. [8] With the help of a circuit diagram, explain the working of a water cooler.[8] State and explain laws of illumination. What is flood-lighting and where it is used. What are the requirements of good lighting? Explain in detail. OR [6] [6] [6]

Q6) a) b) c)

State and describe various types of lighting schemes.

[6]

Explain with a neat diagram the principle of operation of a sodium vapour lamp. Mention its use. [6] A room of size 15x6 metres is to be illuminated by twenty 200W lamp. The mscp of each lamp is 250. Assume a depreciation factor 1.2 and utilization factor 0.6. Find the average illumination produced on the floor. [6] SECTION - II

Q7) a) b)

What are the different traction systems? Discuss them in brief.

[8]

Draw a general block diagram for A.C. electric locomotive and explain it. [8] OR

Q8) a) b) Q9) a) b)

What are the advantages and disadvantages of electric traction?

[8]

Discuss various current collection system used in electric traction. [8] Derive expression for simplified quadrilateral speed-time curve. [8]

The distance between two stations is 1km and the schedule speed is 30 kmph, station stopping time 20 seconds. Assuming braking retardation 3 kmphps and maximum speed 1.25 times the average speed. Determine the acceleration required to run the service if the speed time curve is approximated by a trapezoidal curve. [8] Draw the speed time curve of a sub-urban and urban service train and explain. [8] 2

Q10)a)

[3764]-202

b)

An electric train has an average speed of 42 kmph on a level track between stops 1400 m apart. It is accelerated at 1.7 kmphps and is braked at 3 kmphps. Estimate the energy consumption at the axle of train per tonne-km. Take tractive resistance constant at 50N / tonne & allow 10% rotational inertia. [8] What is regenerative braking? Discuss the suitability of dc shunt and series motors and 3 induction motor for electrical regenerative braking. [6] Differentiate between shunt transition and bridge transition. Draw the label circuit diagram for the same. [6] Explain the suitability of dc series motor for traction duties. OR [6]

Q11)a)

b) c)

Q12)a)

Explain with the energy diagram how the energy is saved with series-parallel starting in case of a locomotive engine using 4 motors for the operations. [6] What should be the essential electric & mechanical features of traction motors. [6] A train weighing 500 tonnes is going down a gradient of 20 in 1000. It is desired to maintain train speed at 40 kmph by regenerative braking. Calculate the power fed into the time. Tractive resistance is 40 N/tonne and allow rotational inertia of 10% and efficiency of conversion of 75%. [6]

b) c)

kbkb

[3764]-202

Total No. of Questions :12]

[Total No. of Pages : 3

P1343

[3764]-213 B.E. (Electrical) VLSI DESIGN (Elective - II) (2003 Course)


[Max. Marks : 100

Time :3 Hours]

Instructions to candidates: 1) Answer any three questions from each section. 2) Answer three questions from Section I and three questions from Section II. 3) Answers to the two sections should be written in separate books. 4) Neat diagrams must be drawn wherever necessary. 5) Figures to the right indicate full marks. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Differentiate Mealy & Moore machine modelling along with example.[6] Implement the following : i) ii) c)
m ( 0, 5, 6, 7, 9, 12 ) Using 8 : 1 Mux.

[3] [3]

Implement 16 : 1 Mux using only 4 : 1 Mux

Draw 4 bit binary UP/DOWN asynchronous MOD 16 counter along with its timing diagram. [6] OR

Q2) a) b) c) Q3) a)

What is the need of synchronous counter? Draw Mod 6 synchronous and asynchronous counter. [6] Draw 4 explain 4 bit PISO shift register. Draw state table state diagram and Implement 101 detector. Define and explain in brief : i) Entity. ii) Architecture. iii) Component. iv) Configuration. Draw ckt. of 2 4 decoder and write its VHDL code. OR P.T.O. [6] [6] [8]

b)

[8]

Q4) a) b) Q5) a) b)

Write VHDL code for MOD 100 counter and draw flowchart for it. [8] What is an architecture? What are its types? Explain any one of it with example. [8] Explain various data types and data objects of VHDL. [8]

What do you mean by configuration? How it can be use in practical application. Explain with VHDL code. [8] OR

Q6) a) b)

What do you mean by sub-program. Explain with VHDL code.

[8]

What do you understand by package? Explain it with practical electrical application. [8] SECTION - II

Q7) a) b) c)

Differentiate CMOS and NMOS. Explain the construction of MOSFET. Explain w.r.t. CMOS and give std. value. i) ii) iii) iv) v) Fan in. Fan out. Power dissipation. Figure of merit. Noise margin. OR

[4] [4] [10]

Q8) a)

Implement following gates using CMOS : i) ii) iii) NOT. AND. OR. [8] [5] [5]

iv) EXOR. b) c) Explain the voltage transfer characteristics of CMOS inverter. Explain Depletion type MOSFET.

[3764]-213

Q9) a) b)

Explain the Architecture of FPGA with the help of Xilinx 4000 family. Explain the complete process of simulation and synthesis in detail. OR

[8] [8]

Q10)a) b) Q11)a) b)

Explain the Architecture of CPLD along with its detailed diagram.

[8]

Explain the process of place and route and simulation with its types.[8] Write VHDL code for 8 8 RAM. Draw block diagram and write VHDL code for 4 bit ALU. OR [8] [8]

Q12)a) b)

Write VHDL code for Barrel shifter. Write VHDL code and explain 64 bit comparator.

[8] [8]

####

[3764]-213

Total No. of Questions : 12]

P1349

[Total No. of Pages :4

OPTICAL AND MICROWAVE COMMUNICATION (2003 Course)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Attempt Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from section - I & Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 from section - II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Assume suitable data, if necessary.

[3764] - 232 B.E. (E & TC)

SECTION - I Q1) a) b) c) Compare surface Emitting & Edge Emitting structures of LED. [6] Explain the construction & working of APD with the help of neat diagram. [6] Find core radius necessary for single mode operation at 820 nm of step Index fiber with n1 = 1.480 & n2 = 1.478. What is NA and maximum acceptance angle of fiber? Also calculate corresponding solid angle. [6] OR Q2) a) A double heterojunction In GaAs P LED emitting at a peak wavelength of 1310 nm has radiative & nonradiative recombination times of 30 nsec & 100 nsec resp. The drive current is 40 mA. Determine total recombination life time, internal quantum efficiency & internal power level of the source. [6] Explain the three transmission windows along with the attenuation curve for single mode fiber. [6] Draw the structure of PIN photodiode & explain its operation in brief. Plot the responsivity curve as a function of wavelength for PIN constructed of silicon. [6]
P.T.O.

b) c)

Q3) a) b)

Explain the major causes of attenuation along with their mechanism in an optical fiber. [6] Determine the maximum bit rate for RZ & NRZ encoding for the following pulse sperading constants & cable lengths. [4] i) t = 10 ns/m, L = 100 m ii) t = 20 ns/m, L = 1000 m iii) t = 2000 ns/m, L = 2 km What is dispersion? Explain intermodal dispersion in detail. OR Explain bending losses in the fiber. What are the linear scattering losses in the fiber. [6] [4] [6]

c) Q4) a) b) c)

A multimode SIF has NA of 0.3 and a core R.I of 1.45. The material dispersion parameters for the fiber is 250 ps nm-1 km-1 which makes material dispersion the totally dominating intramodular dispersion mechanism. [6] Estimate i) The total RMS pulse broadening per km when fiber is used with a LED source of RMS spectral width of 50 nm. ii) The corresponding BW-length product for the fiber. A D-IM analog optical fiber link of length 2 km employs an LED which launches mean optical power of -10 dBm into a multimode optical fiber. The fiber cable exhibits a loss of 3.5 dB km-1 with splice losses calculated at 0.7 dB km-1. In addition there is a connector loss at the receiver of 1.6 dB. The pin photodiode receiver has a sensitivity of -25 dBm for an SNR of 50 dB and with a modulation index of 0.5. It is estimated that a safety margin of 4 dB is required. Assuming there is no dispersionequalization penalty : [8] i) Perform an optical power budget for the system operating under the above conditions and ascertain its viability. ii) Estimate any possible increase in link length which may be achieved using an injection laser source which launches mean optical power of 0 dBM into the fiber cable. In this case the safety margin must be increased to 7 dB. What are the applications of optical amplifiers? State advantages of each of them. [8] OR 2

Q5) a)

b)

[3764]-232

Q6) a) b) c)

Write a short note on 2*2 fiber coupler. Explain basic structure of STS - 1 SONET frame. Explain in detail the concept of photonic switching. SECTION - II

[4] [6] [6]

Q7) a)

An air filled rectangular waveguide has dimensions of 6 cm 4 cm. The signal frequency is 3GHz. Compute the following for TE10 mode. [6] i) ii) iii) Cut off frequency. Wavelength in the waveguide. Wave impedance in the waveguide. [6] [6]

b) c)

Write a short note on waveguide termination. Differentiate between TM & TE mode in rectangular waveguide. OR

Q8) a) b) c) Q9) a) b)

Define scattering matrix & state its properties for a reciprocal & lossless [6] network. Explain directional coupler. Define coupling coefficient, directivity & [8] insertion loss. Write a short note on - Microwave Isolators. [4]

Compare two cavity klystron & Reflex klystron with relevant sketches.[8] The parameters of a two cavity klystron amplifier are Vo = 1200V, Io = 30 mA, F = 10 GHz Gap spacing in each cavity (d) = 1 mm Spacing between two cavities (L) = 4cm Effective shunt resistance of each cavity = 40 k . i) ii) iii) Find the input microwave voltage V1 in order to generate maximum output voltage. Determine the voltage gain. Calculate the efficiency of the amplifier. 3 [8]

[3764]-232

OR Q10)a) b) c) Q11)a) b) A helical slow wave structure has a pitch p of 2 mm & a diameter of 4 cm. Calculate the wave velocity in axial direction of helix. [4] Explain how mode jumping is avoided in magnetron. [4] Why magnetron is called crossfield devices? Explain how oscillations sustained in magnetron. [8] What are the limitations of conventional tubes at microwave frequencies? Explain how these oscillations can be overcome. [8] Explain principle of operation, IV chara. and equivalent circuit of microwave tunnel diode. [8] OR Q12)a) b) Draw constructional details & equivalent circuit of varactor diode. Explain its operation with any four applications. [8] A GaAs Gunn diode has an active region length of 10 m. If the electron drift velocity is 105 m/s, find the natural frequency & the critical voltage. The critical electric field is 3 kV/cm. [6] List the different operating modes of Gunn diode. [2]

c)

kbkb

[3764]-232

Total No. of Questions : 12]

[Total No. of Pages : 4

P1352

[3764] - 243 B.E. (Electronics) ADVANCED POWER ELECTRONICS (2003)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer Q1 or Q2, Q3 or Q4, Q5 or Q6 from Section - I and Q7 or Q8, Q9 or Q10, Q11 or Q12 from Section - II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) Draw the circuit diagram of a three-phase fully-controlled converter feeding a highly inductive (level) active load and the following waveforms for firing angle = 120. i) Supply phase voltages. ii) Supply line voltages. iii) Output voltage. iv) Phase B line current. [8] A three-phase fully-controlled converter operates from the 415V, 50Hz mains and feeds a highly inductive (level) active load having E = 400V and R = 20. If the firing angle is 120, calculate : i) Average (DC) load voltage. ii) Average (DC) load current. iii) RMS line current. iv) Power supplied by the battery of the active load. [10] v) Power fed back to the mains assuming the converter to be lossless. P.T.O.

b)

OR Q2) a) Why are dual converters important? With the help of a neat circuit diagram and relevant waveforms, explain the operation of a three-phase dual mode dual converter. [10] With the help of a neat circuit diagram, explain the technique for achieving equal voltage sharing of two series connected diodes. Derive the relationship between the current sharing resistors in terms of the diode parameters. [8] With the help of a neat circuit diagram, relevant waveforms and mode equivalent circuits, explain the operation of a three-phase, 180 mode, voltage source inverter feeding a balanced, star-connected resistive load. Also derive an expressions for the following : i) RMS line-to-neutral output voltage. ii) RMS SCR current. [10] Explain the MMSR technique of selective harmonic elimination for inverters. [6] OR Q4) a) With the help of a neat circuit diagram, relevant waveforms and mode equivalent circuits, explain the operation of a three-phase, ASCSI feeding an induction motor load. [10] Briefly explain any one technique for output voltage control and harmonic reduction in inverters. [6] With the help of a neat circuit diagram and relevant waveforms, explain the Symmetrical Angle Control (SAC) technique for power factor improvement in AC-DC converters. [8] Enumerate the different methods of sensing DC current in power electronic circuits and explain any one in detail. How would you modify this method to sense DC voltage? [8] 2

b)

Q3) a)

b)

b)

Q5) a)

b)

[3764]-243

OR Q6) a) With the help of a neat circuit diagram, waveforms of capacitor voltage & inductor current and mode equivalent circuits, explain the operation of a ZVS resonant DC-DC converter. [10] What are the advantages of resonant converters over switched-mode converters? [6] SECTION - II Q7) a) Compare the inherent properties of a typical DC stepper motor and DC servo motor with respect to any four of the following : i) ii) Speed control. Torque-speed behaviour.

b)

iii) Shaft-torque and input power. iv) Angular position control. v) b) Rotor inertia. vi) Start-stop operation at high speed. [10] Explain half-stepping & micro-stepping modes of operation for stepper motors. [8] OR Q8) a) With the help of a neat circuit diagram and relevant waveforms, explain the operation of a single-phase semiconverter-based separately excited DC motor drive. Derive expressions for the motor armature current and torque in terms of the firing angle, motor speed, field current and motor parameters. [12] A 230V, 1000rpm, 10A separately excited DC motor is fed from a single-phase semiconverter operating from the 230V, 50Hz mains. If Ra = 0.75, calculate the firing angle to obtain rated torque for a motor speed of 500rpm. [3764]-243 3 [6]

b)

Q9) Explain any two of the following methods for speed control of induction motors : [16] a) Variable frequency PWM-VSI drive. b) Stator voltage control. c) Slip power. OR Q10)a) With the help of the appropriate torque-speed characteristics, explain how electromagnetic braking is achieved for three-phase induction motors fed from a constant V/f variable voltage variable frequency drive. [8] A 4 pole, 415V, 50Hz, three-phase induction motor has a rated speed of 1460rpm. Calculate its speed, slip and slip frequency under constant V/f control for a stator frequency of 40Hz, the load torque being equal to 60% of rated motor torque. [8] Q11)a) b) What are the different types of transients present in the power system? What are the sources of these transients? [8] What are the different types of industrial and residential/ commercial loads which contribute to harmonics in the power supply? Explain the effect of these harmonics on the working of power systems and connected equipment. [8] OR Q12)a) b) Write a short note on Energy Audit. [8]

b)

Enumerate the different types of short-duration power-line voltage disturbances and explain any two in detail. [8]

vvvv
[3764]-243 4

Total No. of Questions : 12]

[Total No. of Pages : 3

P1356

[3764] - 281 B.E. (Instrumentation & Control) PROCESS INSTRUMENTATION - I (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer three questions from Section - I and three questions from Section - II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed.

SECTION - I Q1) a) b) Elaborate Control Valve Capacity Testing. [8] Differentiate between Source treatment and path treatment for reducing control valve noise. [8] OR Q2) a) b) With the help of necessary equations explain control valve pneumatic actuator design. [8] Comment on the valves used for high temperature and high pressure applications. [8] Substantiate single capacity processes are easiest to control. Explain the following terms : i) Interacting Lags. ii) Quarter Amplitude Damping. OR P.T.O. [8] [8]

Q3) a) b)

Q4) a) b)

Describe step analysis method for finding single time constant of a process. [8] Compare self regulating and non-self regulating processes. [8]

Q5) a) b)

What are the methods of Ratio Control? Why ratio calculations are done outside the control loop? [9] Compare feedback and feed-forward control system. OR [9]

Q6) a) b)

Describe with suitable application the Cascade Control.

[9]

With the help of a suitable diagram explain Split Range Control. [9] SECTION - II

Q7) a) b)

What are the desired qualities of a non linear controller. Explain with suitable examples. [9] Elaborate analysis of a typical Flow Control Loop. OR [9]

Q8) a) b)

Compare SLPC and MLPC.

[9]

Define the term Scaling. What is its necessity in Process Control? Explain the various steps involved in Scaling. [9]

Q9) a) b)

With the help of a neat block diagram explain the working of MRAC. [8] What is Self Tuning Controller? Explain its advantages and shortcomings. [8] OR

[3764]-281

Q10)a) b)

Explain the use of optimal controller to improve the performance of a process. [8] Explain the terms Steady state adaptive system and Dynamic adaptive system with reference to Adaptive Control. [8]

Q11)a) b)

With the help of suitable examples explain the need of advance process control techniques. [8] Explain the terms Fuzzifier and Defuzzifier w.r.t. Fuzzy Controller. [8] OR

Q12)a) b)

Explain the applications, merits and demerits of ANN based controller. [8] Explain the techniques for analysis of process control performance using SPC. [8]

vvvv

[3764]-281

Total No. of Questions : 12]

P1357

[Total No. of Pages :4

[3764] - 283 B.E. (Instrumentation and Control)


DIGITAL CONTROL

(2003 Course)
Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Assume suitable data, if necessary.

SECTION - I Q1) a) Derive a mathematical model of ZOH. Derive the pulse transfer function of the closed loop control system shown by Fig. 1 [8]

b)

Examine the stability of following system by using Jury stability test. [8] P(z) = 2z4 + 7z3 + 10z2 + 4z + 1 OR

Q2) a)

Obtain the pulse transfer function of the system shown in Fig. 2

[6]

P.T.O.

b)

Consider the system described by following equation y(k) 0.6y(k 1) 0.81 y(k 2) + 0.67 y(k 3) 0.12y (k 4) = x(k) where x(k) is input and y(k) is output of the system. Determine the stability of the system using Jurys Stability criteria. [10] Explain the properties of Dead Beat Controller. Design the deadbeat controller and find its unit step response. [10]

Q3) a)

b)

Diagonalize the following matrix


1 0 0 G= 0 0 1 6 11 6

[6]

OR Q4) a) Obtain the state transition matrix of the following discrete time system[8]
1 x1 (k + 1) 0 = x (k + 1) 0.24 1 2 x1 (k ) 1 x (k ) 1 + u (k ) and y (k ) = [ 0] 1 x (k ) 1 2 x2 (k )

Derive an expression for the pulse transfer function of discrete time system. b) Determine the stability of the equilibrium state of the following system[8]
1 x1 (k ) x1 (k + 1) 0 = x (k + 1) 0.5 1 x (k ) . Also find the Liapunov function. 2 2

Q5) a) b)

Derive an expression for velocity form of PID controller algorithm. State advantages of velocity form over position form of PID algorithm. [10] Consider the digital control system with G p (s ) =

1 . Design a s(s + 1) deadbeat controller GD(z) such that the closed loop system will exhibit a deadbeat response to a unit step input. [8]
2

[3764]-283

OR Q6) a) b) Derive an expression for the stability of an LTI discrete time system in the sense of Liapunov. [8] What is mean by Hermitian Matrix. Explain the sylveters Criterion for positive / negative definiteness of matrix. [10] SECTION - II Q7) a) b) Derive an expression for Ackermanns formula for pole placement. [8] Consider the system x(k + 1) = Gx(k) + Hu(k) and y(k) = Cx(k) where[8]
2 0 0 0 1 0 2 0 , H = 1 0 and C = 1 0 0 . G= 0 1 0 0 3 1 0 1 Check the system for complete state controllability.

OR Q8) a) Consider the system x(k + 1) = Gx(k) + Hu(k) and y(k) = Cx(k) where[8]

0 0.16 0 G= , H = and C = [0 1] 1 1 1 Design a full order observer, if the desired eigen values of the observer matrix are z = 0.2+ j0.2.
b) Determine the Liapunov function V(x) for the following system x(k + 1) = G.x(k) where [8]

1 1.2 G= 0 0.5
Q9) a) Explain the effect of dead time on the performance of system. Explain the Smith predictor for compensation of dead time. Also state the important features of deadtime compensator. [10] Discuss the design steps for state regulator. OR [6]

b)

[3764]-283

Q10)Explain the internal model control (IMC) strategies. Design IMC for the system with transfer function [16]

2e5 s ~ G p (s ) = . Also convert it into conventional controller with approximate 1 + 20s


Ds dead time as e

Ds 2 . = Ds 1+ 2 1

Q11)State the Quadratic Optimal Control problem. Consider the discrete time control system defined by [18]
x1 (k + 1) 1 1 x1 (k ) x (0 ) 1 = and 1 = x (k + 1) a 1 x (k ) 2 2 x2 (0 ) 0

Where 0.25 < a < 0. Determine the optimum value of a that will minimize the following performance index
1 * J = x (k )Qx(k ). 2 k =0

OR Q12)Write a short notes on following system identification methods (Any three) : [18] a) b) c) d) ARX model. ARMA model. Least Square Estimation. Output error method.

kbkb

[3764]-283

Total No. of Questions : 6]

P1361

[Total No. of Pages :4

COSTING, ESTIMATING AND PROJECT MANAGEMENT OPERATION RESEARCH

[3764] - 301 B.E. (Printing)

(2003 Course) (408282)


Time : 3 Hours] Instructions to the candidates: 1) All questions are compulsory. 2) Figures to the right indicate full marks. 3) Assume suitable data, if necessary. [Max. Marks:100

SECTION - I Q1) a) Prepare a cost sheet from the following data. ABC Pvt. Ltd a stationery manufacturing company. Produces two types of items, as A - for the school and B - for the office. From the following available, prepare cost sheet for the item A and B. Direct Material - A : - 27,300/B :- 97,850/Direct Labour - A : - 15,600/B :- 61,800/Direct Expenses -A : - 62,40/B :- 26,780/Factory overheads are charged at 75% on labour cost. Administrative overheads are charged at 25% on factory cost. Selling and distribution overheads A :- 25/- and B :- 55/- per unit profit :- 10% for both the items. Items sold A :- 78 and B :- 206. [8] Comment on the following : [8] i) Marginal cost. ii) Standard cost OR Prepare a cost sheet from the following data. The standard production of a particular product is 20 units/day and the rate of wages is Rs 60 per unit, if daily production is 20 units/day or more. The rate of wages is Rs. 50 per unit, if the production is less than 20 units/day. Cost of material is Rs. 30 per unit. It is proposed to charge factory over heads according to one of the following method. i) 80% on prime cost. ii) 100% on labour cost. P.T.O.

b)

a)

b)

Calculate the data in the form of suitable statement, finding out factory cost per unit under each of the above method, if daily production is 15 units, 20 units and 25 units. [8] Comment on the following : [8] i) Product cost. ii) Process cost. Explain the term Globalization with respect to printing industry. [8] Differentiate between perfect competitive, Monopoly and Monopolistic market with suitable examples. [8] OR Explain in detail the element of direct cost with suitable examples. [8] Explain in detail the element of indirect cost with suitable example. [8] Explain the project scheduling and economical feasibility with the help of appropriate example. [9] How to ensure the quality of project? Explain with suitable example. [9] OR What is project management? Explain all the facets of project management.[9] Explain the characteristics to become a successful project manager. [9] SECTION - II

Q2) a) b)

a) b) Q3) a) b) a) b)

Q4) Consider a task of obtaining ISO 9000 quality certification for an organisation the activities involved dependence and estimated durations are as given below [16] Activity A B C D E F G H I J Dependence A C A,B D D,E F,G D,E A,B Estimated Duration tm tp to 7 4 1 9 6 3 14 5 2 3 2 1 18 9 6 27 18 9 40 20 10 18 9 6 28 10 4 5 5 5

Find Total float, Free float, Independence float. [3764]-301 2

OR a) b) What is the difference between PERT and CPM? Activity a b c d e f g h i j k l m i) ii) iii) iv) Q5) Preceding Activity none a a c b e,d d f,g f,g J J k Duration 8 10 4 (0.0) 5 6 4 8 7 5 3 5 3 [4] In a printing production process following characteristic were observed.[12]

Draw the network for completion of process. Find the various paths, the critical path and project completion time. Find earliest start, finish, latest start, finish time for each activity. Find total, free and independent float for each activity.

zmax = 10x1 + 20x2 Subjected to, 3x1 + 2x2 < 1200 2x1 + 2x2 < 1500 x1 < 350 x2 < 200 OR zmin = 12x1 + 20x2 Subjected to, 6x1 + 8x2 > 100 7x1 + 12x2 > 120 x1 , x2 > 0

[16]

[16]

[3764]-301

Q6) a)

Solve the transportation problem by VAM method. O1 O2 O3 O4 O5 D1 68 57 91 52 51 16 D2 35 88 60 53 18 18 D3 4 91 75 24 82 20 D4 74 3 45 7 13 14 OR D5 15 8 60 82 7 14 18 17 19 13 15

[10]

b) a)

Derive relation for EOQ for inventory Model?

[8]

Find the job sequence that minimize the total time in sequence A,B,C and find idle time for M/c B and M/c. [8] Job M/c A M/c B M/c C 1 8 5 4 I 11 9 13 21 14 II 17 7 16 24 10 2 10 6 9 3 6 2 8 III 8 12 15 17 12 4 7 3 6 IV 16 6 12 28 11 V 20 15 16 26 13 5 11 4 5 [10]

b)

Solve the assignment problem 1 2 3 4 5

kbkb

[3764]-301

Total No. of Questions : 12]

[Total No. of Pages : 2

P1362

[3764]-323 B.E. (Chemical) CHEMICAL PROCESS SYNTHESIS (2003 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) 7)

Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Your answers will be valued as a whole. Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain two approaches to chemical process design. b) Explain in short over all process design. OR Q2) a) Discuss idealized reactor model. b) Explain in short different parameters in choice of reactor. [8] [8] [8] [8]

Q3) a) Discuss choice of reactor for mixed parallel and series when the parallel reaction has a higher order than the primary reaction. [8] b) Explain the role of reactor concentration on equilibrium conversion with suitable example. [8] OR Q4) a) Explain four possible arrangements for fixed bed reactor. b) Explain fluidized bed catalytic reactor with neat sketch. [8] [8]

Q5) a) State and explain with principle the settling processes used for separation of hetrogineous mixtures. [10] b) Discuss three stage evaporator. OR [8]

P.T.O.

Q6) Write short notes on : a) Practical reactors. b) Thermal dryers. c) Absorption. SECTION - II Q7) a) Discuss thermal coupling of the prefractionator arrangement.

[18]

[8]

b) Explain the concept of internal mass flow in sequence of simple distillation columns. [8] OR Q8) a) Explain direct and indirect sequences of simple distillation columns for a three component separation. [8] b) What is optimization of a reducible structure. [8]

Q9) a) What are threshold problems associated with energy targets for heat exchanger networks. [8] b) Discuss simple furnace method. OR Q10) a) Explain Integration of steam turbine with the process above the pinch.[8] b) Explain heat recovery problem with one hot stream and one cold stream. [8] Q11) Write in brief on : a) Toxic release from processes. b) Fire hazards. OR Q12) Write short notes on : a) Unconfined vapour cloud explosion. b) Safety devices. c) Quantitative measures on inherent safety. [18] [18] [8]

[3764]-323 2

Total No. of Questions : 12]

[Total No. of Pages : 2

P1364

[3764]-328 B.E. (Chemical) POLYMER TECHNOLOGY (2003 Course) (Elective - I) (409341)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2)

Answer three questions from Section I and three questions from Section II. Assume suitable data, if necessary.

SECTION - I Q1) Classify different polymers based on addition and condensation of polymerization process. [16] OR Q2) What are different factors has influenced on polymer properties explain crosslinked, linear branch, thermoplastic, thermoset polymers in detail. [16] Q3) Explain different polymerization technique along with their reactor configuration and selection methodology. Explain in detail Bulk polymerization. [16] OR Q4) Explain interfacial polymerization process along with flowchart and phases etc. [16] Q5) What are different methods are used for determination of molecular wt in polymers explain in detail Gel permeation chromatography method in detail. [18] OR Q6) Write a note on (Any two) : a) Effect of molecular wt on polymer properties. b) Polydispersity index and conversion of polymer. c) Membrane osmometry method for determination of molecular wt. [18]

P.T.O.

SECTION - II Q7) Explain kinetics of free radical polymerization with consideration of following points. [16] a) Intiation. b) Propagation. c) Termination. Draw suitable rate expression for RP rate of polymerization. OR Q8) Explain kinetics of following : a) Copolymerization kinetics. b) Kinetics of coordination polymerization. Q9) Explain the use and different fillers, plasticizers and lubricants, colourants used in compounding. [16] OR Q10) With suitable diagram explain injection moulding process alongwith temperature zones and operation. [16] Q11) With typical manufacturing flowsheet, explain production of Nylon 6, 6 polymer and PP polymer. [18] OR Q12) Write a note on (Any two) : a) Synthesis of Epoxy thermosets. b) Synthesis of elastomers. c) Polystyrene synthesis. [18] [16]

[3764]-328

Total No. of Questions : 12]

[Total No. of Pages : 3

P1365

[3764]- 329 B.E. (Chemical Engineering) CATALYSIS (2003 Course) (409341) (Elective - I)

Time : 3 Hours] Instructions to the candidates: 1) 2)

[Max. Marks : 100

Answers to the different sections must be written in separate answer books. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Explain the mechanism of heterogeneous catalysis with suitable examples. [8] How homogeneous and heterogeneous catalysis is industrially useful?[8] OR Q2) a) b) Q3) a) b) Give a brief account of reaction feasibility with respect to activation energy and temperature in catalysis. [8] Explain the role of supports in heterogeneous catalysis. [8] Derive the relationship between size, number and total surface area of the crystallites. [8] Kinetic experiments on the solid catalyzed reaction A 2R are conducted at 8 atm and 700oC in a basket type mixed reactor of 640 cm3 volume and containing 1 g of catalyst of diameter dp = 3mm. Feed consisting of pure A is introduced at various rates into the reactor. Partial pressure of A in the exit stream is measured for each feed rate. Find a rate equation to represent the rate of reaction on catalyst of this size, using the following results: [10] Feed rate 100 22 4 1 0.6 litre/hr PA,out / PA,in 0.8 0.5 0.2 0.1 0.05 OR
P.T.O.

Q4) a) b)

Derive Langmuir expression for first order adsorption and desorption.[8] The catalytic reaction A 3R is run at 3 atm and 215oC in a PFR which contains 9 g of catalyst and uses a feed consisting of the partially converted product of 0.3 liter/min of pure unreacted A. Assuming the reactor to be a differential reactor, find a rate equation to represent this reaction, using the following results: [10] Run 1 2 3 4 CA,in (mol/liter) 0.100 0.080 0.060 0.040 CA,out(mol/liter) 0.084 0.070 0.055 0.038

Q5) a) b)

Write a brief note on co-catalysts. [6] The following kinetic data on the reaction A R are obtained in an experimental packed bed reactor using various amounts of catalyst and a fixed feed rate FAo = 12 kmol/hr. W (kg catalyst) 1 2 3 4 5 6 7 XA 0.12 0.20 0.27 0.33 0.37 0.41 0.44 i) Find the reaction rate at 40% conversion. ii) In designing a large packed bed reactor with feed rate FAo = 500 kmol/hr, how much catalyst would be needed for 40% conversion? iii) How much catalyst would be needed in part (ii) if the reactor employed a very large recycle of product stream? [10] OR

Q6) a) b)

Write a brief note on triphase catalysis. [6] The second order reaction A R is studied in a recycle reactor with very large recycle ratio. Following data are recorded: Void volume of reactor = 1.2 liter Weight of catalyst used = 4 g Feed to the reactor: CAo = 2.4 mol/liter, Vo= 1.2 liter/hr Exit stream condition: CA,out= 0.6 mol/liter i) Find the rate constant for this reaction. ii) How much catalyst is needed in a packed bed reactor for 80% conversion of 1200 liter/hr of feed of concentration CAo=1.2 mol/ liter? [10]
2

[3764]-329

SECTION - II Q7) a) b) Describe the impregnation method of catalyst preparation. State the role of each step in influencing the properties of catalyst. [8] Derive mathematical equation for determining catalyst surface area by BET method. [8] OR Explain the concept of dual functional catalysis. [8] Derive the mathematical model for kinetics of catalyst deactivation. [8]

Q8) a) b)

Q9) What is the relative activity and the degree of inhibition caused by a competitive inhibitor when [S]=Km and [I] = Ki? Derive the necessary equations. [16] OR Q10)Data for the enzyme catalyzed reaction S P is as follows: [S] (M) 6.25x10-6 7.50x10-5 1.00x10-4 1.00x10-3 1.00x10-2 v (nmoles.lit-1.min-1) 15.00 56.25 60.00 74.90 75.00 a) b) c) d) Estimate Vmax and Km. What would v be at [S] = 2.5x10-5 M and at [S] = 5.0x10-5 M? What would v be at 5.0x10-5 M if the enzyme concentration were doubled? How will you verify that v represents a true initial velocity? [16] [18]

Q11)Write short notes on the following. a) Zeolite modification. b) Alumina as a support. c) Protein. OR Q12)Write short notes on the following: a) Cracking catalyst. b) Industrial application of molecular sieves. c) Selectivity in zeolites.

[18]

EEE
[3764]-329 3

Total No. of Questions : 12]

[Total No. of Pages : 2

P1366

[3764]-330 B.E. (Chemical) ADVANCED SEPARATION PROCESSES (2003 Course) (Elective - I) (409341)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Answer Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from Section I and Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain in detail Pressure swing adsorption. b) Give the details of liquid chromatography. [6] [6]

c) Give the application of chromatography in separation of enzymes and proteins. [6] OR Q2) a) Explain the methods of development of chromatographic separations.[6] b) Explain and differentiate between Temperature swing adsorption and Pressure swing adsorption methods. [8] c) Give the examples of liquid chromatographic separation technique. [4] Q3) a) Explain the following terms : i) Membrane porosity. ii) Pores. iii) Separation factor. iv) Permeability. b) Find the flux equation in dialysis process OR Q4) a) Explain Osmotic Pressure. b) Explain in detail Membrane configurations. [8]

[8] [4] [8]

c) Give the classification of the main types of membrane separation process. [4]
P.T.O.

Q5) a) What is the Reactive Distillation? Explain in detail. b) Explain the term Reactive Crystallization. OR Q6) a) Explain with example Reactive Extraction. SECTION - II

[8] [8] [8]

b) Give the solute characteristics in reversible chemical complexation. [8] Q7) a) Give the classification of flotation technique based on mechanism and size of material. [9] b) Explain Collapse and drainage phenomena. OR Q8) a) Explain the flotation application in waste water treatment. b) Give the adsorption properties of foam. Q9) a) Give the classification of adductive crystallization. b) What is the molecular sieves? Give its applications. OR Q10) a) Explain Clathrates and Adducts. b) What is electrophoresis? c) Explain Zone Refining. Q11) a) Explain in detail Recoil Method. b) Explain Ultra configurations. OR Q12) a) What is the Ring-oven technology? Explain in details. b) Give the classification of separation processes. [8] [8] [6] [4] [6] [8] [8] [9] [9] [8] [8] [9]

[3764]-330

Total No. of Questions :12]

[Total No. of Pages : 2

P1367
[3764]-336 B.E. (Chemical Engineering) FOOD TECHNOLOGY (409348) (Elective - II) (2003 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answers to the different sections must be written in separate answer books. 2) Draw neat sketches wherever necessary. 3) All questions are compulsory.

SECTION - I Q1) a) b) Explain the various post harvesting operations used in food industry.[8] Explain the role of solar energy in food preservation in Indian scenario.[8] OR Q2) a) Explain the vapor absorption cycle of refrigeration used in food industry. [8] Explain the method of heat sterilization of milk. [8]

b)

Q3) Explain the various engineering aspects involved in the processing of milk.[16] OR Q4) Describe the complete process for refining of vegetable oil. Q5) Write short notes on the following : a) b) c) Physico-chemical characteristics of food materials. Equipment for storage of solids. Storage of oils. OR [16] [18]

P.T.O.

Q6) Write short notes on the following : a) b) c) Nutritional characteristics of food materials. Sorting of food materials. Removal of free fatty acids from oil. SECTION - II

[18]

Q7) Describe the various operations and equipment involved in the processing of fruits. [16] OR Q8) a) b) Q9) a) b) Explain the theory of size reduction equipment used in food grain processing. [8] Explain the theory of hot oil frying. Describe the evaporation extrusion. [8] [8]

Give the brief account of the preservatives used in food processing. [8] OR

Q10)a) b)

Explain the theory of food packaging.

[8]

Give the brief account of equipment used in post processing operations. [8] [18] Manufacturing of jams. Hot air dehydration. Types of packaging materials. OR [18]

Q11)Write short notes on following : a) b) c)

Q12)Write short notes on the following : a) b) c) Manufacturing of jellies. Freeze drying. Packaging operations.

####
[3764]-336 2

Total No. of Questions : 12]

[Total No. of Pages : 2

P1368

[3764]-338 B.E. (Chemical) INDUSTRIAL HAZARDS AND SAFETY (2003 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3)

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks.

SECTION - I Q1) a) Discuss the importance of ingredients of successful safety program and draw a neat sketch of the same. [8] b) Explain about role of computers in Industrial safety. OR Q2) Describe in detail about a) FAR. b) Relative toxicity. Q3) a) Discuss the importance of Industrial Hygiene in Chemical Industries.[9] b) Discuss the evaluation of workers exposure to noise. OR Q4) a) Focus on Govt. Regulations related to Industrial safety. b) Determine the TLV for uniform mixture of dust containing Dust Concentration, wt% TLV in ppcf A 70 20 B 30 2.7 Q5) a) Distinguish between fires & Explosion [8] [10] [9] [16] [8]

[8]

b) What are the different types of fire extinguishers? Give their compositions & specific application. [8] OR

P.T.O.

Q6) Write short notes on : a) BLEVE. b) MOC. SECTION - II

[16]

Q7) Explain about the design to prevent fires & explosions and discuss about the explosion proof equipments & instruments. [16] OR Q8) a) Explain the storage & handling of flammable and toxic chemicals. [8] b) Draw a neat sketch of VSP for acquiring runway reactions data and discuss in detail. [8] Q9) Explain the importance of a) HAZOP study. b) Probability theory for Risk assessment. OR Q10) Discuss in detail about a) Process Hazard Checklist. b) Revealed & Unrevealed failure. Q11) Write short notes on a) Safety plan for Emergency shutdown. b) Hazard model & Risk data. OR Q12) Write short notes on : a) Tackling of disasters. b) Safety Audit in Chemical Industries. [18] [18] [16] [16]

[3764]-338

Total No. of Questions : 12]

[Total No. of Pages : 3

P1369

[3764]-340 B.E. (Chemical) FUEL CELL TECHNOLOGY (2003 Course) (409348) (Theory)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) 7)

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures on the right indicate full marks. Use of logarithmic tables, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary. Write the chemical reactions wherever necessary. All questions are compulsory.

SECTION - I Q1) a) Explain the feasibility of application of fuel cell vehicles vis--vis battery operated vehicles in transportation. [8] b) Explain the thermodynamic aspects involved in a fuel cell. OR Q2) a) Explain the salient features of the storage of hydrogen as a fuel for fuel cell. [8] b) Explain schematically the working principle of Phosphoric Acid Fuel Cell (PAFC). [8] Q3) Gibbs free energy for the formation of water vapor is 55.14 cal/mole at STP condition. In the typical SOFC, pure ethane is fed at the pressure of 2 atm. Total pressure of gases on anodic side of the fuel cell is observed to be 2.5 atm. Air is supplied at 1.4 atm. Fuel and air is supplied at the same operating temperature of 850C. Faradays constant is 96486 J/(V.mol). Calculate : [18] a) Standard open circuit potential. b) Open circuit potential at the operating conditions. c) What will be the effect if the operating temperature is increased to 1000C? OR
P.T.O.

[8]

Q4) a) A typical SOFC operating at 900C gives the current density of 12 A/m2 by using methanol as a fuel fed at the pressure of 2.0 atm. Anodic side pressure was observed to be 2.5 atm. Air was supplied at 1.6 atm. The diffusion factors for hydrogen, oxygen and water vapor are 95, 70 and 55 C/s.m2.atm. Calculate concentration overpotentials across anode and cathode. [9] b) The typical data of a SOFC with active anodic surface area of 0.2 m2 is as follows : Average current density = 10 A/m2. Fuel flow rate = 18 mole/h. Fuel composition = hydrogen 75%, carbon monoxide 25% (by volume). Air flow rate = 15 mole/h. Output potential = 230 V. Lower heating value of fuel = 28000 kcal/kg. Calculate fuel utilization factor, air ratio, power output and fuel efficiency of SOFC. [9] Q5) Develop the comprehensive material balance for the SOFC generating 500 kW power at 85% CHP efficiency and 60% electrical efficiency, by using externally reformed methane as a fuel and 50% theoretical excess air as an oxidizer. [16] OR Q6) Derive Nernst equation for calculating open circuit potential of SOFC using air as an oxidizer for the following conditions: [16] (a) Pure methanol as a fuel and (b) Methanol and H2 in the proportion of 30 : 70% each, as a fuel. SECTION - II Q7) a) Explain the scope of improvement in the performance of SOFC. [8] b) Compare the qualitative and quantitative aspects of emission of various pollutants from SOFC and fossil fuel based power plant. [8] OR Q8) a) Explain the required characteristics of materials of construction of electrode, electrolyte and interconnect. [8] b) Derive the Butler Volmer form of the charge transfer rate. [8]

[3764]-340

Q9) a) Design the SOFC power plant to generate 400 kW power using methanol as a fuel. The system consists of tubular cells, each having TPB diameter of 18 mm and active length of 1.6 m. Assume that the cell is structurally supported by cathode. [12] b) Defect energy for the typical material of SOFC is 50 kJ/mole. Calculate mole fraction of defect at 300 and 1100C temperature. Comment on the significance of the result. [6] OR Q10) a) Design the SOFC power plant generating 400 kW power using methane as a fuel. The system consists of planar cells, each having the effective [12] anodic area of 0.18 m2. b) Explain the mechanism of direct oxidation of hydrocarbons in fuel cell.[6] Q11) Explain the design of typical direct ethanol SOFC considering the following aspects : [16] a) catalyst, b) structure, c) reactions and d) exit gas characteristics. OR Q12) Develop a mathematical model for SOFC system using the anodic system of Ni, H2H2O/YSZ. Hydrogen is used as a fuel and air as an oxidizer. Explain the : [16] a) approach, b) assumptions, c) flow chart and d) reactions.

[3764]-340

Total No. of Questions : 12]

[Total No. of Pages : 3

P1370

[3764]- 352 B.E. (Polymer) POLYMER PROCESSING OPERATIONS - I (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer any three questions for each section. 2) Answers to the two sections should be written in separate book. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables, slide rule, mollier charts, electronic pocket calculator and steam table is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) Discuss the concept of barrier screw with suitable sketch. Discuss also merits and demerits of same. [8] b) Explain with neat sketch wire coating process. c) Explain why capstan is used in wire coating. OR Q2) a) Describe the different methods used for pipe size. [6] b) Explain the process of lamination and the effect of process parameter on quality of products. [6] c) Explain different types of winders with merits and demerits used in film production. [6] Q3) a) Draw neat sketch of accumulator type die head assembly for extrusion blow molding? Explain function of each part. [8] b) Explain the following terms with references to extrusion blow molding. i) ii) iii) iv) Parison sag. Pleating. Shark Skin effect. Calibrated neck. OR [8] [2]

[8]

P.T.O.

Q4) a) Explain how will you control degree of crystallization and rule of crystallization in single as well as two stage PET injection stretch blow molding. [8] b) List different techniques of parison programming. Explain any one method with neat sketch. [8] Q5) a) Explain the significances of Biot number in case of thermoferming of thick and thin sheet. [6] b) Discuss the types of molds and mold material and design consideration for thermoferming mold. [6] c) Discuss different types of heating modes of thin sheet and thick sheet.[4] OR Q6) Write short notes on : a) Draw ratio and secondary draw. b) Twin sheet roll fed thermoforming. c) Process control in thermoforming. d) Diaphragm forming. SECTION - II Q7) a) With neat sketch explain the process of gas injection molding. [6] b) Draw cycle time chart of thermoset injection molding clearly showing atleast one method of mold breathing. [6] c) Write short note on sandwich molding. OR Q8) a) Explain the process of reaction injection molding? Give applications of process. [8] b) Explain the different sequences for pattern generation in injection molding. [6] c) Write short note on Structural foam injection molding. [4] [6] [16]

[3764]-352

-2-

Q9) a) Explain flow cure relationship for compression molding process. [4] b) Explain the effect of bulk factor and particle size distribution on compression molding product. [4] c) Draw a cycle time chart for compression molding process. [4] d) Explain the benefit of preheating the thermoset material prior to molding. [4] OR Q10) a) Discuss positive, semi positive and flash type of mold with merits and demerits of same. [9] b) Give mold features of compression molding of dough molding compound (D.M.C). [7] Q11) a) Explain dielectric preheating and infrared preheating in detail and give merits and demerits of same. [8] b) With neat sketch differentiate between Integral pot type and separate pot method of transfer molding. [8] OR Q12) a) Explain advantages of transfer molding over compression molding process. [4] b) With help of bar chart for molding cycle explain the process of transfer molding. [5] c) State any four defects in transfer molding and suggest remedy for it.[4] d) Explain the need for breathing in transfer molding process. [3]

xxxx

[3764]-352

-3-

Total No. of Questions :12]

[Total No. of Pages : 2

P1372
[3764]-396 B.E. PETROCHEMICAL Novel Separation Processes (2003 Course) (Elective)
Time :3 Hours] [Max. Marks : 60

Instructions to the candidates: 1) Answer any Three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn whereever necessary. 4) Black figures to the right indicate full marks. 5) Use of logarithmic tables,SECTION - I charts, electronic pocket calculator slide rule, Mollier and steam tables is allowed. 6) Assume suitable data, Q1) Attempt the following : if necessary. [18]

a) b) c)

Classify membrane separation processes by giving examples. Discuss in brief on : adsorptive bubble separation techniques. Explain in brief the selection criterial for chemical engineering separation processes. OR

Q2) a)

Classify the models for gas separation by membranes. Develop cross flow model for membrane separation processes. State the assumption made. Discuss the solution strategy for different cases. [18] A 9-micron tubular membrane is used to recover salt A From a dilute solution. The solutions to either side dare at 0.028 and 0.004 kmol/m3, with mass transfer coefficients of 3.5 10 -5 and2.25 10 -5 m/s respectively. The distribution coefficient is 0.85 and the diffusivity of A in the membrane is 275 10-11m2/s.

Q3) a)

P.T.O.

(i)

Calculate the percentage of total resistance to mass transfer contributed by the membrane.

(ii) Calculate the membrane are a needed to allow recovery at 0.015 kmol/hr. Flow inside the tube is turbulent and mass transfer follows the Cilloilaln. Sherwood & Linton correlation. If the velocities of both solutions are doubled, what will the membrane resistance now be? [8] b) A liquid containing dilute solute A at a concentration 3x 10-2 kgmol/m3 is flowing rapidly by membrane of thickness, 3 10-5 m. The solute diffuses through the membrane and its concentration on the other side is 0.55 10-2 kgmol/m3. The mass transfer coefficient kel is large and can be considered as infinite and ke2 = 2.22 10-5 m/s. Data : Distribution coefficient = K= 1.55 and Diffusivity. DAB = 8 10-11 m2/sec in the membrane. (i) Derive the equation to calculate the steady state flux. NA and make a sketch.

(ii) Calculate the flux and concentration at the membrane interfaces. [8] OR Q4) a) A membrane is to be used to separate a gaseous mixture of A and B in one of the chemical complex near Mumbai. The following information is known : Feed flow rate = 3 105 cm3 (STP)/s Feed composition of A = 0.55 mole fraction Desired composition of reject = 0.25 mole fraction Thickness of membrane Pressure on feed side Permeability of A. PA Permeability of B. PB = 2.55 10-3 cm = 100 cm Hg = 20 10-10 cm3(STP). cm/(s.cm2.cm. Hg) = 10 10-10 cm3(STP). cm/(s.cm2.cm. Hg)

[3764]-396

Assuming complete mixing model, calculate the following : (i) The permeate composition. [9] (ii) The fraction permeated. (iii) Membrane area. b) c) Q5) a) b) i) II) Explain any two locking protocols with respect to distributed databases. [6] Discuss the different system failures modes in distributed system. Explain in detail the XML document. Write short notes on : SOAP. Client Server architecture. OR Q6) a) b) i) ii) Explain in detail 3Tier architecture. Write short notes on : Domain specific DTD. Querying XML data. SECTION - II Q7) a) b) Q8) a) b) c) Q9) a) b) c) d) Q10)a) b) What is a data cube? Explain any two operations on data cubes. OR What is meant by OLAP? Explain in brief. Discuss the different data smoothing techniques. What is meant by ETL Tools? What are Bayesian classifiers? State and explain K-means algorithm for clustering. [6] [8] [2] [2] [8] [8] [8] [8] [8] [8] [8]

Discuss the different ways of handling missing values in data cleaning.[8]

What is the difference between descriptive and predictive data mining? [2] Explain outlier analysis. Explain the Market Basket analysis in brief. What is a decision tree? How are decision trees used for classification? Why are decision tree classifiers so popular? [8] [10] [4]

c) Explain Text mining in brief. [3764]-396 3 Q11) a) Explain in the detail the measuring of the retrieval effectiveness. b) i) Explain the following terms : Terms frequency.

Total No. of Questions : 12]

P1375

[Total No. of Pages :3

[3764] - 414 B.E. (Computer Engineering)


PRINCIPLES OF COMPILER DESIGN

(2003 Course)
Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Your answers will be valued as a whole. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Compare Compiler and Interpreter. Define following : i) Cross compiler ii) OR Q2) a) b) Q3) a) Explain various Compiler Construction tools. [8] Write a LEX program to calculate number of words in the input C file. Program also should remove comments from the program. [8] Construct LALR parsing table for following grammar. S -> AA A -> aA A -> b Explain operator precedence parser. OR Q4) a) Show that following grammar is LL(1) but not SLR(1). S -> AaAb | BbBa A -> C B -> C Write a YACC program for a simple calculator. [9] [10] Incremental Compiler [4] [4] [8]

Write a LEX program for a subset of C.

b)

[8]

b)

[9] P.T.O.

Q5) a) b)

Explain what is inherited and synthesized attributes. With example explain how these are calculated. [8] Write Quadruple and Triple representation for following expression. [8] A=B+C*D/E+-F*-G OR

Q6) a)

Write intermediate code generated for following sentences. While a < b do If c < d then x = y+z Else x = y-z Explain with example concept of backpatching. SECTION - II

[8]

b)

[8]

Q7) a) b)

What is the need of Activation record? With example explain how these are generated. [8] With example explain different parameter passing methods. OR [8]

Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b)

Enlist and explain in short different ways of accessing non-local names.[8] What are different storage allocation strategies. Explain any one in detail. [8] Explain peephole optimization in detail. Explain the dynamic programming code generation algorithm. OR Explain various transformations that can be done on basic blocks. [8] Write a note on code generator generators. With example explain different types of loops in flow graph. [8] [8] [8] [8]

What is the need of code optimization? Discuss principal sources of code optimization. [10] OR

[3764]-414

Q12)a)

For the following three address code statements i) PROD = 0 ii) I = 1 iii) T2 = ADDR(A) - 4 iv) T4 = ADDR(B) 4 v) T1 = 4 * I vi) T3 = T2[T1] vii) T5 = T4[T1] viii) T6 = T3 * T5 ix) PROD = PROD + T6 x) I = I + 1 xi) IF (I <= 20) GOTO (V) Compute basic blocks and draw the flow graph. Discuss algorithm for live variable analysis.

[10]

b)

[8]

kbkb

[3764]-414

Total No. of Questions :12]

[Total No. of Pages : 3

P1377
[3764]-416 B.E. (Computer Engineering) ADVANCED DATABASES (2003 Course) (410445) (Elective - I)
Time :3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Explain any two partitioning techniques with respect to parallel database system in detail. [8] Explain the following with respect to parallel database system. i) ii) Intraoperation and interoperation parallelism. Fragment - and - Replicate join. OR Q2) a) b) Explain interquery and intraquery parallelism. Explain the following with respect to parallel database system. i) ii) Q3) a) b) c) Range Partitioning sort. Skew. [8] [8] [8]

Describe and compare homogenous and heterogenous databases with respect to distributed databases. [4] Explain deadlock handling with respect to distributed databases. [6]

What is the major disadvantage of the Twophase commit protocol in distributed databases? How it is overcome in Threephase commit protocol? [8] OR P.T.O.

Q4) a) b) c) Q5) a) b)

What are the different approaches to store a relation in the distributed database.Explain them in brief. [4] Explain any two locking protocols with respect to distributed databases. [6] Discuss the different system failures modes in distributed system. Explain in detail the XML document. Write short notes on : i) ii) SOAP. Client Server architecture. OR [8] [8] [8]

Q6) a) b)

Explain in detail 3Tier architecture. Write short notes on : i) ii) Domain specific DTD. Querying XML data. SECTION - II

[8] [8]

Q7) a) b) Q8) a) b) c) Q9) a) b) c) d)

What is a data cube? Explain any two operations on data cubes. OR What is meant by OLAP? Explain in brief. Discuss the different data smoothing techniques. What is meant by ETL Tool? What are Bayesian classifiers? State and explain K-means algorithm for clustering.

[8]

Discuss the different ways of handling missing values in data cleaning.[8] [6] [8] [2] [2] [8]

What is the difference between descriptive and predictive data mining? [2] Explain outlier analysis. OR [4]

Q10)a) b) c)

Explain the Market Basket analysis in brief.

[5]

What is a decision tree? How are decision trees used for classification? Why are decision tree classifiers so popular? [8] Explain Text mining in brief. 2 [3]

[3764]-416

Q11) a) b)

Explain in the detail the measuring of the retrieval effectiveness. Explain the following terms : i) ii) iv) v) Term frequency. Relevance. Conceptbased querying. Stop words OR

[8] [10]

iii) Proximity.

Q12) a) Explain in detail popularity ranking. b) Explain the following terms. i) ii) Web crawlers. Page Rank.

[8] [10]

iii) Full text retrieval. iv) Inverse document frequency. v) Homonyms.

####

[3764]-416

Total No. of Questions : 12]

[Total No. of Pages : 02

P1379

[3764] - 421 B.E. (Computer Engineering)

SOFTWARE TESTING & QUALITY ASSURANCE (2003 Course)


Time : 3 Hours] Instructions to the candidates: 1) Answer any three questions from each section. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. [Max. Marks : 100

5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) How would you begin to measure the quality of software? [8] What is good data and how to collect & define data? [10] OR A commonly used software quality measure in industry is the number of known errors or thousand lines of product source code. Compare the usefulness of this measure for developer and users. What are the possible problems with relying on this measure as the sole expression of software quality? [10] Explain why it is wrong to assert that LOC is bad software measure?[8] What are the aspects of that software size, length & reuse? [8] Draw Biemans data dependency graph model of information flow i) Initialize if x<y then A=B else A=C D=A
P.T.O.

b) Q3) a) b)

ii)

Initialize A=B While X > A do A = f(A,B) end.

[8]

Q4) a) b) Q5) a) b) Q6) a) b)

OR Draw various common flow graphs as per program structure models or as per basic control constructs in imperative language programming.[8] Define & Explain briefly NMC, DIT, NOC, CBO, RFC, LCOM. [8] What is positive and negative testing? Explain with examples. [8] Write any algorithm & draw a control flow graph representation for the same algorithm. [8] OR Write down the defect classes & their origin of defects. [8] Describe forecasting and planning tools with example. [8] SECTION - II

Q7) a) b) Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b) Q12)a) b)


[3764]-421

Write the goal of integration testing & describe top-down testing. [8] What are the approaches to test cost estimation? [8] OR Explain how to form the software test group stepwise. [8] Explain the advice of Beizer in recovery testing. What we do detect in recovery testing? [8] Explain DRE or efficiency of product. [8] What is NSI? Explain costumer satisfaction metrics. [8] OR Explain 5 levels of process maturity in CMMI. [8] Explain ISO & briefly give the narration how we can improve the quality of the product using ISO. [8] Describe the sources of input for requirement of general purpose software products. [8] How one should decide what defects should be fixed in a patch bundle? OR [10] Explain the typical organization structure in product organizations. [8] What is the role of support analyst in problem reporting? Explain with neat diagram. [10]

EEE
2

Total No. of Questions : 12]

P1381

[Total No. of Pages :2

[3764] - 439 B.E. (IT)


DISTRIBUTED SYSTEMS

(2003 Course) (414449)


Time : 3 Hours] Instructions to the candidates: 1) Answer any 3 questions from each section. 2) Neat diagrams must be drawn wherever necessary. 3) Assume suitable data, if necessary. 4) Figures to the right indicate full marks. [Max. Marks:100

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) b) Define Distributed System. Which IPC mechanism is used by nodes to communicate? What are other IPC mechanisms? [8] Explain peer to peer models. [8] OR What is mobile and ubiquitous computing? [8] Explain interaction models. [8] In RPC, how is parameter passing by i) value and ii) reference handled? Give examples. [8] Explain two mechanisms for stream synchronization. [8] OR Explain Jini - Distributed Event Specification. [8] What are sockets? Specify socket primitives. [8] [18]

Q5) Explain NFS and CODA using following points : a) Goal and access model. b) Cache consistency. c) Sharing Semantics. d) Security. OR

Q6) Explain the problem of removing unreferenced entities. Explain the mechanism of referencing counting, its problem and the solutions. [18] P.T.O.

SECTION - II Q7) a) b) Why do we need to have a global clock? Prove with the help of example.[8] Show vector timestamps in the following figure. [10]

OR Q8) a) b) Show the instances where we cannot conclude C(a) < C(b) or C(b) < C(a). Draw appropriate figures, if necessary. [10] What is meant by concurrency control mechanism? Explain Optimistic Concurrency Control mechanism. [8] What is message logging? What is pessimistic and optimistic logging? Which do you think is better? [8] Explain totally ordered multicast with the help of example. Draw diagram, if necessary. [8] OR Explain hierarchical feedback control. [8] Explain causally ordered multicast with the help of example. Draw diagram, if necessary. [8] Write a note on CORBA services (any two) : i) time service. ii) externalization. iii) query service. What are clusters of workstation? Explain their characteristics. OR Explain Grid and Cloud Computing. Explain IIOP and GIOP. [8]

Q9) a) b)

Q10)a) b)

Q11)a)

b) Q12)a) b)

[8] [8] [8]

kbkb
[3764]-439 2

Total No. of Questions : 12]

[Total No. of Pages : 02

P1382

[3764] - 440 B.E (Information Technology) INFORMATION RETRIEVAL (2003 Course)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

[Max. Marks : 100

Answer Question 1 or 2, 3 or 4, and 5 or 6 from section - I and Question 7 or 8, 9 or 10, and 11 or 12 from section - II Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) Explain with the help of block diagram, typical IR system. Describe the needs and concepts of information retrieval. [8] Explain Single link algorithm. [8] OR You are developing a text processing system for use in an automatic retrieval system. Explain the following parts: [8] i) Removal of high frequency words. ii) Suffix stripping. iii) Detecting equivalent stems. What is cluster hypothesis? Explain graph theoretic method with an example. [8] Explain Signature File with example. [8] Explain the Fuzzy Set Model. [8] OR Explain the two ways of serial search retrieval using matching functions.[8] Explain the ring structures. [8]

b) Q3) a) b) Q4) a) b)

P.T.O.

Q5) a) b) Q6) a) b)

Explain different evaluation measures for information retrieval systems. [10] Explain Information Access Process. [8] OR Explain TREC document collection, tasks and Evaluation measures at TREC Conferences. [10] What are the different starting points for search interfaces. [8] SECTION - II

Q7) a)

b) Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b) Q12)a) b)

Discuss the following points with respect to Digital Libraries: [8] i) DL architecture issues. ii) Document models, representation and access. iii) Prototypes, projects and interface standards. Write note on: online retrieval system. [8] OR Describe issues regarding emerging information retrieval approaches and related technologies. [8] List and explain working of various search engines and their challenges. [8] Explain the automatic Feature Extraction. [8] Explain how images can be retrieved using image content as the basis for retrieval. [8] OR Explain the One dimensional time series. [8] Write short note on: MULTOS. [8] Describe query processing in distributed IR systems. Write a note on : Characterizing the Web. Describe the MIMD architecture with respect to parallel IR. Explain Meta Searches with examples. [10] [8] [10] [8]

EEE

[3764]-440

Total No. of Questions : 12]

[Total No. of Pages : 4

P1383

[3764]-441 B.E. (Information Technology) ARTIFICIAL INTELLIGENCE (2003 Course) (Elective - II) (414451)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

Answers to the two sections should be written in separate sheet. Use of logarithmic tables, slide rules and electronic pocket calculator is allowed. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) Define Artificial Intelligence and justify with suitable example how does conventional computing differs from the intelligent computing? [6] b) In what situations Means-Ends-Analysis is used. Also explain the role of difference tables in Means-Ends-Analysis. [6] c) Explain state space approach in solving any AI problem. Discuss this for 8-puzzle (Sliding tiles) problem. [6] OR Q2) a) Explain the following with respect to minimax search procedure. i) Static evaluation function. ii) Maximizing ply, Maximizing player. iii) Manimizing ply, Manimizing player. [6]

b) Specify the global database, rules and termination condition for production system to solve the following water-jug problem. Given a 4 Litre jug filled with water and an empty 3 Litre jug. How can one obtain precisely 2 Litre water in 3 Litre jug. Water may be discharged or poured from one jug to another or fill with water pump. [6]

P.T.O.

c) Apply constraint satisfaction algorithm to solve a cryptoarithmetic problem given below : [6] TOO +TOO +TOO +TOO GOOD Q3) a) With suitable examples, explain the steps needed to convert a WFF in predicate logic to its equivalent clause form. Also Convert the following sentence into WFF in predicate logic and convert it into clause form. Anything any one eats and isnt killed by is food. [8] b) Elucidate components of the scripts. Identify the props, roles, and scenes in the Restaurant script. [8] OR Q4) a) What do you understand by conceptual dependency? Give a conceptual dependency structure for the sentence Sonali drove her car to office.[8] b) Consider a simple inheritance: If X is a dog. Then X is a mammal. If we add (to working memory) the fact Pluto is a dog, also the following fact will be added: Pluto is a mammal. Later on we know that Pluto is a dog is not true. What to do with Pluto is a mammal and other derived facts? What is this situation called as? Explain. [8] Q5) a) Explain understanding as constraint satisfaction. Also label the following figure using Waltz algorithm. [8]

b) Write short note on :i) Perception. ii) Vision. OR


[3764]-441 2

[8]

Q6) a) With suitable examples explain the following terms with respect to pragmatic analysis of NLP :[8] i) Parts of entities. ii) Entities involving in actions. iii) Illocutionary force. iv) Planning sequences. b) Describe in details the difference between language understanding and language generation. Also explain the problem in developing a program which is capable of carrying on a dialog with a group of people. [8] SECTION - II Q7) a) What is planning? Why block world problem is studied as a planning problem. [5] b) Explain how Goal stack planning is different from non linear planning methods. [5] c) What is goal stack planning? What are the operators used to solve block world problem. Specify their respective Precondition (P), Delete (D) & Add (A) lists. [8] OR Q8) a) Consider the following block world problem. Represent the start state and goal state using STRIPS type of operators. Using goal stack planning process, what will be the initial goal stack? What operators will be used to achieve the first goal? Specify its preconditions. [9]

b) Explain the components of a Planning System.

[9]

Q9) a) What is learning? Explain supervised learning, reinforcement learning and unsupervised learning. [8] b) Explain version space method of concept learning described by Mitchell. Also write version space characteristics. [8] OR Q10) a) Explain how perceptron model a neuron by taking a weighted sum of its inputs? Also explain with suitable diagram how several perceptrons can be combined to compute more complex function? [8]
[3764]-441 3

b) Explain the interesting features of Hopfield network. How these features are achieved? [8] Q11) a) What is Expert system? Explain its various components/parts. Discuss the concept of uncertainly in expert system. [8] b) What kinds of knowledge do we have to represent in an Expert System? For which kinds would we use rules, and for which would we use frames? [8] OR Q12) a) Given the following Prolog program, state the solutions for the query ?-flies(X) and ?-bird(X). [4] aeroplane(concorde). aeroplane(jumbo). on(fred, concorde). on(jim, no 18bus). bird(percy). animal(leo). animal(tweety). animal(peter). hasFeathers(tweety). hasFeathers(peter). flies(X) :- bird(X). flies(X) :- aeroplane(X). flies(X) :- on(X, Y), aeroplane(Y). bird(X) :- animal(X), hasFeathers(X). b) Represent the following facts in the language of logic :[6] i) Alison likes cakes or Alison eats cakes. ii) If Alison likes cakes then Alison eats cakes. iii) If Richard is a friend of Alison then Alison likes Richard. iv) Alison eats everything that she likes. v) There exists some bird that doesnt fly. vi) All elephants are grey. c) Using predicates is _city, is_beautiful, and is_beautiful_ city write Prolog rules and facts that state : [6] i) Pune is a city. ii) Pune is beautiful. iii) If something is a city and is beautiful then it is a beautiful city. Illustrate your answer by explaining the execution of a query that asks Is Pune a beautiful city?
[3764]-441

Total No. of Questions : 12]

[Total No. of Pages : 4

P1384

[3764]-442 B.E. (Information Technology) REAL TIME SYSTEM (2003 Course) (Elective - II) (414451)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Answer question 1 or 2, 3 or 4, 5 or 6 from Section I and question 7 or 8, 9 or 10, 11 or 12 from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Assume suitable data, if necessary.

SECTION - I Q1) a) Draw a block diagram of Real-Time System and explain the different component. [8] b) Explain the following properties of good performance measure. i) Efficient encoding. ii) Objective basis for ranking. iii) Objective optimization criteria. iv) Varifiable facts. OR Q2) a) Consider a traffic light control system. A traffic light will be normally green for G second, yellow for Y second and red for R second. During night for certain period of time the intersection will automatically suspend normal service and its will flash yellow. [10] Consider an intersection two-two way street. i) Find accomplishment level. ii) Find hierarchical view performance. b) What are the various factor, that are to be consider while estimating the program run time. [6] Q3) a) State the assumption made for the implementation of the Rate-Monotonic Scheduling algorithm. What is the easy schedulability test for this algorithm. [6] [8]

P.T.O.

b) Consider : Task 1 = (p1, e1) = (2, 0.9) Task 2 = (p2, e2) = (5, 2.3) i) Find total processing utilization. ii) Find necessary and sufficient condition. iii) Draw the cycle for Rate-Monotonic task scheduling. c) Explain the classification of Real-Time Scheduling with example. OR

[8]

[4]

Q4) a) Describe the Focused Addressing and Bidding (FAB) algorithm used for task set containing both critical and non-critical real time tasks. [6] b) Explain the priority inversion problem in handling the critical section. How is it solved? Explain with suitable example. [8] c) Consider : Task 1 = (p1, e1) = (2, 0.9) Task 2 = (p2, e2) = (5, 2.3) Draw the cycle for earliest deadline first algorithm. Q5) a) Mention the desired characteristics of Real Time language. [4]

[6]

b) Describe the Adaptive Earliest Deadline (AED) algorithm used in transaction priorities. State the drawback of AED algorithm. How Adaptive Earliest Virtual Deadline (AEVD) avoid this drawback. [10] OR Q6) a) Explain how the two-phase locking approach used in pessimistic concurrency control is disadvantage to real time system. How can it be modified to overcome the problem? [10] b) How are time stamps assigned to transaction so that serialization consistency is maintained? Explain with suitable example. [6] SECTION - II Q7) a) Explain the Virtual-Time-Carrier-Sensed-Access-Minimum-Laxity Priority algorithm (VTCSAM-L) [4] b) Consider VTCSAM-L. Suppose following table. Node M RC at arrival 1 1 0 2 2 10 3 3 20 4 4 20
[3764]-442 2

the packet arrive according to the [6] TM DM 32 16 36 20 56 40 72 60

Let us assume that for each packet is TM = 15, propagation time = 1 . i) ii) Draw the trajectory for n = 2 Draw the trajectory for n = 4

c) What is Timed-Token protocol? How it is implemented? Draw the flow chart for Synchronous and Asynchronous packet transmission. [8] OR Q8) a) Write a short notes on (Any Two) : [10] i) Wormhole-Routing. ii) Deadline-Based Protocol. iii) Passive Star Network and Wavelength Division Multiplexing (WDM) Network. iv) Stop and Go Multihop protocol. b) What is the Polled Bus Protocol? [4] c) Consider Nodes 1, 2 and 3 have priorities 4, 7, 4 respectively; with higher value indicating higher priority. They are connected to a common bus that implements polled Bus protocol. Assign a poll number to each node and indicate the order in which they access the bus for data transfer. [4] Q9) a) Draw the functionality block diagram of real time operating system. [4] b) Explain the difference between SRTOS and HRTOS. [4] c) Describe the following capability of real time operating system. [8] i) External-internal interrupt handling. ii) Memory management through virtual memory mapping and memory locking. OR Q10) a) Write short notes on the following mechanism present in real time operating system. [10] i) Time Service. ii) Scheduling Mechanism. b) With the help of block diagram explain the capability of RT-Linux. [6] Q11) a) How is hardware redundancy implemented through voting and consensus. Explain the working of formalized majority votor. [8]

[3764]-442

b) Write short notes on (Any Two) : i) Time Redundancy. ii) Information Redundancy. iii) Data Diversity. OR

[8]

Q12) a) Explain reliability model for hardware redundancy. State reliability model require for permanent fault only. [8] b) Define the following term : i) Hardware fault. ii) Error latency. iii) Fault latency. iv) Backward error require. [8]

[3764]-442

Total No. of Questions : 11]

[Total No. of Pages : 3

P1385

[3764] - 452 B.E. (Biotechnology) ENZYME AND FERMENTATION ENGINEERING (2003 Course) (416282) (Sem. - I)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer three questions from Section - I and three questions from Section - II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams should be drawn wherever necessary. 4) Figures to the right indicate full marks.

SECTION - I Q1) a) Derive the Michaelis-Menten equation for kinetics of enzyme acting on one substrate. State the assumptions made and explain the significance of the constants in the equation. [8] Explain the various mechanisms leading to enzyme deactivation. [5] Write a note on factors affecting microbial growth kinetics. [5] OR Q2) a) b) c) Explain the mechanism of substrate activation and inhibition. Also give the expressions representing the respective kinetics. [6] Describe the kinetics of enzyme acting on two substrates. [8] Explain the effect of temperature on enzyme kinetics. Also give the related expressions. [4] What is solid state fermentation? Enlist the characteristics, applications, advantages and disadvantages of solid state fermentation. [8] Describe in detail the continuous mode of operation of a fermenter system. [4] Write a note on the construction, working and applications of an airlift bioreactor. [4] P.T.O.

b) c)

Q3) a) b) c)

OR Q4) a) Write notes on the following topics : [12] i) Fed-batch mode of fermenter operation. ii) Advantages and disadvantages of submerged fermentation. iii) Bubble column. Enlist the characteristics of the batch mode of operating fermenters.[4] How will you control the concentration of dissolved oxygen during fermentation? List the different devices employed for measuring the DO concentration. [5] What are the various factors which affect the power consumption in a mechanically agitated fermenter? Describe each factor in brief. [6] What are the different steps involved in the transfer of oxygen from air bubble to the cells? Which of these steps is the rate controlling step? [5] OR Q6) Write notes on the following : a) Control of pH in fermenter. b) Factors affecting the mass transfer in fermenters. c) Factors causing change in rheology of fermentation broth. d) Effect of increasing gas velocity on fermenter performance. SECTION - II Q7) a) b) c) Write a note on Del factor and its significance in steam sterilization.[6] Describe with neat diagrams the configurations used for continuous steam sterilization. [6] What are the different considerations to be taken into account while scaling up of a fermenter system? [6] OR [3764]-452 2 [16]

b) Q5) a)

b) c)

Q8) a) b)

What is HTST sterilization? What are its advantages? [6] Write notes on the following : [12] i) Inoculum development for a production scale fermenter. ii) Temperature-time profile for batch, direct and indirect continuous sterilization. iii) Operating parameters for scale-up. What is immobilization? What are the advantages offered by immobilization of enzymes? [4] Describe the different methods of immobilization of enzymes. State the advantages and disadvantages. [8] What are the different factors affecting the kinetics when an enzyme is immobilized on the internal surface of a support? Write the steady state equation for diffusion in this case. [4] OR

Q9) a) b) c)

Q10)a) b) c)

Enlist the industrial processes utilizing immobilized enzymes. Explain one in detail. [6] Describe any one physical method of enzyme immobilization. [5] What is the significance of Damkhlers no. in distinguishing the different rate limiting regimes in immobilized enzyme kinetics? [5] [16]

Q11)Write notes on the following (any four) : a) Bioreactors for animal cell cultures. b) Design criteria for bioreactors for plant cell. c) Antibody production using disposable reactors. d) Microfermentation. e) Advantages of semi-synthetic fermentation. f) Disadvantages of disposable bioreactors.

vvvv
[3764]-452 3

Total No. of Questions : 12]

P1387

[Total No. of Pages :3

[3764] - 454 Final Year B.E. (Biotechnology)


NOVEL SEPARATION TECHNIQUES

(2003 Course) (416284)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Figures to the right indicate full marks. 2) Use of Programmable calculator is not allowed. 3) Draw a neat sketch wherever necessary. 4) Make necessary assumptions wherever required. 5) Answer any three questions from Section I and any three questions from Section II.

SECTION - I Q1) a) b) Explain the range and characteristics of Bioproducts? Explain in detail the need of downstream processing? OR Q2) a) b) Q3) a) b) Give a brief overview of Bioseparations? [6] Differentiate between bioprocesses and other conventional separation processes? [10] Explain in detail Gas chromatography with a neat sketch? [8] [6] [10]

Define Ion exchange chromatography? What is the principle behind it? List out the applications of Ion exchange chromatography? [8] OR What are the materials used in HPLC columns for stationary phase and mobile phase? [4] How many types of column chromatography techniques are there? Explain the principle for separation behind column chromatography? [6] Explain Liquid chromatography with a neat sketch? [6]

Q4) a) b) c)

P.T.O.

Q5) a) b) c)

What are the advantages of membrane separation processes over conventional separation processes? [6] Classify different separation techniques along with examples? Explain Pervaporation in detail with a neat sketch? OR [8] [4]

Q6) a)

Give a short notes on : i) Micro filtration. ii) Ultra filtration. iii) Reverse osmosis.

[6]

b) c)

What are the different types of membranes used in Membrane separation processes? [6] Explain Electro dialysis in detail with a neat sketch? SECTION - II [6]

Q7) Explain in detail with a neat sketch Atomic absorption spectroscopy? Give its applications? [16] OR Q8) Define NMR spectroscopy? Explain in detail NMR spectroscopy with a neat sketch? Give its applications? [16] Q9) a) b) Define Adsorption? Give a short notes on Freundlich isotherm? [8]

Explain the nature of adsorbents used in various adsorption operations? [8] OR List out various industrial adsorbent materials along with their applications? [6] Give a brief notes on zeolites? Explain the following terms : i) Adsorption potential. ii) Isosters. iii) Adsorption hysterisis. 2 [4] [6]

Q10)a) b) c)

[3764]-454

Q11)a) b)

What are the advantages of Reactive Distillation over conventional distillation operation? [9] Define Thermal diffusion? Explain thermal diffusion with a neat sketch? [9] OR Give a short notes on Molecular sieves? Give their application? Explain the following : i) ii) iii) Isothermal chromatography. Reactive extraction. Zone refining. [9] [9]

Q12)a) b)

kbkb

[3764]-454

Total No. of Questions : 12]

P1388

[Total No. of Pages :2

[3764] - 455 B.E. (Biotechnology) Final Year


ENVIRONMENTAL BIOTECHNOLOGY

(2003 Course) (Sem. - I) (416281)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer to two sections should be written in separate answer books. 2) Draw diagrams wherever necessary. 3) Maximum marks for each question is given in parentheses.

SECTION - I Q1) Describe activated sludge process for wastewater treatment. Mention the advantages and disadvantages. What factors influence the microbial composition in activated sludge process? [18] OR Q2) Describe the physical, chemical and biological characteristics of wastewater. Why is it important to characterize wastewater? [18] Q3) a) b) Name the types of solids present in wastewater. How would you determine the amount of suspended solids present in wastewater? [8] Explain fixed film biological process for wastewater treatment with an example. [8] OR Q4) a) b) With the help of a neat sketch, discuss the working of a Grit chamber.[8] Differentiate between aeration mechanisms in aerated lagoons and RBC. [8] [16]

Q5) Differentiate ANY TWO : a) Unit operation and Unit process. b) Aerated lagoons and trickling filters. c) Chemical Oxygen Demand and Biological Oxygen Demand. d) Neutralization and Proportioning.

P.T.O.

SECTION - II Q6) Write short note on : a) Composting. b) Bioremediation. c) Phytoremediation. OR Q7) a) b) c) Why are hydrocarbons slow to degrade? What is the role of surfactants in bioremediation of hydrocarbons? How does the addition of fertilizer to oil spills affect the growth of bacteria? [8] [18] [18]

Q8) Explain the disposal of solid waste by composting. OR

Q9) Describe the aerobic and anaerobic degradation of Polychlorinated Hydrocarbons. [8] Q10)What is the significance of Bioventing and Bioaugmentation in Bioremediation? [8] OR Q11)What is the difference between slurry phase and solid phase bioremediation? [8] Q12)Write short notes on ANY TWO : a) b) c) d) Applications of land farming. Advantages and limitations of Bioremediation. Methods for Waste minimization. Sampling techniques in wastewater. [16]

kbkb

[3764]-455

Total No. of Questions : 12]

[Total No. of Pages : 3

P1389

[3764] - 461 B.E. (Biotechnology) PLANT ENGINEERING (Sem. - II) (2003 Course) (419289)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) Figures to the right indicate full marks. Use of Programmable calculator is not allowed. Draw a neat sketch wherever necessary. Make necessary assumptions wherever required.

[Max. Marks : 100

Answer anyThree Questions from Section I and any Three Questions from SectionII

SECTION - I Q1) a) b) Explain the various aspects of chemical engineering plant design. [6] Discuss scale up factors for following equipments. [10] i) Batch reactors. ii) Shell and tube heat exchanges. OR Draw following symbols used in process flow diagram. [10] i) Rotary drum. ii) Vacuum crystallizer. iii) Magnetic separator. iv) Autoclave. v) Plate & Frame filter press. Explain the factors to be considered for scale up of agitated batch crystallizers. [6] Explain optimum operation design for flow system to the absorption column. [8] Discuss various types of project design for any pharmaceutical industry. [8] OR
P.T.O.

Q2) a)

b) Q3) a) b)

Q4) a) b) Q5) a)

Explain various factors to be considered while selecting plant site for any chemical plant. [10] Discuss procedure for preparing plant layout. [6] State the service fluid code for piping as per IS 9446-1980 for following utilities. [10] i) Plant air. ii) Process water. iii) Raw water. iv) Electricity. v) Low pressure condensate. vi) Steam. vii) Demineralised water. viii) Fuel oil flow. ix) Hot water supply. x) Fuel gas. Draw utility line diagram for batch reactor. [8] OR For the process of azeotropic distillation for production of absolute alcohol requires steam as utility. Draw utility block diagram for the process. [10] Draw utility line diagram for tray dryer without process lines. [8] SECTION - II

b) Q6) a) b)

Q7) a) b) Q8) a) b) Q9) a) b)

Explain various types of supports used for piping in chemical plants.[8] Discuss color codes used for transportation of fluids in plants. [8] OR State different types of thermal insulations for heating and cooling used in piping design. [8] Explain water hammer design of gas pipelines. [8] Explain the construction and working of volute pumps. Describe characteristic curves of centrifugal pumps. OR [8] [10]

Q10)a) b)

Explain working of steam jet ejectors. [8] Define NPSH. Why NPSH calculations are necessary for design of pumps? Describe the working of double acting reciprocating pump. [10]
2

[3764]-461

Q11)a) b)

Explain the HAZOP study. How HAZOP study is useful for controlling the process parameters. [8] Explain the safety regulations and safety index to be followed for design of chemical plant. [8] OR

Q12)a) b)

Differentiate between CPM and PERT techniques in detail. [8] It is required to fabricate tanks for electroplating shop. The activities involved are: [8] i) Order material for the tanks. ii) Await delivery of material. iii) Collect tooling equipment for tank fabrication. iv) Fabricate the tanks. v) Test the tanks against leakage. vi) Obtain rubber lining from market. vii) Fix lining inside the tank. viii) Paint the tank from outside. Using these activities, construct arrow diagram and explain CPM planning schedule and control technique.

EEE

[3764]-461

Total No. of Questions : 12]

P1391

[Total No. of Pages :4

[3764] - 134 B.E. (Mechanical)


GAS TURBINE AND JET PROPULSION

(2003 Course)
Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables slide rule. Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Unit - I Q1) a) A convergent-divergent nozzle has a throat area 500 mm2 and an exit area of 1000 mm2. Air enters the nozzle with a stagnation temperature of 360 K and stagnation pressure of 1 MPa. Determine the maximum flow rate, a static pressure, static temperature, Mach number and velocity at exit if (i) the divergent section acts as nozzle (ii) the divergent section acts as a diffuser. [10] Show that for an isentropic flow, the mass flow rate per unit area is maximum when Mach number is unity (Start with basic continuity equation). [6] OR Q2) a) b) c) Explain with the help of governing equation and T-S diagram, why shock waves causes supersonic flow to jump to subsonic flow. [5] Draw the Fanno curve on H-S diagram and discuss the effect of friction in case of subsonic and supersonic flow. [5] What do you mean by Rayleigh flow? What are the assumptions made in Rayleigh flow? Explain choking in Rayleigh flow. [6]
P.T.O.

b)

Unit - II Q3) a) A centrifugal blower compresses 4.8 m3/sec of air from 1 bar and 20C to 1.5 bar. The index of compression is 1.5. The flow velocity at inlet and outlet of the machine is the same and equals to 65 m/s. The inlet and outlet impeller diameters are 0.32 m and 0.62 m. The blower rotates at 8000 rpm. Calculate : (i) blade angles at outlet and inlet of the impeller. (ii) Absolute angle at the tip of the impeller (iii) breadth of the blade at inlet and outlet. Assume that no diffuser is employed and whole pressure increase takes place in the impeller and blades have negligible thickness. [10] Explain the various losses in a centrifugal compressor with the help of Head-discharge diagram. [6] OR Q4) a) An axial flow compressor is designed for 50% reaction with inlet and outlet air angles for rotor blades as 80 and 45 respectively measured from axial direction. The mean blade speed is 200m/s and the axial velocity of flow is constant throughout. Assuming a work factor of 0.88, find the number of stages required if the total pressure ratio is 4:1 with an isentropic efficiency of 85%. The stagnation inlet temperature may be taken as 200K. Assume = 1.4, R = 287Nm/kg-K Cp =1.005KJ/kg-K. [11] Compare axial flow compressor and centrifugal compressor on following points : (i) Pressure ratio per stage (ii) isothermal efficiency (iii) frontal area (iv) part load performance (v) delivery pressure possible. [5] Unit - III Q5) a) A 4500 Kw gas turbine generating set operates with two compressor stages; the overall pressure ratio is 9:1. A high pressure turbine is used to drive the compressor and a low pressure turbine drives the generator. The temperature of the gases at entry to the high-pressure turbine is 625C and the gases are reheated to 625C after expansion in the first turbine. The exhaust gases leaving the low-pressure turbine are passed through a heat exchanger to heat air leaving the high-pressure stage compressor. The compressors have equal pressure ratio and intercooling is complete between the stages. The air inlet temperature to the unit is 20C. The isentropic efficiency of each compressor is 0.8 and isentropic efficiency of each turbine stage is 0.85 and the heat exchanger thermal ration is 0.8. A mechanical efficiency of 95% can be assumed for both the power shaft and compressor turbine shaft. Calculate :- (i) thermal efficiency (ii) work ratio pf the plant (iii) mass flow rate in kg/sec neglecting the mass of fuel. 2

b)

b)

[3764]-134

b)

Q6) a)

Assume =1.4, R = 287Nm/kg-k Cp =1.005KJ/Kg-K for air. For gases = 1.333, Cp = 1.15KJ/kg-K. [12] Explain the effect on work output and efficiency if pressure ratio is varied between fixed temperature limits of the cycle with the help of T-S diagram. [6] OR Air is taken in a gas turbine plant at 1.1 bar and 20C. The plant comprises of LP and HP compressors and turbines. The compression in LP stage is up to 3.3 bar followed by intercooling to 27C. The pressure of air after HP compressor is 9.45 bar. Loss in pressure during intercooling is 0.15 bar. Air from HP compressor is transferred to heat exchanger of effectiveness 0.65 where it is heated by the gases from LP turbine. After heat exchanger, the air passes through combustion chamber. The temperature of gases supplied to HP turbine is 700C. The gases expand in HP turbine to 3.62 bar and air then reheated to 670C before expanding in LP turbine. The loss of pressure in reheater is 0.12 bar. Determine (i) overall efficiency (ii) work ratio (iii) mass flow rate when the power generated is 6000KW. Assume isentropic efficiency of compression in both stages = 0.82, isentropic efficiency of expansion in turbines = 0.85 Assume =1.4, Cp =1.005KJ/Kg-K for air. For gases = 1.33, Cp = 1.15KJ/kg-K. [13] State merits and demerits of closed cycle gas turbine over open cycle gas turbine. [5] SECTION - II Unit - IV

b)

Q7) a) b)

With a neat sketch explain velocity compounding of a multistage impulse turbine. [6] The mean diameter of the blades of an impulse turbine with a single row wheel is 105 cm and the speed is 3000 rpm. The nozzle angle is 72 with respect to axial direction, the ratio of blade speed to gas speed at inlet is 0.42 and the ratio of relative velocity at outlet from the blades to that at inlet is 0.84. The outlet angle of the blade is to be made 3 less than the inlet angle. The mass flow rate is 8 kg/s. Calculate the following i) Tangential thrust on blades. ii) axial thrust on blades. iii) power produced. iv) blade efficiency. [10] OR 3

[3764]-134

Q8) a) b)

For a fifty percent reaction turbine, prove that maximum work is Vb2, where Vb is the mean blade speed. [8] In a stage of reaction turbine, the mean diameter of the rotor is 1.4 m and the velocity ratio is 0.7. Turbine rolates at 5000 rpm. Blade outlet angle is 70 to the axial direction. Find the diagram efficiency and also find the value of maximum diagram efficiency. [8] Describe briefly the factors affecting the combustion chamber design of gas turbines. [8] Write a note on combustion chamber geometry. OR [8]

Q9) a) b) Q10)a) b) Q11)a)

Why gas turbine blades need cooling? Explain different methods used for blade cooling. [8] Discuss the various fuels that can be used for gas turbines. [8]

With the aid of a neat diagram explain the working principle of a ramjet engine. Also draw the thermodynamic cycle of the ramjet engine. What are its advantages and disadvantages. [8] A turbojet plant uses aviation kerosene having a calorific value of 43 MJ/ kg. The fuel consumption is 0.18 kg per hour per N of thrust, when the thrust is 9kN. The aircraft velocity is 500 m/s and the mass of air passing through the compressor is 27 kg/s. Calculate the air fuel ratio, thrust power, heat input and overall efficiency. [6] What is meant by thrust angmentation and explain how it is effected.[4] OR With the aid of the schematic diagram and thermodynamic cycle, explain the working of a turboprop engine. [6] The effective jet exit velocity from a jet engine is 2700 m/s. The forward flight velocity is 1350 m/s. The air flow rate is 78.6 kg/s. Calculate. i) Thrust ii) Thrust power iii) propulsive efficiency. [6] What is meant by thrust? Derive the thrust equation for a general propulsions system. [6]

b)

c) Q12)a) b)

c)

kbkb
[3764]-134 4

Total No. of Questions : 12]

[Total No. of Pages : 3

P1392
[3764] - 111 B.E. (Civil) GEOINFORMATICS (2003 Pattern) (Elective - I) (401005)
Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. [Max. Marks : 100

SECTION - I Q1) a) Describe briefly the following Radiometric Quantities; [12] i) Radiant Energy. ii) Radiant Flux. iii) Irradinace. iv) Radiant Intensity. Explain Scattering, Absorption and Refraction with reference to interaction of EMR with the Earths surface. [6] OR Q2) a) b) What are the elements of Interpretation of Aerial Photographs & Satellite Imageries? Explain their significance and factors influencing them. [12] Describe briefly the following types of Resolution with necessary sketches : [6] i) Spatial Resolution. ii) Spectral Resolution. iii) Radiometric Resolution. P.T.O.

b)

Q3) a) b)

Enumerate the different types of Vegetation Indices? Explain any two in detail. [12] What are the different types of Filters? Explain any one in detail. [4] OR

Q4) a) b) Q5) a)

What are the different Digital Image Processing Techniques? Explain any two methods in detail. [12] Explain Principal Component Analysis. [4]

Explain with neat sketches the working of GPS, in association with [12] i) ii) GPS space segments. GPS control segments &

iii) User segments. b) What are the applications of GPS? OR Q6) a) b) What are the different types of errors in GPS observations and explain how to minimize it ? [12] Differentiate single point GPS and Differential GPS. [4] SECTION - II Q7) a) b) What is GIS? What are the objectives of GIS and explain in detail the components of GIS. [12] State the differences between : i) ii) Spatial and Non-Spatial Data. Vector and Raster Model. OR [6] [4]

[3764]-111

Q8) a) b)

Describe briefly with necessary sketches the different spatial Analysis that can be performed with help of GIS. [12] What are the different types of Map Projections system and describe any two systems in detail. [6] Explain with neat sketches the object oriented GIS model. State the difference between Primary Key and Foreign Key. OR [12] [4]

Q9) a) b)

Q10)a) b)

Elaborate the concept of Relational Database, the Hybrid and Integrated GIS Data Model. [12] What are the components of DBMS? [4]

Q11)Explain application of GeoInformatics with working flow charts in following areas : [16] a) Land use/Land cover classification mapping and analysis. b) Crime Mapping and Analysis using Geoinformatics. OR Q12)Explain application of GeoInformatics with working flow charts in following areas : [16] a) Disaster Planning and Management using Geoinformatics. b) Rainwater Harvesting using Geoinformatics.

vvvv

[3764]-111

Total No. of Questions : 10]

P1401

[Total No. of Pages :2

[3764] - 460 B.E. (Biotechnology)


BIOINFORMATICS AND REGULATIONS

(2003 Course) (Sem. - II) (416288)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer three questions from Section I and three questions from Section II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams should be drawn whenever necessary. 4) Figures to the right indicate full marks.

SECTION - I Q1) Define databases. Classify protein databases. Write in detail about Secondary Protein databases. [18] OR Q2) Enlist Heuristic methods of sequence alignment. What is FASTA? Explain in detail about principal and working of FASTA. [18] Q3) Align the following two sequences using Needleman wunsch algorithm, and write the optimal alignment. [16] [Match +1, Mismatch - 1, Gap - 1] Seq. 1 GTAG Seq. 2 GAG OR Q4) Define Bioinformatics. Write in detail about scope, goal and applications of bioinformatics. [16] Q5) Write short notes [Any two] : a) Primary nucleotide databases. b) BLAST. c) SCOP & CATH. d) SGD & UNIGENE. [16]

P.T.O.

SECTION - II Q6) What is Phylogenetic Analysis? Enlist the methods used for phylogenetic analysis. Draw phylogenetic tree using Distance method for the following sequence. [18] Sequence 1 ACGCGTTGGGCGATGGCAAC Sequence 2 ACGCGTTGGGCGACGGTAAT Sequence 3 ACGCATTGAA TGATGATAAT Sequence 4 ACACATTGAG TGATAATAAT OR Q7) Explain in detail quality control and quality assurance requirements for the biotechnology products. [18] Q8) a) Align the following sequences using Dot Plot. Write the optimal alignment. [12] Seq. 1 LPAMGNDEQMILVFW Seq. 2 LPAMGILVFW Write in detail Profile of companies engaged in Bioinformatics tools package development. [4] OR Q9) a) b) What is Epitope analysis? Explain use of epitope prediction methods in designing synthetic vaccines. [10] What is clinical research and clinical data management? [6] [16]

b)

Q10)Write short notes .[Any two] a) b) c) d) Patents. Trademarks. Tradesecrets. Clinical trials.

kbkb

[3764]-460

Total No. of Questions : 12]

[Total No. of Pages : 2

P1402

[3764] - 462 B.E. (Biotechnology) FOOD BIOTECHNOLOGY (Elective - II) (Sem. - II) (2003 Course) (416286)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer three questions from Section I and three questions from Section II. 2) Answers to the two sections should be written in separate answer booklets. 3) Maximum marks for each questions given in brackets.

SECTION - I Q1) Explain the role of various physical, chemical and biological agents in food spoilage. [16] OR Q2) With suitable examples describe the role of fermentation in food technology. [16] Q3) a) b) c) In canning, what should be done to ascertain that there is a tight seal after processing? What category of microorganisms is most affected by a tight seal? Identify the preservation method that keeps fruits and vegetables the closest to fresh ones in color, flavor, and texture. Why it is the best method? What substances are used to prevent fruit from darkening when preserving them by drying? What does the substance inhibit and how does it work? [18] OR Describe the preparation methods for each of the following before freezing them: i) Fruits. ii) Vegetables. iii) Meat.
P.T.O.

Q4) a)

What type of food can be preserved by drying? Indicate the methods used to dry food. Explain how water affects spoilage in foods. c) Describe the three heat treatments employed in food preservation. [18] Q5) Explain the role of lipids in the production of various classes of flavor compounds? Describe the various pathways and major enzymes involved.[16] OR Q6) Describe the applications of Xanthan Gum in baking and confectionary products? Explain the properties of Xanthan Gum for use in baking? Also, briefly describe the fermentative production of Xanthan Gum. [16] SECTION - II Q7) Compare the process conditions for the production of cheese, butter, yogurt and ghee. [16] OR Q8) Write short notes on ANY TWO a) Functional foods. b) Single cell protein. c) Solid state fermentation. d) Pickling. Q9) What is the role of enzymes in food preservation and processing? OR Q10)What is meant by clarification in the production of fruit juices? Describe the role of enzymes. [16] Q11)Describe the characteristics of dairy waste? What are the most common treatment methods for solid wastes? [18] OR Q12)Describe the biological treatment strategies employed for the treatment of effluent from sugar industry? [18]
[3764]-462

b)

[16]

[16]

EEE
2

Total No. of Questions : 12]

[Total No. of Pages : 3

P1437

[3764]- 209 B.E (Electrical) Restructuring and Deregulation (2003 Course) (Elective - I)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) Answer any 3 questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks.

[Max. Marks : 100

SECTION - I Q1) a) b) Q2) a) State and explain the functions of regulatory commission at Central and State level. [8] Explain the functions of Central Electricity Authority (CEA). [8] OR Explain functions of following entities. i) Planning Commission. ii) Ministry of power. iii) Financing institutes. [8] Explain main features of Electricity Act. 2003. [8] State the desirable characteristics of tariff. Also give factors governing the tariff structure. [8] Explain following terms: i) Capital cost. ii) Dept & equity. iii) Variable cost. iv) Working capital v) Depreciation. [8]
P.T.O.

b) Q3) a) b)

Q4) a) b)

OR Explain different performance indices for generation, transmission and distribution. [8] Explain along with example, merits and demerits any two methods to compare the investment options. [8] [18]

Q5) Write short note on: a) Rate of return regulation. b) Performance based regulation. c) Incentive regulation. d) Yardstick regulation. OR Q6) a) b)

Explain non-price issues in regulation such as environment, service quality, consumer service. [9] Give in detail the composition of regulatory commissions in India. Explain how public participation is important for decision making of regulatory processess. [9] SECTION - II

Q7) a) b) Q8) a) b)

Explain wholesale competition model and retail competition model. [8] Explain California energy crisis after electricity reforms. [8] OR Explain the restructuring of power industry in U.K. and Latin America.[8] Explain following models in detail. i) Pool model. ii) Bilateral trade. [8] Explain regulatory frame work and working of Indian Energy Exchange in India. [8] State and explain various methods of transmission pricing. [8] OR Compare integrated model and wheeling trading model. [8] Specify pecularities of electricity as a commodity compare to other commodities. [8]
2

Q9) a) b) Q10 a) b)

[3764]-209

Q11)a) b)

Q12)a) b)

Explain Availability Based Tariff (ABT). Explain the role of ABT in maintaining the grid discipline. [9] Explain the importance of transmission pricing under open access. Explain the components which are important in transmission costs. [9] OR Explain the congestion issues & management. [9] Explain the working of ISO (Independant System Operator). [9]

EEE

[3764]-209

Total No. of Questions : 12]

[Total No. of Pages : 2

P1440

[3764]- 285 B.E (Instru. & Control)

INSTRUMENTATION FOR ENVIRONMENTAL ENGINEERING (Elective - I) (1997/2003 Pattern) (406264 (2))


Time : 3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answers any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, it necessary.

SECTION - I Q1) a) b) Explain modern methods of qualitative analysis of pollution. Discuss on various sensors used for measurement of pollutions. OR [8] [8]

Q2) a) b) Q3) a) b)

Enlist chromatographic methods of analysis. Explain partition chromatographic analysis. [8] Explain importance of pollution control. [8] Discuss on Bump testing & Drop/Topple testing. [10] What is Threshold Limiting Value (TLV). Explain biological sampling & their measurements. [8] OR Explain analysis of toxic agents. Write note on ISO 14001 standard. [8] [10]

Q4) a) b) Q5) a) b)

Explain Instrumentation setup for air pollution analysis. [8] What is collection efficiency? Explain mechanisms of particulate control equipments. [8]
P.T.O.

OR Q6) a) b) Discuss on HVAC controls. Explain NO-NOX analysis by spectrophotometric determination. SECTION - II Q7) a) Explain following terms: i) BOD. ii) TOC. iii) COD. iv) TO. v) MPN. Describe sequence of operations for sludge treatment. [10]
[8] [8]

b)

[8]

OR Q8) Enlist Primary, Secondary (Biological), Tertiary treatments of domestic effluents. Explain any one method of each treatment in detail. [18] Q9) a) b) How radioactive pollution is measured & controlled. [8] Suggest suitable method to control radioactive pollution on nonliving organisms. [8] OR

Q10) a) What is noise mapping? Suggest control setup for automobile noise.[8] b) List & explain working of sensors used in noise control systems. [8] Q11) a) Suggest Instrumentation setup for soil pollution reduction. b) Explain Environmental Impact assessment. OR Q12) Write short note on (any two): a) Polarographic analysis of pesticides. b) Analysis of micronutrients. c) Chromatographic characterization. [16] [8] [8]

EEE
[3764]-285 2

Total No. of Questions : 12]

[Total No. of Pages : 3

P1441

[3764]-321 B.E. (Chemical) PROCESS DYNAMICS & CONTROL (2003 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

Answers to the two sections should be written on separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain the basic needs that should be satisfied by a control system.[8] b) i) ii) Develope the feedback control system for controlling the temperature of liquid inside the stirred tank, which is heated by steam passing through a steam coil immersed in the liquid. Also develope feedforward control scheme for the said purpose based on temperature of liquid entering the tank. [10] OR

Q2) a) With reference to CSTR example, explain the basic elements of feedback control used to control the temperature inside the reactor by manipulating the flow rate of jacket fluid. [10] b) State applications of Laplace transform, Z-transform, state-space methods, frequency response methods of analysis for process control systems. [8] Q3) a) Derive the transfer function model of a LTI system modeled by nth order linear differential equation. Define poles and zeros of the system. How will you predict the dynamic behaviour of the process based on the nature of poles and zeros qualitatively. [8] b) A liquid tank has a uniform cross-section area of 0.2 m2 and linear output resistance of 0.1 m2/min. Water enters the tank at a steady rate of 30 lit/ min. Find

P.T.O.

i) ii) iii)

iv)

Transfer function for the tank system. Initial steady-state level of water inside the tank. The response equation for height of water inside the tank, if inlet flow rate of water is suddenly changed to a new steady value of 40 lit/min. Find the time required to accomplish 90% change in level. [8] OR

Q4) a) Starting from first-order ODE model, derive the transfer function of pure capacitive process. Also derive its step response and sketch it graphically. Give physical examples of such systems. [8] b) Distinguish between interacting and non-interacting liquid tank systems. State their transfer functions and sketch step response for unit step change in input flow rate for the first tank. [8] Q5) a) Draw block diagram of feedback control system. Explain function of each block in the system. Explain servo and regulator operations. [8] b) Explain performance measures of feedback control system. OR Q6) a) Derive servo and regulator transfer functions for a feedback control system. Find poles and zeros of these transfer functions. [8] b) Find the range of Kc for a feedback. Control system having characteristic equation. S4 + 4S3 + 6S2 +4S + (1 + K) = 0 Also find the value of K for which output undergoes sustained oscillations. Also find the corresponding frequency of oscillations and pair of imaginary roots of the equation. [8] SECTION - II Q7) a) Sketch root locus plot for the system having characteristic equation : S3 + 4S2 + 5S + K = 0 Show poles and zeros, break away points, asymptotes and imaginary roots clearly on the sketch. [8] b) What is frequency response of the system? Derive the expressions for AR and for a first-order system. Draw true and asymptotic Bode plot for this system. Find maximum error between peak amplituder on true and asymptotic plot. [8] OR
[3764]-321 2

[8]

Q8) a) Derive frequency response of second-order system. Derive the expressions for AR & . Draw asymptotic Bode plot for the systems [8] having <1, = 1 & >1. b) Explain Ziegler-Nichols method of tuning a PID-controller. [8]

Q9) a) Draw block diagram of cascade control system. Explain cascade control system for controlling temperature of exit fluid stream heated using hot liquid in counter current heat exchanger. The flow rate of hot stream is the manipulated variable which is also considered as the secondary controlled variable. [8] b) Distinguish between feedback control and feedforward control strategies. Explain feedforward control strategy for maintaining liquid level in boiler drum constant by controlling flow rate of feed water and steam achieved by manipulating flow rate of feed water. [8] OR Q10) a) Explain two different methods for controlling ratio of flow rates of wild stream A & uncontrolled stream B. [8] b) Explain override control used to protect boiler system against failure due to low water level inside the drum and high pressure of the steam produced. [8] Q11) Write short notes on the following : a) Process control symbols used in P & ID. b) Batch reactor control. c) pH control. OR Q12) a) Define control system design problem. Explain the decisions to be taken during control system design. List the contents of CDF. [10] b) Explain control strategy for controlling temperature inside jacketed CSTR for i) Endothermic reaction, and ii) Exothermic reaction. The flow rate of jacket fluid is manipulated to achieve the control. [8] [18]

[3764]-321 3

Total No. of Questions : 6]

[Total No. of Pages : 2

P1442

[3764]-372 B.E. (Petroleum Engineering) PETROLEUM EXPLORATION (2003 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Answers to the two sections should be written in separate answer books. Neat diagrams should be drawn wherever necessary. Attempt any three questions from Section - I and Section - II. Figures to the right indicate full marks.

SECTION - I Q1) a) Describe the principle, construction and working of Lacoste Romberg Gravimeter with the help of a neat figure. [8] b) How are magnetic anomaly maps prepared taking into consideration shapes and sizes of different subsurface bodies. [8] OR Write notes on any two of the following : a) Earths Magnetism. b) Proton precession magnetometer. c) Free Air and Bouger Correction. d) Drift correction in gravity survey. Q2) a) What is vertical electrical sounding? Explain the Schlumberger method of vertical electrical sounding. What are the limitations? [12] b) What are the applications of electrical resistivity survey? OR a) What is the principle of radioactive survey? Explain with suitable diagram the working principle of Geiger Muller Counter used in radioactivity survey. [8] b) How are different isotopes used in geochemical survey for petroleum?[8] [4] [16]

P.T.O.

Q3) a) What are the different modes of transport of microseepages of petroleum from reservoir to surface. [10] b) Why geochemical correlation of crude oil is necessary? What are the different geochemical correlation methods? [8] OR a) Describe in brief the field procedure adopted for petroleum geochemical survey. [12] b) What are the possible weathering processes of petroleum seepages? [6] SECTION - II Q4) a) Give important characteristics of seismic waveforms: velocity, amplitude, resolution and display. [8] b) What is CDP method of shooting? OR a) What is a synthetic seismogram? How is it prepared? [8] b) Explain the navigation systems used for marine survey seismic survey.[8] Q5) Write short notes on any two of the following : a) Direct detection methods of seismic survey. b) 4-D Seismic survey. c) Seismic stratigraphy. d) AVO technique. Q6) Discuss in details volumetric and material balance methods of reserves estimation giving advantages of each. [18] OR a) How do explorationists ascertain Geological Risk in petroleum exploration ventures? [9] b) List and explain unconventional hydrocarbon resources. How is their profitability assessed? [9] [16] [8]

[3764]-372

Total No. of Questions : 8]

[Total No. of Pages : 2

P1443
[3764] - 374 B.E. (Petroleum Engg.) NATURAL GAS ENGINEERING (2003 Course)
Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answers to the two sections should be written in separate answer books. Question no. 3 and 6 are compulsory. Figures to the right indicate full marks. Neat diagrams should be drawn wherever necessary. Use of a non-programmable calculator is allowed. Assume suitable data, if necessary and clearly state it. [Max. Marks : 100

SECTION - I Q1) Define Bg, cg, g, z, critical and pseudocritical properties and their behavior with pressure and draw the phase diagram for a gas reservoir. [16] Q2) What is an inflow performance curve for a gas reservoir? What is AOFP? What is an outflow performance curve? What is a tubing intake curve? Plot all on the same graph? What is the usefulness of this graph? Explain in detail with equations. [16] Q3) Explain the different methods to find flowing and static BHP of a gas well. [18] Q4) Explain all the constants in the gas flow meter equation. [16]

P.T.O.

SECTION - II Q5) a) b) What is the criteria for choosing a CO2 removal process? Draw a process flow diagram showing the removal of carbon dioxide. [16]

Q6) Derive an expression to find the increase in flow rate for a series and parallel pipeline. [18] Q7) a) b) Draw a diagram of a centrifugal compressor and name its parts. [10] Write a note on compressor selection. [6] [16]

Q8) Write short notes on : a) b) c) d) Liquid unloading. Mollier charts in compressor design. Gas well testing. Pseudo gas pressure.

vvvv

[3764]-374

Total No. of Questions : 8]

[Total No. of Pages : 7

P1444

[3764]-381 B.E. (Petroleum Engineering) PETROLEUM ECONOMICS (2003 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Solve any two questions each for Section I and Section II. Answers to the questions of both the sections should be written in separate answer books. Use graph paper and semi log paper wherever necessary. Assume suitable data, if necessary.

SECTION - I Q1) a) Following are the details of oil production from a well. Plot the information on suitable graph and extrapolate time required to decline to economic limit of 20 BOPD. Month Bbl/month Month Bbl/month Month Bbl/month 1 5400 16 1790 31 1030 2 5000 17 1700 32 1000 3 4800 18 1620 33 980 4 4100 19 1550 34 960 5 3900 20 1500 35 940 6 3600 21 1410 36 910 7 3300 22 1370 37 900 8 3100 23 1300 38 890 9 2900 24 1280 39 870 10 2650 25 1230 40 850 11 2400 26 1200 41 840 12 2350 27 1160 42 815 13 2160 28 1120 43 800 14 2050 29 1100 44 790 15 1910 30 1060 45 780 Assuming recovered reserves are 21% of OOIP, calculate OOIP. How much is still producible taking into consideration economic limit. [15]
P.T.O.

b) Explain Exponential Decline and Hyperbolic Decline models with suitable diagrams. [10] OR Q2) a) Figure given below shows that the well has produced at a constant rate of 200 BOPD for 4 years. The production then declined exponentially over the next 16 years to an economic limit of 5 BOPD. The company demands a minimum ROR of 10% and oil from this field is $ 3.15/bbl net after local taxes, royalty and operating expenses. Calculate a composite NPV of a barrel of oil using annual compounding. [15]

b) Explain with the help of hypothetical cash flow diagram, various concepts used in the mathematical methods of profitability evaluation. [10] Q3) a) Following is the cash flow generated over the tenure of a project against an initial investment of $ 4,50,000. Year Cash flow generated 1 2,50,000 2 1,50,000 3 1,20,000 4 80,000 5 50,000 6 20,000 Calculate NPV @ 10% and also DCFROR using graph and show calculations. [10] b) Write notes on any three of the following : i) Incremental Investment Analysis. ii) Investment Yardsticks. iii) Sensitivity Analysis. iv) Reserves auditing. v) Oil price elasticity. OR
[3764]-381 2

[15]

Q4) a) Project under consideration requires an investment of $ 1,20,000, which will result in the cash flow generation for next five years as $ 40,000, $ 50,000, $ 30,000, $ 30,000 and $ 20,000 respectively. Calculate the NPV at 10% and also calculate the DCFROR for the project. [10] b) Prepare a forecast of future oil prices using following equation for the next five years with the first year price determined on the basis of the market price of designated marker crude and escalated at the rate of 2% per year. [10] Oil Price = (marker crude oil price @ 0 API) + 0.19(API) - 0.77(% sulphur) Given, i) Current Market Price of Marker Crude (40 API) = $ 64.00 ii) Current Market Price of Marker Crude (0 API) = $ 28.00 iii) Quality of oil to be produced: Gravity = 34 API, Sulphur = 1.0% c) Write a note on Production and Demand of hydrocarbons in India. [5] SECTION - II Q5) a) Following is the database available from major regions of the world on the proven reserves in billion barrels (R, column 2), production in million barrels per day (P, columns 3, 4, 5, and 6) and consumption in million barrels per day (D, columns 7, 8, 9, and 10). [15] Region R P P P P D D D D 2006 2007 2008 2009 2006 2007 2008 2009 N. America S&C America Europe Eurasia Middle East Africa Asia Pacific 63.8 13.9 13.9 14.1 14.3 23.6 23.7 23.7 24.1 102.2 6.9 6.8 6.9 6.7 4.7 4.8 4.6 4.6

105.9 14.9 15.4 16.2 16.9 19.4 19.6 19.5 19.2 726.6 23.2 22.5 20.9 22.6 101.8 7.8 47.7 7.9 7.8 7.9 7.9 7.9 8.4 7.8 4.3 2.5 4.3 2.4 4.4 2.5 4.5 2.5

21.1 21.1 21.7 22.6

[3764]-381

Analyze the data and give your comments on following points i) Plot the information on production and demand to infer future trends for the same. What may be the production and demand forecast for the year 2012? ii) What are the existing reserves to production ratio? Write R/P ratio in descending order. iii) Compare the production and demand to ascertain the likely areas of greater demand. iv) Identify the factors affecting future production and demand. b) Consider the following investment opportunities that might be available to a company with a current priority in minimum risk involved. Asset Opportunity Total Investment (M = 106 $) A Drilling exploration wells in an area with $ 20 M no history of occurrence of hydrocarbons B C Exploration project adjacent to producing field Redevelopment in producing field $ 10 M $ 15 M

If a budget of $ 20 M is available for allocation of projects for next year, which is the best way to spend money acknowledging the factors of uncertainty and risk? i) 100% allocation in asset C and 50% allocation in asset B. ii) 100% allocation in asset C, 25% in asset B and 12.5% in asset A. iii) 80% allocation in asset C, 40% in asset B and 20% in asset A. Justify your decision with suitable arguments for each alternative. [10] OR [18] Q6) a) Write notes on any three of the following : i) Oil and gas accounting system. ii) Risk analysis applied to Petroleum field development. iii) Meaning and interpretation of EMV. iv) Variation in technical costs of exploration and production of oil and gas as a function of water depth and geographic location. v) Production sharing contract.

[3764]-381

b) Company A owns complete Working Interest (W.I.) for a petroliferous basin. For some reason A leases its land for oil and gas development to D, retaining its 1/8 royalty interest. In order to hedge against nonproductive development A sells 1/4th of its royalty to B and 1/8th of its royalty to C. D, the original lessee, then conveys the lease to E, retaining 1/6th of 7/8 Overriding Royalty Interest (ORI). To support D with its development and operating cost, E now sells one-fourth of its interest in the lease to F. A, B, C, D, E and F, thus, become the royalty owners for the hydrocarbon development project. Calculate the Overriding Royalty Interest (ORI) and Working Interest (W.I.) for each of them. [7] Q7) a) The management of an oil and gas company is analyzing a drilling prospect from a known hydrocarbon area. However, the most important aspect in the discussion is finding of hydrocarbon reserves. The field has a history of occurrence of reserves of gas of 2 BCF in 35% wells, 3 BCF in 35% wells, 4 BCF in 20% and 5 BCF in 10% wells. The probability of finding of gas is 0.25 and if gas is encountered then probability of finding of reserves of 2 BCF, 3 BCF, 4 BCF and 5 BCF is identical to that of success ratio encountered in the field. Monetary profits for each level of reserves if encountered, are given for two available alternatives, drilling or farm out. Dry hole cost is $ 70,000 Reserves 2 BCF 3 BCF 4 BCF 5 BCF NPV, if drilled + 40,000 $ + 90,000 $ + 1,30,000 $ + 2,00,000 $ NPV profit, if farmed out + 9,000 $ + 12,500 $ + 15,000 $ + 18,000 $

What is the best choice in this prospect based on maximizing EMV? What is the minimum probability of finding gas required to justify even the risk of drilling? Draw a graph of EMV and probability of finding gas and show the intersecting point where the decision is reversed. Show all calculations. Construct decision tree at a suitable step, show all calculations and take decisions with proper justification. [15]

[3764]-381

b) Construct a critical path study to develop a medium size field for which details are given below : [10] i) Sixty development wells ($ 1.5 MM each) - One third will be injectors. ii) Three platforms - two for wells, the other for production/injection equipment and pipeline terminus. ($ 310 MM each). iii) Wells take about one month to drill. Upto two rigs/platform. iv) Platforms manufactured in one and a half years - two out time one month during weather window in Summer. (Two out costs $ 10 MM). Setup time is three months for drilling/well platform, five months for production platform. v) Pipeline lay time is about 14 months. (Cost $ 180 MM). vi) Production commissioning and final permit take two months ($ 5 MM). vii) Overhead and other ongoing costs = $ 1 MM/month. The main idea of this exercise is to avoid waste of time, labor and material. 1) Draw a critical path diagram for this project. Assume a starting date of July, 1, 2010. 2) Determine the time length of the critical path. 3) Plot cumulative costs as a function of time. OR Q8) a) Following are the details of production of oil from a small field. Year 1 2 3 4 5 6 7 8 9 10 11 12 Annual Production (bbl) CAPEX, IN $ MM 8.6 8.6 [20]

108000 108000 108000 108000 87000 69000 51000 34500 17250 8625

[3764]-381

Prepare a spreadsheet based on assumptions given below and calculate NPV @ 10%. Oil price is $ 50/bbl and is constant throughout the tenure. OPEX is $ 3/bbl for service life. Royalty is 10% on gross revenue. Cost recovery is 70% of net revenue since beginning of commercial production. Profit petroleum is to be shared between government and operator on 60 : 40 proportion. Tax holiday is for first 3 years from beginning of commercial production, after that tax is 25%.

b) An oil company have mapped a prospect and concluded that the resources may be as high as 50 million barrels and the probability of success is estimated to 10%. The data acquired, the interpretations and the cost of the exploration well will amount to 20 million USD. If a discovery is made, the NPV will be 90 million USD. [5] Calculate the expected monetary value. Find the break even POS.

[3764]-381

Total No. of Questions : 12]

[Total No. of Pages : 2

P1445

[3764] - 418 B.E. (Computer Engineering) MULTIMEDIA SYSTEMS (Elective - I) (2003 Course) (410445)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6)

[Max. Marks : 100

Answer Q1 or Q2, Q3 or Q4, Q5 or Q6 from Section - I & Q7 or Q8, Q9 or Q10, Q11 or Q12 from Section - II. Answers to the two sections should be written in separate answer books. Neat diagrams should be drawn wherever necessary. Figures to the right indicate full marks. Use of electronic pocket calculator is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) b) What is Multimedia? Explain the Goals and Objectives of Multimedia.[8] State and explain the basic components of Multimedia. [8] OR State the various applications of Multimedia over internet. [8] What is Multimedia Authoring? State and explain various types of Multimedia authoring tools. [8] State and explain the different functions of Multimedia file Manager. [8] Explain the Process Management with respect to Multimedia Operating System. [8] OR State and explain the characteristics of Multimedia DBMS. [8] Enlist all the applications of Multimedia DBMS system. [8]

Q5) Write short note on: a) Color Image Processing. b) Lossless Image Compression Techniques.

[18]
P.T.O.

Q6) Write short note on: a) Different Spatial Filtering Techniques. b) JPEG Compression Techniques. SECTION - II Q7) a) b) Q8) a) b)

OR

[18]

Write short note on sound card stating the different components and I/O ports. [9] State and explain any three audio file formats in brief. [9] OR Draw and explain MPEG-4 encoder & decoder. [9] Explain LZW compression technique with example. [9]

Q9) (a) Which are the types of nodes in VRML? Write a script for implementing dining table using VRML. [8] (b) Differentiate between the Virtual Reality and Augmented Reality by taking example. Also explain CCD and its use in the multimedia applications. [8] OR Q10)(a) What is Virtual Reality? How does the multimedia techniques are used to implement the Virtual reality. [8] (b) Explain Head Mounted Displays and their use in multimedia applications. [8] Q11)(a) What is animation? Explain with respect to animation (i) Kinematics. (ii) Morphing. (iii) Onion Skinning. [8] (b) What is rendering? Explain different rendering algorithms in animation.[8] OR Q12)Write short notes on: (a) 2D & 3D animation. (b) Principles of animation. (c) Client Pull & Server Push animation. [16]

EEE

[3764]-418

Total No. of Questions : 8]

[Total No. of Pages : 2

P1448

[3764] - 1005 B.E. (Civil) ARCHITECTURE AND TOWN PLANNING (1997 Course) (401001) (Elective - I)

Time : 3 Hours] Instructions to the candidates: 1) Answer any three questions from each section. 2) Figures to the right indicate full marks. 3) Use separate answer sheet for two sections. 4) Neat diagrams must be drawn wherever necessary. 5) Use of nonprogrammable calculator is allowed. 6) Assume suitable data if necessary.

[Max. Marks : 100

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Co-relate between Vastushastra and functional plan. Describe salient features of Gothic Architecture. Differentiate clearly between soft and hard landscape. Write a short note on Interior Design. [8] [8] [8] [8]

A Management Institute is to be planned. Prepare the activity chart & establish functional relationship. [8] Write a note on composite climatic behavior and its impact on planning. [8] [18]

Q4) Write short notes on any three: a) Order in planning. b) Shading Devices. c) Connectivity Matrix. d) Sky line and its importance.

P.T.O.

SECTION - II Q5) a) b) Q6) a) b) Q7) a) b) Explain the planning considerations of neighbourhood with special referance to Indian cities. [8] Enlist various surveys to be carried out during preparation of Development plan. Elaborate on any two. [8] Explain the concept of Garden City and its contribution in early planning efforts. [8] Discuss the theory of Three Magnets and its relevance in Modern Urban Planning. [8] What are the different land uses? Explain importance of landuse zoning in Development Plan. [8] Write short notes: [8] i) Topography and its effects on plan preparation. ii) Enlist various amenities with reference to D.P. [18]

Q8) Write short notes : (Any three) a) Demographic Survey for Development Plan. b) Regional Plans. c) Patric Gadder. d) Town Planning Scheme.

EEE

[3764]-1005

Total No. of Questions : 12]

P1474

[Total No. of Pages :3

EMBEDDED SYSTEMS DESIGN


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Assume suitable data, if necessary.

[3764] - 225 B.E. (E & TC)

SECTION - I Q1) a) b) Explain the design metrics in detail for embedded system. Explain the following communication protocols. i) IrDA. ii) Blue tooth. iii) CAN. iv) GPRS. OR Q2) a) Compare the following in complete details. i) CAN with MODBUS. ii) IEEE 802.11 with IEEE 802.16. [10] [6] [12]

b) Q3) a)

Explain the protocol architecture of bluetooth & all details of physical layer. [8] Explain the processor selection criteria for i) Portable camera. ii) Fingerprint access control. [10]

b)

Explain the concept of context switch. List and explain the different states of a task. Also draw a task state diagram. [6] OR

P.T.O.

Q4) a) b)

What is the memory selection criteria in embedded system and explain in detail any one case study of your memory selection. [8] Explain in detail software and hardware architecture for interfacing keyboard, 6 digit seven segment LED display & RS 485 port in an embedded system. [8] Explain following software tools in designing of an embedded system. i) Assembler. ii) Loader. iii) Compiler. iv) Linker. [6] Write a device driver for 86 keyboard & 162 LCD character display for COS. Define your APIS for the device driver & implement C code for each of them. [10] OR

Q5) a)

b)

Q6) a) b)

Explain in detail interprocess communication and synchronisation. Where it is used. [8] What is foreground task and background task. Explain with example.[8] SECTION - II

Q7) a) b)

Explain in detail what is pipe, message, events and compare them. [10] Write a C code for implementing events for RTOS. OR [8]

Q8) a) b) c) Q9) a) b)

Write a C code for implementing a scheduler for RTOS.

[8]

List and explain services provided by RTOS and what are the minimum services RTOS must provide. [6] Explain the boot sequence in embedded system. What is operating system selection criteria for embedded system. Compare in detail i) Vx works with Nucleus. ii) RT Linux with QNX. [4] [6]

[6]

c)

Explain stages in software development life cycle with the help of waterfall model. [4] 2

[3764]-225

OR Q10)a) b) What is operating system selection criteria for mobile computing. Compare the following mobile computing OS : i) Windows Mobile. ii) Palmos. iii) Iphone OSX. iv) Symbian. [6] [6]

c)

Explain stages in software development life cycle with the help of waterfall model. [4]

Q11)Draw hardware block diagram for implementing QVGA graphics LCD display & write C code for it assuming COS. [16] OR Q12)Implement MOD Bus protocol for RS 485 using COS for embedded system. [16]

kbkb

[3764]-225

Total No. of Questions : 12]

P1475

[Total No. of Pages :3

ADVANCED DIGITAL SIGNAL PROCESSING (2003 Course) (404218)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Your answers will be valued as a whole. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary. 7) Solve Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6, from section I.solve Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12, from section II .

[3764] - 227 B.E. (E & TC)

SECTION - I Q1) a) Obtain the power spectrum of the autocorrelation rx(k) = |k|, where || < 1. [8]
n For a factor of L Up-sampler, governed by xu(n) = x for n = 0, + L, L + 2L,......obtain the Z-Transform equivalent relationship. [8]

b)

OR Q2) a) b) Define Wide Sense Stationary (WSS) process. State & explain any 3 important catagorieal properties. [8] It is required to decimate a signal by reducing the sampling rate from 12kHz to 400 Hz. The specifications for H(z) are fp = 180 Hz, fs = 200 Hz, p = 0.002, s = 0.001. Apply H(z) = I(z) F(z6) & compute complexity. [8] Define and explain i) AR ii) ARMA iii) MA processes. For which type of process is the Toeplitz symmetry useful? [10] Explain what is an innovations process with the help of a neat sketch.[8]
P.T.O.

Q3) a) b)

OR Q4) a) b) What do you mean by forward prediction? Explain how LevinsonDurbin Algorithm is vital in the prediction. [10] Given a 3-stage lattice filter with coefficients as K1 = 0.8, K2 = 0.5 & K3 = 0.14, determine the FIR filter coefficients with the direct form of structure. [8] What is the role played by Eigen values & Eigen vectors in adaptive filters? Explain in detail. [8] Draw the block diagram of a typical adaptive filter. Explain the terms presented. [8] OR Q6) a) Explain the following terms for a typical adaptive filter i) Rate of convergence. ii) Misadjustment. iii) Tracking.

Q5) a) b)

[8]

b)

Highlight & explain major differences in RLS & LMS adaptive algorithms. [8] SECTION - II

Q7) a) b)

Explain the salient features of Bartletts method of power spectral density [8] estimation. Explain in detail the following terms with a neat sketch : i) Periodogram. ii) Correlogram. OR

[8]

Q8) a)

Define the parametric & non-parametric methods of power spectral estimation. Highlight the major differences between them. Justify under what condition, a certain method is useful. [8] Explain the salient features of Welchs method of power spectral density estimation. [8]

b)

[3764]-227

Q9) a)

Explain what are the fixed point & floating point DSP processors. Enlist their application areas. [8] b) What do you mean by pipelining in the context of DSP? Explain with the help of a neat sketch & suitable example. [10] OR Q10)Explain the following terms for a typical DSP processor (any 3) : [18] a) b) c) d) Q11)a) b) Zero overhead looping. Circular buffering. Barrel shifter & its role. Super Harvard architecture. Explain with the help of a neat sketch, various steps in digitisation of speech signal. [8] State various speech coding techniques & explain any one of them. [8] OR Q12)Explain the following terms in the context of speech processing (any 4) :[16] a) b) c) d) e) Cepstrum. Pitch & pitch detection. Formants. Signal detection. Vowels, consonants & nasals.

kbkb

[3764]-227

Total No. of Questions : 12]

P1479

[Total No. of Pages :3

[3764] - 241 B.E. (Electronics)


COMPUTER NETWORKS

(2003 Course)
Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) Suggest various network topologies for : i) Broadcast networks ii) Point to Point network List their advantages and disadvantages.

[8]

b) c)

What is the principal difference between connectionless communication and connection oriented communication. [4] What are headers and trailers and how do they get added and removed? [4] OR Explain the service primitives used in connected oriented services. [6] List similarities and differences between OSI and TCP/IP reference model. [6] Which OSI layer is responsible for the following? i) Determining the best path to route packets. ii) Providing end-to-end communication with reliable service. iii) Determining the size of packets. iv) Carrying the packets. [4]

Q2) a) b) c)

P.T.O.

Q3) a)

Give a brief description of the application and limitation of the following types of transmission media: [12] i) Twisted pair. ii) Fiber optic cable iii) Coaxial cable iv) Microwaves. Calculate the maximum achievable data rate for a binary signal transmitted over a 3kHz channel with SNR 20dB. [4] OR Explain why bandwidth of twisted pair and coaxial cable decreases with distance. [4] It is required to transmit a data at a rate of 64kbps over a 3kHz telephone channel. What is the minimum SNR required to accomplish this? [4] Explain packet, circuit and message switching with examples. [8]

b)

Q4) a) b) c) Q5) a)

Let g( x )=x3+x+ 1. Consider the information sequence 1001. i) Find the codeword corresponding to the information sequence given. ii) Suppose that the code word has a transmission error in the first bit. What will be the syndrome generated at the receiver? [6] Discuss in detail the HDLC protocol. What are the similarities and differences between PPP and HDLC? [6] Write down the problems that are encountered in building the bridge between: [6] i) 802.3, 802.4 ii) 802.4, 802.5 OR

b) c)

Q6) a) b) c)

Suppose transmission channels become virtually error free is the data link layer still needed? Justify. [4] What is sliding window protocol? What is the importance of the size of window? [8] What is piggybacking? What is the significance of piggy backing? Give with an example. [6]

[3764]-241

SECTION - II Q7) a) b) c) Q8) a) b) c) Q9) a) b) c) Q10)a) b) List the goals of the Network Layer. Define routing, flooding. [8] Explain the congestion prevention policies of transport layer, network layer and data link layer. [6] How does a router differ from a bridge? [4] OR Answer briefly crash recovery in the transport layer? [6] List the properties of routing algorithm used in computer networks. What is the Optimality-principle? [6] Explain various congestion control techniques. [6] What is DNS? What resource records are associated with it? Explain the five basic functions in Electronic mail. Explain DES. OR Discuss security issues of intranet & internet. Write short note on : i) Video on Demand. ii) Web page in HTML. iii) Email. [6] [4] [6] [4] [12]

Q11)a) b)

Draw IP address formats for Class A, Class B, C, D and E using suitable example and give range of each. What is the significance of sub-netting?[8] What are the major goals of lPv6. Give the difference between IPv4 and IPv6. [8] OR Explain in detail the layered architecture of TCP/IP protocol suite. [4] Write short note on : i) FTP. ii) BOOTP. iii) SMTP. iv) Trace route. [12]

Q12)a) b)

kbkb
[3764]-241 3

Total No. of Questions : 12]

[Total No. of Pages : 02

P1480

[3764] - 244 B.E. (Electronics) VLSI DESIGN (2003 Course)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answer any 3 questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks.

[Max. Marks : 100

Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) Using structural modeling draw schematic and write VHDL code of 16:1 Mux by 4:1 Mux (as a component). [16] OR Q2) a) List different synthesizable VHDL statements. [4] b) Explain function and procedure with VHDL examples. [12] Q3) Draw state diagram and write VHDL code for Traffic light control. OR Q4) a) What is metastability and synchronization. b) Write VHDL code for Lift control. [16] [6] [10]

Q5) Draw detail block diagram and explain different sub-blocks of CPLD. [18] OR Q6) a) Draw only the block diagram FPGA and explain difference between CPLD and FPGA. [12] b) Write specification of CPLD and FPGA. [6]

P.T.O.

SECTION - II Q7) a) b) Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b) What is clock skew and Jitter? Explain different techniques of clock distribution. [12] Define Global and switch Box routing. [4] OR Explain the classification of memory. [12] Define off chip connection. [4] What is technology scaling? Explain different scaling techniques. [12] Explain what is body effect in MOSFET. [4] OR Explain different power dissipation in CMOS Inverter, also define power delay product. [12] Draw schematic and explain Transmission Gate. [4]

What is the need of DFT? With schematic explain different faults. [12] Define controllability and observability. [6] OR Q12)Write short notes on: [18] a) TAP Controller. b) BIST. c) JTAG.

EEE

[3764]-244

Total No. of Questions : 12]

P1482

[Total No. of Pages :2

[3764] - 248 B.E. (Electronics)


ADVANCED COMMUNICATION ENGINEERING

(2003 Course) (404205)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks.

SECTION - I Q1) a) b) State and explain the principle of operation of two cavity klystron amplifier. [8] State and explain the principle of operation of helix traveling wave tubes. [8] OR Draw a neat sketch of E-plane tee, H-plane tee and magic tee. Write S parameter matrix of each. [8] Draw a neat sketch of Directional Coupler. State the spacing between the centers of two holes of two hole directional coupler. Explain how the wave energy is Propagating through it. [8] State the characteristics of IMPATT Diodes. What do you understand by the term Negative Resistance? [8] With the help of Voltage and Current waveforms explain the principle of operation of TRAPATT diodes. [8] OR Q4) a) b) What is Gunn Effect? State the microwave generation and amplification using Gunn Diode. [8] State the physical structures and principle of operation of microwave transistors. [8]
P.T.O.

Q2) a) b)

Q3) a) b)

Q5) a) b)

Write a short note on Plan Position Indicator (PPI). [9] With the help of block diagram explain the working of Pulsed Radar System. [9] OR Derive the Radar Range Equation. Write a short note on System Losses in radar. SECTION - II [9] [9]

Q6) a) b)

Q7) a) b)

With the help of block diagram explain the Optical Fiber Communication Link. [8] State and explain different types of losses in Optical Fiber Communication. [8] OR Derive the equation of Numerical Aperture. Write a short note on Modes and types of optical fibers. [8] [8]

Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b)

State the advantages and disadvantages of DS-SS and FH-SS systems.[8] What is the difference between handoff and roaming? OR What is meant by cell splitting? How it is used to increase cellular system capacity? Explain with suitable example. [8] State the difference between CDMA and other mobile communication techniques. [8] Discuss the main effects of the troposphere and the ionosphere with reference to signal propagation in satellite communication. [9] Explain the terms Synchronous Orbit, Polar orbits and Inclined Orbits. [9] OR Draw the block diagram of Earth Station receiver. Sketch the Noise Temperature Equivalent of the receiver. Derive the equation for system noise temperature. [9] Describe Satellite System Power Budget. [9] [8]

Q12)a)

b)

kbkb
[3764]-248 2

Total No. of Questions : 6]

[Total No. of Pages : 3

P1488

[3764]- 310 B.E. (Printing) SUBSTRATES AND INK TECHNOLOGY (2003) (408290)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) All questions are compulsory. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn whenever necessary. 4) Figures to the rights indicate full marks.

SECTION - I Q1) a) State the importance of uni-flow cylinder mould machine in packaging industry with neat sketch. [10] b) Mention the types of polyethylene used in packaging with their properties and uses in flexible packaging. [8] OR a) Comment on multivat cylinder mould machine for the production of boards used in printing and packaging industry. [10] b) Mention the types (names) of paper, grammage of the paper and finish of the paper required for the following jobs (any two) : [8] i) ii) iii) iv) Annual Reports. Business Catalog. News paper. Telephone Directories. [8]

Q2) a) Explain any two in details with reference to printing paper. i) ii) iii) iv) Caliper. Cobb factor. Acidity & pH. Opacity.

b) Explain in short the points to be considered at the time of selection of paper for particular printing job. [8] OR P.T.O.

a) Mention the points to be considered specifically, while placing an order of the paper in reel-form. [8] b) Discuss the importance of the following properties of paper in your printing job (any two) : [8] i) ii) iii) iv) Ream weight. Breaking length. Burst factor. Grain Direction.

Q3) a) Discuss in short the points to be considered in calculating direct cost in printing job. [8] b) Find the quantity of paper in size 61cms 88 cms for 20,000 booklets in size 210 mm 297 mm, assuming the booklet contains 24 pages.[8] OR a) Comment on (any two) : i) ii) iii) iv) Recycle paper. Kraft paper. Duplex paper. Coated paper. [8]

b) Find the length of paper of 100 gsm in a reel of 62 cms width and weight of reel is 150 kg. [8] SECTION - II Q4) a) Discuss the different types of pigments used in printing inks and their properties. [8] b) What are different additives used in printing inks? Explain the purpose of their addition and their specific essential properties. [8] OR a) Discuss the principles of ink formulation with two specific formulae.[8] b) Explain the role of waxes in ink formulation. [8]

Q5) a) Explain in brief BIS and ISO quality control with reference to printing inks. [8] b) Discuss the methods of ink testing used in laboratory. OR
[3764]-310 -2-

[8]

a) Explain the term rheology with reference to paste inks and liquid inks. [8] b) Comment on the following : i) ii) Product quality vs. system quality. Environment management in printing inks utilization. [8]

Q6) a) Explain the formulation method for metallic inks with their essential properties. [9] b) Discuss the advantages and disadvantages of water base inks. OR a) Discuss electrographic printing inks. [9] b) Green issues in printing operation with reference to the solid waste and VOC. [9] [9]

xxxx

[3764]-310

-3-

Total No. of Questions : 12]

P1492

[Total No. of Pages :3

[3764] - 351 B.E. (Polymer) (2003 Course)

POLYMER STRUCTURE AND PROPERTY RELATIONSHIP


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) d) e) f) What leads to charring in polymers. Explain chromophoric effect. Explain role of atoms on density. Explain role of atoms on Hammability. Give the effect of wheathering on polymer. [2] [2] [2] [2] [2]

Explain the effect of presence of H-atom in any polymeric structure and also the type of bonds if forms. [8] OR Explain the type of bonds oxygen atom makes and thus the effect on properties. [6] Explain the type of bonds nitrogen atom makes and thus the effect on properties. [6] Explain the type of bonds carbon atom makes and thus the effect on properties. [6]

Q2) a) b) c)

P.T.O.

Q3) a) b)

Write short note on role of chemical groups in adhesion.

[6]

Give the various types of available additives that are available in the market and in short give the role played by each of them when added to polymer. [10] OR Corelate procenability with viscosity in various processes like injection, extrusion, spinning etc. [6] Even though the structural formula of LDPE and HDPE is same, why do they differ in properties like M.P, density, etc. [4] For PVC & PVDC, show their structure & justify which one has high Tg. [3] In ps what all modifications can be made to make it less brittle. [3]

Q4) a) b) c) d) Q5) a)

b) c) Q6) a) b)

Explain what is meant by M.W.D. Also explain what is NMWD & BMWD. How do they both affect the properties of a polymer. Explain with egs. [8] Explain action of a plasticizer. [4] Explain the significance of structure on dielectric constant. OR Draw plot of impact strength v/s MFI for NMWD and BMWD for two grades having density 0.950 and 0.960 gm/cc. [9] Give the factors affecting dielectric constant. SECTION - II [7] [4]

Q7) a) b) c)

What is meant by amorphous and semicrystalline polymers. Explain with egs. [6] Give list of factors that can be used to obtain a tailor made polymer.[6] Write note on thermoplastics, thermosets & elastomers. OR [6]

Q8) a) b)

Explain the effect of structure on various polymer properties with eg.[10] Explain what is meant by freedom of rotation. Explain with egs. [8]

[3764]-351

Q9) a) b) c) d)

Discuss flexibility-structure relationship in detail. In PMA and PMMA, which one will have higher Tg and why? Will ps or 2,6, dimethyl ps will have higher Tg and why?

[10] [2] [2]

Explain why poly (butyl acrylate) is niffery and poly (methyl acrylate) is stiffly flexible. [2] OR Explain role of polarity on polymer properties. [4]

Q10)a) b) c) Q11)a) b)

What is the effect of orientation on properties. & how is it different from crystallisation. [6] What are the structural criterias to get a polymer undergo better crystallisation. [6] Explain fringed micelle model. Also explain lamella & effect of temperature on growth of sphermlite. [8] What are the different types of intermolecular bonding forces that contribute towards the attained intermolecular forces & thus properties.[8] OR [16]

Q12)Write short notes on any 3 : a) b) c) d) Solubility parameter and its significance. Effect of halogens on properties. WLF equation. Why nylons are hygroscopic.

kbkb

[3764]-351

Total No. of Questions : 12]

P1495

[Total No. of Pages :5

[3764] - 380 B.E. (Petroleum)


OIL WELL DRILLING ENGINEERING

(2003 Course)
Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer 3 questions from section I and 3 question from section II. 2) Answer to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) A3.5'' drill pipe ,13.3 ppf grade S135 premium class is used to run 4.5'' O.D. liner to 21,000 ft. If length of drill pipe is 17,500 ft, mud weight is 120 pcf. Total weight of liner is 50,000 lbs calculate stretch in drill pipe. [6] Explain in brief, importance & different parameters considered while making Geo technical order. [6] Using following bit performance record & drilling records, determine out of 3 bits which bit gives lowest drilling cost. If the hourly operating cost of rig is 40,000Rs/hour and trip time is 10 hours. The connection time is included in the rotating time. Drilling record for thick shale section at 12,000ft. [6] BIT A B C Bit cost (Rs) 28,000 160,000 320,000 Interval drilled (ft) 106 415 912 OR Rotating Time (hrs) 9 62 153

b) c)

P.T.O.

Q2) a)

A drill string consist of 600ft of 8.25" 2 13/16" drill collar & rest is 5" drill pipe, 19.5ppf grade X95 drill pipe. If required MOP is 100,000 lbs and mud weight is 10 ppg. Calculate maximum depth of the hole that can be drilled when i) Using new drill pipe Pt =501,090 lb ii) Using class 2 drill pipe having yield strength Pt = 394,000 lb, steel density = 489.5 pcf, B.F.= 0.847. [8] What are different parameters used to calculate drilling cost/ meter? How to optimize the cost of drilling? [4] A rig hoist a load of 300,000 lbf. The drawworks can provide an input power as 500 hp. Eight lines are strung between the crown block & travelling block. Calculate. [6] i) The static tension in fast line when upward motion is impending. ii) The maximum hook horse power. iii) The maximum hoisting speed. Consider efficiency 0.841 A 9 ppg brine having a viscosity of 1 cp is being circulated in a well at a rate of 600gpm. Determine whether the fluid in the drill pipe is in laminar or turbulent flow if the internal diameter of the drillpipe is 4.276". [4] What is hedstrom number? A 10 ppg mud having plastic viscosity 40 cp & yield point 151bf/l00 sq.ft is being circulated at a rate of 600 gpm. Calculate hedstrom number if 6.5" hole contain 4.5" drill collar, have a length 1000 ft. to check turbulence for annulus. [4] What are different factors affecting rate of penetration? Explain anyone in detail. [4] What is hydraulics? Discuss various factors to optimize it. OR [4]

b) c)

Q3) a)

b)

c) d)

Q4) a)

Calculate Pc. Pbit, BHHP, IF [8] Hydraulic horse power of pump =1211 hp , maximum permitted surface pressure Ps = 3500 Hole size = 12.25" , mud density = 13ppg , Drillpipe = 5" O.D.,4.276" I.D. pc =K Qn K = 0.01 , n= 1.86 Use BHHP criteria. Discuss different pressure losses in mud circulation system with suitable sketch. [8]

b)

[3764]-380

Q5) Calculate : [16] a) lst & 2nd KOP depth. b) Total horizontal displacement. c) Measured depth at a point of entry to reservoir. Data for double build up horizontal well is as follows BUR 1 = 5.5, BUR2 = 10, Target = 10000 ft Tvd. ( land at target = 90) Tangent angle = 50, Tangent length = 500 ft. OR Q6) a) Write short note any two : i) MWD tool. ii) Minimum curvature method. iii) Types of horizontal wells. Calculate dog leg severity between two stations Measured depth (ft) Inclination Azimuth 2000 5.5 149 2041 6.5 145 Discuss Mohrs Coulombs criteria of rock failure in brief. SECTION - II Q7) a) A 13-3/8 intermediate casing set at 9750 ft, External mud weight 11 ppg, Internal mud weight 11.2 ppg ,Drilling ahead 12.25" hole at 13360 ft. Experienced total loses & fluid level dropped to 2528 ft. Calculate net collapse load at casing shoe. [4] During pressure test calculate net burst load at casing shoe. Data given as 9-5/8 casing set at 9750 ft, mud weight 11.5 ppg , Top of cement at 3000 ft, Previous casing shoe at 1500 ft, pressure test carried at 3000psi. [4] [8]

b)

[4]

c)

[4]

b)

c ) Calculate tensile load as weight in air ,buoyancy, bending, shock Running 13-3/8", 72 ppf intermediate casing to 9750 ft, inside diameter 12.347" Mud weight 11ppg, instantaneous velocity 5 ft/sec, dog leg severity = 1/100 ft. [4] d) Explain leak off test in detail. OR [3764]-380 3 [6]

Q8) a) b)

c) Q9) a) b)

Write casing seat selection procedure in detail. [6] Calculate number of sacks (take 20% extra for open hole), Water required for gail & tail slurry for 13-3/8" casing cementation job. If rise of cement is 600m from bottom, height of gel slurry 200m and tail slurry 400m, distance between float shoe and float collar is 25 m. Data given : Capacity 17.5" & 13- 3/8" casing = 0.1237 bbl/ft, capacity of 13-3/8" casing = 0.1521 bbl/ft Gel slurry yield = 1.66 cu.ft./sack & water requirement = 8.77 gal/ sack Tail slurry = 1.15 cu.ft./ sack & water requirement = 5 gal/sack. [8] Discuss triaxial casing design. [4] Explain drillers method of well control in detail. [8] A well is closed in on a 30 bbl gas kick, while drilling 8.5" at 11000 ft (TVD) with 5" drill pipe and 750 ft of 6.5" drill collar. Annular capacities 5"drill pipe in 8.5" hole = 0.0292 bbl/ft., 6.5" drill collar in 8.5" hole = 0.0292 bbl/ft Mud weight = 12.3 ppg, SIDPP = 350 psi, gas gradient = 0.115 What will be SICP? [4] Accumulator bottle capacity = 10 gallons, number bottles = 15, maximum operating pressure = 3000 psi, minimum operating pressure = 1200 psi, pre charge pressure = 1000 psi Electric pump discharge volume = 5 gpm. i) During a BOP function the pressure on the accumulator bottle bank drops from 3000 psi to 1800 psi, how many gallons of fluid did that function use. ii) If electric pump was switched off during that operation, how long would it take to re- charged the bottle bank when switched on. [4] OR

c)

Q10)a)

A well has been drilled to 10000 ft & pulling out for a bit change, mud weight 10 ppg formation pressure at 10000 ft was 5000 psi. What shall be the effect on bottom hole pressure after pulling out 10 stands (90 ft each) of 5" ,19.5" ppf drill pipe wet without filling the hole. Metal displacement 5" drillpipe = 0.0065 bbl/ ft , 9-5/8" casing shoe = 1000 ft Drill pipe capacity = 0.0177 bbl/ft, casing capacity= 0.0727bbl/ft, annular volume 9-5/8" 5" = 0.0475 bbl/ ft. [4] 4

[3764]-380

SIDP = 500 psi , SICP = 610 psi, kick volume = 10 bbls , hole size = 8.5". Open hole x drill pipe capacity = 0.0456 bbl/ft , open hole x drill collar capacity = 0.03 bbl/ft mud weight = 10 ppg, TVD = 10000 ft , drill collar length = 600 ft. Find influx density. [4] c ) Describe i) Primary well control ii) Secondary well control iii) Tertiary well control. [6] d) Q11)a) b) Write different reasons of well kick. [2]

b)

Describe BOP stack pressure testing for shear ram with suitable sketch.[8] Explain accumulator / hydraulic control unit of BOP with suitable sketch. [8] OR

Q12)a)

Write short notes on : i) ii) Subsea well head. Offshore rigs.

[10]

b)

Discuss drilling operations on floating rig in brief.

[6]

kbkb

[3764]-380

Total No. of Questions : 11]

[Total No. of Pages : 03

P1500

[3764] - 433 B.E (IT)

SOFTWARE TESTING AND QUALITY ASSURANCE (2003 Course) (414444)


Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) Answer question 1 or 2, 3 or 4 and 5 or 6 from section - I and question 7 or 8, 9 or 10 from section - II Question 11 is compulsory. Answers to the two sections should be written in separate answer books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data if necessary. [Max. Marks : 100

SECTION - I Q1) a) Define any 4 of the following terms i) Failures. ii) Faults. iii) Test Bed. iv) Defects. v) Errors. vi) Software Quality. [8] Explain in short any four methods of System Level Testing. [8] OR Is complete testing possible? When to stop testing? Explain the difference between random testing and testing using error guessing. [8] With reference to any hypothetical software identify following types of bugs. i) S/W doesnt do something that the product specification says it should do. ii) S/W does something that the product specification says it shouldnt do. iii) S/W does something that the product specification doesnt mention.
P.T.O.

b) Q2) a) b)

iv) Q3) a) b)

S/W doesnt do something that the product specification doesnt mention but should. [8]

Explain in detail a test plan template. [8] Explain what is test case database, defect repository and configuration management repository in context of test infrastructure management. [8] OR Q4) (a) Explain in details different functions (responsibilities) to be handled in a testing life cycle or process. [8] (b) Draw control flow graph for the code given below. Clearly label each node so that it is linked to its corresponding statement. Calculate its cyclomatic complexity. How can this value be used to measure testability? Describe how cyclomatic complexity number and the flow graph be used to design a set of white box tests for this module that would at least cover all its branches. [8] module foo() /* a[ ] and b [ ] are global variables */ begin int i , x i=1 read (x) while (i<x) do begin a[i] = b [i] *x if a [i] > 50 then print (array a is over the limit) else print (ok) i = i+1 end print (end of nonsense) end. Q5) a) b) Q6) a) b) Explain with example the GQM method for identifying software measures. [10] Explain different types of measurement scales with examples. [8] OR What is customer problem metric? What are approaches to achieve low PUM? [10] Explain the importance of the metric - percentage delinquent fixes in context with software maintenance. [8]
2

[3764]-433

SECTION - II Q7) a) b) Q8) a) b) Q9) a) b) What is meant by software quality control? Explain the method of measuring software reliability as a software quality attribute. [8] How is software usability measured? Describe different usability testing methods. [8] OR Enumerate Ishikawas Seven Basic Quality Tools. Explain any two in details. [8] What are the different components of costs, for quality software. Explain in details. [8] Explain the key process areas of CMM level 3. [8] A software manufacturer is experiencing a delay in delivery time because of skilled programmers leaving the organization. What would be a typical solution for this problem and a six sigma solution for the same. [8] OR Q10)a) b) Explain the Software Project Tracking & Oversight (SPTO) KPA of the CMM level 2. [8] Explain the PDCA cycle in details with reference to ISO 9000:9001. [8]

Q11)Write short notes on ANY three. [18] a) Client-Server Testing Techniques. b) Functional Testing of Website. c) Difference between web application testing and client/server testing. d) Importance of code review in software security testing.

EEE

[3764]-433

Total No. of Questions : 12]

P1501

[Total No. of Pages :2

[3764] - 435 B.E. (IT)


MOBILE COMPUTING

(2003 Course)
Time : 3 Hours] Instructions to the candidates: 1) Answer any 3 questions from each section. 2) Neat diagrams must be drawn wherever necessary. 3) Assume suitable data, if necessary. [Max. Marks:100

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Explaining the role of Context Manager, describe its various information and relevances in the mobile computing environment. [8] Explain the three-tier architecture of mobile computing. OR Explain various characteristics of mobile computing environment. [8] What is multiple access method? Why is it important? Explain various multiple access mechanisms with its application areas and examples.[8] Explain in detail various databases used in GSM. Explain the strengths and architecture of SMS in detail. OR Q4) Write detail notes on : a) IPv6. b) Mobile IP. c) RFID. Q5) a) b) Explain FHSS and DSSS in detail with appropriate diagrams. Write short notes on : i) MMS. ii) IS-95 architecture. [18] [9] [9] [8]

[8] [8]

P.T.O.

OR Q6) a) b) Explain the 3G Networks with its applications. Write short notes on : i) SGSN. ii) GGSN. SECTION - II Q7) a) b) Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b) Q12)a) b) Explain 802.11 architecture. Explain various entities used in SS#7 architecture. OR Explain various factors which are considered as constraints for handheld devices. [8] Explain various internal components of PDA. Explain Palm OS architecture. Explain Symbian OS architecture. OR Explain how J2ME is different than J2EE and J2SE. Explain the three prong approach used in JAVA. Explain any two real time protocols in detail. Explain various flavors of Windows CE. OR Explain symmetric and asymmetric key algorithms with examples. Explain various attacks on static and dynamic assets. [8] [8] [9] [9] [8] [8] [8] [9] [9] [8] [8] [8] [8]

kbkb

[3764]-435

Total No. of Questions : 11]

P1502

[Total No. of Pages :2

[3764] - 436 B.E. (IT)


GIS & REMOTE SENSING

(2003 Course) (414445)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer Q1 or Q2, Q3 or Q4, Q5 or Q6 from Section - I and Q7 or Q8, Q9 or Q10, from Section - II. 2) Question 11 from section II is compulsory. 3) Answers to the two sections should be written in separate answer books. 4) Neat diagrams must be drawn wherever necessary. 5) Figures to the right indicate full marks. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) What are different sensor parameters? Describe them with examples.[10] Describe IRS series of satellites. OR Describe the electromagnetic spectrum along with Maxwells theory and Quantum theory. [10] Explain the radar principle with required formula. What are the factors affecting microwaves? [8] Enlist the details that are annotated on the satellite imagery. Explain the sub-processes involved in image interpretation. [8] Explain the pre-processing correction methods used in processing of remote sensed data. [8] OR Q4) a) b) Write a note on application of aerial image interpretation. [8] Describe the image enhancement techniques used in processing of remote sensed data. [8] [8]

P.T.O.

Q5) a) b)

What is grid system? Which grid systems are used in the GIS applications? [8] What is GIS? What are the four Ms of GIS? Enlist the contributory disciplines to GIS. [8] OR What are maps? What is map scale? Explain spatial referencing system.[8] What is map projection? Describe different types of map projections.[8] SECTION - II

Q6) a) b)

Q7) a) b) Q8) a) b) Q9) a) b)

What is vector data representation? Explain it with suitable example.[10] What are the different ways to built GIS real world model? OR What is spatio-temporal data? Explain different types of representations used for spatio-temporal data. [10] What is raster data representation? Explain it with suitable example. [8] What are the common errors in GIS databases? Explain the process of data cleaning. [8] What is overlay analysis? Describe the process of digital terrain modeling. [8] OR What are various guidelines for digitization in GIS? Describe the data types and their sources used for GIS in India. [8] [8] [8]

Q10)a) b) Q11)a) b)

Explain data processing in GIS applications with desired steps and a suitable example. [8] Describe the software scenario in GIS focusing on functionalities, products and developers? [8]

kbkb

[3764]-436

Total No. of Questions : 10]

P1504

[Total No. of Pages :2

[3764] - 1017 B.E. (Production & Industrial Engineering)


MATERIALS MANAGEMENT

(1997 Course) (Elective - I)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Assume suitable data if necessary.

SECTION - I Q1) a) b) What is the scope of purchasing activities in a manufacturing company? Where would you fit purchasing in the materials management function?[8] Explain integrated materials management approach with suitable organisation chart. Compare its effectiveness over the other practice ie Decentralisation. [8] Explain any two laws related to purchasing activities. [8]

Q2) a) b) Q3) a) b) Q4) a) b)

What is negotiation? What are the objectives of negotation? What are the practices of good negotiation? [8] What is Vendor Development? Explain in brief. Describe what is Vendor Rating? [8] [8]

What are the factors which affect on import and export trade? Discuss.[8] What is Purchase Cycle? Draw the flow diagram and write down important steps and activities involved. [8] [18]

Q5) Write short notes on (any three) : a) Value Engineering. b) Ethics in purchasing. c) Buyer - Seller relationship. d) MRP.

P.T.O.

SECTION - II Q6) a) b) Expalin A,B,C. analysis technique used in materials function. [8] A company requires 16000 units of raw material costing Rs. 2 per unit. The cost of placing an order is Rs. 45 and the carrying costs are 10% per year per unit of the average inventory. Determine! i) The economic order quantity. ii) Cycle time. iii) Total variable cost of managing the inventory. [8] What is ment by Buffer Stock? Why it is required? What factors influence buffer stock? [8] What are the different factors that should be considered at the time of setting safety stock level. [8] Explain the functions of stores. What are the reasons for High finished goods inventories. With proper format. Explain Bin card. [6] [6] [6]

Q7) a) b) Q8) a) b) c) Q9) a) b)

What are inventories? Why are they required in any organisation? Describe the various types of inventories. [8] Discuss the need of physical stock taking in industry. [8] [18]

Q10)Write short notes on any three of the following : a) b) c) d) e) Surplus or obsolescent stock. Lead time in purchase. J.I.T. Two-bin system. Codification & standardisation.

kbkb

[3764]-1017

Total No. of Questions : 12]

[Total No. of Pages : 02

P1402

[3764] - 462 B.E (Biotechnology) FOOD BIOTECHNOLOGY (Sem. - II) (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Black figures to the right indicate full marks. 4) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary & state it clearly. 6) All questions are compulsory.

SECTION - I Q1) a) i) ii) b) i) ii) Q2) a) i) ii) Q3) a) b) Define & explain the term Industrial Engineering mention the contribution made by F.N. Taylor to the field of IE. [7] Define Method study. Discuss in brief the various steps involved in method study. [9] Discuss in brief various recording techniques/charts used in Method Study. [8] What is Micro motion study? Give any eight jherbrigs with its symbol. [8] State the objectives of work measurement. Mention the steps in making the time study. [10] Following data rapers to a sampling study of production of one job.

In canning, what should be done to ascertain that there is a tight seal after processing? What category of microorganisms is most affected by a tight seal? [18] Identify the preservation method that keeps fruits and vegetables the closest to fresh ones in color, flavor, and texture, Why it is the best method?
P.T.O.

c)

What substances are used to prevent fruit from darkening when preserving them by drying? What does the substance inhibit and how does it work? OR

Q4) (a) Describe the preparation methods for each of the following before freezing them: [18] i) Fruits. ii) Vegetables. iii) Meat. b) What type of food can be preserved by drying? Indicate the methods used to dry food. Explain how water affects spoilage in foods. c) Describe the three heat treatments employed in food preservation. Q5) Explain the role of lipids in the production of various classes of flavor compounds? Describe the various pathways and major enzymes involved.[16] OR Q6) Describe the applications of Xanthan Gum in baking and confectionary products? Explain the properties of Xanthan Gum for use in baking? Also, briefly describe the fermentative production of Xanthan Gum. [16] SECTION - II Q7) Compare the process conditions for the production of the production of cheese, butter, yogurt and ghee. [16] OR Q8) Write short notes on ANY TWO a) Functional foods. b) Single cell protein. c) Solid state fermentation. d) Pickling. OR Q9) What is the role of enzymes in food preservation and processing? OR Q10)What is meant by clarification in the production of fruit juices? Describe the role of enzymes. [16]
[3764]-462 2

[16]

[16]

Q11)Describe the characteristics of dairy waste? What are the most common treatment methods for solid wastes? [18]

Total No. of Questions : 8]

P1511

[Total No. of Pages :2

[3764] - 371 B.E. (Petroleum Engineering)


RESERVOIR ENGINEERING - I

(2003 Course) (412381)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two sections must be written in separate answer books. 2) Questions No. 2 (two) and 8 (eight) are compulsory. 3) Figures to the right indicate full marks. 4) Neat diagrams should be drawn wherever necessary. 5) Use of a non programmable calculator, log-log, semi-log paper is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Q2) a) b) What is reservoir engineering? What are drive indices? [6] [4]

Explain in detail classification of reserves and how are they calculated.[6]

Derive the material balance equation for a reservoir producing with combination of all the drive mechanisms. [8] From this derive the Havelena Odeh Linearization process. [10]

Q3) Derive the material balance equation for a gas reservoir. Explain the usefulness of the p/z graph. [16] Q4) State the different equations for decline curves. Explain the Fetkowitch Type curve. [16] SECTION - II Q5) Derive the diffusivity equation in cartesian coordinate system. [16]
P.T.O.

Q6) Explain the terms ETR, MTR and LTR. Explain the different flow regimes in a reservoir. [16]

Q7) Explain in detail a isochronal and modified isochronal test and analysis. [16] Q8) Explain the derivative plot for different reservoir models. [18]

kbkb

[3764]-371

Total No. of Questions : 06]

[Total No. of Pages : 03

P1516

[3764] - 200 B.E (Production) PROJECT MANAGEMENT (Sem.- ) (2003 Course)

Time : 3 Hours] Instructions to the candidates:

[Max. Marks : 100

All questions are compulsory answer any one of each question a or b.

SECTION - I Q1) a) Define project. Explain with suitable example difference between standard routine production and projects. [12] ii) Explain in detail various aspects of completion of project. [04] OR Explain differences in projects under private, public & joint sector. [16] Why modernization and replacement is required in projects? What are the considerations involved in decision making? [14] ii) Explain the term diversification. [2] OR For the automobile company producing cars explain following aspects involved. [16] i) Balancing. ii) Modernization. iii) Replacement. iv) Expansion. Explain in detail various steps in Project formulation involving importsubstitution projects? [14] What are the methods of formulating budgeting in projects. [4] OR
P.T.O.

i)

b) Q2) a)

i)

b)

Q3) a) b)

b)

Write short notes on following: i) Pre-investment decisions in project. ii) Incentives from government for import-substitution. iii) Project feasibility report formulation. SECTION - II

[18]

Q4) a) b)

Explain various sources for raising finance? [12] Explain impact of local & foreign investment in raising projects.[4] OR Explain Project Apraisal for following aspects. [12] i) Techno commercial. ii) Financial discounted cash flow. When assembling a machine what are the basics points to be observed? ii) Types of lubrication system? In modern machines often the entire gear and other drive components are encased in an oil bath/oil sprinkler system. Explain reasons for the same. What are the various fasteners used in any machine? List at least 8. The cutting action of a Paper cutting machine is -------? Explain the reason for the same. What are the principles of Plant layout? Explain in detail. Prepare a layout for a printing press room with following equipment: Explain the work flow. i) 1.4 colour offset machine 19 x 26 inches. Area of machine is 30 feet by 8.5 feet. CPU unit requires an area of 5feet x 9 feet. Ancillary equipment such as compressor, chilling unit etc occupies an area of 6 feet x 10 feet. i) ii) i)

i) ii)

Q5) a) b)

Q6) a) b)

ii) iii) iv)


[3764]-360

1.4 colour offset machine 30 x 42 inches Area required for the machine is 8 feet x 56 feet Ancilliary equipment requires further 5 feet x 30 feet 2 single colour offset machines 20 x 30 inches area required by the machines 6 x 10 feet I die cutting cylinder machine 25 x 38 inches
2

area required by the machine is 12 feet x 6.5 feet Supervisor cabin 812 x 10 feet Test equipment table 8 feet x 4 feet Storage area for consumeables and spares 12 x 20 feet. Prepare the layout taking into consideration the above equipment providing space for working area and work in process. And additional for sanitary facilities, rest rooms based on the total number of workers that would be needed. Explain how you have arrived at the figures. Layout only as a block diagram space is of no consideration.

EEE

[3764]-360

Total No. of Questions : 06]

[Total No. of Pages : 03

P1521

[3764] - 309 B.E. (Printing)

ASSEMBLY & MAINTENANCE OF PRINTING MACHINES (2003 Course) (408289)


Time : 3 Hours] Instructions to the candidates: 1) 2) 3) All questions are compulsory. Answer any one of each question a or b. Questions 1, 2, 4 and 5 have 16 marks and Questions 3 and 6 have 18 marks. Illustrations / drawings should be made to illustrate. [Max. Marks : 100

SECTION - I Q1) a) i) ii) iii) iv) b) i) ii) iii) iv) Q2) a) i) ii) iii) iv) What are the different types of cams used in printing machines. Where are lead screws used in printing machines. Where are bevel gears used in printing machines and why? What is the function of an air cylinder. What other mechanical component does it replace. In a printing machine speed control systems are used. Explain the reason for the same. What are the types of bearing used in printing machines. Explain the advantage of rolling bearings over sliding bearings. What are the various types of couplings used in printing industry? Where are pneumatic systems used in Printing industry? What are the various mechanical groups of a printing machine? If you do not know the undercut of a machine how would you find out the same? How is the motion on the feeder mechanism on a printing machine changed from vertical to horizontal? What are chain drives commonly replaced with in modern times? Advantage thereof.
P.T.O.

b)

i) ii) iii) iv)

What are the type of dampening systems used in web-fed offset printing machine? Explain any one with diagram. What are the different types of feeding systems used in web offset printing industry? Explain the function of a stream feeder in brief. How is the blanket clamped to the cylinder?

Q3) a)

What is the purpose of daily/routine inspection of a machine? How does it help in keeping the equipment running with minimum mean time between failures?

b)

What is Proactive Maintenance? How can it reduce the incidence of Breakdowns? SECTION - II

Q4) a) b)

What do you understand under Preventive Maintenance? Explain in detail. What is to be observed in Lubrication and care to be taken? Explain the different types of lubricants. i) ii) When assembling a machine what are the basics points to be observed? Types of lubrication systems?

Q5) a)

b)

In modern machines often the entire gear and other drive components are encased in an oil bath/oil sprinkler system. Explain reasons for the same. i) ii) What are the various fasteners used in any machine? List at least 8. The cutting action of a Paper cutting machine is -------? Explain the reason for the same.

Q6) a)

b)

What are the principles of Plant layout? Explain in detail. Prepare a layout for a printing press room with following equipment: Explain the work flow. i) 1.4 colour offset machine
2

19 x 26 inches.

[3764]-309

Area of the machine is CPC unit requires an area of

30 feet by 8.5 feet. 5feet x 9 feet.

Ancillary equipment such as compressor, chilling unit etc. occupies an area of 6 feet x 10 feet. ii) 1.4 colour offset machine Area required for the machine is Ancilliary equipment requires further iii) iv) 2 single colour offset machines area required by the machines I die cutting cylinder machine area required by the machine is Supervisor cabin Test equipment table Storage area for consumables and spares 30 x 42 inches. 8 feet x 56 feet. 5 feet x 30 feet. 20 x 30 inches. 6 x 10 feet. 25 x 38 inches. 12 feet x 6.5 feet. 812 x 10 feet. 8 feet x 4 feet. 12 x 20 feet.

Prepare the layout taking into consideration the above equipment providing space for working area and work in process. And additional for sanitary facilities, rest rooms based on the total number of workers that would be needed. Explain how you have arrived at the figures. Layout only as a block diagram space is of no consideration.

EEE

[3764]-309

Total No. of Questions : 12]

P1522

[Total No. of Pages :3

[3764] - 339 B.E. (Chemical Engineering)


PIPING DESIGN AND ENGINEERING

(2003 Course) (Elective - II)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) A horizontal commercial steel pipeline 100mm in diameter and 400m long carrying gasoline at 40C has a pressure drop of 1.33 105 N/m2. Compute the flowrate when the specific gravity is 0.68. The kinematic viscosity of gasoline at 40C is 4.2 10-7 m2/s. The equivalent sand grain roughness of pipe material is 4.92 10-5 m. [8] Discuss the procedure in determining pipe diameter for specified height of pipe wall roughness and the discharge? [8] OR Q2) a) Derive the following :
n r . Qo Q = n . r . n . Qo 1

b)

[8]

b)

Two pipes each 300mm long are available for connecting to a reservoir from which a flow 0.085 m3/s is required. If the diameters of the two pipes are 0.030m and 0.015m respectively. Determine the ratio of the head of head loss when the pipes are connected in series to the head loss when they are connected in parallal. Neglect minor losses. [8]
P.T.O.

Q3) a) b)

Explain the difference between code and specification?

[6]

List out the major standards providing engineering bodies in piping? Explain most commonly used piping components and their dimensional standards? [10] OR Discuss the various types of gasket according to ASME B16.5 and B16.47 for flanges? [8] Explain in detail the following types of flanges : i) Weld neck Flange ii) Threaded Flange iii) Orifice Flange. [8]

Q4) a) b)

Q5) a)

Describe the construction and principle of operation for the following types of valve actuators : [10] i) Electric motor. ii) Pneumatic. iii) Hydraulic. iv) Solenoid. Discuss the sizing of pressure relief valves for gas or vapor based on the ideal gas law? [8] OR

b)

Q6) a) b)

State and explain two major types of rupture discs made of ductile metal?[10] What are the steps followed during sizing of control valve? SECTION - II [8]

Q7) a)

Explain the sizing of the steam trap with the help of following points:[12] i) Method of heat-up to be employed. ii) Providing suitable reservoirs or collecting legs for condensate. iii) Ensuring adequate pressure differential across the steam trap. iv) Steam trap load safety factor. v) Flow of condensate from the selected trap. Write a note on insulation material selection criteria? OR [4]

b)

[3764]-339

Q8) a)

Explain the concept of deposition velocity for heterogeneous flow of slurry in the pipeline along with different empirical correlations proposed for estimating it? [8] Explain the important considerations required in the overall system design of process Piping? [8] Explain the types of plot plan and their advantages? [8]

b) Q9) a) b)

Discuss the following points for locating the pipe racks of a process unit i) Pipe rack width and number of levels. ii) Elevations and bent spacing. iii) Pipe flexibility, access and maintenance. [10] OR

Q10)a) b)

Develop the piping layout considerations for storage tanks, heat exchangers? [10] What are the plant layout specifications considered by the design engineer? [8] Explain the inadequate and correct pump piping arrangement with the help of graphic information? [8] What are the design criteria used in insulation system design for piping applications? [8] OR Derive the expression for critical thickness of insulation? [8]

Q11)a) b)

Q12)a) b)

What are the most common insulation material classifications to the industrial and commercial piping industry? [8]

kbkb

[3764]-339

Total No. of Questions : 12]

[Total No. of Pages : 3

P1526

[3764] - 360 B.E. (Polymer) POLYMER PROCESSING OPERATIONS - II (2003 Course)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

[Max. Marks : 100

Answer Q.1 or Q.2; Q.3 or Q.4; Q.5 or Q.6 from Section - I Q.7 or Q.8; Q.9 or Q.10; Q.11 or Q.12 from Section - II Figures to the right indicate full marks. Use of pocket calculator log-log paper is allowed. Assume suitable data, if required. Draw neat sketches wherever required.

SECTION - I Q1) a) b) Explain how bridging at Kiss-off points can be avoided by product design in case of rotational moulding. [6] Explain the theory of bubble formation in rotational moulding process. Explain different theories proposed for reduction of bubble size. Discuss also various means of ensuring bubble free rotational moulding processing. [8] Explain the merits of independent arm rotational moulding machine. Give sequence of operations. [4] Explain the effect of initial viscosity and rate of rise of viscosity on process of rotational moulding of liquids. [6] Discuss rotomoulding of nylons using open system and closed system of nitrogen introduction in mould. [6] Explain the information pertaining to process control that can be gained from rotolog of internal air temperature measurement. [6]

c) Q2) a) b) c)

P.T.O.

Q3) a) b) c) Q4) a) b) c) Q5) a) b) Q6) a)

Analyse Forces during calendering. Explain why point of maximum pressure falls prior to nip. [6] With neat sketches explain different types of Z-calenders. Explain the significance of Friction Ratio in calendering. [6] [4]

Using examples of different types of calendering arrangements, explain the concept of floating calenders. [6] Explain various methodologies used for ensuring uniform gauge thickness including roll shape modifications. [4] Draw calendering plant layout for making PVC sheet and explain all major stages involved in the plant. [6] Discuss embossing of thermoplastics. Give processing conditions for at least two plastics. Discuss also embossing faults and remedies. [8] Discuss Gravure printing on plastic films. Draw neat sketch of gravure printing unit. Give advantages and limitations of gravure process. [8] Discuss following terminology with reference to vacuum metallizing. [9] i) First - surface metallizing. ii) Second surface metallizing. iii) Vacuum evaporation & workholders. Discuss electroplating of ABS. Explain use and application of slush moulding. SECTION - II [5] [2]

b) c)

Q7) a) b) c)

Discuss manufacturing of various regenerated cellulosic fibers.

[4]

With a neat flow chart give classification of fibers with suitable examples. [6] Explain melt spinning of fibers with a neat flow chart. Give suitable examples. [6]
2

[3764]-360

Q8) a) b) c) Q9) a) b) c) Q10)a) b) c)

Compare dry and wet spinning of fibers. Write short note on High Speed Melt spinning.

[4] [6]

Discuss post spinning operations like - Drawing, Annealing and texturing. [6] State four Rs of plastic waste management. Give suitable examples.[4] What is tertiary recycling method. List different materials used for tertiary recycling. Explain hydrolysis, glycolysis and alcoholysis for any one.[6] Explain with neat sketch general reclaimation of plastic waste processing. [6] State different types of reactors used for pyrolysis. Explain fluidised bed reactor with neat sketch. [6] Explain separation of PET/PVC waste material. Write short note with reference to waste management. i) Incineration. ii) Land fill. iii) Collection and separation. Write short notes on - (Any three). i) Self tapping screws. ii) Thread forming screws. iii) Laser machining of plastics. iv) Spin welding. v) Hot plate welding. Describe the process of solvent cementing. [4] [6]

Q11)a)

[12]

b)

[6]

Q12)a) Describe the process of ultrasonic welding. Discuss far field and near field ultrasonic welding. [10] b) Discuss theory and mechanism of adhesion bonding. [8]

EEE
[3764]-360 3

Total No. of Questions : 6]

[Total No. of Pages : 2

P1528

[3764]- 373 B.E. (Petroleum Engineering) FORMATION EVALUATION (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answers to the two sections should be written in separate answer books. 2) All questions are compulsory. 3) Draw neat diagrams wherever necessary.

SECTION - I Q1) Describe the principles and commonly used tools in electrical logging with the help of neat figures. [16] OR With the help of a neat figure, explain the logging environment including borehole conditions, temperature, pressure, fluids etc. in an open hole. Explain in brief the wireline logging operation. What are the different effective depths of investigation of electrical and porosity logging tools? Give significance of these different depths of investigations. [16] Q2) Describe the principles and working of any two important porosity determination tools. [16] OR a) What are the advantages of MWD and LWD techniques? Explain the techniques in brief. [10] b) Write a note on applications of core analysis. [6] Q3) Write notes on any three of the following : a) Principles of SP generation in a borehole. b) Mud Logging. c) Production Logging Tool. d) Logs to determine quality of cementation. e) NMR Log. f) Caliper Logs. P.T.O. [18]

SECTION - II Q4) How will you determine clastic depositional environments using logs and log patterns? [16] OR Outline the procedure for determination of water saturation using logs.[16] Q5) Write notes on any two of the following : a) Perforation. b) Cross Plots. c) Significance of clays in formation evaluation. d) DST. OR What are over pressures? How are over pressures determined. Q6) a) Explain Duel Water Model and the Global method. b) Write notes on any three of the following : i) ii) iii) iv) Geosteering. Downhole Production Sampler. Factors influencing rate of drilling, and Detection of fractured reservoir on logs. [16] [6] [12] [16]

xxxx

[3764]-373

-2-

Total No. of Questions : 10]

P1530

[Total No. of Pages :3

[3764] - 401 B.E. (Petrochemical) (2003 Course)

CATALYSIS TECHNOLOGYAND FLUIDIZATION ENGINEERING


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier Charts, electronic pocket calculator and steam table is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Q2) a) b) With the help of neat sketch explain how catalyst changes reaction pathways. [6] Name various means and ways by which a catalyst can be deactivated discuss all of them. [6] Write a short note on homogeneous catalysis. [4]

Derive Langmuir Adsorption Isotherm with help of the important assumptions. [6] For the catalytic gas phase reaction: M + N P, derive the rate expression considering Langmuir- Hinshelwood mechanism in terms of partial pressure of the respective components. Note that all the reactants and products are adsorbed appreciably. If some inert gas Helium is also present, this is also strongly adsorbed on the surface, write down the modified rate expression. [10] A specially designed catalyst with mass of 314.67 gm displaces 102.4 cm3 Helium. The same catalyst sample is reported to displace 134.6 cm3 of Mercury in another study. Calculate pore volume of the sample and particle porosity. [6]
P.T.O.

Q3) a)

b) c) Q4) a) b) c)

Write down important characteristics needed for a catalyst sample to be suitable for industrial applications - Elaborate on each of them. [6] What are the role of catalyst support? Name four catalyst support. [4] What are Zeolites ? Why they are used heavily now-a-days? Discuss the shape selectivity of Zeolites and its applications. [6] Describe any method of catalyst manufacture in details. What is Sintering? Explain with help of neat sketch. [6] [4] [18]

Q5) Write Short Notes on (any four) : a) b) c) d) e) f) Characterization of Catalyst. Adsorption Isotherm. Poisoning of Metal Catalysts. Hydrodesulfurization reactor and its catalysts. Auto Emission Catalysis. Catalyst Regeneration. SECTION - II Q6) a) b) c) Q7) a) b) c) Q8) a) b) c)

Explain the process of fluidization with help of neat diagram. Discuss the minimum superficial gas velocity and its significance. [6] Differentiate between group of particles as classified by Geldart. Provide appropriate examples of each group. [6] Write a short note on quality of fluidization. [4] Discuss all the advantages of fluidized bed system. [6]

With help of rough sketch discuss various types of gas distributor for fluidized bed - Compare their performances. [6] What is pneumatic conveying? Discuss its applications [4]

In a fluidized bed, mixing is combined effort of plug flow and mixed [6] flow mode - Explain with help of neat diagram. Discuss the bubble movement through the fluidized bed. [4] Write down important assumptions of Kuni-Levenspiel model and discuss the model qualitatively. [6] 2

[3764]-401

Q9) a) b)

Explain the principle of immersed tube fluidized bed heat transfer medium. Highlight its advantages and disadvantages. [8] With help of schematic diagrams explain operations of various types of fluidized bed driers. [8] Explain the operation of modern fluidized bed catalytic cracker with help of neat sketch. [6] Discuss Sintering and Aglomeration in fluidization operation. [4] Define: Superficial gas velocity, minimum fluidization velocity, minimum bubbling velocity and minimum slugging velocity. [4] Write down all the major disadvantages faced by fluidization. [4]

Q10)a) b) c) d)

kbkb

[3764]-401

Total No. of Questions : 8]

P1531

[Total No. of Pages :2

[3764] - 403 B.E. (Petrochemical Engineering) PETROLEUM EXPLORATION AND PRODUCTION OPERATIONS (2003 Course) (Elective - II)

Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two sections should be written in separate answer books. 2) Draw neat diagrams wherever necessary. 3) Q.1 and Q.5 are compulsory. Solve any other two questions each from Section - I and Section - II.

SECTION - I Q1) a) b) What happens to each produced barrel of oil in terms of approximate percentage usage in various applications? [6] What are the important events in the history of petroleum industry since 1970s which have affected prices of oil? How has the industry responded to them? [6] Explain different sources of subsurface data in an oil well. [6]

c)

Q2) Explain in brief, how organic matter is transformed into petroleum in a sedimentary basin. [16] Q3) Draw neat figures and explain in brief various types of reservoir traps. [16] Q4) a) b) c) d) Explain different reservoir drive mechanisms with the help of neat sketches. [4] Define different classes of petroleum with respect to (i) API gravity and (ii) Percentage of impurity. [4] What are the important rock properties? How are they determined? [4] What are the essential conditions for the formation of petroleum reservoir? [4]

P.T.O.

SECTION - II Q5) a) b) Explain different types of drilling units used in oil industry for drilling wells onshore and offshore with the help of suitable sketches. [14] What are the functions of land lease department in an E & P Company?[4]

Q6) What are the function of casings? What are the five classes of casing? Explain them in brief. List and explain important casing accessories. How in casing cementation carried out? [16] Q7) a) b) c) d) What are the functions of drilling fluids in an oil well? Explain Seismic Reflection method of oil exploration. With the help of a neat sketch explain the borehole environment. [4] [4] [4]

What are Well Logs? How are they useful in locating hydrocarbons?[4]

Q8) What is artificial lift? Explain important methods of artificial lift mechanisms.[16] OR Explain any four techniques in brief. a) b) c) d) e) Extended reach drilling, MWD, Coiled Tubing in oil wells, Reservoir management, Unconventional synthesis of oil. [16]

kbkb

[3764]-403

Total No. of Questions : 12]

P1532

[Total No. of Pages :3

[3764] - 425 B.E. (Computer)


HIGH PERFORMANCE NETWORKS

(2003 Course)
Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) What is medium independent interfacing? Comment on GMII characteristics. [8] Explain in detail the need of Frame Bursting along with its operation.[8] OR Q2) a) b) Q3) a) b) c) Comment on the various physical medium options available for implementing Gigabit Ethernet. [8] Differentiate between 10Mbps, 100Mbps and Gigabit Ethernet based on various MAC characteristics. [8] Discuss in short the operation of frame handler in a situation where number of users are connected to same frame handler. [6] Discuss various similarities and differences between Frame relay and ATM. [8] Explain the terms FECN and BECN. What is their significance in a Frame relay network. [4] OR Q4) a) An organization has decided to go for an ISDN connection to provide concurrent Internet facility to its 50 users. Discuss the various components required to satisfy the given criteria. Also draw and explain the topology of the network. [8]
P.T.O.

b)

Draw and explain the LAPD Frame format.

[6] [4]

c ) Describe the terms NT2 and T A related to ISDN technology. Q5) a) b)

What are various functions supported by Transmission Convergence Sub layer? Explain HEC operation in detail. [8] Draw and Explain B-ISDN protocol architecture. Which layers are Related to ATM. [8] OR

Q6) a) b)

Explain with a neat diagram the Cell delineation process.

[8]

Define the term Quality of Service. Explain any 4 ATM QOS parameters. [8] SECTION - II

Q7) a)

Explain in detail the working of DSL service. Also draw the diagram indicating how typically customer premises are connected to service provider. [8] Explain the operation of ADSL using DMT (Discrete Multitone). OR [8]

b)

Q8) a) b) Q9) a) b)

Explain the terms ADSL Lite, HDSL, IDSL, and VDSL. Write a short note on Cable Modem. Describe the terms Flowspec and Filterspec related to RSVP. OR

[8] [8] [8]

Which are the 2 primary message types supported by RSVP Protocol?[8]

Q10)a) b)

Draw and Explain the structure of label used in MPLS. What is the range of Label values? Which values are reserved? [8] Describe the following terms related to MPLS operation. i) Label Edge Router (LER). ii) Label Switch Router (LSR). iii) Label Distribution protocol (LDP). iv) Label Switched Path (LSP). 2 [8]

[3764]-425

Q11)a) b) c)

Explain the various security measures that can be applied to secure A WiFi network. [6] Comment on 802.11 b standard. [6] Explain why CSMA/ CD method fails in Wireless networks. What is the solution adapted instead of CSMA/CD. [6] OR

Q12)a) b) c)

Discuss in short about 802.16 and 802.16a standards supported by WiMax. [6] Explain in short any 3 QOS parameters alongwith their suitable applications related to WiMax. [6] Explain the importance of OFDM in WiMax technology. [6]

kbkb

[3764]-425

Total No. of Questions : 12]

[Total No. of Pages : 02

P1534

[3764] - 438 B.E. (IT) SYSTEM OPERATIONS & MAINTENANCE (2003 Course) (414448)

Time : 3 Hours] Instructions to candidates:

[Max. Marks : 100

1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) Explain the benefits when advanced support systems are deployed by the Telecom service provider. [9] With a short description explain the support processes related to order processing and provisioning process. [9] OR With a short description explain the network operational management process. [9] Explain service delivery cycle with neat diagram. [9] Explain. i) Permanent virtual circuits. ii) Switched virtual circuits. iii) Semipermanent virtual circuits. Explain the concept Local number portability OR [8]

b)

[8]

P.T.O.

Q4) (a) Explain with neat diagram topology of SS7 network. (b) List and explain QOS factors of IP based services and products. Q5) a) b) Q6) a) b) Explain in detail web switching. With a neat diagram explain directory enabled networking. OR Explain in detail policy based networking. With a neat diagram explain MPLS. SECTION - II Q7) a) b) Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b)

[8] [8] [8] [8] [8] [8]

Compare and constrast X.25 usage. [8] Explain ISDN. [8] OR Explain the significance of frame Relay services as one of the alternatives of fast packet switching. [8] Explain ATM. [8] With a neat diagram discuss TMN physical architecture and interfaces.[8] List the goals of telecommunication service providers with middleware.[8] OR Draw a neat diagram of structure of SNMP based management services and list the strengths and weakness of SNP. [8] Write a note on common Information model. [8]

Explain Internet billing. [9] Discuss the significance of periodic security audit for a telecommunication service provider. [9] OR Q12)a) Write a job profile of typical network operation manager. [9] b) What is SLA? List some service dependent and service independent metrices for the same. [9]

EEE

[3764]-438

Total No. of Questions : 12]

P1540

[Total No. of Pages :3

[3764] - 282 B.E. (Instru.)


PROJECT ENGINEERING & MANAGEMENT

(1997 & 2003 Course)


Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Assume suitable data if necessary. 5) All questions are compulsory.

SECTION - I Q1) a) Draw ISA symbols used in P & ID Diagram. i) ii) iii) iv) v) b) Two way valve fail close. Vacuum relief valve. Pressure reducing regulator with external tap. Level regulator with mechanical linkage. Flow element in line. [10]

State the chronological steps in development of Project engineering document. [6] OR

Q2) a)

Draw ISA symbols used in P & ID Diagram. i) ii) iii) iv) v) Pneumatic signal line. Ultrasonic guided signal. Shared signal from field to control room. Bias. High selector & High Limiter (SAMA) Symbol.

[10]

b)

List & Explain different categories of the Project.

[6]

P.T.O.

Q3) a)

Draw the Temperature Control Loop. Give naming convections for i) The Loop. ii) For the instruments as per ISA.

[4] [2] [2]

b) c) Q4) a) b)

Prepare an Instrument Index Sheet for the Loop Drawn in Q.No. 3a.[4] Prepare the Specification Sheet in S-20 format for Thermocouple. [6] OR Explain the loop wiring diagram in Project Engineering. Support your answer with two examples. [10] Draw the Level Control Loop. Give naming convections for i) The Loop. ii) For the instruments as per ISA. [4] [2] [2]

Q5) a) b) Q6) a) b)

What are different types of Cables used in Plant instrumentation? Suggest suitable cables for Analog Signal & Data Signal justify your selection.[8] What is IOI? Explain the term networking with respect to IOI. OR Prepare BOM for the Temperature Transmitter. [8] Explain the importance of Plant Layout & GA drawings for Instrument Project Engineering. [8] SECTION - II [8]

Q7) a) b) Q8) a) b) Q9) a) b)

Enlist & Explain in Brief the documents required for commissioning activity. [8] Explain the Vendor Registration process. State its need. OR What are the key points required to be considered while issuing the PO to the Supplier. [8] Prepare CAT for any Control Panel. Prepare Typical Inspection report for the Control Panel. Write short note on CPM & PERT? 2 [8] [9] [9] [8]

[3764]-282

OR Q10)a) b) Draw & explain the control room layout with certain considerations.[9] Draw & explain the Installation of DP transmitter. [9] [16]

Q11)Write brief notes on : a) b) c) d) WBS. Crash Time Concept. SOW. Project Estimates. OR Q12)a) Explain the following Standards in brief. i) ii) iii) iv) b) ISA. API. SAMA. NEMA.

[8]

Explain Gant Chart in detail.

[8]

kbkb

[3764]-282

Total No. of Questions : 11]

[Total No. of Pages : 3

P1555

[3764]-137 B.E. (Mechanical) ALTERNATIVE ENERGY SOURCES (2003 Course) (Elective - I) (402045)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

Answer three questions from Section - I and three questions from Section - II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator is allowed.

SECTION - I Q1) a) Describe the solar chimney power plant and state its practical limitations.[8] b) Calculate the hour angle at Sunrise and Sunset on June 10 and December 21 for a surface inclined at an angle of 10 and facing due south. The surface is located in Sangli (17 N, 75 E). [8] OR Q2) a) Write a note on low temperature power generation cycle using flat plate collectors. Also write the experimental investigations in India. [8] b) Explain the following terms in solar radiation geometry with suitable diagrams. [8] i) Lattitude. ii) Declination. iii) Surface Azimuth Angle. iv) Hour Angle. Q3) a) Explain how transmissivity of the cover system of a collector can be obtained. [8] b) Write a note on passive space heating by solar energy. OR [8]

P.T.O.

Q4) a) Write a note on - Effects of various parameters on liquid flat plate collectors efficiency. [8] b) Estimate Hourly beam, diffuse and global radiations by ASHRAE model using following data : [8] Location : Nagpure (21 06 N, 79 03 E). Day : June 19, 1968. Time : 0900-1000 h (LAT). Constants : A = 1092 w/m2, B = 0.185, C = 0.137 Q5) a) Write advantages of concentrating solar collectors and explain any one in details. [8] b) Explain the principal of working of solar ponds. Write experimental investigations on solar ponds in India. [10] OR Q6) Write notes on : a) Solar stills. b) Materials used for solar collectors. c) Heliostats. SECTION - II Q7) a) Derive an expression for efficiency of propeller type wind turbine. Also find limiting value of efficiency of wind turbine. [8] b) Write a note on solar photovoltaic cell. OR Q8) a) Explain different types of wind mills. b) Write a note on micro Hydel power plants. Q9) a) Explain various types of geothermal power plants. [8] [8] [8] [8] [18]

b) Explain suitable site requirements for tidal energy power plants. Which Indian costal regions are suitable for tidal energy power plants. [8] OR Q10) a) How ocean thermal energy power plants works? b) Explain different types of fuel cells? Explain working of any one. [8] [8]

[3764]-137

Q11) Write a note on any three of following : a) Dome type biogas plant. b) Biomass gasification. c) Environment protection norms ISO 14000. d) Biogas for diesel engine.

[18]

[3764]-137

Total No. of Questions : 6]

[Total No. of Pages : 3

P1558

[3764]-206 B.E. (Electrical) POWER QUALITY (2003 Course) (Elective - I) (403143)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6) 7)

Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Your answers will be valued as a whole. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Which are the various stake holders of power quality. Explain various terms of power quality with reference to various stake holders. [6] b) Why power quality issues are becoming important in todays context.[6] c) Explain EMC and emission, immunity terms. OR a) Classify the EMC phenomena as per IEEE std 1159. [10] b) Explain grounding practices recommended by IEEE std 1100 for sensitive electronic equipments. [6] Q2) a) Explain various RMS voltage variations with the help of graphical representation as per IEEE 1159 standard. [10] b) Explain short term (pst) and long term (plt) flicker indices. OR a) Explain flicker, its causes, effects and variation and means to reduce flicker. [12] b) Explain in detail impact of reactive power flow on RMS voltage variations. [6] [8] [4]

P.T.O.

Q3) a) Explain various voltage sag indices.

[6]

b) What is Area of vulnerability. Explain detailed procedure for assessment of equipment sensitivity to voltage sag. [10] OR a) Explain in detail the following voltage sag mitigation devices i) DVR ii) SMES iii) CVT. [10] b) Explain various characteristics of voltage sag. SECTION - II Q4) a) Result of Harmonic Measurement at industrial site is tabulated in following table. [8] Harmonic 1 2 3 4 5 6 7 8 9 10 11 12 order Ind. voltage 400 3.00 4.00 2.00 15.00 1.00 7.00 0.70 1.5 0.6 3.0 0.5 Harmonic Mag. (v) Ind. current 50 2.00 3.00 1.00 6.00 0.8 4.00 0.6 1.2 0.3 1.1 0.3 Harmonic Magnitude (Amp) Calculate following Harmonic indices i) % individual current and voltage harmonic distortion from 2nd order to 12th order ii) % iii) % b) Write mathematical relationship for various A.C. quantities under non sinusoidal conditions. [8] OR a) Explain in detail K-rated transformer. [8] b) Explain Harmonic series resonance and consequences of harmonic resonance. [8] Q5) a) Explain various sources and effects of impulsive and oscillatory transients. [8] b) Explain capacitor switching transients and various factors governing magnification of capacitor switching transient. [8]
[3764]-206 2

[6]

OR a) Explain basic principle of over voltage protection and various devices used for over voltage protection. [10] b) Explain transient velocity, surge impedance and the effect of line terminations. [6] Q6) a) Explain various approaches followed in power quality monitoring with its advantages and disadvantages. [8] b) Explain the factors governing selection of power quality monitor and various equipments used for monitoring power quality parameters. [10] OR a) Explain various voltage and current transducers used for power quality monitoring. [12] b) Explain various power quality monitoring objectives. [6]

[3764]-206

Total No. of Questions : 12]

[Total No. of Pages : 3

P1561

[3764]-284 B.E. (Instrumentation & Control) BIOMEDICAL INSTRUMENTATION (1997 & 2003 Course) (Elective) (406264)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

Answer three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain Electrode offset potential? How effect of electrode offset potential is overcome. Explain the various properties that bio-electrode should possesses. [8] b) Define bio electrode. Name various types of basic bio electrodes used for bioelectric potential measurements. Explain the necessity of microelectrode, Micropipette electrode. [8] OR Q2) a) Define and discuss the term Biosensors. [6] b) What is a half cell potential? Draw and explain electrical equivalent circuit of electrode jelly and Tissue. [8] c) What are the important of use of Electrolytic Jelly at the skin-electrode interface? [2] Q3) a) Explain in detail the pumping action of the heart and the genesis of ECG waveform. [8] b) Discuss the various ECG leads configuration in detail. OR [8]

Q4) a) List out various bioelectric preamplifiers. Explain chopper amplifier in detail. [10] b) Draw and explain Heart Rate meter. [6]

P.T.O.

Q5) a) Enlist two important techniques used in sphygmomanometer BP measurement. Explain the same method of BP measurement along with its advantages and disadvantages. [10] b) List out various methods used for cardiac output measurement. Explain indicator dilution method with dilution curve. [8] OR Q6) a) Explain electromagnetic blood flow measurement with neat diagram. [8] b) Discuss Doppler shift Ultrasonic blood flow measurement along with neat diagram. [8] c) List out the microphones used in phonocardiograph. SECTION - II Q7) a) What is EEG? Enlist various illness and diseases for which EEG is effectively used. Explain the EEG montage system. [10] b) Explain the various types of EEG Electrodes. OR Q8) a) Draw and explain various parts of Brain stem. b) Draw and explain the structure of neuron. c) Define efferent and afferent nerves? [8] [6] [2] [6] [2]

Q9) a) Enlist various ophthalmic instruments & briefly explain instrument used for measurement of IOP. [10] b) Explain the various vision errors in human vision system and also explain the way of elimination of the same. [4] c) Suggest suitable devices that are used to recover the percentage losses in EAR or EYE, if some residual capacity has been remain with these organs. [2] OR Q10) a) Define a Hearing threshold. Explain the speech audiometer and pure tone audiometer. [10] b) What are three main sections of Human auditory system? Explain the impedance matching in human hearing phenomenon. [6]

[3764]-284

Q11) a) Explain Wedge Spiro meter for respiratory measurement. Explain the following terms with respect to respiratory measurement. [10] i) RV. ii) ERV. iii) TLC. iv) TV. b) Why inspired and expired gas analysis is of great importance. Draw and explain Thermal conductivity analyzer. [8] OR Q12) a) State the condition of patient at which support of ventilator is essential? What is role of nebulizers and aspirators in ventilator? [10] b) Explain the various methods of accident prevention in medical equipments. [8]

[3764]-284

Total No. of Questions :12]

[Total No. of Pages : 3

P1562
[3764]-286 B.E. (Instrumentation & Control) LASER APPLICATIONS IN INSTRUMENTATION (Elective - I) (2003 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answer three questions from section I and section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Use of electronic pocket calculator is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Explain the importance of Einsteins equations in emissions of radiation. [8] Explain in detail the process of emission and absorption of radiation.[8] OR Q2) a) b) State the different processes due to which the small gain coefficients of laser get affected. [8] Write short notes on : i) ii) Q3) a) Laser modes. Q switching. [8]

What is different laser system features which are applicable to most commercial and industrial lasers? Explain each in short. [12] Estimate the efficiency of a GaAs laser operating well above threshold. The refractive index of material is 2.6 and laser cavity length is 0.3 mm. The loss coefficient is 900 per metre length and the internal quantum efficiency is 0.8. [6] OR P.T.O.

b)

Q4) a) b) c)

Explain the construction and working of diode laser. How the laser products are classified for safety standards?

[8] [4]

Calculate the threshold pumping power of a Nd: Glass laser for critical population inversion of 10 10 21/m3 and spontaneous life time of 200 s. The upper level is at energy of 1.6eV. [6] Describe how Fabry-Perot interferometer is used with small coherent length source for displacement measurements. [8] What is Speckle Pattern? Describe subjective and objective speckles. [8] OR Describe the dynamic tracking of speckle pattern for displacement measurements. [8] Describe the properties of speckle pattern in short. SECTION - II [8]

Q5) a) b)

Q6) a) b)

Q7) a) b)

Explain the principle of operation of Laser vibrometer.

[8]

Compare the two options for the electronic processing of the Doppler signal? [8] OR Explain the frequency domain processing of Doppler signal in detail.[8] Discuss the performance parameters of operation of laser velocimeter? [8] Explain the Sagnac effect? Show how is the phase shift is proportional to the angular velocity. [8] Explain the components required for all fiber FOG configuration. OR [8]

Q8) a) b) Q9) a) b)

Q10)a) b)

Show that the frequency of the sagnac signal in RLG is proportional to the angular velocity of rotation. [8] Explain in detail the Fiber Optic Gyroscope. [8]

[3764]-286

Q11)a) b)

Write a short note on Holographic Interferometer.

[9]

What are different emulsions used to record the holograms? Mention the characteristics of it. [9] OR A thin strip of the hologram undergoing stress parallel to the x-axis is illuminated by a He-Ne laser. The fringes are localized in a plane having slope of 1.6 per unit length in x-direction and the fringe spacing is found to be 2 mm. Hence find the strain. [8] Explain the any one applications of holographic interferometer that you know. [10]

Q12)a)

b)

####

[3764]-286

Total No. of Questions :12]

[Total No. of Pages : 3

P1564
[3764]-327 B.E (Chemical Engineering) II ENERGY CONSERVATION (2003 Course) (Elective - I)
Time :3 Hours] Instructions to the candidates: 1) Answers any three questions from each section. 2) Neat diagrams must be drawn wherever necessary. [Max. Marks : 100

SECTION - I Q1) a) b) Describe the method of solar drying? Discuss the factors considered for the design of solar dryer? [10] Wind at 1 standard atmospheric pressure and 15C has a velocity of 15 m/s Calculate : i) ii) iii) The total power density in the wind stream. The maximum obtainable power density. A seasonally obtainable power density.

iv) The total power. v) The torque and axial thrust. Given : Turbine diameter : 120m, and turbine operating speed = 40rpm at maximum efficiency. Propeller type wind turbine is considered. [8] OR Q2) a) b) Q3) a) Enlist the various methods of solar energy storage. Explain in detail thermal energy storage system. [10] Discuss the tidal and geothermal energy in detail? [8]

Explain the role, types design and material of absorption plate in solar flat plate collector. [8] P.T.O.

b)

Explain the various zones of gasification along with temperature; Explain its significance? [8] OR

Q4) a) b)

Explain the various nuclear reactions for energy generation?

[6]

What are different methods of biochemical energy generation? Discuss their advantages and disadvantages? [10]

Q5) What are the types of recuperators for waste heat recovery? Explain any two in detail? [16] OR Q6) a) b) Define heat regeneration; Explain the principle of heat generation with suitable example? [8] Incineration is the last resource in waste management. Discuss the incinerator is a energy recycle device. [8] SECTION - II Q7) a) b) Explain condensate heat recovery reduces boiler fuel consumption? Describe with neat sketches different condensate recovery systems?[10] Explain energy performance assessment of Heat exchanger? OR Q8) a) b) Q9) a) b) Justify that steam trap are energy conservation devices. Explain with the help of proper diagram. [8] Explain the co-generation system with the help of different types of cycles. [10] Justify that pressure reducing valves (PRV) are energy conservation devices. Explain with the help of proper diagram. [8] Explain the energy conservation Act of Gov. of India. OR Q10)a) b) Justify that steam economisers in a boiler are energy conservation devices. Explain with the help of proper diagram. [8] Explain the consumption and conservation of energy in cement industry? [8] 2 [8] [8]

[3764]-327

Q11) Distinguish between Macro Audit and Micro Audit. Write down the steps followed for carrying out energy audit of plant along with detailed flow chart? [16] OR Q12) Write short notes on (Any two) : a) Sanky diagram and its use. b) Fluidized bed combustion. c) Optimizing the energy input requirement. [16]

####

[3764]-327

Total No. of Questions :12]

[Total No. of Pages : 3

P1570
[3764]-434 B.E. (I.T.) BIO - INFORMATICS (Elective - I)
Time :3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Explain the Central Dogma of Molecular Biology. Explain the Gene Mapping Process in detail. OR Q2) a) b) Explain the odds-likelihood form of Bayes Theorem and explain any two limitations of Bayes Theorem? [8] The probability of a patient having a particular genetic disease is 0.5. calculate the pretest odds? If the Likelihood ratio is given as 2.75, calculate the post-test odds? Find the probability of the patient suffering from the genetic disease? [8] Explain Microarray Spotting Process Flow? [8] [8] [8]

Q3) a) b)

What is Clustering? Explain Hierarchical Clustering. Explain K-means clustering? [8] OR

Q4) a)

For the given fluorescence data as x[n] in the table below, calculate mean, standard deviation and variance? [8] n x [n] 1 3.2 2 1.6 3 4.4 4 3.3 5 2.7 6 1.7 7 6.8

P.T.O.

b) c) d) Q5) a)

Explain the concept of True Positives, True Negatives, False Positives and False Negatives. [4] Explain the concept of Sensitivity and Specificity along with the formulae. [2] Explain the concept of Receiver Operating Characteristics. Discuss following data mining methods in detail : i) ii) iii) Classification. Regression. Link Analysis. [2] [10]

iv) Deviation Detection. b) v) Segmentation. Explain and differentiate Pattern Recognition from Pattern Discovery. [8] OR Q6) a) Explain following terms : i) ii) Genetic Programing. Neural Networks. [16]

iii) Hidden Markov Models. b) iv) Decision Trees. Explain Inductive Logic Programming? SECTION - II Q7) a) For the given two nucleotide sequences calculate the alignment score. Use gap penalty of (- 0.5) per gap. Assuming opening cost and extension cost of (- 0.5) each calculate the penalty gap, using this also calculate expanded gap penalty. [12] Sequence 1 : ATTCGGCATTCAGAGCTAGA Sequence 2 : ATTCGACATT----GCTAGTGGTA b) Given A =[2 3 8 4 1] and B=[9 11 1 0 2 4 5 6 7 3 2], calculate Max Value = f(A1, Bi), where, i=1, 2,....., 11. OR [3764]-434 2 [6] [2]

Q8) Explain following in brief : a) b) c) d) DNA Probes. Genetic Markers. Applications of genetic engineering. Polymerase chain reaction.

[18]

Q9) BLAST and FASTA are two widely used tools for sequence alignment. Explain the similarities and differences in their approach. [16] OR Q10)a) What is an E-value? You do a databank search using FASTA with an amino acid sequence as a query. The only reported match has an E-value of 10. What does this mean for the similarity of the two sequences? [8] Explain PSI-BLAST with the schematic. List any four applications for which PSI-BLAST can be used. [8]

b)

Q11) Explain the concept behind Collaboration and Communication. Explain clearly the hierarchy. [16] OR Q12) a) What is the significance of Biotechnology? [8] b) Discuss various factors that are responsible for degradation of ecosystem. [8]

####

[3764]-434

Total No. of Questions :10]

[Total No. of Pages : 2

P1587
[3764]-1025 B.E (E&TC) RADIATION & MICROWAVE TECHNIQUES (1997 Course)
Time :3 Hours] Instructions to the candidates: 1) Answer any three questions from each section. 2) Neat diagrams must be drawn wherever necessary. 3) Assume suitable data, if required. [Max. Marks : 100

SECTION - I Q1) a) b) What are the advantages of waveguide over coaxial cable at microwave frequencies? [8] An air field rectangular waveguide of inside dimensions 7 3.5 cm operates in the dominant mode TE10 i) ii) iii) Q2) a) b) Q3) a) b) Q4) a) Find the cut-off frequency. Determine the phase velocity of wave in the guide at 3.5 GHz. Determine the guided wavelength at the same frequency. [8] [8] [8] [8] [8]

Explain two hole directional coupler and its S parameters. Explain four port circulator and S parameters. With the help of diagram explain two cavity Klystron amplifier. Explain bunching of electrons in reflex klystron.

With the help of VI characteristics explain operation of Gunn diode. [8] [8]

b) Explain LSA mode of operation of GUNN diode. Q5) Write short notes on : a) b) c) Waveguide bends. Waveguide isolator. Magnetron.

[18] P.T.O.

SECTION - II Q6) a) b) Explain the principle of Cassegrain feeding mechanism used for parabolic reflector. [8] Explain following antenna parameters. i) ii) iii) iv) Q7) a) b) Q8) a) b) Q9) a) Radiation pattern. HPBW. Near field and far field. Directivity and power gain.

[8]

With the help of Block diagram explain operation of pulsed Radar. [8] What is Doppler effect? How it is used in RADAR. What is VSWR? How it is measured? [8] [8]

Explain the set-up for the measurement of impedance at microwave frequencies. [8] Give the applications of following devices : i) ii) iii) iv) PIN diode. Bolometer. Gunn diode. Lens antenna. [8] [8]

b)

Explain how a parametric amplifier works.

Q10)Write short notes on : a) b) c) Microwave power measurement. Industrial applications of microwave. Microstrip- antenna. [18]

####

[3764]-1025

Total No. of Questions :12]

[Total No. of Pages : 3

P1593
[3764]-332 B.E. (Chemical) PROJECT COSTING & APPRAISAL (409349) (2003 Course)
Time :3 Hours] Instructions to the candidates: 1) Answer any three questions from each section. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Assume suitable data, if necessary. [Max. Marks : 100

SECTION - I Q1) a) Give difference between market survey and market research. b) Explain with graph, break even analysis. OR Q2) Write note on : a) Techno economic feasibility. b) Factors of production. c) Supply and demand. d) Margin. Q3) a) Explain the statement of income and expenditure. b) What is ratio analysis, explain different types of ratio. OR Q4) a) Explain with diagram, accounting procedure in industry. b) Describe the balance sheet with all assets and liabilities? [8] [8] [8] [8] [16] [8] [8]

P.T.O.

Q5) a) Explain basic factors involved in equipment costing? b) Explain different cost indices used in equipment costing? OR

[8] [10]

Q6) a) Explain different methods for estimating capital investment. [10] b) Explain prime cost and overhead cost. SECTION - II Q7) a) What are different methods of raising finance, explain each. b) Explain different types of interest rate with suitable example. OR Q8) Write note on : a) Fixed capital. b) Working capital. c) 6/10 factor rule. d) Insurance. Q9) a) Explain in detail discounted cash flow diagram. b) Discuss the concept of marginal additional investment. OR Q10) The annual direct production costs for a plant operating at 70% capacity are Rs. 2,80,000/-. While the sum of the annual fixed charges, overhead costs, and general expenses is Rs. 2,00,000/-. What is the break-even point in units of production per year if total annual sales are Rs. 5,60,000/- and the product sells at Rs. 40/- per unit? What were the annual gross earnings and net profit for this plant at 100% capacity if corporate income taxes required a 15% tax on the first Rs. 50,000/- of annual gross earning, 25% on annual gross earning of Rs. 50,000/- to Rs. 75,000/-, 34% on annual gross earning above Rs. 75,000/- and 5% on gross earning from Rs. 1,00,000/- to Rs. 3,35,000/-?[16] [10] [6] [16] [8] [8] [8]

[3764]-332

Q11) a) Define depreciation and discuss its need and significance? b) Discuss various methods of determing depreciation charges. OR

[8] [10]

Q12) The original value of a piece of equipment is Rs. 22,000/-. Its salvage value is Rs. 2,000/- at the end of a service life estimated to be 10 years. Determine the asset value of the equipment at the end of each year using. i) Straight-line method. ii) Declining-balance method. iii) Double declining balance method. Plot graph of asset value with service life. [18]

####

[3764]-332

Total No. of Questions : 12]

[Total No. of Pages : 2

P1594

[3764]-341 B.E. (Chemical) PETROCHEMICAL ENGINEERING (2003 Course) (Elective - II)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5)

Answer three questions from Section I and three questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) What are petrochemicals? [4] b) Discuss in details the scope for expansion of petrochemical industry worldwide. [12] OR Q2) What are various types of Crude Oil Distillation? Draw neat process diagram for synthesizing naptha, diesel oil and lubricants. [16] Q3) Enlist applications of aromatics. Explain in details any one method for production of aromatics. [16] OR Q4) Discuss and draw various unit operations and processes for production of Napthalene. [16] Q5) Discuss in details the separation and purification techniques used in petrochemical industry. [18] OR Q6) With neat sketches, explain Catalytic Cracking. SECTION - II Q7) Draw diagrams with details for production of amines. OR [16] [18]

P.T.O.

Q8) Explain in depth the production of Ethylene Glycol by combining olefins and aromatics. [16] Q9) Write short notes on various types of polymerization processes. OR Q10) Explain with suitable sketches the manufacture of a polymeric product.[16] Q11) Discuss and propose suggestions on the methodology for integration of refinery and a petrochemical plant for power generation. [18] OR Q12) Describe the pollution control norms for a petrochemical plant. What are various pollution reduction measures? [18] [16]

[3764]-341

Total No. of Questions : 8]

[Total No. of Pages : 2

P1596

[3764]-392 B.E. (Petrochemical Engineering) PETROCHEMICAL PROCESSES (2003 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Answer any three questions from each section. Answers to the two sections should be written in separate answer books. Figures to the right indicate full marks. Neat diagrams must be drawn wherever necessary.

SECTION - I Q1) a) Describe with flowsheet the process for conversion of toluene to benzene by Hydrodealkylation. [12] b) Write a note on, Autothermal Reactor. c) Mention end uses of Bisphenol-A and Acetic Anhydride. [3] [3]

Q2) a) Describe with flow sheet the Nippon Zeon process for separation of [12] butadiene from steam cracked C5 cut. b) Mention end uses of ethylene oxide and formaldehyde. [4] Q3) a) Describe the process of steam reforming for production of hydrogen.[10] b) Elaborate on, Xylene Isomerisation. c) Mention end uses of acrylonitrile. [4] [2]

Q4) a) Describe with flow sheet the BASF process for manufacture of isoprene [12] from steam cracked C5 cut. b) Explain the role of steam in steam cracking of naphtha. SECTION - II Q5) a) Describe with flow sheet the oxidation dehydrogenation process for conversion of methanol to formaldehyde. Mention applications of formaldehyde. [12] b) Explain the process for preparation of nylon 66. [6] [4]

P.T.O.

Q6) a) Mention end uses of styrene and ethylene glycol.

[4]

b) Describe with flow sheet the Sohio process for conversion of propylene to acrylonitrile. Mention health and handling precautions for acrylonitrile. [12] Q7) a) Describe with flow sheet how ethylene can be converted to polyethylene by low pressure Ziegler process. [10] b) Mention health and handling precautions and applications of butadiene.[6] Q8) Write short notes on following (Any 4) : a) Types of Polymerization. b) Manufacture of LDPE. c) Thermoplastics and Thermosets. d) Manufacture of HDPE. e) Feedstocks other than Petroleum. f) Styrene Butadiene Rubber. [16]

[3764]-392

Total No. of Questions : 10]

[Total No. of Pages : 2

P1597

[3764]-457 B.E. (Biotechnology) PHARMACEUTICAL BIOTECHNOLOGY (2003 Course) (Elective - I) (416281) (Semester - I)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Answer three questions from Section I and three questions from Section II. Answers to the two sections should be written in separate answer books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks.

SECTION - I Q1) Write in detail different routes of drug administration. Explain various types of dosage forms along with the example. [18] OR Q2) Explain in detail controlled and modified release dosage forms. [18]

Q3) What is Kinetics of drug absorption? Explain the method of residual (feathering curve) and Wagner nelson method. [16] OR Q4) a) Explain the terms Bioavailability. Enlist methods of determination of bioavailability. [8] b) Write in detail factors affecting drug elimination. Q5) Write short notes. (Any Two 8 marks each) a) Mechanism of NSAIDs. b) Tablet Evaluation tests. c) Accelerated stability testing. d) Target oriented drug delivery system. [8] [16]

P.T.O.

SECTION - II Q6) Write in detail about acute and chronic toxicity. Add note on Toxicity testing. [18] OR Q7) Explain in detail various Phases involved in Clinical trials. [18]

Q8) a) Write in detail about structure-activity relationship (SAR) and Quantitative SAR (QSAR). [12] b) Explain the Target-structure based drug discovery. OR Q9) a) Explain in detail food, drug and cosmetic act. b) Write note on Allergic reaction to the drugs. Q10) Write short notes. (Any Two 8 marks each) a) IPR. b) ICH guidelines. c) In-silico drug discovery. d) Antidotes. [12] [4] [16] [4]

[3764]-457

Total No. of Questions :10]

[Total No. of Pages : 2

P1601
[3764]-1044 B.E. (Electronics) MICROWAVE TECHNIQUES (404205) (1997 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks.

SECTION - I Q1) a) b) Q2) a) b) State and explain the principle of operation of two-cavity klystron amplifier. [8] What is GUNN EFFECT? State the microwave generation and amplification using Gunn diode? [8] Draw a neat sketch of E-plane tee, H-plan tee and magic tee. Write S parameter matrix of each. [8] Draw a neat sketch of Directional Coupler. State the spacing between the centers of two holes of two hole directional coupler. Explain how the wave energy is propagating through it. [8] State and explain the principle of operation of helix traveling wave tubes. [8] State the physical structures and principle of operation of microwave Transistors. [8] With the help of voltage and current waveforms explain the principle of operation of TRAPATT diodes. [8] State the characteristics of IMPATT diodes. Explain the negative resistance. [8]

Q3) a) b) Q4) a) b)

P.T.O.

Q5) Write short notes on any three of the following : a) b) c) d) e) Masers. Magnetron. Cavity resonators. Reflex Klystron. Modes in rectanguler waveguide. SECTION - II Q6) a) b) Q7) a) b) Q8) a) b) Q9) a) b) State and define any three antenna parameters. State the principle of operation of reflector antenna. [8] [8] [18]

State the difference between Aperture antenna and Horn antenna. [8] Draw a block diagram of experimental setup of measurement of microwave power and explain its procedure. [8] With the help of block diagram explain the working of CW Radar. What is DOPPLER EFFECT? Where and how is it used? Explain use of Microwave in health care. [8] [8] [8]

Explain the terms Synchronous Orbit, Polar Orbit, Inclined Orbit. [8]

Q10)Write short notes on any three of the following : a) b) c) d) e) Pulsed Radar system. Plan _Position indicator. TV relay. Lens antenna. Cassegrein feed.

[18]

####

[3764]-1044

Total No. of Questions : 10]

[Total No. of Pages : 2

P1604

[3764] - 1056 B.E. (Electronics) VLSI DESIGN (1997 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Use of electronic pocket calculator is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) b) Draw the primitive building blocks of CPLD. Explore each block in detail. [12] Compare CPLD & FPGA in brief. [4]

Q2) Draw FSM diagram for decade counter. Write VHDL code and Test bench.[16] Q3) a) b) Explain inertial, delta & wire delays in detail. Write VHDL code for 8 bit shift register for SIPO operation. [8] [8]

Q4) Draw & explain high level ASIC design flow in detail. Mention the input & output files in each step. [16] Q5) Write short notes on (any three): a) Passive process. b) Interconnect matrix. c) Power dissipations in CMOS. d) Voltage transfer curve of CMOS Inverter. e) Power delay product. [18]

P.T.O.

SECTION - II Q6) a) b) Q7) a) b) Q8) a) b) What are the types of test benches? Explain with examples. Explore any two attributes in VHDL with suitable examples. What are the advance tools for synthesis? Write VHDL code for full adder by structural modeling. [8] [8] [8] [8]

Design CMOS logic for Y = AB + CDEF. [8] Explain static & dynamic power dissipations. Give mathematical analysis. [8]

Q9) Write VHDL code for FSM of Tea/Coffee vending machine. Assume suitable inputs & outputs. Also write full test bench for it. [16] Q10)Write short notes on (any three): a) I/O Block in FPGA. b) MOSFET Parasitics. c) JTAG. d) Macrocell. e) Architectural modelling. [18]

EEE

[3764]-1056

Total No. of Questions : 10]

[Total No. of Pages : 02

P1605

[3764] - 1064 B.E. (Industrial Electronics) INDUSTRIAL INSTRUMENTATION (1997 Course)

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks.

[Max. Marks : 100

Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed.

SECTION - I Q1) a) Define the following: [10] i) Neutral zone. ii) Set point. iii) Proportional band. iv) Rate gain. v) Control Lag. Explain PID control for the temperature control application in detail. [8] Discuss different types of isolation circuits and compare. Describe the Ziegler - Nichols method of tuning PID. [8] [8]

b) Q2) a) b) Q3) a) b)

With a neat sketch explain the operation of current to pressure converter.[8] In a proportional temperature control, input range is 4-20 mA and output varies from 40C to 50C. When input is 10 mA output is set at 35C. When set point is changed to 37C, input current required is 8 mA. Calculate proportional band of the controller. If the proportional band is adjusted to 120% how much is the input current required to set temperature at 38C. Assume linear control. [8]
P.T.O.

Q4) a) b)

Explain different types of lags in a process. Describe the selection criterion for the control valves.

[8] [8] [16]

Q5) Write short notes (any three): a) Magnetic shielding and cabling. b) Ratio control system. c) ISO 9000-9001. d) Adaptive control. SECTION - II Q6) a) b) Q7) a) b) Q8) a) b) Q9) a) b)

Design a PD controller using Op-Amp. Derive the equation for the output. [8] Draw a PLC ladder diagram for the control of traffic signal lights. [8] With a neat block diagram explain the hardware of microprocessor based PLC. [8] With suitable example explain the significance of data acquisition control. [8] Explain the instrumentation involved in pollution control. Explain cascade control for controlling level in a tank. Give differences between RTD and thermocouple. With a neat sketch explain the construction of pneumatic valve. [8] [8] [8] [8] [18]

Q10)Write short notes (any three): a) Optical fiber in instrumentation. b) Actuator. c) Grounding and shielding. d) Supervisory control.

EEE

[3764]-1064

Total No. of Questions :10]

[Total No. of Pages : 2

P1606
[3764]-1066 B.E. (Industrial Electronics) OPTO - ELECTRONICS (1997 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) b) Classify the opto-electronics devices and explain the bulk photo detector. [8] What are different types of opto-couplers? How to select opto coupler for specific application? [8] With neat diagram explain Ruby LASER. How to use solar cell for battery charging? Explain principle of holography. How to measure displacement using optical devices. [8] [8] [8] [8]

Compare single mode and multimode step-index and graded index optical fibers. [8]
2 Show that the numerical aperture of step index fiber is given as n12 n2 , Where n1 and n2 are refractive indices of core and cladding. [4] Calculate the numerical aperture of step index fiber having n1 = 1.48 and

c)

n2 = 1.46. What is the maximum entrance angle 0 max for this fiber if the outer medium is air. [4]

P.T.O.

Q5) Write short notes on : a) b) c) Laser printing. Mode coupling in optical fiber. LED Display. SECTION - II Q6) a) b) Q7) a) b) Q8) a) b) Q9) a) b)

[18]

What factors are to be considered while designing a transmitter for optical link? [8] Explain wavelength division multiplexing with neat diagram. [8]

Draw optical power loss model for point to point link and explain link power budget. [8] Explain rise time budget for digital system. [8]

How to measure light flux? Explain light flux measurement with circuit diagram. [8] How signal degrades when transmitted along the optical fiber? Explain pulse broadening in graded index optical fiber. How to measure speed using opto-electronics devices? [8] [8] [8] [18]

Q10)Write short notes on : a) b) c) Industrial applications of Lasers. Optical current sensor. Optical time division multiplexing.

####

[3764]-1066

Total No. of Questions :10]

[Total No. of Pages : 2

P1608
[3764]-1093 B.E. (Computer Engineering) PROJECT PLANNING & MANAGEMENT (410250) (1997 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks.

SECTION - I Q1) a) b) Q2) a) What are the phases of Project Development? Why Project Management is important? What is the role of Project Coordination. [8] What is role of Organization Structure in Project Development? What is the impact of Parallel development activities on Projects. [8] What are the ways for Requirement Elicitation? What is the role of Prototyping in Requirement Analysis? What tasks are performed in Requirement Validation? [8] What are the elements of System Requirement Specification (SRS)? What are the characteristics of quality SRS? [8] Why Risk analysis is performed? What are primary sources of risks? How risk assessment is performed? [8] What are the mechanisms to control the risks? How an undermined risk can lead to Project failure? Why Reactive Risk Management is often Cost-effective? [8] What is meant by Classic Mistake? Explain in detail Process related Classic Mistakes. What is the impact of Process related Classic Mistakes. [8] What is Software Change? How it is identified? What is change control cycle? [8] P.T.O.

b) Q3) a) b)

Q4) a) b)

Q5) Write short notes on (any three) a) b) c) d) Project Managers Responsibilities. Elements of Project Plan. SQA plan. Requirement Traceability. SECTION - II Q6) a)

[18]

What is the role of Metrics in Estimation? What are the techniques for effort estimation? [8] What is the importance of Data Collection? What are the techniques for Software Size Estimation? [8] What is Gantt chart? What is expected to be traced with the help of Gantt chart? What is Decision Tree? [8] Explain in details Critical Path Method. What are the applications of CPM? [8] What is Rapid Development? What are the characteristics of High Performance team? How team models are established and used. [8] What is meant by Formal Verification? What problems can be identified by performing Inspections? [8] What is the difference between Forward Engineering and Reverse Engineering? What is Restructuring? What are the reasons for restructuring? [8] What are the issues that Functional Testing should address? What is the difference between Testing Technique and Testing Strategy. [8] [18]

b) Q7) a) b) Q8) a) b) Q9) a)

b)

Q10)Write short notes on (any three) a) b) c) d) Test Plan. Ballpark estimate. SEI-CMM. Importance of Test Oracle.

####
[3764]-1093 2

Total No. of Questions : 12]

[Total No. of Pages : 2

P1609

[3764]-135 B.E. (Mechanical) PRODUCT DESIGN AND DEVELOPMENT (2003 Course) (Elective - I) (402045)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4)

Answer three questions from Section I and three questions from Section II. Answers to the two sections should be written in separate books. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Unit - I Q1) a) Explain different types of designs. b) Explain the relationship of s-curve and technology forecasting. OR Q2) Explain different types of customer needs. Discuss various need Gathering methods. [16] Unit - II Q3) a) Explain subtract and operate procedure. b) Explain stepwise Benchmarking procedure. OR Q4) a) What do you mean by House of Quality? Explain with neat sketch.[9] b) Discuss in detail function based modularity and manufacturing based modularity for a product. [8] Unit - III Q5) a) Explain different sources of information gathering in a concept generation process. [9] b) Explain in detail morphological analysis. OR [8] [9] [8] [8] [8]

P.T.O.

Q6) a) Explain pugh concept selection charts with suitable example.

[9]

b) Explain basic method of Geometry & layout of concept embodiment.[8] SECTION - II Unit - IV Q7) a) Explain design for Assembly guidelines. b) Explain design for Environment guidelines. OR Q8) a) Explain design for Manufacture guidelines for casting process. Unit - V Q9) a) What do you mean by optimization? Explain fundamental concepts in optimization. [9] b) Explain steepest descent & linear programming technique. OR Q10) Explain briefly : a) Global Optimality. b) Sensitivity Analysis. c) Spreadsheet Search. d) Pareto Optimality. Unit - VI Q11) a) What is prototyping? Explain essentials of a prototype. b) Explain in detail Design of Experiments. OR Q12) a) Explain with neat diagrams stereo lithography and selective laser sintering. [9] b) Explain the types and uses of prototypes. [8] [9] [8] [5] [4] [4] [4] [8] [8] b) Explain with neat sketch Manufacturing Cost Analysis breakdown. [8] [8] [8]

[3764]-135

Total No. of Questions :10]

[Total No. of Pages : 2

P1611
[3764]-1101 B.E. (Information Technology) ENTERPRISE RESOURCE PLANNING (1997 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections must be written on separate answer books. 3) Assume suitable data, if necessary. 4) Draw sketches wherever necessary. 5) Figures to the right indicate full marks.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) b) Define ERP. What are the facilities, which form multi-facility environment of ERP? [9] What are various resources that ERP needs to manage? Enlist the various resources that ERP in automobile sector, has to deal with. [9] What is the role of consultants, vendors, customers & users in implementation of ERP? [8] What is Business Process Re-engineering (BPR)? Explain role of IT in implementation of it? [8] Is ERP an asset? Explain it with suitable examples. [8]

What are different core processes in banking sector? Explain their importance in accordance with ERP for financial services management. [8] How is ERP implemented? Describe a step-wise implementation process for ERP? [8] How are short-term concerns different than long-term management concerns about ERP? [8]

Q5) Write short notes on : a) b) Scope of ERP. Inventory Management. [8] [8] P.T.O.

SECTION - II Q6) a) b) Q7) a) b) Q8) a) b) Q9) a) b) What are the key issues that can lead to failure of ERP implementation?[9] What is gap analysis? What are post-implementation options? [9] What is SAP? Explain any SAP product highlighting its features, modules and applications? [8] How is the world market for ERP products evolving? Is there any space for Indian ERP solutions in market? [8] Why is there a need to understand the markets to implement ERP solution? [8] What is market strategy? How is it represented in documentation? What is ERP sales cycle? Explain it in details? Why is ERP package evaluated? How to evaluate it? [8] [8] [8]

Q10)Write short notes on : a) b) Order-Winners and Qualifiers. Operational research. (OR) Management. [8] [8]

####

[3764]-1101

Total No. of Questions : 12]

[Total No. of Pages : 5

P1612

[3764] - 141 B.E. Mechanical & Mechanical Sand Wich CAD/CAM AND AUTOMATION (2003 Course)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) Given a point P = (2, 4, 8) and using the homogeneous representation calculate P* if P is translated by d = 3i 4j 5k and then scaled uniformly by s = 1.5. [6] Show that the midpoint of a line transformed to the midpoint of the transformed lines. [5] What does mapping mean? What are the various applications for which mapping can be used? [5] OR Q2) a) A triangle PQR represented as P(30, 20), Q(90, 20) and R(30, 80). It is to be scaled by a factor of 0.5 about a point A(50, 40). Determine the composite transformation matrix and the new coordinates of the triangle. [6] Show that : [5] i) Translation is commutative. ii) Mirror and two-dimensional rotation about Z-axis are not commutative. What is meant by geometric transformation? What is the need for it? What is its role in model construction and viewing? [5] P.T.O.

b) c)

b)

c)

Q3) a)

b) c)

Find the equation and endpoints of two lines, one horizontal and the other vertical. Each line begins at and passes through a given point and is clipped by another given points. [6] Write a short note on Order of Continuity. [6] Explain different solid manipulations and its importance. [4] OR

Q4) a)

b)

A cubic spline curve is defined by the equation P(u) = C3u3 + C2u2 + C1u + C0, 0 < = u < = 1. Where C3, C2, C1 and C0 are the polynomial coefficients. Assuming these coefficients are known, find the four control points that define an identical Bezier curve. [8] Explain the effect of the Multiple Control Points and Degree of Bspline Curve on its shape. [8] In the figure below, a load P = 60kN is applied as shown. Determine the displacement field, stress and support reaction in the body. Take A = 250 mm2 and E = 20 kN/mm2. [8]

Q5) a)

b) c)

Write a short note on Automatic and Semi-automatic mesh generation with an illustrative example. [6] Explain, with suitable examples, the plane stress and plane strain condition. [4] OR

Q6) a)

For the plane truss composed of the three elements shown in the fig, subjected to a downward force of P = 10,000 lb applied at node. Determine the x and y displacement of the node and the stresses in each element. Let E = 30 106 psi and A = 2 in2 for all elements.[10] 2

[3764]-141

b)

Derive an expression for the element stiffness matrix of the two noded truss element. Also show the element stress calculations. [8] SECTION - II

Q7) a)

A CST element is defined by nodes at I (30, 40), J(140, 70), and K(80, 140) and the displacements at these nodes are (0.1, 0.5), (0.6, 0.5) and (0.4, 0.3) respectively. Determine the displacement the natural coordinates and the shape function at point P(77, 96) within the element. [8] Explain shape function of CST element. Also explain the physical representation by area coordinates. [8] OR

b)

Q8) a) b)

Explain how symmetry is used in FEA with applications.

[8]

Discuss the Problem Modeling and Boundary Conditions for the following cases : [8] i) ii) A hollow cylinder of length L subjected to an internal pressure, one end of the cylinder is fixed and other end is free. Press fit of a ring of length L and internal radius r onto a rigid shaft of radius (r + ).

[3764]-141

Q9) a) b)

What are advantages and limitations of Automation? [6] Write a manual part program for finishing a forged component as shown in the figure. Assume the speed and feed on the turning centre as 450 rpm and 0.4 mm/rev. assume 1mm material is to be removed radially from external diameter. [10]

OR Q10)a) b) Draw the layout of a typical FMS system and explain main components of FMS. [6] Write an APT part program to machine the outline of the geometry shown in fig. Assume the component to be 5mm thick. The post processor cell statement is MACHINE/ABM, 1. The end mill is used is 10mm in diameter. Assume spindle speed as 1000 rpm and feed as 0.3 mm/rev. [10]

Q11)a) b) c)

Write a note on new trends developing in CNC/DNC technology. [6] Write a short note on Magnetic Grippers used for robot. [6] What do you understand by automation strategy as regards the manufacturing industry? Explain with suitable example. [6] 4

[3764]-141

OR Q12)a) b) c) Explain the steps in manufacturing on a CNC system. [6]

What are various configuration of a robot? Explain with suitable sketches showing work envelope. [6] Write a short note on Robot Applications. [6]

vvvv

[3764]-141

Total No. of Questions :08]

[Total No. of Pages : 2

P1621
[3764]-402 B.E. (Petrochemical Engineering) BIOCHEMICAL ENGINEERING (Elective - II) (2003 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks.

SECTION - I Q1) a) Define the term Biotechnology and explain the concept of Biotechnology tree. Mention the main areas of applications of Biochemical Engineering. [10] Explain the terms enzyme and enzyme technology. Mention important industrial applications of enzymes. [8] Define carbohydrates. Mention about classification of carbohydrates and functions of carbohydrates. [10] Mention and differentiate between important types of cells. [6]

b)

Q2) a)

b) Q3) a)

Mention about amino acids and primary, secondary and tertiary structure of proteins. [10] Write a note on lipids. [6]

b) Q4) a)

Mention about nucleosides, nucleotides and nucleic acids and differentiate between RNA and DNA. [10 Write a note on immobilization of enzymes. [6]

b)

P.T.O.

SECTION - II Q5) Substrate A and enzyme E flow through a CSTR having volume of 6.0 lit from the inlet (CAo) and exit (CA) concentrations and flow rates given below, find a rate equation to represent the action of enzyme on substrate. [16] CEo mol/lit 0.02 0.01 0.001 C Ao mol/lit 0.2 0.3 0.69 CA mol/lit 0.04 0.15 0.60 v lit/hr 3.0 4.0 1.2

Q6) Discuss in detail kinetic aspects of competitive and noncompetitive inhibition. [16] Q7) Discuss in detail : a) b) c) Fermenter scale-up. Fermenter power requirement calculation. Heat and mass transfer issues in fermenter design. [16] [18]

Q8) Write notes : a) b) Monod Kinetics. Separation Challenges in Biotech Sector.

####

[3764]-402

Total No. of Questions :10]

[Total No. of Pages : 2

P1622
[3764]-1047 B.E. (Electronics) MODERN ELECTRONIC SYSTEMS (404208) (1997 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) b) With the help of neat diagram, explain absorption, stimulated emission, and spontaneous emission of an electron. [8] Explain population inversion and thresold condition of gain to start LASER. [8] With the help of energy level diagram, explain working of Nd : YAG LASER. [10] State typical applications of Nd : YAG LASER. [6]

Draw diagram and explain how Load Cell can be used for vibration measurement. [8] Draw and explain different controls on a vibration analyzer. State specifications. [8] What is meaning of Air pollution index? How this index indicates different pollutants in the air? [8] How sound pollution is expressed and measured? State maximum allowable sound pollution levels in different areas in the city. [8]

P.T.O.

Q5) Write short notes on any three. a) b) c) d) e) Semiconductor Laser. Holography. Water pollution measurement. Sound level meter. GPS system. SECTION - II Q6) a) b) Q7) a) b) Q8) a) b) Q9) a) b) Explain a security system with sensors for a bank. Explain working of a Gas sensor in fire alarm system. Draw block diagram and explain solar powered street lamp.

[18]

[8] [8] [8]

What is meant by AH capacity of an battery Calculate AH capacity of an battery to operate 12 v / 18 Watt CFL lamp for 3 Hrs. [8] What is principle of operation of an Microwave oven? What is the power rating and limitations of microwave oven? [8] What are the recording formats used for audio CD, video CD & DVD? [8] What is thro ratio of an LCD projector? How computer output is interfaced with the LCD projector? [8] Describe main features of EPABX. Explain working of two incoming and 32 extensions EPABX with minimum essential facilities. [8] [18]

Q10)Write short notes on any three. a) b) c) d) e) Fuzzy logic in instrumentation. Railway route relay interlocking. Electronic ignition system in an automobile. Solar water heater for domestic application. WLL communication.

####

[3764]-1047

Total No. of Questions : 12]

[Total No. of Pages : 3

P1630

[3764]-146 B.E. (Mechanical Engineering) ENERGY MANAGEMENT (2003 Course)


[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6)

Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of electronic pocket calculator is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Write an essay on contemporary energy crises and role of conventional and non-conventional energy sources in it? [6] b) Write a note on Conventional fuels and their impact on human beings and environment. [6] c) What is Energy Management and what are its objectives? OR Q2) a) Explain the Energy consumption patterns in Global and Indian industry, agriculture, commercial and residential sectors? [6] b) Explain energy conservation in production of heat for power generation. [6] c) Explain the difference between energy conservation and energy efficiency and state one example where energy costs are reduced but energy consumption goes up. [6] Q3) a) Briefly describe the instruments used for energy auditing. [8] [6]

b) An investment of Rs. 1 lakh is made for a variable speed drive at the beginning of the year, which is also the date of first operation. Savings expected over 4 years are Rs. 10,000, Rs. 20,000, Rs. 30,000 and Rs. 35,000 respectively. Find out the Net Present Value at the end of the 4th year, if the discount rate is 18%. Would you invest in this measure? Explain your decision. [8]
P.T.O.

OR Q4) a) Explain building system energy audit. b) Illustrate Billing audit, Field audit and Micro audit. c) Explain the following (Any three) : i) Simple payback period. ii) Time value of money. iii) Return on Investment. iv) Internal Rate of Return. [4] [6] [6]

Q5) a) What is a steam trap? What are the types of steam trap? Explain the criteria of sizing and selection of steam trap. [8] b) How to determine the cost of steam, compressed air and electricity? Explain with examples. [8] OR Q6) a) List the energy conservation measures which are cost effective in various boilers and fired systems. [6] b) What is excess air? How to determine excess air if oxygen/carbon dioxide percentage is measured in the flue gas? [6] c) Explain the difference between efficiency and evaporation ratio with respect to boiler performance evaluation. [4] SECTION - II Q7) a) State briefly the criteria of selection of refractories. [6] b) What are the benefits of insulation other than heat loss/heat gain? And give examples of materials for high temperature insulations. [6] c) Name the three classifications of refractories on the basis of chemical composition. [6] OR Q8) a) What are the different demand side management techniques? [6] b) Discuss in detail the various energy conservation methods as applied to motors. [6] c) Explain why centrifugal machines offers the greatest savings when used with Variable Speed Drives. [6]

[3764]-146

Q9) a) What is cogeneration? What are its benefits? Discuss in short various cogeneration techniques. [6] b) What is heat to power ratio and state its importance. [4] c) List out important factors to be considered for cogeneration plant performance. [6] OR Q10) a) Explain the waste heat recovery system and recycling procedures. [6] b) Explain the operating principle of a waste heat recovery boiler with examples. [6] c) List the circumstances under which cogeneration will become attractive.[4] Q11) a) A reciprocating V belt driven compressor was found to operating during normal factory operation with the following parameters : Load pressure = 6 bar. Unload pressure = 8 bar. Load time = 3 minutes. Unload time = 1.5 minutes. Suggest possible energy saving opportunities on a short-term basis. [8] b) List down energy conservation opportunities in pump and fan. OR Q12) a) What are the energy conservation opportunities in a thermal power plant? [8] b) What are the various energy conservation measures as applied to refrigerators and air conditioners? [8] [8]

[3764]-146

Total No. of Questions :08]

[Total No. of Pages : 2

P1850
[3764]-115 B.E. (Civil) ADVANCED STRUCTURAL DESIGN (Ele. II, 401007) (2003 Course)
Time :3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Attempt Q. 1 or Q. 2, Q. 3 or Q. 4 from section I and Q. 5 or Q. 6, Q. 7 or Q.8 from section II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figure to the right indicates full marks. 5) Assume suitable data, if necessary. 6) Use of cell phone is prohibited in the examination hall. 7) Use of electronic pocket calculator, relevent IS code & steel table is allowed.

SECTION - I Q1) A 50 m microwave antenna lattice tower is to be built near Pune. The terrain at the location is nearly a level ground. It has to carry a 3 m diameter hemispherical antenna disc at the top. The necessary data is given below: The width at the top of the tower = 3.2 m. Weight of the platform at top = 0.8 kN/m2. Weight of railing at top = 0.25 kN/m. Weight of ladder and cage = 0.6 kN/m. Weight of antenna disc and fixture = 8.5 kN. Self weight of truss = 4.5 kN/m. Weight of miscellaneous items = 2.5 kN. Terrain category II and class of structure B. Draw suitable truss configuration and determine the maximum compressive and tensile forces in the leg at the base. Also the maximum transverses shear force at the base. [25] OR Q2) a) The bottom chord tension member of a roof truss is subjected to an axial pull of 400 kN. A point load of 50 kN is acting at the centre of the tension member of an effective length 4.2 m. Design the section consisting of two angles section. [12]

P.T.O.

b)

Design a suitable base for a column subjected to an axial load of 500 kN and bending moment of 175 kNm. The column section is ISHB 450 @ 925 N/m. The safe bearing pressure of concrete assumed to be 4000 kN/m2. [13]

Q3) Designed a castellated beam for a span of 15m. The dead weight of roof is 750 N/m2 and the live load on the roof is 2000 N/m2. Cut the I section at 45 and adjust the section such that the overall depth of section should not exceed 900 mm. [25] OR Q4) Two channel sections without bent lips 200 mm 50 mm are connected with webs to act as a beam. The thickness of channel is 2.5 mm. The effective span of simply supported beam is 5 m. Determine the maximum uniformly distributed load excluding self weight which can be supported through out the length. Ixx = 2 3.9 106 mm4. [25] SECTION - II Q5) A traffic control post 2.50 m diameter is supported centrally by a 300 mm diameter reinforced concrete column. Allowing a live load of 1500 N/ mm2. Design the circular slab. Use M 25 concrete and Fe 415 steel. [25] OR Q6) Design a counter fort type retaining wall for the following data : Overall height of the wall = 7m. Unit weight of backfill = 1600 N/mm 3. Angle of repose of the soil = 35. Surcharge angle = 15. Spacing of counter fort = 3 m. Toe slab to be supported by front counter forts. Use M 20 concrete and Fe 415 steel. [25] Q7) Design an intze water tank of capacity 6,00,000 liters. The height of staging is 12 m up to the bottom of tank. The bearing capacity of soil is 120 kN/m2. Wind pressure intensity is 1.8 kN/m2. Use M 20 grade of concrete and Fe 415 grade of steel. [25] OR Q8) Design an exterior panel of 6 m 6 m of flat slab with suitable drop to support a live load of 4 kN/m2. The slab is provided with floor finish of 1 kN/m2. The floor system is supported by column of size 500 mm 500 mm. Floor to floor distance is 3.5 m. Use M 20 grade of concrete and Fe 415 grade of steel. [25]

####
[3764]-115 2

Total No. of Questions : 10]

[Total No. of Pages : 2

P1851

[3764]- 1027 B.E. (E & TC) AUDIO - VIDEO ENGINEERING (1997 Course) (Elective - I)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn, wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) With the help of neat sketch, explain the working of horn type loud speaker. What are its advantages and disadvantages relative to permanent magnet type speaker? [8] b) Explain the working of moving coil microphone. Give typical parameters and applications. [8] Q2) a) Compare variable area and variable density recording in case of optical recording on films. [8] b) Discuss the recording of sound on CD. State advantages of CD recording. [8] Q3) a) With necessary block diagram, explain the working of PA system. State typical specifications for Hi-Fi PA system. [8] b) Define the terms : i) ii) iii) iv) Reverberation. Absorption coefficients. Sound reduction Index. Cross over network. [8]

Q4) a) Discuss compatibility requirements of colour TV transmission. What is frequency interleaving? [8] b) Explain the working of PAL Encoder with necessary block diagram.[8] P.T.O.

Q5) Write short notes on (any three) : a) MAC Encoding. b) Yaggi Antenna. c) TV remote control. d) Baffles and Enclosures for speakers. SECTION - II

[18]

Q6) a) Draw the complete colour plexed composite video signal indicating the timings and levels of all the components. Discuss the purpose of all components. [8] b) Explain in detail, the close circuit television (CCTV). [8]

Q7) a) Compare design features of low level and high level modulation TV transmitters. [8] b) Explain with necessary diagram, working of TV pattern generator. [8] Q8) a) Discuss the facilities provided in vision mixer for basic editing operations. [8] b) Explain how colourplexed video signal is recorded on VCR Tape? [8] Q9) a) What are the features of HDTV? Discuss compatibility problems in HDTV. State HDTV standards. [8] b) Discuss different types of colour picture tubes in brief. Q10) Write short notes on (any three) : a) Ghost images. b) CATV. c) Interlaced scanning. d) Graphic Equaliser. [8] [18]

xxxx

[3764]-1027

-2-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1852

[3764]- 295 B.E. (Instrumentation) PROCESS MODELING AND OPTIMIZATION (1997 & 2003 Course) (406270)

Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer three questions from each section as per the instructions. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn, wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) Derive the model of the field controlled DC shunt motor. [8] b) Fit the following data to the model y = a0 + a1x + a2x2 using Lagrange interpolation formula. [8] x 1 3 6 8 y 9.8 13.0 9.1 0.6 OR Q2) Fit the following data to the model y = a0 + a1x + a2x2 using least square method. [16] x y 20 73 20 78 30 85 40 90 OR Q4) Develop the model of the non isothermal CSTR with first order reaction dynamics for the reaction. [16]
A k B

40 91

50 87

50 86

60 90

70 65 [16]

Q3) Develop the model of the ideal distillation column.

P.T.O.

Q5) Write short note on : a) Sine wave testing for system Identification. b) Pulse test for system Identification. OR

[18]

Q6) Explain the advantage pf the ATV identification over pulse test. Explain the ATV identification method and its five models. [18] SECTION - II Q7) a) Define the term Niederlinsky index. Obtain the Niderlinski Index for the system and comment on the stability of the system. [10]
12.8e s 16.7 s + 1 G (s ) = 7 s 6 .6 e 10.9 s + 1 18.9e 3 s 21s + 1 19.4e 3 s 14.4 s + 1

b) Define the relative gain array. Obtain the RGA of the system whose transfer function matrix is [8]
22.89 e 0.2 s 4.572 s + 1 G (s ) = 0.2 s 4.689 e 2.174 s + 1 11.64 e 0.4 s 1.807 s + 1 5.8 e 0.4 s 1.801 s + 1

OR Q8) Define the resiliency index and determine the Morari Resiliency index of the systems given in Q.7 (a) and Q.7 (b). [18] Q9) Explain the following terms : a) Concave function. b) Convex function. c) Local minimum and global minimum. d) Hessian matrix for function f (x). OR [16]

[3764]-295

-2-

Q10) a) Find the optimum values f (x) = 12x5 45x4 + 40x3 + 5 of function. [8] b) Find the minimum value of the y for
2 1 x1 x2 x3 y= + + + 2 16 x2 x1x3

[8]
x with bracket 2 < x < 3 and 0.01 log 2 x

Q11) a) Minimize the function f ( x) = using Secant method.

[8] [8] OR

b) Explain the Newtons method of function minimization

Q12) a) Explain the steepest decent method with the help of algorithm and flowchart. [8] b) Minimize f (x1,x2) = x1 x2 + 2 x1 + 2x1x2 + 2 x2 using Newtons method.
2

0 Assume starting point is x = . 0

[8]

xxxx

[3764]-295

-3-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1853

[3764]-237 B.E. (Common for E & TC / Electronics) SYSTEM PROGRAMMING & OPERATING SYSTEM (2003 Course)
[Max. Marks : 100

Time : 3 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) 6)

Solve Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6, Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Define: i) Interpretler. ii) Translator. iii) Assembler. iv) Complier. Give example of each. b) Explain lexical analyzer in complier with example. OR Q2) a) Define: i) Parser. ii) System software. iii) Application software. iv) Operating system. Give example of each. [8] [8]

[10]

b) Define basic function of complier. Explain different phases of complier with diagram. [10] Q3) a) Explain different data structures used for pass-I assembler. [8]

b) Define Macro. Explain how macro expansion is take place if macro is used in program. [8] OR
P.T.O.

Q4) a) Explain machine dependent & independent features of assembler. b) Explain data structures used for pass-I Macro processor.

[8] [8]

Q5) a) What is linkers? Explain how linkers works in C complier? Which files gets linked when program is executed? [8] b) Define basic function of loader. Explain relocating loader in details. [8] OR Q6) a) What is loader? Draw the flow chart for loader & explain it briefly. [8] b) Explain the concept of direct linking loader. SECTION - II Q7) a) Draw the physical overview of computer system & with respect to that explain functions of operating system. [10] b) Define process. Explain any two scheduling policies for processes. [8] OR Q8) a) In following process number & time is given. Process : Time : P1 P2 P3 P4 P5 20 10 25 15 5 units If priority queue is - P3, P1, P2, P5 & P4. [8]

Calculate average time to complete for scheduling policies i) FCFS. ii) Shortest job first. iii) Priority based scheduling. FCFS & SJF is non-preemptive. Comment on result.

[10]

b) What is process context switching? Explain process control block. [8] Q9) a) What are different file operations & how the file is protected? [8]

b) Explain contiguous memory allocation & non-contiguous memory allocation. [8] OR Q10) a) Explain the concept of memory management using paging. b) Explain file indexing & explain how file is accessed. [8] [8]

[3764]-237

Q11) a) Explain how I/O devices communicate with CPU? What is role of operating system to manage I/O devices? [8] b) Explain physical IOCS in details. [8] OR Q12) a) Explain the different operation involved in device driver. b) Write short on : i) I/O devices. ii) Modes of IO operation. [8] [8]

[3764]-237

Total No. of Questions : 12]

[Total No. of Pages : 6

P1298

QUANTITY SURVEYING CONTRACTS & TENDERS (2003 Course)


Time : 4 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer Q. 1 or Q. 2, Q. 3 or Q. 4, Q. 5 or Q. 6 from Section - I and Q. 7 or Q. 8, Q. 9 or Q. 10, Q. 11 or Q. 12 from Section - II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagram must be drawn whenever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

B.E. (Civil)

[3764]-103

SECTION - I Q1) Referring figure no. 1, workout the quantities of following items describing them fully in a format of measurement sheet.

Fig. No. 1
P.T.O.

Schedule for opening: Doors 1.2 2.1 01 no Doors 1.0 2.1 03 nos Windows 1.2 1.2 04 nos Windows 0.6 0.45 02 nos a) Excavation in foundation. b) UCR masonary in foundation and plinth. c) Brick masonary in super-structure. d) RCC in lintels, chajjas and slab. Consider uniform wall section for all main walls except partition walls of WC & bath. Lintel of size 0.3m 0.15m with bearing of 0.15m on either side is provided. [18] OR Q2) a) Figure no. 2, shows a RCC retaining wall. Workout quantities of various reinforcing bars in kg and tabulate the same as abstract. Assume length of the wall 6 m, hook length at each end of bar as nine times the diameter of bar, cover of 5 cm from all sides and development length or overlap of forty seven times the diameter of bar (wherever shown in fig.) [14]

[3764]-103

-2-

(Fig. No. 2 Retaining wall of length 6 m) Consider weight of bar per meter length as 6 - 0.22 kg/m, 10 - 0.62 kg/m, 12 - 0.89 kg/m, 16 - 1.58 kg/m and 20 - 2.47 kg/m. b) Explain the terms supplementary estimate and revised estimate. [4]

Q3) a) Workout approximate estimate of a proposed five storied building with carpet area of 950 sq.m. at each floor. Consider following data : [8] i) ii) Area occupied by walls as 10% of carpet area. Area occupied by W.C. bath, staircases etc as 30% of carpet area.

iii) The rate of construction per sq.m. of built-up area as Rs. 7000/-. Also make suitable provision for : i) ii) Electrification. Water supply & Sanitary items.

iii) Contingencies. iv) Worked charged establishment cost. b) Write a short note on : i) ii) Approximate estimate of a road. Approximate estimate of Lift irrigation scheme. OR Q4) a) What are reasons for preparing an approximate estimates? [4] [8]

b) List out the basic data required for preparation of an approximate estimate of any structure. [4] c) List out the basic data required for preparation of a detailed estimate of any structure. [4] d) Why an approximate estimate should not be too approximate? [4]

Q5) a) Draft a detailed specification for providing and laying P.C.C. at bed of foundation trenches. [8]
[3764]-103 -3-

b) Explain the factors affecting the rate per unit quantity of any construction item. [4] c) Explain the term task work. State the task work for following items.[4] i) ii) First class brickwork in cm 1 : 6 in super structure. PCC (1 : 4 : 8) in plinth of a building. OR Q6) a) State importance and uses of specification. b) Workout rate per unit of measurement of following items. i) ii) 10 cm thick brick partion wall in cm 1 : 3 on ground floor. Cement plaster (12 mm thick) in cm 1 : 4. SECTION - II Q7) a) Explain the terms : i) Obsolescence ii) Salvage value iii) Depreciation iv) Standard rent [8] [6] [10]

b) A concrete mixer is purchased for Rs. 4.00 lakh. Its estimated life is 10 years. Scrap value at the end of its life is Rs. 40,000/-. Using sinking fund method calculate the book value of mixer at the end of 5th and 8th years. Assume rate of interest of 6% for calculation of sinking fund.[8] c) Explain the term Years Purchase. OR Q8) a) What is capitalized value? Workout the capitalized value of the building based on the following data : [10] i) ii) Total built up area 800 sq.m. and present gross rent Rs. 60/- per sq.m. per month. Total out going 35% of the annual gross rent. [2]

iii) Expected future life = 40 years. iv) Area of plot = 500 sq.m. and it market rate Rs. 2500/- per sq.m.
[3764]-103 -4-

v)

Expected rate of return on investment in building and land is 10% and 6% respectively.

vi) Consider the reversionary value of the land and rate of interest on redumption of capital = 5%. b) Explain the land & building method of valuation. c) Differentiate between cost & value of a property. [6] [2]

Q9) a) Explain the procedure adopted in PWD to obtain Administrative and Technical sanction of any work. [8] b) Compare Lump Sum Contract with Item Rate Contract with respect to : [8] i) ii) Nature of agreement. Contract documents required.

iii) Mode of payments. iv) Advantages. OR Q10) a) Explain in brief : i) ii) Security deposite. Comparative statement. [8]

iii) Liquidated damages. iv) Earnest money. b) Explain the unbalanced tender with suitable example. Q11) a) Explain in brief : i) ii) Time is an essence of contract. Arbitration. [8] [8]

iii) Defect liability period. iv) Termination of contract by breach.


[3764]-103 -5-

b) State the different methods of execution of works in PWD. Explain rate list method. [8] OR Q12) Write short note on : a) Secured advances. b) Pre tendering. c) BOT-need, scope and advantages. d) Global Tendering.
rrrr

[16]

[3764]-103

-6-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1302

[3764]-109 B.E. (Civil)

ARCHITECTURE AND TOWN PLANNING (401005) (2003 - New Course) (Elective - I)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Solve Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from Section I and Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 from Section II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Use of non-programmable pocket calculator, slide rule, log table, steam table is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Write a short note on qualities of Architecture. i) ii) Q2) a) b) Explain the importance of Architectural Composition. Explain in detail, "Gothic Architecture". OR Write a short note on "Principles of Architecture". i) ii) Q3) a) b) Write a short note on 'factors in Architecture'. Explain in detail, "Renaissance Architecture". [9] [4] [4] [8] [5] [4]

Explain in detail the importance of connectivity matrix and its application in case of Educational Institute. [9] Write short notes on: i) ii) Garden City Solar passive Architecture. OR [8]

Q4) a)

Write a short note on various stages involved in the development of a building plan. [8]
P.T.O.

b)

Write short notes on: i) ii) Effect of climatic factors on planning the building. Planning concepts for neighbourhood. [4] [5]

Q5) a) b)

Write a short note on Development plan; and norms in UDPFI guidelines for the same. [8] Explain in detail the surveys carried out prior to D.P. OR [8] [16]

Q6) Write short notes on: a) b) c) d) Built Environment in towns Importance of Zoning in D.P. Three magnet theory Importance of bye-laws and Acts. SECTION - II Q7) a) b)

Enlist principles of landscaping. Explain any two principles in detail.[8] Discuss different soft landscaping elements and explain their effective use in screeing and pollution control for a sight along highway. [8] OR Explain steps involved in preparation of landscape plan of an undulating site admeasuring 165 acres along a canal. [8] Elaborate : 'Role of landscape designer in Urban Planning'. [8]

Q8) a) b) Q9) a) b)

'Town Planning scheme is very effective tool in the hands of Urban Planner'. Explain in detail giving examples. [8] Discuss various traffic surveys to be carried out for preparation of Development Plan. [8] OR Write short notes on: i) ii) Amenity spaces in Development Plan. Planning for services in Development Plan.
-2-

Q10)a)

[8]

[3764]-109
2

b)

Elaborate on stages of preparation of D.P. as per MRTP Act, 1966.[8] [18]

Q11))Write short notes on: a) b) c) Q12)a) b) Use of satellite imagery in Planning. GPS Segment. Application of GIS in Transportation Planning. OR

Explain use of GIS in data collection, analysis and planning of a Town. Enlist various softwares used in Urban Planning. Discuss two in detail. [18]

[3764]-109
3

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1305

[3764]-116
B.E. (Civil)
CONSTRUCTION MANAGEMENT
(2003 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answer 3 questions from Section I and 3 questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Construction industry plays a major role in economic development of nation. It has given employment to lacs of people. Write your comments on this process of employment generation in India and its impact in economy. [6] b) Write a detailed note on CIDC and its role in construction industry.[6] c) Explain any two functions of Management in detail. OR Q2) a) State qualities required by a successful construction manager. [6] b) State salient features of the site you have visited w.r.t. following points: [6] i) ii) Site layout. Material Management. [6]

iii) Quality Control. c) Discuss the common reasons for delay in work and disputes on sites. [6]
P.T.O.

Q3) a) Following is the sales data of various electronic goods in a mall. Sr. No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Name of Material WT - 105 WT - 110 WT - 100 WT - 115 CX - 1 CX - 11 CX - 111 SCD - 4 SCD - 54 SCD - 45 SCD - 10 FX - 100 FX - 120 FX - 1050 Annual Sale (in number) 1500 250 3005 2500 80 275 155 10 12 18 09 550 450 350 Rate Rs. 300/no. Rs. 690/no. Rs. 250/no. Rs. 350/no. Rs. 10,500/no. Rs. 8,000/no. Rs. 5,650/no. Rs. 20,000/no. Rs. 25,000/no. Rs. 12,000/no. Rs. 17,500/no. Rs. 850/no. Rs. 990/no. Rs. 1,050/no.

Carry out the ABC analysis of the problem by stating the A, B and C type of materials. [8] b) Explain in detail MRP system used for material management. OR Q4) a) Explain in detail what is Just In Time system (JIT system). How it can be implemented on Construction site? [8] b) Explain following methods of inventory management. i) ii) MUSIC 3D rule. VED analysis. [8] [8]

iii) HML analysis. iv) GOLF analysis.


[3764]-116 -2-

Q5) a) Explain the break even analysis in detail. How you will apply it for a multistoried construction project involving 550 flats? [8] b) What is the procedure of getting loan from World Bank? OR Q6) a) Two alternatives A and B are available for a construction project requiring initial investment of Rs. 50 lakhs and Rs. 60 lakhs respectively. Their net cash flows are as shown below : Year 1 2 3 4 5 6 Net cash flow for A (in lakhs) 10.0 13.20 15.65 17.4 13.2 11.1 Net cash flow for B (in lakhs) 23.35 17.8 15.4 13.2 11.8 9.5 [8]

With cost of capital as 10%, select proper alternative with Net Present Value method. [8] b) Differentiate between : i) ii) Payback period method and benefit cost method. NPV method and IRR method. SECTION - II Q7) a) Explain the phases in Disaster Management Planning. Explain each of them in brief. [10] b) What are the on site and off site emergency planning for a Tsunami?[8] OR Q8) a) In case of terrorist attack, how will you plan for Preparedness? [8] b) What are the reasons of evacuation? What are the hurdles faced in the process of evacuation? [10]
[3764]-116 -3-

[8]

Q9) a) Explain the procedure for calculating the compensation in case of permanent disablement? Explain with example. [8] b) What is the definition of child labour? What are the establishments where child labour is banned? [8] OR Q10) a) Explain the clauses under Minimum Wages Act. [8] b) In case of workmans compensation act, explain the terms arising out of and in the course of employment. [8] Q11) a) Design a training programme for Refresher course for Site Engineers. (Please include the outline of the course material.) [8] b) What are the sources of Risk? What are the steps to be taken for mitigation of risk. [8] OR Q12) a) Write a detailed note on RAMP book. b) What is the role of risk manager? rrrr [8] [8]

[3764]-116

-4-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1306

[3764]-119 B.E. (Civil) (2003 Course)

DAMS AND HYDRAULIC STRUCTURES


Time : 3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Solve Section-I Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6. 2) Solve Section-II Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12. 3) Answers to the two sections should be written in separate books. 4) Neat diagrams must be drawn wherever necessary. 5) Figures to the right indicate full marks. 6) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Discuss the various factors which govern the selection of type of dam. [10] Write short notes on: [6] i) Rockfill dams. ii) Arch dam. OR Write short notes on: [9] i) Inspection of dams. ii) Safety of dams during and after construction. iii) Balloon dams. What are the factors which affect the selection of site for a dam. Discuss them briefly. [7] Write short notes on (any three): [12] i) Galleries in gravity dam - classification, location and purpose for which galleries are provided. ii) Investigations required for reservoir planning. iii) Various zones of storage in a reservoir. iv) Zone method of design of a gravity dam.
P.T.O.
1

Q2) a)

b) Q3) a)

b)

The following table gives monthly mean flow rate. The demand rate is [6] constant 80 m3/s. Determine the required storage capacity.
June July Aug. Sept. Oct. Nov. Dec. Jan. Feb. March April May

Month Mean flow rate m3/s Q4) a) i) ii)

25 55 195 305 195 155 105 80 65

45

25

25

OR What are the factors on which the selection of the site of a reservoir depend? [4]

b)

What do you understand by a mass curve? How to find out safe yield from the mass inflow curve? [4] A gravity dam 100m height, tap width 7m bottom width 70m, u/s face vertical, d/s face has a slope of 7H : 10V from a point of 10m below the top Freeboard is 3m. Test the stability of the dam. Calculate principal stresses at the toe and heel of the dam. Assume unit weight of masonry = 24 kN/m3. unit weight of water = 10 kN/m3. Permissible shear stress of joint = 1400 kN/m2. [10] [3]

Q5) a)

i) ii)

What are the criteria for safe design of earth dam?

List the critical conditions for stability of side slopes of an earth dam. [2]

iii) What do you understand by construction pore pressure in earth dams and how are they determined? [3] b) A ogee type spillway has 20 crest gates each having 10m clear span. Find the maximum flood that can be safely passed by lifting all the gates when the maximum reservoir level is 105.00m and the crest level is 101.00 M. Take coefficient C = 2.16. Coefficient of end contractions for piers = 0.05 Coefficient of contractions for abutments = 0.1. Neglect velocity of approach. Also design d/s profile of this spillway of gravity dam having d/s face slope 0.7H : 1V. [8] OR

[3764]-119
2

-2-

Q6) a)

For an earthen dam of homogenous section with a horizontal filter, upto a length of 30m from d/s end, draw the top phreatic line. The top width of the dam is 6 m, u/s slope 3 : 1, d/s slope 2:1, total height of dam 20m with free board of 2m. If the coefficient of permeability of the soil material used in the dam is 5 104 cm/s, find the seepage flow per unit length of the dam. [10] Explain in brief shaft spillway or side channel spillway. SECTION - II [6]

b)

Q7) a) b)

In what way storage headworks is different from diversion headworks? What are the various purposes of a diversion headworks? [8] Explain Khosla's theory of design of weir on permeable foundation. List the various corrections that are needed in its application. [8] OR What are the main causes of failure of weirs on permeable foundations? Explain Bligh's creep theory for seepage below a weir. [8] Explain the functions of the following components of diversion head works. [8] i) Canal head regulator. iii) Divide wall. Describe briefly the various considerations made in the alignment of a canal? [6] Design an irrigation canal is alluvial soil using Lacey's silt theory for the given data Full supply discharge = 15 cumes. Lacey's silt factor = 0.9 Side slope of canal = 0.5H : 1V. [6]

Q8) a) b)

Q9) a) b)

c)

Q10)a)

What is a cross regulator? What are the functions of a cross regulator? [6] OR State the factors which govern the type of cross-drainage work. Also explain how would you avoid one type of cross drainage work and prefer the other one by simply changing the canal alignment, taking off from a head work. [9] What are the advantages of canal lining? How will you justify economically the necessity of lining of an existing canal? [9]
-3-

b)

[3764]-119
3

Q11)a) b)

Q12)a) b)

What are the different types of hydropower plants based on storage characteristics? Explain any one in detail with sketch. [8] What are merits and demerits of river training by levees? Describe how a river is controlled with the help of levees? [8] OR What is cut off? Describe briefly how a cut off may be used as river training measure? [8] Distinguish between a run-of-river plant and a storage plant. Also draw neat sketches. [8]

[3764]-119
4

-4-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1311

[3764]-133
B.E. (Mechanical)
MECHATRONICS (2003 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answer 3 questions from Section I and 3 questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain the following terms : i) Linearity ii) Repeatability b) Write a short note on : i) Measurement system ii) Response of system c) Explain with neat sketch working principle of McLeod gauge. OR Q2) a) Explain the following terms : i) Resolution ii) Precision b) Compare the characteristics of any two flow meters. c) Explain the advantages and limitations of Rotameter. Q3) a) Compare the characteristics of RTD and Thermocouple. b) Explain capacitance type level measurement. c) Write a short note on optical encoders. OR Q4) a) Write a short note on : i) Pyrometers ii) Load cell b) Explain various types of strain gauges and strain gauge circuits. [6] [6] [4] [6] [4] [6] [6] [4] [6] [8] [8]
P.T.O.

Q5) a) Derive the model equation of a translational mechanical system. b) Explain open loop control system with suitable example. c) Explain the building blocks of electrical system. OR Q6) a) Explain Feed Forward Control System with suitable example. b) Explain the building blocks of fluid system. c) Compare open loop and closed loop control system. SECTION - II Q7) a) Explain dynamic response of second order system to step input. b) Explain P + I control action. c) Write a short note on Transfer function. OR Q8) a) Explain level and temperature switches. b) Write a short note on stability of control system. c) Explain P + D control action.

[6] [6] [6] [6] [6] [6]

[6] [5] [5] [6] [5] [5]

Q9) a) Write a short note on IC 555 timer. [6] b) Explain D/A convertor. [5] c) State the specifications of operational amplifier. [5] OR Q10) a) Explain decade counter. [5] b) Write a short note on D Flip Flop and Master slave Flip Flop. [6] c) Explain operational amplifier circuits for sample and hold application.[5] Q11) a) Explain the advantages of PLC over Relays. [6] b) State the typical specifications of PLC. [6] c) Explain the various elements used in Ladder diagram. [6] OR Q12) a) Write a short note on micro-controller. [6] b) Explain any one application of Mechatronic system using PLC and draw its Ladder diagram. [12]

rrrr [3764]-133 -2-

Total No. of Questions : 6]

[Total No. of Pages : 4

P1312

[3764]-139
B.E. (Mechanical)
OPERATION RESEARCH (402045) (2003 Course) (Sem. - I) (Elective - I)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4)

[Max. Marks : 100

Answers to the two sections should be written in separate books. Figures to the right indicate full marks. Use of calculator is allowed. Assume suitable data, if necessary.

SECTION - I Q1) Two animal feeds A and B are available in the market. One kg of A contains 0.1 kg of x1, 0.1 kg of x3 and 0.2 kg of x4 and 1 kg of B contains 0.1 kg of x2, 0.2 kg of x3 and 0.1 kg of x4 (x1, x2, x3, x4 are different ingredients). A feed mixing operation can be described in terms of two activities. The daily per head requirement is of at least 0.4 kg of x1, 0.6 kg of x2, 2.0 kg of x3 and 1.8 kg of x4. Feed A can be bought for Rs. 0.07 per kg and feed B for Rs. 0.05 per kg. The availabilities, requirements and costs are summarised in the following table : Ingredient x1 x2 x3 x4 A (kg) 0.1 0 0.1 0.2 B (kg) 0 0.1 0.2 0.1 Requirement (kg) 0.4 0.6 2.0 1.8

Cost Rs. 0.07/kg, Rs. 0.05/kg. Determine the quantities of feeds A and feed B in mixture so that the total cost is minimum. [16] OR
P.T.O.

Q1) Using the dual, solve the following linear programming problem. Zmax = 2x1 + 2x2 + 4x3 Subjected to, 2x1 + 3x2 + 5x3 2 3x1 + x2 + 7x3 3 x1 + 4x2 + 6x3 5 x1, x2, x3 0

[16]

Q2) Consider a firm having two factories. The firm is to ship its products from the factories to three retail stores. The number of units available at factories X and Y are 200 and 300 respectively, whose those demanded at retail stores A, B and C are 100, 150 and 250 respectively. Rather than shipping directly from factories to retail stores, it is added to investigate the possibility of trans-shipment. The transportation cost (in Rupees) per unit is given below : Factory X Factory X Y Retail store A B C 0 6 7 1 8 Y 8 0 2 5 9 OR Q2) a) Using VAM Approximation Method to obtain an initial feasible solution of the transportation problem. [8] A 7 5 0 1 7 Retail store B 8 4 5 0 8 C 9 3 1 4 0 [16]

Find the optimal shipping schedule.

A B C
[3764]-139

D 11 16 21 200

225 275 250

E F G 13 17 14 18 14 10 24 13 10

250 300 400


-2-

b) Solve Assignment 1 I 2 II 4 III 7 IV 3

problem. 2 3 3 4 5 6 8 9 5 8

[8] 4 5 7 8 4 [18]

Q3) Write short notes (Any Three) : a) EOQ model with Finite Replenishment Rate. b) Dynamic programming. c) Non-linear programming. d) Static inventory model. SECTION - II

Q4) a) Describe a two-persons zero-sum game. [4] b) Explain the iterative method of getting an approximate solution to a game problem. [4] c) Solve the game by L.P. Method. [8]
B 3 1 3 A 3 3 1 4 3 3

OR Q4) The following mortality rates have been observed for a certain type of light bulbs. [16] Week % failing by end of week 1 10 2 25 3 50 4 80 5 100

There are 1000 bulbs in use and it costs Rs. 2 to replace an individual bulb which has burnt out. If all bulbs were replaced it would cost 50 paise per bulb. It is proposed to replace all bulbs at fixed intervals whether or not they have burnt out. At what interval should all the bulbs be replaced? Q5) Explain Kendalls notation for single-channel Poisson arrivals with exponential service, infinite population model [M/M/1 : FCFS||]. [16] OR
[3764]-139 -3-

Q5) a) Using graphical method, determine the optimal sequence needed to process job 1 and 2 on five machines A, B, C, D, E. For each machine find the job which should be done first also find total time needed to complete both the jobs. [8] Sequence : A B C D E Job 1 Time (hrs) : 1 2 3 5 1 Sequence : C A D E B Job 2 Time (hrs) : 3 4 2 1 5 b) Explain Monte Carlo simulation. [8] Q6) Find the optimum solution for the following network. Activity A B C D E F G H I Succeeding Activity B, C D, E I G F H F Normal duration 8 4 4 3 6 9 5 7 8 Crash durat 8 3 3 3 4 6 4 5 5 Normal cost 500 1000 800 750 1500 2500 500 800 3000 [18] Crash cost 500 750 500 750 800 1600 400 600 1500

Indirect cost = Rs. 150/- per day. OR Q6) a) Given below is the information regarding a project. Activity Preceding Activity Duration (days) Activity Preceding Activity Duration A 3 I E, H 4 B 4 C 2 J E, H 2 D A, B 5 E B 1 K C, D, F 1 F B 3 G F, C 6 L J, K 5

[8] H B 4

Draw network find critical path and its duration. b) Write difference between PERT and CPM. c) Explain types of floats.
[3764]-139 rrrr -4-

[5] [5]

Total No. of Questions : 12]

[Total No. of Pages : 5

P1318

[3764]-151 B.E. (Mechanical S/W)


DESIGN ENGINEERING

(2003 Course)
Time : 4 Hours] Instructions to the candidates: 1) 2) 3) 4) 5) Answer three questions from Section I and three questions from Section II. Answers to the two sections should be written in separate answer books. Neat diagrams must be drawn wherever necessary. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Annume suitable data, if necessary. [Max. Marks : 100

SECTION - I Q1) a) A straight bevel pinion having 18 teeth is to mesh with a straight bevel gear having 40 teeth. Pinion and gear are made of case hardened steel having ultimate tensile strengths of 720 MPa and 580 MPa respectively. The gear pair is manufactured by generation. The pinion is connected to 15 kW, 1440 rpm electric motor. The starting torque is approximately twice the rated torque. If the surface hardness of the gear pair is to be 350 BHN, design the gear pair with a factor of safety of 1.5. Assume velocity factor accounts for dynamic load. [12] Sketch and describe various arrangements of worm gear reducer. [6] OR Q2) a) A worm gear pair transmits 5 kW power from a shaft rotating at 1440 rpm to another shaft rotating at 36 rpm. The worm gear is made of phosphor bronze and worm is made of 14C6. The normal pressure angle is 20o. The temperature rise of the lubricating oil is limited to 50oC and the overall heat transfer coefficient is 18 W/m2 oC. i) Find dimensions of worm and worm gear. ii) Required effective surface area of the gear box approximate centre distance is a 8[(G + 5) Pi]0.588 mm. Where G gear ratio, Pi - input power kW.
P.T.O.
1

b)

G acmm 160 200 250

30 1/30/10/8

40 1/40/10/10 5 0.025 6 0.023

54 1/54/10/5 7 0.022 8 0.0215 [12]

1/30/10/10 1/40/10/8

Sliding velocity m/s Coefficient of friction b) Q3) a)

Derive the equation for virtual number of teeth in case of straight tooth bevel gear. [6] An air receiver consisting of a cylinder closed by hemispherical ends. It has a length equal to two times the diameter of vessel. It has a storage capacity of 0.25 m3 and an operating internal pressure of 5 MPa. It is made of plain carbon steel (Sult = 340 MPa) and factor of safety of 4. Neglecting the effect of welded joints, determine the dimension of the reciever. [6] An unfired cylindrical pressure vessel is subjected to an internal pressure of 0.55 MPa at 250 oC. Design the flanged joint with following data. Inner diameter of asbestos gasket = 1200 mm. Gasket factor = 2. Gasket design seating stress = 11 MPa. Allowable tensile stress for bolts at atmospheric condition = 80 MPa. Allowable tensile stress for bolts at operating condition = 75 MPa. Corrosion allowance = 1.5 mm. Find the nominal diameter of bolts. [10] OR Derive Birnie's equation for the thickness of shell related to thick cylinders. [6] Find the diameter of bolts of an hydraulic cylinder for the following data. Pressure of hydraulic fluid = 10 MPa. Internal diameter of cylinder = 40 mm. Thickness of cylinder flange = 10 mm. Thickness of cylinder head = 8 mm.
-2-

b)

Q4) a) b)

[3764]-151
2

Thickness of zinc gasket = 3 mm. Cylinder and flange material is FG 200. Modulus of elasticity for FG 200 = 100 GPa. Modulus of elasticity for zinc = 83 GPa. Number of bolts = 4. Preload in each bolt = 2.8 kN. Bolt material is FeE400. Modulus of elasticity for bolt = 207 GPa. Factor of safety for bolts = 6. State wheather the joint will separate or not. Q5) a) b) Explain with sketches design principles in powder metallurgy.

[10] [6]

The recommended class of fit for the journal and the bearing of a hydrodynamic bearing is 20 H7e8. The diameters of the journal and bearing are normally distributed. The maximum and minimum clearances are limited to 0.08 and 0.05 mm respectively. Determine the percentage of rejected assemblies. The tolerances in micron are as follows. Diameter mm 20 es + 21 H7 e8 ei 0 es - 40 ei - 73

Areas under std. normal distribution curve for 0 to Z are as follows. Z A Q6) a) b) 1.9 0.4713 2.0 0.4772 OR Explain with sketches, design principles in forging. [6] It is observed from a sample of 200 pins produced on an automatic machine that their diameters are normally distributed with a mean of 10.5 mm and a standard deviation of 0.02 mm. If the rejection is to be limited to 10 pins, determine the design tolerance. Assume the process to be centered. Refer to table of Z and A given in question 5(b). [10] 2.6 0.4953 2.7 0.4965 [10]

[3764]-151
3

-3-

SECTION - II Q7) a) b) c) Explain causes of stress concentration. [4] Explain repeated stress and completely reversed stress with diagrams.[6]

Q8) a) b)

A plate made of steel (Sult - 580 MPa) is subjected to a completely reversed axial force of 40 kN. The theoretical stress concentration factor at the change of cross section is 2.27 and the notch sensitivity is 0.8. The surface finish factor and the size factor are 0.75 and 0.85 respectively. The load factor is 0.923. The expected reliability is 90% for which the reliability factor is 0.897. If the required factor of safety is 2, find the plate thickness for infinite life. [8] OR Explain methods of reducing stress concentration with diagrams. [6] A mechanical component is subjected to following bending stress cycle. 350 MPa for 70 % time. i) 500 MPa for 5 % time. ii) 6 3V 300 MPa for remainingtime.M iii) A = 2 , A = The component is made of plain carbon steel bd = 660 MPa). If the bd 2 (Sult endurance limit is 280 MPa find the life of component. [12] A beam of rectangular cross section is subjected to a maximum bending moment M and a maximum shear force V. The allowable stresses in bending and shear are A an A respectively.

Q9) a)

Where b and d are the width and depth of cross section of beam. It is desired that the depth of the beam shall not exceed twice its width. Formulate the design problem for optimisation with the objective of minimum cross sectional area of the beam using following data. M = 40 kNM V = 150 kN A = 10 MPa A = 2 MPa Determine the range of optimum dimensions for the cross section of beam. [12]
[3764]-151
4

-4-

b) Q10)a)

Explain the case of normal specifications in optimum design.

[4]

OR A helical compression spring of an exhaust valve operates under following conditions. i) ii) The force acting on the spring at its extended position should have a specific value of Pmin. The stress at the most compressed position should not exceed
max

which is permissible torsional shear stress.

Neglecting inactive coils, design the spring for minimum weight. [8] b) The initial preload for a helical compression spring is 675 N. The maximum spring load is limited by permissible torsional shear stress of the spring wire, which is 750 MPa. Due to space limitations, the outer diameter of the spring should not exceed 50 mm. Specify the spring dimensions for minimum weight. [8] Explain basic types of product forms with diagram. [6]

Q11)a) b) c)

State the important properties to be considered in the design of material handling equipment for unit loads. [4] A flat horizontal belt conveyor is used for transporting crushed rock having a mass density of 2 t/m3. The belt is 800 mm wide and has a speed of 1.75 m/s. Determine the capacity of the conveyor. The surcharge angle may be taken as 25o. The effective width b in meters is given by b = 0.9B - 0.05. Where B - belt width, m. [6] OR What is Qualitative display? What are the design recommendations for the Qualitative display. [6] Explain with sketch straight roller idler with rolling contact bearing.[4] Explain conveyor belt sag in belt conveyors. State equations for carrying and return idlers. [6]

Q12)a) b) c)

[3764]-151
5

-5-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1321

[3764]-171 B.E. (Production)


PRODUCTION MANAGEMENT

(2003 Course)
Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data, if necessary.

SECTION - I UNIT - I Q1) a) b) Explain production system with block diagram. [8] Explain, how Break Even Analysis is used in product design and development? [8] OR Explain product life cycle with its characteristics and phases. What is Concurrent Engineering? Explain in brief. UNIT - II Q3) a) b) What are the different principles of Plant Layout? [8] Explain the urban and rural locations with their advantages and disadvantages. [8] OR What are the different types of layouts? Compare process layout and product layout. [8] Explain different factors that are taken into account while selecting the site for the industry. [8]
P.T.O.
1

Q2) a) b)

[8] [8]

Q4) a) b)

Q5) a) b) Q6) a) b)

UNIT - III What are different productivity ratios? Explain what are external factors that affect enterprise productivity. [9] Explain the concept of Manpower forecasting used in industry. [9] OR With the help of block diagram explain the process of capacity planning. [9] Define productivity? Enumerate different productivity improvement Techniques? Explain Technology based tool in brief. [9] SECTION - II

Q7) a)

UNIT - IV "Information age competition has initiated some unique challenges that business has to cope up with" by Luftman 1996;. Explain this statement in brief. [9] Explain in brief Maskel's model of WCM. [9] OR Explain manufacturing challenges through value added manufacturing. [9] Explain the seven wastes suggested by Shigeo (1981). How these are eliminated? [9] UNIT - V Define Industrial maintenance? Explain primary and secondary functions of maintenance. [8] How performance of maintenance function is evaluated? [8] OR What is labour cost in maintenance department? Explain different techniques to estimate labour costs. [8] Explain 8 pillars of TPM in brief. [8] UNIT - VI "Global Warming is the result of Rapid industrialization". Explain.[8] How energy audit classified? Explain any two in brief. OR Discuss Green Production [Sustainable Manufacturing]. [8] [8]

b) Q8) a) b)

Q9) a) b) Q10)a) b) Q11)a) b) Q12)a) b)

Explain the concept of "Lean Manufacturing" with block diagram.[8]


-2-

[3764]-171
2

Total No. of Questions : 12]

[Total No. of Pages : 4

P1323

[3764]-174 B.E. (Production)


OPERATIONS RESEARCH

(2003 Course)
Time : 3 Hours] [Max. Marks : 100 Instructions to the candidate: 1) Solve one question from every unit in each section. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculators is allowed. 6) Assume suitable data, if necessary.

Q1) a) b)

SECTION - I UNIT - I How do you recognise that an LP problem is unbounded while using the simplex method? [6] The Handy-Dandy company wishes to schedule the production of a kitchen appliance that requires two resources - labor and material. The company is considering three different models and its production engineering department has furnished the following data: Model A Labor (Hrs. per unit) Material (Kgs per unit) Profit (Rs. per unit) 7 4 4 B 3 4 2 C 6 5 3

The supply of raw material is restricted to 200 Kgs/day. The daily availability of labor is 150 Hrs. Formulate a linear programming model to determine maximum profit. [10] OR Q2) a) What are artificial variables? Why do you need them? How do they differ from slack/surplus variables? [6]
P.T.O.
1

b)

Solve the following by dual method. Minimise Z = x1 + 4x2 + 3x4 Subject to x1+ 2x2 - x3 + x4 3 -2x1 - x2 + 4x3 + x4 2 x1, x2, x3, x4 0. [10] UNIT - II What are the similarities and differences between a transportation problem and a transshipment problem? [6] We have three reservoirs with daily supplies of 15, 20 and 25 million liters of fresh water respectively. On each day we must supply four cities A, B, C, D whose demands are 8, 10, 12 and 15 respectively. The cost of pumping per million liters is given below in thousand Rupees. Cities A B C D 1 2 3 4 5 Reservoirs 2 3 2 5 2 3 4 1 2 3 Use the vogels Approximation method to determine the cheapest pumping schedule if excess water can be disposed of at no cost. [10] OR Explain why the transportation problem solving algorithm is not appropriate for solving the assignment problem? [6] Find the optimal assignment of fourjons and four machines when the cost of assignment is given by the following table : J1 J2 J3 J4 M1 10 9 8 7 3 4 5 6 M2 M3 2 1 1 2 4 3 5 6 [10] M4 UNIT - III What are the shadow prices and how are they computed? What is their relationship to the dual problem? [6] Solve the following integer problem by brands and bound algorithm.
-2-

Q3) a) b)

Q4) a) b)

Q5) a) b)

[3764]-174
2

Maximize Z = 5x1 + 8x2 Subject to x1 + x2 6 5x1 + 9x2 45 0 and integer. [12] OR List 6 reasons why simulation analysis is more appropriate for many real world problems. [6] Define in words the following concepts in dynamic programming : i) stage, ii) state, iii) statevariable, iv) Transformation function, v) Return function, vi) Decision variable, vii) Translation variable. [12] SECTION - II UNIT - IV What is the difference between a goal and a constraint as used in goal programming? [6] The following mortality rates have been observed for a certain type of fuses: End of week 1 2 3 4 5 % Failing to 5 15 35 75 100 [10] There are 1000 fuses in use and it costs Rs. 5 to replace an individual fuse. If all the fuses were replaced simultaneousoly, it would cost Rs.1.25 per fuse. It is now proposed to replace all the fuses at fixed intervals of time irrespective of their state and to continue replacing burnt out fuses as they fail. At what intervals group replacement should be made? OR Explain the concept of geometric programming. [6] Compare the policies adopted in group replacement as against individual replacement. In what circumstances, still individual replacement will prevail the other? [10] UNIT - V Describe Kendall's notation for identifying queueing models with examples. [6] Consider a game having the following payoff matrix. Player B B1 B2 Player A A1 2 6 A2 -2
-3-

x1 , x2

Q6) a) b)

Q7) a) b)

Q8) a) b)

Q9) a) b)

[3764]-174
3

Q10)a) b)

Show that what ever the value of max be, the game is strictly deterministric. ii) Solve for the value of the game. [10] OR Explain the following terms in game theory. [6] i) Saddle point ii) Min Max Principle iii) Value of game i) What is meant by queue discipline? Describe some of the performance measures used in analysing queues. [10] UNIT - VI What are the essential differences between PERT and CPM? Consider a project of eight jobs to be performed. Job A B C D E F G H

Q11)a) b)

[6] [12]

Predecessors Normal Time Crash Time Cost of Crashing (days) (days) per day (Rs.) B A, C A, C D E F, G 10 5 3 4 5 6 5 5 7 4 2 3 3 3 2 4 4 2 2 3 3 5 1 4

Given the overhead costs as Rs. 5 per day, determine the optimal duration of the project in terms of both the crashing and overhead costs and also develop an optimal project schedule. Q12)a) b) OR What is the meaning of critical path in project management? Why it is the longest path? [6] Explain the following terms in networks. [12] i) Event, ii) slack, iii) Free Float, iv) Independent float, v) Total float, vi) Beta distribution curve.

[3764]-174
4

-4-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1324

[3764]-176
B.E. (Prod. & Ind. Engg.)
POWDER METALLURGY (411085) (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates : 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) Powder Metallurgical technique is Indispensable for certain types of products. Explain. [8] b) Compare & contrast the testing procedures for fused & sinter metal products (Cast & P/M products). [8] OR Q2) a) Describe briefly the effects of powder characteristics on the strength & density of P/M parts. [8] b) Discuss the merits & demerits of powder metallurgy technique for shaping. [8] Q3) a) Explain the role of different factors on the degree of compaction of a metal powder.To what extent can the theoretical density be approaches by compacting? [8] b) Write in brief about the basic components of the compacting tools for most P/M products. [8] OR Q4) a) Describe the process, types, advantages & shortcomings of heat treatment. Give some of its applications. [8]
P.T.O.

b) Write short note on following : i) ii) Role of lubricants in die compaction. Die design.

[8]

Q5) a) What is Sintering? Explain the stages of Sintering.

[6]

b) Why do green compacts Shrink during Sintering? Discuss the factors that determine the amount of Shrinkage in a compact. [6] c) What are the pre-requisites of a Sintering furnace? Describe the essential parts of a Sintering furnace. [6] OR Q6) a) Critically discuss various theories of Sintering. [6] b) What is liquid-phase Sintering? Explain its stages & advantages & applications in industry. [6] c) What are the functions of a Sintering atmosphere? What atmospheres are used for Sintering metal powder parts? [6] SECTION - II Q7) a) What are the advantages of Isostating pressing? Describe the wet & dry bag tooling methods of Isostatic pressing. [10] b) Compare & contrast the roll compaction & Die compaction. OR Q8) a) What are the advantages & shortcomings of hot Isostatic pressing? Give some applications also. [6] b) Write short note on following : i) ii) Polymer blends. P/M forging. [10] [6]

Q9) a) Describe with the help of a flowsheet the production of tungusten carbide powder. [8] b) What are the advantages of porous bearings? Describe their production in brief. [8] OR
[3764]-176 -2-

Q10) a) Discuss the manufacturing of carbide-tipped tools by P/M method. Describe its properties & uses also. [8] b) Write short note on following : i) ii) Self lubricated bearings. Electrical contact material. [6] [8]

Q11) a) Why is heat treatment of P/M parts done?

b) What are the different processes employed for finishing P/M parts? [6] c) Why has Machining of P/M parts become a necessity? Outline the general rules you would adopt for machining of the Sintered parts. [6] OR Q12) Write short note on following : a) Near net-shape. b) Production of nano composites. c) Quality & economics of P/M components.
rrrr

[18]

[3764]-176

-3-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1325

[3764]-177
B.E. (Production)

PLANT ENGINEERING AND MAINTENANCE (2003 Course) (Elective - I) (Sem. - II)


Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) Answer three questions from Section I and three questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary. [Max. Marks : 100

SECTION - I Unit No. - I Q1) a) What factors will be considered for the site selection for following:[10] i) Steel Industry ii) OR Q2) a) Discuss the objectives of good plant location. [8] b) Environmental & Ecological aspects are assuming growing importance while making decision on plant location. Explain and illustrate with suitable example. [10] Unit No. - II Q3) a) Briefly explain two disposal methods of solid waste. [8] Cement Industry b) What are the Primary and Secondary functions of plant engineering?[8]

b) What are the fundamental differences between the methods of layout planning adopted in the two computer programmes CRAFT and CORELAP. [8] OR
P.T.O.

Q4) a) Enumerate the tools and techniques that are employed for plant layout studies. [8] b) Write short notes on : i) ii) REL chart. Systematic Layout Planning (SLP). Unit No. - III Q5) a) Explain the importance of auxiliary services while finalising the plant layout. [8] b) What is material handling? What is its scope in an industry? OR Q6) a) Explain how material handling will help to increase the productivity?[8] b) Explain the following principles of material handling. i) ii) Space utilization. Gravity. [8] [8] [8]

iii) Simplification. iv) System. SECTION - II Unit No. - IV Q7) a) Briefly enumerate the challenges of maintenance function. [8]

b) How can effectiveness of preventive maintenance help the maintenance department? [8] OR Q8) a) Explain the primary and secondary functions of maintenance department. [8] b) Define the condition based maintenance and the advantages derived from a condition monitoring programmes. [8]

[3764]-177

-2-

Unit No. - V Q9) a) Discuss the importance of planning a lubrication schedule. [8]

b) Briefly explain the techniques which can be used for the detection of corrosion in a machinery. [8] OR Q10) a) Discuss the factors which need to be considered for implementation of an efficient spare parts control system. [8] b) Differentiate between the spectrometric oil analysis procedure and the magnetic plug inspection system. [8] Unit No. - VI Q11) a) Discuss the various distribution functions used for the estimation of reliability in the performance of the maintenance function. [10] b) Briefly describe the maintenance information system used for maintenance functions. [8] OR Q12) a) Write short notes on : i) ii) Reliability Centered Maintenance (RCM). Total Productive Maintenance (TPM). [10]

b) What is MTBF? Describe a typical example where MTBF concept can be applied. [8]
rrrr

[3764]-177

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1327

[3764]-179 B.E. (Production)

MATERIALS AND FINANCIAL MANAGEMENT (411087) (2003 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidate: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate answer book. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Q2) a) Derive an equation for economic batch quantity for finished good inventory when the back ordering is permitted. [10] Explain 'Two bin system' of replenishment. Explain the 'Q-system' of replenishment. OR Write short note on: i) Corporate policy and material management functions. ii) Purchasing under uncertainty. [5] [5] [4] [4]

b)

Derive an equation for 'Economic Manufacturing Quantity'. When the replenishment is gradual. State the assumptions? [8] Explain the following terms in relation to logistic management. i) Procurement cycle. ii) Manufacturing support cycle. iii) Physical distribution cycle. [9]

Q3) a)

b)

Explain briefly various factors to be considered in warehouse design. [7] OR


P.T.O.

Q4) a) b) Q5) a) b) Q6) a) b)

Explain and state the differences between procurement cycle and physical distribution cycle. [10] Explain the various factors to be improved to increase the effectiveness of supply chain. [6] Explain the 'Import' procedure when purchasing from foreign suppliers. [12] Explain 'Orientation' phase of value analysis. [4] OR Explain in detail various steps involved in 'Waste Management'. [10] Explain the following: i) LOC ii) Bill of Lading. SECTION - II [6]

Q7) The following information is available for 'XYZ' company Ltd. a) i) ii) iii) iv) v) vi) vii) b) Assets Cash Bank Accounts Receivable Inventory Repayments Land and building Plant and machinery December 31st Year 1 Year 2 1,000 6,000 12,600 18,400 800 20,000 30,000 1,200 7,500 14,800 20,500 850 24,000 32,000

[18]

Liabilities and Shareholders equity: i) ii) iii) iv) v) vi) vii) Bills payable 4,000 Accounts payable 6,400 Other current liabilities 2,000 Debentures (10%) 20,000 Preference shares (12%) 10,000 Ordinary Shares, Rs.10 each 40,000 Retained earnings 6,400
-2-

7,850 6,000 2,200 18,000 10,000 50,000 6,800

[3764]-179
2

c)

Income and Retained earnings statement of year ended Dec.31, Year2 Sales Revenue *Less expenses: Cost of goods sold Selling Administrative Interest Income tax *Less Dividend: Preferred Ordinary 60,000 28,000 8,000 2,000 2,000 6,400 1,200 8,000

Compute: a) Rate of Return on assets. b) Profit margin (before interest and related tax effect). c) Cost of goods sold to sales percentage d) Selling expenses to sales percentage e) Operating expense ratio f) Total assets turnover g) Accounts receivable turnover h) Inventory turnover. i) Rate of return on ordinary share Equity. OR Q8) Considering same information given in Question number 7 of 'XYZ' Company. [18] Compute. a) b) c) d) e) f) g) h) i) Current ratio. Quick ratio. Long term debt ratio. Debt Equity ratio. Earnings per ordinary share. Price earning ratio. Book value per ordinary share. Inventory turnover ratio. Operating expenses ratio.
-3-

[3764]-179
3

Q9) a)

Explain i) Job costing ii) Batch costing iii) Contract costing Explain 'Process costing' and state the merits. OR Explain the following: i) Process Costing. ii) Operation Costing. iii) Output Costing. iv) Operating Costing. Define 'Depreciation'. State the causes of depreciation. Explain various ways to classify overheads. Explain the use of marginal costing in decision making. OR

[4] [4] [4] [4] [12]

b) Q10)a)

b) Q11)a) b)

[4] [10] [6]

Q12)Write short note on: a) b) c) Standard costing. Marginal costing. Capital budgeting. [6] [6] [4]

[3764]-179
4

-4-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1328

[3764]-180
B.E. (Production & Industrial Engineering)

PROCESS PLANNING AND TOOL SELECTION (2003 Course) (411089)


Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6) Answer 3 questions from Section I and 3 questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary. Use of electronic pocket calculator is allowed. [Max. Marks : 100

SECTION - I Q1) a) Process Engineering is the hub of the organization. Discuss with the help of a material flow in an organization. [8] b) Explain briefly the expertise that a process engineer should have to discharge his duties in process planning. [8] OR Q2) a) List the main responsibilities of product engineer and explain how it is helpful in process planning? [8] b) Where is the process engineer and product engineer located in the organization? Explain with the help of organization chart. [8] Q3) a) What key points should be considered in determining the nature of work to be performed on the work-piece? [8] b) Define and draw commonly used symbols for geometric tolerances. [8] OR Q4) a) What are the two methods of dimensioning? Which method is normally performed and why? [8] b) Explain the part print analysis in detail with respect to general characteristics of the work-piece. [8]
P.T.O.

Q5) a) Explain with neat sketches geometric control for : i) ii) iii) Long cylinders. Short cylinders. Conical shapes.

[9]

b) What is the concept of interchangeability and standardisation? And what are causes of work-piece variations. [9] OR Q6) a) What is meant by selective assembly? What is the basic difference between tolerance stack and limit stack, illustrate with an example? [9] b) Define work-piece control. What are the variables which interfere with work-piece control? Discuss. [9] SECTION - II Q7) a) Explain with a neat flow chart, a machine selection method for a new component. [8] b) Identify and describe the main guidelines that should be applied when considering clamping force. [8] OR Q8) a) What are various factors affecting the machine selection? Explain. [8] b) Analyse the location system provided by following work and/or tool holding devices : [8] i) ii) iii) V-blocks. Centres. Sleeves.

Q9) a) How are critical areas on the work-piece generally identified? Distinguish between product critical areas and process critical areas. [8] b) Explain Retrival Computer Aided Process Planning approach and draw general procedure chart of retrival CAPP. [8] OR Q10) a) What is an auxiliary operation? How can supporting operation be distinguished from auxiliary operation? [8]
[3764]-180 -2-

b) Explain the need of CAPP. Also discuss the role of expert system in generative Computer Aided Process Planning (CAPP) system. [8] Q11) Prepare a process sheet to machine a bearing housing as shown in Figure 1. which is to be manufactured in batch size of 350. The process sheet must contain manufacturing plan with operation sequence, equipments, tooling, process parameters and sample calculation of operation time. Also draw a proper work-holding device to drill 12 mm hole and 25 mm spot-face. [18]

OR

[3764]-180

-3-

Q12) Prepare a process sheet to machine a base component as shown in Figure 2. which is to be manufactured in batches of size 600. Analyse the part print carefully and prepare the process sheet containing manufacturing plan with operation sequence, equipments, tooling, process parameters and sample calculation of operation time. [18]

rrrr [3764]-180 -4-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1331

[3764]-184
B.E. (Production Engineering)
ADVANCED MATERIAL PROCESSING (2003 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4)

[Max. Marks : 100

Attempt One Question of each unit from Section - I and Section - II. Answers to the two sections should be written in separate books. Draw neat diagram wherever necessary. Assume suitable data, if required.

SECTION - I Unit - I Q1) a) Explain the concept of Dynamic Turning. Compare it with ordinary turning. Also state advantages of it. [8] b) Explain with neat sketch a Cryo-grinding process. State its advantages. [8] OR Q2) a) Explain Hot machining process. Is there any heat treatment is required for the component after machining. [8] b) What shall be the requirements for machine tool parts for High speed machining? [8] Unit - II Q3) a) For a RC ckt. adjusted for a maximum power deliver condition, the following data is available : [8] Resistance R = 250 Ohm, Capacitance C = 35 microfarad, Supply voltage V =85 Volts. Calculate : i) ii) Charging current at the instant when the ckt. Switched on, Frequency of discharge.
P.T.O.

b) With neat sketch explain shaped tube electrolytic machining process with advantages and limitations. [8] OR Q4) a) Calculate the machining rate and electrode feed rate when iron is electrochemically machined using copper electrode and NaCl solution (s = 5 Ohm-cm) Power supply data of ECM machine used are i) ii) Supply voltage E = 20 V DC, Current I = 5000 Amp,

iii) Tool-work Gap h = 0.6 mm (constant), iv) Efficiency = 100% For Iron, Atomic weight = 56 gms, Valancy = 2, Density = 7.8 106 gm/m3. [8] b) Explain different methods of applying dielectric fluid in machining zone in EDM. [8] Unit - III Q5) Write a short note on : a) Isothermal forging, b) Rotary forging, c) Ring rolling. OR Q6) a) What is meant by out of roundness in three roll forming? Explain the factors responsible for it. [9] b) What is Explosive forming? Discuss the process parameters of confined explosive forming. [9] SECTION - II Unit - IV Q7) a) Explain with sketch an injection casting process. b) Explain a suitable casting process for casting Brass component. OR [8] [8] [18]

[3764]-184

-2-

Q8) a) Compare Brass molding with cast iron molding with respective to casting design, molding process, melting equipment, finishing process. [8] b) Suggest and explain a suitable process for casting of Al and Al alloy ingots. [8] Unit - V Q9) a) Suggest a suitable material and process for production of following plastic components : [10] i) v) Packaging film Buckets. ii) Radio cabinet iii) Automotive Bumpers iv) Washing machine agitators

b) Explain with neat sketch a rotational molding process for plastic components. [8] OR Q10) a) Explain with neat sketch a reaction injection molding process for plastic components. State their advantages and limitations. [9] b) Explain the different stages in blow molding for production of glass bottles. [9] Unit - VI Q11) a) What are the basic method used for removing rust and scale from ferrous machined products? Explain any two methods. [8] b) Explain PVD and compare with CVD. OR Q12) a) Explain the basic steps for the surface preparation in thermal spray coating method. State the application this process. [8] b) Explain fabrication of microparts by LIGA process.
rrrr

[8]

[8]

[3764]-184

-3-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1333

[3764]-192 B.E. (Production S/W) (2003 Course)

411121 : MECHATRONICS AND ROBOTICS


Time : 3 Hours] [Max. Marks : 100

Instructions to the candidate: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Differentiate clearly between closed loop control system and open loop control system, giving advantages and limitations of each. [8] Discuss the functioning of a Digital Camera and draw a block diagram representing the basic elements of the control system for it. [10] OR Explain i) Digital Multiplexer. ii) Time division Multiplexing. State and explain Pulse Modulation process. Explain the term Filtering. Classify and explain Filters. Explain the following for a Microprocessor i) Accumulator ii) Flag Register iii) Instruction Pointer. [4]

Q2) a)

b) c) Q3) a)

[6] [8] [9]

b)

Draw a block diagram of a basic microcontroller and explain the function of each subsystem. [7] OR
P.T.O.

Q4) a) b)

What is Sequential Logic? Explain the Synchronous Systems. Define i) TTL ii) CMOS iii) Digital Logic iv) Parity method for Error Detection. Explain the following instructions: i) LDA ii) SHLD iii) RAR iv) ADC

[6] [10]

Q5) a)

[8]

b) Q6) a)

Write a program in assembly language to determine the maximum marks obtained from a list of given marks. [8] OR Explain the following with neat figures: [8] i) Bidirectional Buffer. ii) Handshaking. Explain in detail the Serial Communication Interface. SECTION - II [8]

b)

Q7) a)

Explain the following, with the help of a ladder diagram: i) Latching ii) Sequencing. Explain the following with neat figure: i) Eddy Current Proximity Sensor. ii) Thermistors iii) Potentiometer iv) Load Cell. OR Explain the following with respect to PLC: i) Timers ii) Internal relays iii) Mnemonics iv) Shift registers.
-2-

[8]

b)

[8]

Q8) a)

[8]

[3764]-192
2

b)

Explain the following terms w.r.t. Fluid Pressure Sensors: i) Diaphragms ii) Capsules iii) Bellows iv) Tube Pressure Sensors.

[8]

Q9) a)

Design a mechanical system which can be used to: [8] i) Operate a sequence of microswitches in a timed sequence. ii) Move a tool at a steady rate in one direction and then quickly move it back to the beginning of the path. iii) Transform a rotation into a linear back-and-forth movement with simple harmonic motion. iv) Transform a rotation of one shaft into rotation of another close shaft, which is at right angles to it.

State the specifications of Stepper Motor. In what way are the stepper motors advantageous than the DC and AC motors? [8] OR Q10)Explain following with neat diagram: [16] a) Accumulator b) Pressure Control Valve. c) Plug shapes d) Vane motor Q11)a) b) What are the various controllers used in Robots? Explain. [6]

b)

Q12)a) b)

Discuss the role of Robot in following applications: [12] i) Assembly ii) Automobile Industry. OR What are the types of actuators used for Robot End-Effectors? State the advantages and typical applications of each. [6] Discuss the role of Robot in following applications: i) Hazardous environment. ii) Household work. [12]

[3764]-192
3

-3-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1337

[3764]-201 B.E. (Electrical)

403141 : POWER SYSTEM OPERATION AND CONTROL

(2003 Course)
Time : 3 Hours] [Max. Marks : 100 Instructions to the candidate: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed.

SECTION - I Q1) a) b) State and derive the swing equation. [8] A double circuit line feeds an infinite bus from a power station. If a fault occurs on one of the lines and the line is switched off, derive an expression for the critical clearing angle. [8] OR Explain the terms: [8] i) Critical clearing angle and ii) Critical clearing time. Derive an expression for the critical clearing angle for a power system consisting of a single machine supplying to an infinite bus, for a sudden load increment. [8] Explain the term 'Unit Commitment'. Discuss dynamic programming method of Unit Commitment. [8] Discuss thermal and hydro constraints used for Unit Commitment.[8] OR Explain priority list method of Unit Commitment. [8] Discuss the concept of spinning reserve. [8]
P.T.O.
1

Q2) a)

b)

Q3) a) b) Q4) a) b)

Q5) a) b) Q6) a) b)

Discuss the concept of Automatic Generation and Control.

[9]

Draw a neat sketch, and explain complete block diagram representation of load-frequency control of an isolated power system. [9] OR Discuss the effect of speed governor dead band on automatic generation and control. [9] Write a short note on Digital Load Frequency Controller. SECTION - II [9]

Q7) a) b)

Discuss the concept of real time data processing using state estimation.[8] Draw a neat sketch, and discuss the basic principle of operation of Supervisory Control And Data Acquisition System. [8] OR Explain the basic principle of centralized and decentralized energy control centers. [8] Explain the functions of telemetering unit and data logging unit used for real time control of power system. [8] Discuss the basic principle of operation of FACTS controller. [8]

Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b)

Draw a neat sketch of loading capability curve and explain basic principle of operation of synchronous generator. [8] OR Discuss various schemes of static Var compensation of a power system. [8] Explain the term Sub-synchronous resonance. Explain the term power pools of a power system. Explain the basic principle of energy banking. OR [8] [9] [9]

Q12)Write short notes on. a) Interchange of power between interconnected utilities. b) Economy interchange evaluation. c) Capacity and diversity interchange.

[6] [6] [6]

[3764]-201
2

-2-

Total No. of Questions : 9]

[Total No. of Pages : 3

P1340

[3764]-204
B.E. (Electrical) CONTROL SYSTEMS - II

(2003 Course)
Time : 3 Hours] [Max. Marks : 100 Instructions to the candidate: 1) Answer any one question from each pair of questions Q.No.1 and Q.No.2, Q.No.3 and Q.No.4, Q.No.5 and Q.No.6 from Section I. 2) Questions No.7, 8, 9 from Section II are compulsory. 3) Answers to the two sections should be written in separate answer books. 4) Neat diagrams must be drawn wherever necessary. 5) Figures to the right indicate full marks. 6) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data, if necessary.

SECTION - I Q1) a) Define and explain the terms: i) State iii) State space [8] ii) State variables iv) State equation

b)

Obtain state model by direct decomposition method of a system whose


Y (s ) 5s 2 + 6 s + 8 = 3 transfer function is ( ) . U s s + 3s 2 + 7 s + 9

[8]

OR Q2) a) b) Derive the relationship between transfer function and the state variable model representation. [8] Find the Transfer function of the system having state model,

1 1 & 0 X= X + 0 U and Y = [1 0]X . 2 3


Q3) a) Define and explain the terms i) Eigen values iii) Modal Matrix

[8]

[8] ii) Eigen vector iv) Vander Monde Matrix


P.T.O.

b)

Obtain the eigen values, eigen vectors and modal matrix for

1 0 0 A= 3 0 2 12 7 6
and prove that M1AM = = Diagonal matrix. OR Define STM and explain various methods to obtain it. Using Cayley Hamilton method, find eAt for [8] [8]

Q4) a) b)

1 0 A= . 6 5
Q5) a) b)

[8]

Define controllability and observability applied to state space represented system. Discuss the methods of determining these values. [9] Evaluate controllability and observability of the following models,
0 0 0 40 A = 1 0 3 B = 10 C = [0 0 1] 0 1 4 0 OR

[9]

Q6) a) b)

Derive Ackermann's formula for determination of the state feedback gain matrix k. [9]

& Consider the system defined by X = AX + BU where


1 0 0 0 0 B = 0 A= 0 1 1 5 6 1 By using the state feedback control u = - kx, it is desired to have the closed loop poles at S = 2 j 4 and S = -10. Determine the state feedback gain matrix k. [9]

[3764]-204
2

-2-

SECTION - II Q7) Solve any two : a) Derive an expression for describing function for "Dead zone with saturation Nonlinearity". [9] b) For the system as shown in Fig. 4(a), the nonlinear element is relay with dead-zone. For a step input r = 3 and zero initial condition, draw phase portrait using method of isoclines. [9]

c)

Find solution for following Nonlinear Systems. i) ii)


& x = 3x 3 .
2

[9]

Q8) Solve any two: a) Find equilibrium point and analyze the Liapunov's Stability, for the 2 & & = c, a > [8] system given by v + 2a v v + bv x =1+ x 0, b > 0, c > 0 . b) c) State Stability theorem. Also analyze the stability of the system given by &+ y + (2 + sin t ) y = 0 & [8] y & Using Lyapunov function approach, analyze the stability of the system given by

V (t , x ) = xT P (t ) x where c1 I P(t ) c2 I , t , ci > 0

& x = A (t ) x

[8]

Q9) Solve any two : a) With suitable example, explain the integration of following control system component : Sensors, actuators, relays and switches. [8] b) Detail out the mathematical procedure for optimal control design by calculus of variation method. [8] c) Enumerate qualitative analysis of performance indices used in optimal control theory. [8]

[3764]-204
3

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1341

[3764]-211
B.E. (Electrical)
SWITCHGEAR & PROTECTION (2003 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6)

[Max. Marks : 100

Answer 3 questions from Section I and 3 questions from Section II. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Give the classification of relays and explain in brief the basis for it. [8] b) Derive the torque equation for induction type relay. OR Q2) a) What are the different types of faults occurring on power transmission circuit and state their percentage occurrence with representation. [8] b) What are basic requirements of protective relaying. Q3) a) Explain the phenomenon of Current Chopping. b) What are the factors affecting the restriking voltage. [8] [6] [4] [8]

P.T.O.

c) For a 220 kV system the reactance and capacitance upto the location of circuit breaker is 8 and 0.025 F respectively. A resistance of 600 is connected across the contacts of circuit breaker. Determine the following : [8] i) ii) iii) iv) Natural frequency of operation. Damped frequency of oscillation. The value of resistance which will give damped frequency of oscillation, one fourth of the natural frequency of oscillation. Critical value of resistance which will give no transient oscillation. OR Q4) a) What are the problems associated with SF6 circuit breaker. [8] b) Compare between fuse and circuit breaker on the basis of function, operation, operating time, breaking capacity, replacement. [10] Q5) Explain following terms : a) Pickup & reset value, operating time of relay. b) Plug setting and Time setting. c) Definite characteristic & Inverse characteristic of relay. OR Q6) a) An IDMT type over current relay is used to protect a feeder through 500/ 1 A.C.T. The relay has a P.S. of 125% & TMS = 0.3. Find the time of operation of the said relay if a fault current of 5000 Amp. Flows through the feeder. Make use of following data for characteristic of relay. [7] PSM Time for Unity TMS (100% current = 1 A) 2 10 3 6 5 4.5 10 3 15 2.5 [6] [4] [6]

b) Explain the working principle and operation of Buchholz Relay, with neat diagram. [9]

[3764]-211

-2-

SECTION - II
Q7) a) Explain clearly the Merz -Price protection scheme for protection of power transformer connected in star - delta fashion. [8]

b) A 6.6 kV, 5 MVA star connected alternator has a reactance of 1.5 ohm per phase and negligible resistance. Merz -Price protection scheme is used which operates when out of balance current exceeds 25% of full load current. The neutral of alternator is grounded through a resistance of 8 ohms. Determine the proportion of winding which remains unprotected against earth fault. Also show that the effects of alternator reactance can be ignored. [8] OR Q8) a) For a 10 MVA, 132 kV/6.6 kV power transformer with delta star connections, obtain the number of turns each CT should have, for the differential protection scheme to circulate a current of 5 A in the pilot wires. [8] b) Explain the phenomenon Loss of excitation related to an alternator & explain the protection provided against it. [8] Q9) a) Explain the carrier current scheme of protection, with the help of block diagram. Also discuss how the phase comparison scheme can be used for protecting feeder from i) ii) One end Both the ends. [9]

b) Derive the torque equation of impedance relay and explain its operating characteristics on R-X diagram. [7] OR Q10) a) What do you mean by power swings and arc resistance? Explain the effect of power swings and arc resistance on the performance of the distance relay. [9] b) Explain the directional comparison method of carrier current protection. Why is it used in an impedance or other type of non-unit protection?[7] Q11) a) What are the advantages of static relays over conventional electromechanical relays? Draw a block diagram of a static relay and explain its working. [8]
[3764]-211 -3-

b) What are the different sources of transient over voltages in static relays and how these can be protected? [5] c) Explain the reason why half cycle data window is preferred over the full cycle data window in numerical protective relaying. [5] OR Q12) Write short notes on any three : a) Microprocessor based over current relay. b) Rationalised Haar Transform (RHT). c) Removal of DC off set component from current signal. d) Walsh-Hadamard Transform Technique. e) Time delay ckt in static relays.
rrrr

[18]

[3764]-211

-4-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1342

[3764]-212
B.E. (Electrical)
DIGITAL CONTROL SYSTEMS (403149) (2003 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6)

[Max. Marks : 100

Answer any one question from each pair of questions Q. 1 & Q. 2, Q. 3 & Q. 4, Q. 5 & Q. 6, Q. 7 & Q. 8, Q. 9 & Q. 10, Q. 11 & Q. 12. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, electronic unprogrammable pocket calculator is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Discuss the advantages and limitations of Digital Control System. [8] b) A discrete system is given as : y(n) = x(n + 2). Check whether the system is. i) ii) Static or Dynamic. Linear or Nonlinear. [8]

iii) Shift invariant or Shift varying. iv) Causal or Non-causal. OR Q2) a) State and explain sampling theorem. Also describe reconstruction process. [8] b) Sketch a D.T. signal x(n) = 3n for 1 n 3 and obtain i) ii) y(n) = x(2n) y(n) = 2x(n) + (n)
P.T.O.

[8]

Q3) a) Explain the term Convolution Sum as used in Discrete Time System. Discuss the various methods of computation of convolution in D.T. System. [8] b) Obtain linear convolution of following sequences by multiplication method and then verify the result by Tabulation method : x(n) = {1, 2, 3, 1} h (n) = {1, 2 , 1, 1} OR Q4) a) Draw a neat block diagram for digital speed control of a turbinegenerator unit and explain function of each block. [8] b) Prove that LTI system is completely characterised by Unit Impulse Response h(n). [8] Q5) a) State and prove the Real Translational (Right Shifting) theorem of Z-transform. [6] b) Find the Z-transform of the sequence : i) ii) [12] [8]

1 f(k) = for k = 0, 1, 2, ............... 2


f(t) = eat.sin t. OR [6] [12]

Q6) a) Explain any two methods of obtaining the Inverse Z-transform. b) Obtain Inverse Z-transform of the following :
1 1 z 1 1 2 x(z) = , | z | > -- using partial fraction method. 1 2 1 z 1 4

i)

ii)

x(z) =

1 --- using Residue Method. ( z 1) ( z 3)

[3764]-212

-2-

SECTION - II Q7) a) Show how a mapping of Left Half of the S-plane is done into the Z-plane with stable and unstable regions. [8] b) Examine the stability of the following characteristic equation using Jurys criteria : P(z) = z4 1.2z3 + 0.07z2 + 0.3z 0.08 = 0 OR Q8) a) Describe Schurchons Stability Test as applied to Discrete Time Systems. [8] b) Open-loop transfer function of unity feed-back discrete-time control system with sampling. [8] Period T = 1 sec, is given by : G( z ) = [8]

k (0.3679z + 0.2642) ( z 0.3679) (z 1)

Determine the range of gain K for stability by use of the Jurys stability test. Q9) a) Derive the expression of pulse transfer function from discrete time state space model, with usual notations : x(k + 1) = Gx(k) + Hu(k) y(k) = Cx(k) + Du(k) [8] b) Obtain STM of following difference eq n using Cayley Hamilton

1 1 0 theorem: x(k + 1) = Gx(k) + Hu(k) where G = ; H = [8] 1 0.2 1


OR Q10) a) Derive the solution of a non-homogeneous state equation of a discrete time system from first principles. [8] b) It is desired to place the closed loop poles at S = 3 and S = 4 by a state feedback controller with the control u = kx. Determine the state feed back gain matrix K and the control signal. [8]

1 0 0 x= x + 2 u ; y = [1 0]x 1 3
[3764]-212 -3-

Q11) a) Explain precisely the concept of controllability and observability in case of discrete time state space representation. Discuss the methods of determining these values. [9] b) A state space model is given by

0 1 0 0 2 0 ; H = G= 0 0 3

1 0 1 2 ; C = 2 1

1 1 2 3 1 5 ; D = [0]
[9]

Determine the controllability and observability of this system. OR Q12) a) Write a detail note on Digital PID controller. b) Consider the system represented by
1 0 0 0 x (k + 1) = 0 0 1 x (k ) + 0 u(k ); y(k) = [1 0 0] x(k) 6 11 6 1

[8]

Design a full order observer such that the observer eigen values are at
2 j 2 3 and 5 .

[10]

rrrr

[3764]-212

-4-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1345

[3764]-215
B.E. (Electrical)
DIGITAL SIGNAL PROCESSING (2003 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Your answers will be valued as a whole. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) What are advantages of digital signal processing over analog signal processing? [6] b) Compute linear convolution of the following sequences. i) ii) [6]

x (n) = {1, 1, 1, 1} , y(n) = {0, 1, 0, 1} .

1 x (n) = n for 0 n 3 3
=0 y(n) = 1 =0 elsewhere for 1 n 1 elsewhere. [6]

c) State and explain sampling theorem and nyquist rate. OR

Q2) a) Give the detail classification of discrete time systems with one example each. [6]

P.T.O.

b) Compute cross-correlation of following signal. x(n) = {1, 2, 3, 4} & h(n) = {1, 1, 1, 1} c) Determine whether following systems are i) 1) 2) shift invariant or variant y(n) = x(n) x(n 1) y(n) = n x(n) ii) linear or non-linear

[6] [6]

Q3) a) Explain following properties of z transform. i) Time shifting ii) Scaling iii) Initial value theorem iv) Time reversal.

[8]

b) Determine inverse z transform of the following function using partial fraction. [8]
4 z 2 + 3z 1 + 2 x ( z ) = 1 2 3 1 for causal sequence. 2 z +1 2z

OR Q4) a) Explain significance of ROC in z-transform. b) Find z-transform and ROC in following functions. i) x(n) =
1 for n > 0 3 1 n for n < 0 2
n

[6] [10]

ii)

x(n) = (1)n (2)n u(n 1).

Q5) a) For n = 8, explain Radix-2 DIT-FFT algorithm for computation of DFT. [8]

[3764]-215

-2-

b) Find the circular convolution of following two sequences using matrix method. [8] x(n) = {0, 1, 2, 3} & h(n) = {2, 1, 1, 2} OR Q6) a) Explain Goertzel algorithm for computation of DFT. b) Compute DFT of following sequence. [8]

x (n) = {3, 2, 1, 0} use four point DFT.


SECTION - II Q7) a) Develop Direct Form - II realization of system described by
5 1 + 6 z 1 + 1 z 2 6 H( z ) = 1 z 1 1 z 2 1 2 2

[8]

[6] [6]

b) Compare digital filters with analog filters. OR Q8) a) Explain design of IIR Filter using Bilinear transformation.

c) Explain rectangular and hanning window for digital filter design. [6] [8]

b) Design FIR Filter using rectangular window with pass band gain of unity with cut-off frequency of 200 Hz sampling frequency of 1 kHz. Assume length of impulse response as 7. [10] Q9) a) What are different types of architectures? What type of architecture is used for DSP? [8] b) Explain data address generator and multiplier accumulator with reference to DSP processor. [8] OR Q10) a) With help of neat block diagram explain architecture of TMS 320C5X. [8] b) Compare Digital Signal Processor with general purpose microprocessor. [8]
[3764]-215 -3-

Q11) Explain how DSP is used for a) Power Factor Correction. b) Harmonic analysis. OR Q12) a) Explain control of 3 induction motor using DSP. b) Explain spectrum analysis using DFT. rrrr

[16]

[8] [8]

[3764]-215

-4-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1348

[3764]-231
B.E. (E & TC)

TELECOMMUNICATION NETWORK MANAGEMENT


Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Assume suitable data, if necessary. [Max. Marks : 100

SECTION - I Q1) a) Explain the major components of a Telecom Network. b) What is DSL? Classify DSLs. Explain ADSL in detail. OR Q2) a) Explain Distance Vector Routing in detail. Differentiate between Distance Vector and Link-State Routing. [12] b) Explain Dijktras Algorithm for finding shortest path. Q3) a) Explain the design issues of a network. OR Q4) a) Mention similarities and differentiate between SONET & SDH. Explain in detail the STS-1 Frame. [8] b) What are the different Fixed Wireless LAN Technologies? Explain LMDS in detail. [8] Q5) a) Explain Hierarchical Routing & Broadcast Routing. [9] [4] [8] [8] [8]

b) Explain the circuit switching, packet switching & virtual switching. [8]

b) Explain ISDN Protocol Architecture. Explain reference points and functional grouping in ISDN. [9] OR
P.T.O.

Q6) Write short notes on Any Three : a) Network functions. b) WLL. c) Routing d) Wi-Max. e) Cable Modems & Leased Lines. SECTION - II

[18]

Q7) a) Explain TMN Building Blocks & TMN Cube. [8] b) Explain parameters which judge performance of a Telecom Network.[8] OR Q8) a) Explain ATM cell header format. [8] b) Explain Congestion Control in Frame Relay & how it is resolved? Compare Frame Relay over X.25 services. [8] Q9) a) Explain in brief the various Network attacks and protection mechanisms in detail. [8] b) Explain the different logical planes of a TMN. [8] OR Q10) a) Describe the features of Configuration Management Systems. [8] b) Explain QOS model & discuss priority levels. [8] Q11) a) Which layer is responsible for providing QOS? How that layer provides QOS? [9] b) Explain SNMP protocol in detail. [9] OR Q12) Write short notes on Any Three : [18] a) Performance Management Architecture. b) LAN, MAN, WAN. c) Flooding Algorithm. d) Jitter, Bandwidth & Delay in Telecommunication Networks. e) SS> Protocol Architecture.
rrrr [3764]-231 -2-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1351

[3764]-242 B.E. (Electronics)


ELECTRONIC PRODUCT DESIGN

(2003 Course)
Time : 3 Hours] [Max. Marks : 100 Instructions to the candidate: 1) All questions are compulsory. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) With the help of a suitable example, explain steps taken to arrive at technical specification of a product to be manufactured on large scale. Explain how techno-commercial feasibility of a product is judged subsequently. [10] Draw a sketch of front panel of a Digital Multimeter and explain how ergonomic and aesthetic design considerations are taken care of in the same. [8] OR For following established practices of reducing Electromagnetic Interference, explain with the help of neat sketches the exact mechanism by which EMI is reduced - i) Twisted pair of wires, ii) Transzorb, iii) Shielding. [12] A Multivibrator circuit uses 2 transistors, 8 resistors, 2 capacitors and 2 diodes. It is followed by a buffer circuit consisting of one transistor and three resistors. If the failure rates of various components are as given below, find MTTF of the circuit in years. [6] Component Resistor Diode Capacitor Transistor Failure rate per 106 hours 0.6 0.2 0.6 0.65
P.T.O.
1

b)

Q2) a)

b)

Q3) a)

Two tracks on a 1.6 mm thick PCB laminate have a parallel run of 12 cm on opposite faces of a double sided PCB. The track thickness is 35 micron and the track width is 0.4 mm. If the relative dielectric constant of PCB laminate is 4.2 and conductivity of copper to be 1.72 106 Ohm-cm, calculate the -3dB frequency of the low pass filter formed by parasitic components with above geometry. Assume that parasitic R and C are lumped. [8] b) Calculate the inductance of a PCB track having length of 10 cm and width of 0.4 mm. Track thickness is 35 microns. Compare the inductance of track if its width is reduced to half. [8] OR Q4) Discuss the mechanism of generation and preventive methods for following phenomena in High-speed PCB Designs - (i) Crosstalk, (ii) Reflections (iii) Skin Effect, (iv) Ground Bounce. [16] Q5) In the context of Digital Storage Oscilloscope (DSO), explain the factors that determine the choice between following alternatives. Justify your choice with reasoning. (i) ALT and CHOP mode, (ii) Normal and AUTO modes, (iii) AC and DC coupling, (iv) Real and Equivalent time sampling, (v) CH1 and CH2 triggering, (vi) Edge and Level triggering, (vii) TV and Line triggering. [16] OR Q6) a) Draw the circuit diagram of Class AB audio power amplifier with driver stage and explain how you will carry out DC analysis on the above circuit. Also explain what important information you can derive from AC analysis for above circuit? [8] b) Explain the meaning of term - Signal Integrity. Also explain with the help of neat sketches how it is affected by limited (i) Bandwidth, (ii) Sampling rate, (iii) Memory depth and (iv) Impedance of probe.[8] SECTION - II

Q7) With the help of suitable example, explain how various phases of software design are detailed out. The discussion should include phases like - Problem definition, Software structure diagram, Modular programming, Testing and debugging. [18] OR Q8) Discuss the advantages and limitations of following methods and tools of software debugging - (i) Single stepping, (ii) Break points, (iii) Software simulators, (iv) Emulators, (v) Integrated Development Environment (IDE). [18]
[3764]-242
2

-2-

Q9) a)

For electronic products listed below, explain with justification the type of environmental tests necessary - (i) An Industrial Controller, (ii) Washing Machine, (iii) Mobile Phone, (iv) Bedside ECG Monitor. [8]

For above products, explain with justification the type of EMI/EMC tests that will be necessary. [8] OR Q10)Explain why electronic products are required to be tested for - (i) Conducted EMI, (ii) Radiated EMI, (iii) Conducted Susceptibility, (iv) Radiated Susceptibility. For each of the above type of test, give a suitable practical example to explain the mechanism that upsets normal working of electronic products. [16] Q11)With the help of neat diagrams explain the significance of following in context of PCB fabrication and assembly - (i) Drilling details, (ii) Edge clearances, (iii) Component Assembly diagram, (iv) Plating on PCB tracks, (v) Solder Mask, (vi) Laminate grade. [16] OR Q12)a) What do you understand by the term - Bare Board testing? In what situations it is recommended to get PCBs bare board tested? Why?[4] b) Draw circuit diagram of Linear Regulated Power Supply (from AC Mains entry) and draw up the Bill of Materials for the same in tabular form. How will you write Product Test Specifications for the regulator? [12]

b)

[3764]-242
3

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1355

[3764]-257
B.E. (Electronics)
DIGITAL IMAGE PROCESSING (2003 Course) (404212)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6)

[Max. Marks : 100

Answer Q. 1 or Q. 2, Q. 3 or Q. 4, Q. 5 or Q. 6, Q. 7 or Q. 8, Q. 9 or Q. 10 and Q. 11 or Q. 12. Answers to the two sections should be written separately. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary. Use of electronic pocket calculator is allowed.

SECTION - I Q1) a) Explain any one technique for image acquisition in detail. [8] b) Write the various ways of finding distance between two pixels. State the significance of distance finding. [8] OR Q2) a) What is Moire' pattern effect? Why does it occur? Suggest techniques to remove this effect from an image. [8] b) Consider the image segment shown.
3 1 2 1(q ) 2 2 0 2 1 2 1 1 ( p) 1 0 1 1

Let V = {0, 1} and compute the lengths of the shortest 4, 8 and m paths between p & q. If a particular path does not exist between these 2 pixels, explain why? [8]
P.T.O.

Q3) a) Compute the 2D DFT of the 4 4 grayscale image given below :[10] f (m, n) = 1 1 1 1

1 1 1 1 1 1 1 1 1 1 1 1

b) What is colour space? Mention various types of colour spaces with their specific applications. [6] OR Q4) a) Explain Hadamard Transform. Derive Hadamard matrix for N = 4.[8] b) Explain HSI colour model in detail. Q5) a) Perform histogram equalization of the image I= [8]

4 4 4 4 4 3 4 5 4 3 3 5 5 5 3 3 4 5 4 3 4 4 4 4 4

containing graylevels from 0 to 7. Also draw the histograms before and after equalization. [10] b) Write a note on : i) ii) Contrast stretching. Unsharp masking. OR Q6) a) Justify the statement Median filter is an effective tool to minimize salt & pepper noise considering the image I = 24 22 33 25 22 24 34 255 24 0 26 23 23 21 32 31 28 26 [10] [8]

[3764]-257

-2-

b) What is meant by pseudo coloring? Explain its application. Explain how a pseudo coloured image can be obtained? [8] SECTION - II Q7) a) What is RLC? Which type of redundancy is exploited by RLC? Derive RLC codes considering an 8 8 binary image. [8] b) Calculate the efficiency of Huffman code for the following symbol whose probability of occurrence is given below : [8] Symbol a1 a2 a3 a4 OR Q8) a) Explain the Huffman coding for image compression considering an example. [8] b) What is redundancy? How redundancy can be an effective tool for image compression? Explain any one redundancy and suggest a compression technique to get rid of it. [8] Q9) a) A binary image X and the structuring element B are given as follows : Probability 0.9 0.06 0.02 0.02

0 0 0 0 0 0 0 1 1 1 0 0 0 1 1 1 0 0 0 0 1 1 1 0 0 0 1 1 1 0 0 0 0 0 0 0 X
Perform : y1 = X
0 1 0 1 1 1 0 1 0 B

B and y2 = X B. OR

[10] [6]

b) Explain the algorithm for adaptive thresholding.

[3764]-257

-3-

Q10) a) Derive the kernel for second order derivative for detecting edges. Compare its performance with first order derivative. [8] b) Write the algorithm for finding chain codes in 4 direction & 8 direction. [8] Q11) a) Explain various noise models occurring in an image. [8]

b) Explain with the help of block diagram, the steps required for finger print recognition system. Suggest the algorithms for each block. [10] OR Q12) a) Explain Weiner filtering. [8] b) Explain with the help of block diagram, the steps required for remote sensing application of Image processing. Also suggest the algorithms for each block. [10]
rrrr

[3764]-257

-4-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1359

[3764]-289 B.E. (Instrumentation & Control)


PROCESS INSTRUMENTATION - II (1997 & 2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answers to the two sections should be written in separate answer books. 2) Figures to the right indicate full marks. 3) Neat diagrams must be drawn wherever necessary. 4) Assume suitable data, if necessary.

SECTION - I Q1) a) With reference to spherical heat exchanger, explain given statement with neat instrumentation scheme: 'Feedback control by throttling coolant inlet is a nonlinear variable gain process'. [8] Draw a neat instrumentation scheme using a temperature flow cascade loop for steam-reboiler. Explain how it will be tuned? [8] OR Draw and explain simplified block diagram of a chiller unit. Clearly show all components along with flowing mediums. [8] Explain 'ON-OFF control' of small industrial refrigeration unit. How to increase its efficiency? [8] Does conversion equations and conversion versus temperature characteristics differ depending on type of reactor? Explain your answer with reference to plug flow and continuous stirred tank reactor. (No instrumentation scheme expected.) [8] For a chemical reactor process, which four interacting time lags are present? Show with a neat reactor diagram, with coolant inlet valve, a temperature controller and a circulation pump for coolant. [8] OR Write a short note on Reactor Safety. [8]

b)

Q2) a) b) Q3) a)

b)

Q4) a) b)

Differentiate between Batch Reactor and continuous reactor control.[8]


P.T.O.

Q5) a)

Select proper option: i) Clear liquids - low viscosity.

[8]

A) Radial flow centrifugal pumps are suitable for : ___________ . ii) Clear liquids - high viscosity. iii) Thin slurries or suspensions. iv) Viscous or thick slurries and sludges. v) Raw sewage and heavy suspensions. vi) All i, ii, iii and iv. vii) None of these. B) C) Axial flow and mixed flow pumps are suitable for : _________ . (Select option from 'i' to 'v'). Reciprocating piston pumps are suitable for ___________ . i) 'i' only. ii) 'ii' only. iii) 'vi' iv) 'vii' D) Diaphragm pumps are suitable for ___________ . i) 'iii' only. ii) 'v' only. iii) 'vi' iv) 'vii' b) c) List four factors that may affect pump capacity. [4] For given pump types, methods of controls are mentioned. You have to write pump types on right hand side: [6] Method of control ON-OFF Throttling valve control Speed control Stroke adjustment Possible control type ON-OFF Throttling ___________ ___________ ___________ ___________

Given pumps : Centrifugal, rotary, reciprocating.


[3764]-289
2

-2-

Q6) a) b)

OR Enlist different capacity control methods of compressors. [8] To detect surge in a compressor, which sensor / transmitter is used among following? [4] Why? Three options are as: Pneumatic transmitter or electronic d/p cell or diffused silicone d/p cell. Can we use closed loop ultimate oscillation method for tuning the controller in the surge control loop? Explain in brief 'tuning the controller for surge loop'. [6] SECTION - II

c)

Q7) Select proper option and rewrite the sentence: a)

[16]

Load on a steam boiler refers to the amount of _______ demanded. i) Feed flow ii) Steam iii) Drum level iv) pH of feedwater The position of oxygen analyzer in a boiler is near _______ . i) Induced draft fan ii) Forced draft fan iii) Steam drum iv) Windbox Vortex shedding meter The position of _______ is in stock path. i) Super heater headers ii) iii) FD fan

b)

c)

iv) FW heater

d)

The reasons why dampers are undesirable as final control elements include their _______ . i) hysteresis ii) nonlinearity iii) leakage iv) all of the three The best method of controlling air flow is to eliminate the damper completely and throttle the fan itself. True or false? Use of orifice meter for steam and water at 10% of flow, is it recommanded or not recommanded? Coriolis mass flow meter is preferred for gaseous fuels. True or False? Attemperator is used to control _______ in a faster way. i) drum level ii) steam temperature iii) fuel flow iv) air fuel ratio
-3-

e) f) g) h)

[3764]-289
3

Q8) a)

OR Explain parallel closed loop control with air and fuel limiting. What is its advantage? Draw the instrumentation scheme required for the same. [8] Explain three element feedwater system with three alternatives. [8]

b) Q9) a) b)

Write a short note on 'Back propagation neural network used in continuous fractionating column'. [8] Draw a neat instrumentation scheme for 'method of distillation column automation through suboptimization control stage' and explain the same. [8] OR What are process complexities in Distillation Column Control System? How feed forward control takes care of such complexities; explain.[8] Explain composition control of two products of Binary Distillation Column Unit. [8] Obtain equations of steady state model of Double effect evaporator. Explain cascade control scheme used in multieffect evaporators. [10] [8]

Q10)a) b)

Q11)a) b)

Write a short note on crystalizer control instrumentation. OR Q12)Write notes along with instrumentation (if required) schemes for: a) b) c) Spray Dryers. Application of evaporators. Turbo dryers.

[6] [6] [6]

[3764]-289
4

-4-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1363

[3764]-325 B.E. (Chemical)


ENVIRONMENTAL ENGINEERING (Elective) (Theory) (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidate: 1) Answer any three questions from each section. 2) Answer to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) d) Name and describe the four layers of the atmosphere. What are the primary pollutants? What are the secondary pollutants? Give examples. Explain the relationship between the adiabatic lapse rate of rising plume of stack gas and the ambient lapse rate. Name and define the two types of inversions. Which types prompts the formation of fog? [16] OR Name five natural removal mechanisms at work in the atmosphere. Which is the most important particulate removal mechanism. [8] What are two broad approaches to control of air pollution emissions. Explain in detail. [8] [16]

Q2) a) b)

Q3) Write short notes on; a) b) c) d) NDIR spectrometry. Isokinetic sampling. Selection of particulate collector. Fabric filter.

P.T.O.
1

OR Q4) Write note on any four of the following; a) b) c) d) e) Q5) a) b) Ozone depletion. Chemical pollution. Effect of air pollution on human health. Air pollution laws and standards. Control of air pollution in automobiles.

[16]

Draw a neat sketch of cyclone separator. Compare the dimensions of conventional and high efficiency cyclone. [6] An air stream with a flow rate of 500 m3/min is passed through a standard cyclone of diameter 2 m. [6] i) Determine the cutsize for particles with density of 1.5 g/cc. ii) What will be the cutsize if same velocity was maintained in multiple cyclone of 400 mm diameter. Data :- Number of effective turns 5, Viscosity of air 2 105 kg/ms. List and compare different particulate emission control techniques.[6] OR A plate type electrostic precipitator for use in cement plant for removing dust particles consists of 10 equal channels. The spacing between the plates are 0.15 m and the plates are 2 m high and 2 m long. The unit handles 10,000 m3/hr of gas. What is the efficiency of collection. What should be the length of plates for achieving 99% collection efficiency if other condition are same. Where Vpm = 0.1 m/sec. [8] A conventional cyclone with diameter 1 m handles 3.0 m3/sec of standard air carrying particles with a density of 2000 kg/m 3. For Ne = 6, determine the cutsize, where a = 0.5 m, p = 2000 kg/m3, g = 1.81 105 kg/m.sec. [4] Explain the gravity settling Chamber with neat sketch. SECTION - II [6]

c) Q6) a)

b)

c)

Q7) Explain the basic concept of the activated sludge process and indicate the advantages and disadvantages of the two major kinds of activated sludge reactors, with neat diagram. [18] OR
[3764]-325
2

-2-

Q8) a)

Define and describe the components of: i) Primary treatment. ii) Secondary treatment. iii) Tertiary treatment.

[10]

b) Q9) a)

What are the major types and sources of grit in municipal waste waters. Describe the treatment methods used to remove grit. [8] Define and explain the significance of following parameters in activated sludge process. [12] i) Volumetric loading rate. ii) Food to mass ratio (F/M). iii) Hydraulic retention time. iv) Mean cell residence time. v) Recycle ratio. vi) Mixed liquor suspended solids (MLSS). What are the nine categories of water pollutants. [4] OR The following BOD results were obtained from a stream sample at 26 oC. t, d i) ii) 0 1 3 2 5.4 3 7 4 8.3 5 9 6 7 8 9 Y mg/L 0 9.6 9.8 10 10.1

b) Q10)a)

Compute the reaction rate constant K and the ultimate first stage BOD, using least square method. [8] Compute the reaction rate constant at 20 oC, = 1.047.

b)

A large stream has a rate of retention (base e) K2 = 0.45 d1 and the rate of deoxygenation K1 = 0.25/day. The dissolved oxygen deficity (DO) of a mixture of water stream and the waste water at the point of reference is 1.5 mg/L and the ultimate BOD of waste (Lu) is 65 mg/L. Calculate [8] the critical time (tc) and the critical deficity (Dc).

Q11)Discuss how you would run a sanitory landfilling operation in your city. Be sure to include the technical, economical considerations. [16] OR Q12)List in a tabular form the advantages and disadvantages of the following methods of solid waste disposal in detail. Incineration, sanitory land fill, composting and pyrolysis.
[3764]-325
3

[16]

-3-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1371

[3764]-353
B.E. (Polymer Engg.)
POLYMER COMPOSITES & BLENDS (2003 Course) (409363)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answers to the two sections should be written in separate books. Draw neat diagrams wherever necessary. Numbers to the right indicate full marks. Assume suitable data, if necessary. Use of logarithmic table, electronic pocket calculators is allowed.

SECTION - I Q1) a) Discuss the role of polymeric modifier for achieving improvement in the Impact Strength, Heat Deflection temperature and Chemical Resistance, Flame resistance of the polymer blends. [8] b) Explain the merits and demerits of solution blending over melt blending. [8] c) Discuss the term polymer alloys. OR Q2) a) Discuss with one example how to achieve the selection of the polymers to prepare the polymer blends. [6] b) Draw and explain in detail the schematic representation of the steps to be taken when developing polymer alloys and blends with a specified set of desired performance characteristics. [10] c) Discuss the term polymer blend. [2] [2]

Q3) a) Discuss Equilibrium Morphology and phase inversion concept in polymer blends. [8] b) Distinguish between Coupling agent Vs Compatibilizer. OR
P.T.O.

[8]

Q4) a) Discuss then role of thermodynamics in polymer blend technology.[8] b) Discuss with the example the principle of Compatibilization by the addition of block and graft copolymer with suitable examples. [8] Q5) a) Write a note on Rheology of Polymer blends. b) Explain the followings : i) ii) Semi-IPN Sequential-IPN OR Q6) Write a note on the followings : a) Toughened PA6. b) Blends of PPO/PS. c) Interpenetrating Polymer Network. d) Commercial Blends of PP. SECTION - II Q7) Explain with two examples the functions of the following constituents in composite manufacturing : [18] a) Gel Coat, c) Reinforcement, e) Fillers, g) Accelerator, i) Pigments. OR Q8) a) What are different types of polyester resin used in composite? How they classified? Explain heat resistance and low shrinkage polyester resin. [8] b) State different types of glass used in composite? What factors to be considered for the selection of reinforcement? Explain types of reinforcement on basis of pattern of weaving? What are carbon fibers? [10] b) d) f) h) Mold Release Agent, Matrix, Curing Agent, Adhesion Promoters, [16] [8] [8]

[3764]-353

-2-

Q9) a) Differentiate between Hand layup and Spray layup techniques. b) Explain Pultrusion process with neat sketch. c) Discuss different types of winding pattern in filament winding. OR

[4] [8] [4]

Q10) a) Differentiate between Vacuum bag forming and Pressure bag forming. [4] b) Explain Resin Transfer Molding process with neat sketch. [8] c) Explain effect of process parameters on properties of spray layup technique products. [4] Q11) a) Trouble shooting in Hand Lay Up Technique. [8]

b) State the repair techniques used in composite. Explain the repairs technique used for macro cracks in composites. [8] OR Q12) a) Discuss the Nanocomposites with one example. b) Trouble shooting in Filament winding Technique.
rrrr

[8] [8]

[3764]-353

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1372

[3764]-396 B.E. (Petrochemical)


NOVEL SEPARATION PROCESSES (Elective) (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidate: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) Attempt the following: a) b) c) Classify membrane separation processes by giving examples. Discuss in brief on: adsorptive bubble separation techniques. [18]

Explain in brief the selection criteria for chemical engineering separation processes. OR Q2) Classify the models for gas separation by membranes. Develop cross flow model for membrane separation processes. State the assumption made. Discuss the solution strategy for different cases. [18] Q3) a) A 9-micron tubular membrane is used to recover salt A from a dilute solution. The solutions to either side are at 0.028 and 0.004 kmol/m3, with mass transfer coefficients of 3.5 105 and 2.25 105 m/s respectively. The distribution coefficient is 0.85 and the diffusivity of A in the membrane is 275 1011 m2/s. i) Calculate the percentage of total resistance to mass transfer contributed by the membrane. ii) Calculate the membrane area needed to allow recovery at 0.015 kmol/hr. Flow inside the tube is turbulent and mass transfer follows the Gilliland. Sherwood and Linton correlation. If the velocities of both solutions are doubled. What will the membrane resistance now be? [8]
P.T.O.
1

b)

Q4) a)

A liquid containing dilute solute A at a concentration 3 102 kgmol/m3 is flowing rapidly by a membrane of thickness. 3 105m. The solute diffuses through the membrane and its concentration on the other side is 0.55 102 kgmol/m3. The mass transfer coefficient kc1 is large and can be considered as infinite and kc2 = 2.22 105m/s. Data: Distribution coefficient = K = 1.55 and Diffusivity. DAB = 8 1011m2/sec in the membrane. i) Derive the equation to calculate the steady state flux. NA and make a sketch. ii) Calculate the flux and concentration at the membrane interfaces.[8] OR A membrane is to be used to separate a gaseous mixture of A and B in one of the chemical complex near Mumbai. The following information is known: Feed flow rate = 3 105 cm3 (STP)/s Feed composition of A = 0.55 mole fraction Desired composition of reject = 0.25 mole fraction Thickness of membrane = 2.55 103 cm Pressure on feed side = 100 cm Hg Pressure on permeate Side = 25 cm Hg Permeability of A.PA = 201010cm3(STP).cm/(s.cm2.cm.Hg) Permeability of B, PB = 101010 cm3(STP).cm/(s.cm2.cm.Hg) Assuming complete mixing model, calculate the following i) the permeate composition ii) the fraction permeated iii) membrane area [9] Reverse osmosis of salt solution at 25oC is tested with a 5 103m2 cellulose acetate membrane. On one side of the membrane is 1 mol NaCl/kg H2O solution at 60 atmospheres (abs.) pressure, on the other is 0.01 mol NaCl/kg H2O at atmospheric pressure. The permeation rate is 96.12 ml/hour. Find the solvent permeability and the rejection rate. [7] [16]

b)

Q5) Write short notes on: a) b) c) Energy requirement for separation processes. Diffusion type model for Reverse osmosis. PSA and TSA - Principles and applications.
-2-

[3764]-396
2

Q6) a)

OR A heart-lung machine uses a 0.175 mm silicone rubber membrane with a permeability of 6.40107 cm3O2(STP)mm/s.cm2cmHg. The machine is to supply 35 cm3/min of oxygen to a patient, where the partial pressure of oxygen in the blood is the equivalent of 30 mmHg. The machine is supplied with pure oxygen at 700 mmHg. so gas film resistance can be neglected. If the resistance on the blood side were neglected also, how large would the membrane need to be? [7] Explain in brief the basic process principles involved in Reverse Osmosis. State the industrial applications. [9] SECTION - II

b)

Q7) Answer the following: [18] a) Differentiate physical and chemical adsorption. b) Give classification of Chromatographic separations. c) Discuss the concept of retention and equilibrium for chromatography. d) Define Capacity factor and selection factor. OR Q8) Activated carbon is used to adsorb ethanol vapor from an airstreams. Activated carbon is used to adsorb ethanol vapour from an airstreams. The lab. experiment to investigate this has a bed 5 cm in diameter and 15 cm high. Exit data for an input of 0.75 liter/second are as follows: Data: Time 0 3 (hours) C/C 0 a) b) c) Q9) a) 3.5 4 4.5 5 5.5 6.0 6.2 6.5 6.8

0 0 0.002 0.030 0.155 0.396 0.658 0.903 0.946 0.978 0.993

Determine breakthrough time if break point is at C/C0 = 0.05. Calculate the height of a new column of the same diameter that has breakthrough at 8 hours. Calculate the diameter of this new column if it is to process 5 liter/min. [18] Discuss in brief the process principles involved in Pressure Swing Adsorption (PSA) and Temperature Swing Adsorption (TSA) with industrial applications. [8] Discuss the process principles involved in elution chromatography and derive the retention equation. [8] OR
-3-

b)

[3764]-396
3

Q10)a)

Two solutes have a relative retention of = 1.08 and capacity factor, k1 = 5 and k2 = 5.5. The number of theoretical plates is nearly the same for both the compounds. How many plates are required to give a resolution of 1.5? and of 3? If the plate height is 0.2 mm, how long must the column be for a resolution of 1.5? [8] The retention ratio in chromatography is defined as: R = tM/tR Show that R is related to the capacity factor, given by equation. R = l/k+1

b)

[8]

Q11)a)

Define the following terms in connection with chromatographic separations and give appropriate equations: [8] i) Retention Ratio (R) ii) Capacity factor (k) iii) Separation factor () iv) Resolution (Rs). Two amino acids, glycine and alanine, were separated by liquid chromatography with the following results: Amino Acid Glycine Alanine TR, (minutes) 4.3 5.0 W (minutes) 0.5 0.6

b)

i) Calculate the resolution of amino acids. ii) Calculate the plate number for alanine. iii) What is the minimum plate numbers needed to provide a resolution of 1.5 ? iv) How do you get this high plate number? [8] OR Q12)Write short notes on: [16] a) b) c) d) Reactive Separations. Parametric Pumping. Bioseparation. Isoelectric Focusing.

[3764]-396
4

-4-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1374

[3764]-412 B.E. (Computer Engg.)


OPERATING SYSTEMS (410442) (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answers to the two sections should be written in separate books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Explain in brief different types of semaphores. Discuss Reader / Writer problem using semaphore. [10] Discuss the Hardware approach to achieve mutual exclusion. [6] OR Explain the structure of monitor. Discuss Producer / Consumer problem using monitor. [10] Explain in brief the following terms: i) Busy waiting. ii) Critical Region. [6]

Q3) a)

b)

Q4) a) b)

Explain the following: [8] i) Necessary conditions for deadlock. ii) Methods of deadlock recovery. State and explain different methods for user authentication and security. [8] OR Explain Banker's algorithm with example. [8] Compare various access matrix schemes of implementation and revocation with respect to each other. [8]

P.T.O.
1

Q5) a) b) Q6) a) b) c)

Explain with neat diagram scenarios for retrieval of a buffer. [10] Explain the file subsystem and data structures used in it. [8] OR Explain the three layer architecture of Unix kernel in detail with neat diagram. [10] Explain the structure of buffer header. [4] Explain the advantages and disadvantages of buffer cache. [4] SECTION - II Discuss the algorithm for allocation of disk block with example. [8] Explain the different types of pipes in detail. [10] OR Explain following system call in brief: [8] i) chown ii) chmod iii) stat iv) fstat What is inode? Explain in detail disk inode and incore inode. [10]

Q7) a) b) Q8) a)

b) Q9) a) b) Q10)a)

b) Q11)a) b) Q12)a)

What is context of a process? Explain with neat diagram components of context of a process. [10] Explain the process creation using fork system call. [6] OR Explain the following concepts: [8] i) U area ii) signals Explain process scheduling in Unix with example. [8] Explain various data structures used in demand paging. [8] Explain in detail driver entry points and role of device switch table for accessing the device. [8] OR Write a note on following : [8] i) Handling of Page fault. ii) Allocation of swap space. Write a note on disk Driver. [8]
-2-

b)

[3764]-412
2

Total No. of Questions : 12]

[Total No. of Pages : 7

P1386

[3764]-453
Final Year B.Tech. (Biotech.)

416283 : BIO-PROCESS EQUIPMENT DESIGN (2003 Course) (Sem. - I)


Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) Figures to the right indicate full marks. Use of Programmable calculator is not allowed. Draw a neat sketch wherever necessary. Make necessary assumptions wherever required. Answer any Three Questions from Section I and any Three Questions from Section II. [Max. Marks : 100

SECTION - I Q1) a) Explain the construction and working of centrifuge discharge filter.[10] b) A chromatographic separation of two component samples on a 40 cm column gave the retention times for two solutes as 8.5 and 10 min. respectively. Calculate the following : i) ii) No. of theoretical plates. Plate height.

iii) Resolution of peaks. The base width of two chromatographic peaks are 0.6 and 0.8 min.[8] OR Q2) a) State the principle of partition chromatography with suitable example. [6] b) Write short note on : i) ii) Rotary disc filter. Leaf filter.
P.T.O.

[12]

Q3) a) Explain the criteria for the selection of vessels operating at low temperatures. [6] b) State normal conditions and transient conditions for operation of pressure vessels. [10] OR Q4) a) Explain different types of pipe joints with neat sketches. [6]

b) Describe downstream processing operations used in fermentation process. [10]

Q5) a) Explain the methods of attachment of formed heads to the shell. b) Design pressure vessel from following data : Shell Inner dia 1000 mm Material-Stainless steel Internal pressure Permissible stress 1.5 N/mm2 180 N/mm2

[6] [10]

Head Type Flanged and Shallow dished Outer dia Crown radius Knuckle radius Nozzle Welded to shell Max. permissible stress 128 N/mm2 Inner dia Thickness Bolts-Material-Mild Steel OR
[3764]-453 -2-

1000 mm 1000 mm 79 mm

189 mm 3.0 mm

Q6) a) Explain autofrettage and shrinkfit construction of high pressure vessel. [6] b) Design high pressure vessel using maximum shear stress theory from following data : [10] Internal diameter of shell Internal pressure External pressure Material Permissible tensile stress Modulus of Elasticity 20 cm 140 N/mm2 atmospheric High tensile steel 478 N/mm2 2*105 N/mm2

SECTION - II Q7) a) Describe with neat sketch design of Spiral heat exchanger. b) Design shell and tube heat exchanger from following data : Shell side No. of passes - 1 Material - Carbon steel Corrosion allowance - 3 mm Fluid - Water Inlet temp. 30C; Outlet temp. 65C Working pressure - 0.48 N/mm2 Design pressure - 0.7 N/mm2 Nozzles - Inlet & Outlet 110 mm Tube side Material - Stainless steel No. of tubes - 40 Pitch - square 22 mm Outer dia - 55 mm Length - 1300 mm [6] [12]

[3764]-453

-3-

Fluid - Nitrous oxide Inlet temp. 98C; Outlet temp. 70C Permissible stress - 480 N/mm2 Nozzles Vent & Drain - 30 mm Material - Carbon steel Permissible stress - 280 N/mm2 Shell cover Dished head Crown radius 678 mm Knuckle radius 72 mm Channel & Channel cover Material - Carbon Steel Permissible stress - 98.2 N/mm2 OR Q8) a) Explain the construction of basket type short tube vertical evaporator.[6] b) Design the vertical short tube evaporator from following data : Evaporator drum External pressure Heating surface required Steam pressure Density of liquid Density of vapour Material Permissible stress Modulus of Elasticity Modulus of Elasticity 0.15 N/mm2 280 mm2 0.25 N/mm2 8500 N/m3 0.90 N/m3 Evaporator-Carbon steel Tubes-Brass 98 N/mm2 19.8*104 N/mm2 8.87*104 N/mm2 [12]

[3764]-453

-4-

Q9) a) Design vessel shell with half coil jacket from following data : Vessel shell with inner dia Jacket inner dia Jacket length Width of channel jacket Internal pressure (shell) Internal pressure (jacket) Allowable stress E at 20 C Poissons ration 1000 mm 1200 mm 1500 mm 80 mm 0.60 N/mm2 0.29 N/mm2 98 N/mm2 190*103 N/mm 2 0.3 1000 mm 1000 mm 98 mm

[10]

Flanged and dished head Inner dia Crown radius Knuckle radius -

b) Explain various types of jackets with neat sketches. OR

[6]

Q10) a) Design shaft & blade of turbine agitator which is running in vessel of 1800 mm diameter using critical speed criteria. [10] Internal pressure of vessel Diameter of agitator Speed (max.) Liquid in vessel Specific Gravity 0.35 N/mm2 200 mm 400 rpm 1.18, Viscosity - 450 cP

Overhang of agitator shaft between bearing and agitator - 1000 mm Agitator blade nos Width of blade
[3764]-453 -5-

6 65 mm

Thickness of blade

8 mm

Shaft Material - Rolled steel permissible stress - 55 N/mm2 Tensile stress E 310 N/mm2 19.8 N/mm2 [6]

b) Explain shaft design based on critical speed.

Q11) a) Explain the design of plate type column with downcomer. b) Design the fractionating column from following data : Shell Dia Design pressure Working temp. Design temp. Material Permissible stress Head Trays Sieve type No. Spacing Holes Thickness Weight of attachment Weight of liquid and tray Weight of column Wind pressure OR
[3764]-453 -6-

[6] [10]

2000 mm 1.2 N/mm2 135C 160C Low carbon steel 78.8 N/mm2 Elliptical welded to shell 40 0.5 m 2 mm 1.8 mm 1000 N/mm2 1200 N/mm2 1200 kgs 1780 N/mm2

Q12) a) Explain the design of liquid distributors and redistributors.

[8]

b) Explain the segmental downcomer, chord type downcomer, circular type downcomer with neat sketches. [8]
rrrr

[3764]-453

-7-

Total No. of Questions : 12]

[Total No. of Pages : 6

P1393

[3764]-131 B.E. (Mechanical)


MECHANICAL SYSTEM DESIGN

(2003 Course)
Time : 4 Hours] Instructions to the candidate: 1) 2) 3) 4) 5) Answer three questions from Section I and three questions from Section II. Answers to the two sections should be written in separate answer book. Neat diagrams must be drawn wherever necessary. Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary. [Max. Marks : 100

SECTION - I Q1) a) b) Derive the equation for the thickness of a thick cylinder subjected to internal pressure by maximum shear stress theory. [6] A cylindrical pressure vessel shell of inside diameter 1500 mm is subjected to an internal pressure of 2 MPa. The shell as well as the heads are made of low alloy steel with sult = 450 MPa. Double welded butt joints which are spot radiographed are used to fabricate the vessel. Corrosion allowance is 3 mm. Determine the thickness of the cylindrical shell and thickness of head if the heads are i) ii) Flat Plain formed [12] OR Q2) a) Describe with sketch different types of supports used in horizontal pressure vessels. [6]

iii) Torispherical with crown radius of 1125 mm.

P.T.O.
1

b)

Design a skirt support for a vertical pressure vessel with following specifications. Diameter of vessel = 3 m. Height of vessel = 40 m. Mass of vessel and its contents = 200 tons. Diameter of skirt = 3 m. Height of skirt = 4 m. Wind pressure upto 20 m = 1.2 KPa. Wind pressure above 20 m = 1.5 KPa. Allowable tensile stress of skirt = 65 MPa. Allowable compressive stress of skirt = 98 MPa. [12]

Q3) A cantilever beam of circular cross section is subjected to the specified constant vertical force F and Torque T at its free end. The factor of safety based on tensile yield strength is N. Due to space limitations, the length and diameter of the beam should not exceed Lmax and dmax respectively. Outline the procedure for the design of the beam with the objective of maximising the strain energy absorption capacity using following materials. a) Steel b) c) Aluminium alloy Titanium alloy. [16] OR Q4) A tensile bar of circular cross section and made of plain carbon steel (Sult = 580 MPa, Syp = 330 MPa, E = 207 GPa and = 7750 MPa) is subjected to cyclic tensile force which varies from zero to 90 kN. The required stiffness of the bar is 3.5 105 N/mm. The surface finish and size factors are 0.76 and 0.6 respectively. Using the Soderberg equation, design the bar with the objective of optimising the factor of safety. Following limitations are used in design. d 30 mm 350 mm M 3 kg.
-2-

Use maximum shear stress theory of failure.

500 mm. [16]

[3764]-131
2

Q5) Torque produced by a 4 stroke diesel engine is given by T = 4000 + 1500 Sin + 4000 Sin2 Nm. Where is the angle turned through by the crank shaft. Speed of the engine is to remain between 200 rpm and 210 rpm as it is loaded with a negligible moment of inertia and uniform torque device. Design a suitable flywheel of CI having tensile strength of 160 MPa. Maximum size of the flywheel is limited to 2 m. Neglecting the effect of [16] spokes find the stress in the rim, = 7200 kg/m3, b = 2t. OR Q6) A mechanical press is designed to punch 20 mm diameter holes in 15 mm thick plates. The material of plate has an Sult = 380 MPa. The press is designed to punch 60 holes/min and punching 1 hole in each stroke. The hole is punched during 75o of the eccentric travel. The eccentric shaft is connected to a flywheel through a gear train of ratio 6:1. The overall efficiency of the press is 75%. The speed fluctuation and the mean diameter of the flywheel rim are limited to 16% and 1.1 m respectively. Design the rim type CI flywheel with 8 spokes of elliptical cross section. The permissible tensile stress for CI may be taken as 10 MPa. Assume flywheel rim width to depth ratio as 1.5:1. Determine also the kW rating of the electric motor required to drive the press. = 7200 kg/m3. Rim contributes 90% of total inertia. SECTION - II Q7) a) A shaft and hole assembly have the following dimensions. Shaft diameter = 40 0.18 mm. Hole diameter = 40.2 0.24 mm. Assuming the shaft and hole diameters are normally distributed, determine the probability of interference fit between the shaft and hole area from 0 to Z is as given below. Z b) 1.6 1.8 0.4641 2.0 0.4772 2.2 0.4861 2.4 0.4918 [10] [8] Area 0.4452 [16]

Explain with sketch design principles in machining.


-3-

[3764]-131
3

OR Q8) a) A mechanical component is subjected to a mean stress of 207 MPa with a standard deviation of 55.2 MPa. The material has a mean strength of 276 MPa with a standard deviation of 41.4 MPa. i) Find the probability of failure. ii) If the material is changed such that its mean strength is 380 MPa find the probability of failure. Area from 0 to Z is as Z b) Q9) a) b) c) 1.0 2.5 0.4938 3.0 0.4987 [12] [6] Area 0.3413

Explain with sketch design considerations in controls.

Establish the structure equations for a 4 speed gear box and draw their structure diagrams. [6] Draw the ray and speed diagram for a six speed gear box. State the necessary assumptions made. [6] Derive the relation for difference between number of teeth of successive gears in a change gear block. [4] OR A 22 drive is required for transmitting speeds starting from 400 rpm with a geometric progression ratio of 1.4. Draw a suitable structure and speed diagram. Also draw the layout of the gear box and determine the number of teeth on each gear. Assume that a belt drive is used to get the desired speed at input from motor shaft. [12] Explain nodal method of optimisation with example. State the advantages of a belt conveyor over other conveyors. [4] [6]

Q10)a)

b) Q11)a) b)

A flat horizontal belt conveyor is used for transporting crushed rock having a mass density of 2 t/m3. The belt is 800 mm wide and has a speed of 1.75 m/s. Determine the capacity of conveyor in t/hr. [10] OR Describe in brief various resistances offered on belt conveyor. [4]

Q12)a)

[3764]-131
4

-4-

b) Tail pulley 1.5 m Snub pulley

Plow Drive pulley Snub pulley Rotary cleaner

A horizontal conveyor is used in transporting mineral ore. Maximum capacity of the conveyor is 225 tph at belt speed of 2 m/s. The mineral ore has a density of 800 kg/m3. A three ply belt is used for which surcharge factor is 0.08. The mass of each idler is 20 kg. The centre to centre distance between drive pulley and tail pulley is 300 m while that between snub pulleys is 299 m. Friction factor for idlers = 0.025. Snub factor for both snub pulleys = 0.02. Snub factor for drive and fail pulleys = 0.06. Velocity of rotary brush cleaner = 2 m/s. Kclean, Cleaning factor = 5 Vclean. Cleaning force = KcleangB. Unloading resistance = 3.5 mmgB. B: belt width in m, mm - mass of material/unit length (kg/m). Angle of lap on drive pulley = 210o. Coefficient of friction between belt and drive pulley = 0.4. Ultimate tensile strength per width of ply = 60 N/mm. Drive efficiency = 93%. Motor speed = 1440 rpm. Carrying idler pitch, Pc = 1.5 m. Approximate return idler pitch = 2Pc. Assume pulley diameter as 125 times number of ply. Standard pulley diameter : 315, 400, 500, 630, 800, 1000 mm. Standard motor rating : 5, 5.5, 7.5, 10, 11, 12.5, 15, 20, 22 kW.

[3764]-131
5

-5-

Standard belt width B mm mb (kg/m) Find :i) ii) Standard belt width. Standard diameter pulley. [12] 400 5 500 6.5 650 9 800 12 1000 16

iii) Number of carrying and return side idler pulleys. iv) Standard electric motor.

[3764]-131
6

-6-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1397

[3764]-326 B.E. (Chemical)


BIOPROCESS ENGINEERING (409341) (Elective - I) (2003 Pattern)

Time : 3 Hours] Instructions to the candidates: 1) 2)

[Max. Marks : 100

Answers to the different sections must be written in separate answer books. Assume suitable data, if necessary.

SECTION - I Q1) Write short notes on the following. a) b) c) d) Protist kingdom. Osmoregulating toxins. Enzyme classification. Specific growth rate of bacteria. [16] [16]

OR Q2) Write short notes on the following. a) b) c) d) Structure of steroids. Limiting nutrient. Role of DNA in cell life cycle. Yield coefficient.

Q3) Explain the manufacturing process for a) ethanol and b) lactic acid.

[16]

OR Q4) Explain the manufacturing process for a) penicillin and b) citric acid. [16]

P.T.O.
1

Q5) Derive the kinetic expression for the following: E + S ES; ES E + P; Kp E + P EP; Km ------- -------(1) ------- -------(2) ------- -------(3)

Where K m and K p are the thermodynamic dissociation constants for reversible reactions 1 and 3 respectively. 'k' is the kinetic constant for reaction 2. What type of kinetics is represented by the above equations? [18] OR Q6) An enzyme was assayed at an initial substrate concentration of 105 M. The Km for the substrate is 2 105 M. At the end of 1 min, 2% of the substrate has been converted to the product. a) What percent of the substrate will be converted to the product at the end of 3 min? What would be the product and substrate concentrations after 3 min? b) If the initial substrate concentration were 106 M, what percent of the substrate will be converted to the product after 3 min? c) What is the maximum attainable velocity 'Vmax' with the enzyme concentration used? d) At about what substrate [18] concentration will 'Vmax' be observed? SECTION - II k Q7) Derive mathematical expressions with the help of Michaelis-Menten inhibition enzymatic kinetics for: a) Noncompetitive inhibition b) Competitive inhibition. [16] OR Q8) What is the relative activity and the degree of inhibition caused by a [16] competitive inhibitor when [S] = Km and [I] = Ki? Q9) Ethanol is produced in a chemostat from glucose using Saccharomyces cerevisiae. The outlet concentration of glucose is 50 g/lit. The feed rate of glucose is 1000 lit/hr. Calculate the specific a) cell growth rate and b) volume of the fermenter. [16] 1 Data: i) Maximum specific growth rate max = 0.33 hr ii) I = 93 g/lit. iii) KI = 100 g/lit iv) Michaelis-Menten constant Ks = 1.7 g/lit. OR
[3764]-326
2

-2-

Q10)The steady state substrate and biomass concentrations for a continuous stirred tank fermenter operated at various dilution rates are given below. Given that the fresh feed concentration is 700 mg/l, calculate the values of the Monod constants m and Ks, the yield coefficient Y and the endogenous respiration coefficient Kd. Dilution rate (hr-l) Substrate concentration (mg/l) Biomass concentration (mg/l) 0.3 45 326 0.25 41 328 0.2 16 340 0.12 8 342 0.08 3.8 344

[16] [18]

Q11)Explain in brief the following. a) b) c) Geometries of enzyme catalyzed CSTRs. Bubble column bioreactors. Monod growth kinetics. OR Q12)Explain in brief the following. a) b) c) Techniques used for downstream processing. Fluidized bed bioreactor. Continuous sterilization of bioreactor.

[18]

[3764]-326
3

-3-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1398

[3764]-355 B.E. (Polymer Engg.)


POLYMER REACTION ENGINEERING

(2003 Course) (Elective - I) (409366)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidate: 1) Answers to the two sections should be written in separate answer books. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Assume suitable data, if necessary. 5) Use of logarithmic table, electronic pocket calculators is allowed.

SECTION - I Q1) a) Explain the following quantities to be used in the Characterization of Long Chain Molecules: [12] i) Weight Fraction ii) First moment of Pjs iii) Number Average Degree of Polymerization iv) Weight Average Degree of Polymerization v) Number Average Molecular Weight vi) Weight Average Molecular Weight. Find the polydispersity Index of the mixture composed of 20 molecules of 1000 monomer lengths and 380 molecules of 1 monomer lengths. [4] OR Explain the distinctive features of Polymerization Reaction Engineering. [8] Discuss the distinction between chain polymerization Vs Step Polymerization based on kinetics. [8] Explain with the help of general polymerization reactions the general mechanism for the Free-radical Polymerization. [6] Derive the necessary equation for the total concentration of the free radicals under free radical polymerization. [12]
P.T.O.
1

b)

Q2) a) b) Q3) a) b)

Q4) a)

b)

OR Define the term Instantaneous Fractional Degree of Polymerization and derive the necessary equation for the Instantaneous Fractional Degree of Polymerization for carrying out Free-radical Polymerization in perfectly mixed batch reactor. [14] Discuss in brief the rate of Initiation in terms of Initiator concentration.[4]

Q5) Discuss the model to account for effect of diffusion on rate constant in step growth polymerization. [16] OR Q6) Discuss the model to find the rate of polymerization in case of emulsion polymerization. [16] SECTION - II Draw process flow sheet for the production of PET and explain the process in detail. [8]

Q7) a) b)

Differentiate between the different polymerization techniques for manufacturing PVC. [10] OR Q8) Give the technological review over the manufacturing process of following polymers. [18] a) SBR b) Polystyrene c) Nylon 6 Q9) a) Find the percentage conversion and the number average molecular weight of Styrene which is to be polymerized at 80oC with Free radical Polymerization in a batch reactor for a reaction time of 3 hours. The initial concentration of monomer is 8.135 gmole/lit, and the concentration of initiator is kept constant at 0.06 gmole/lit. Assume termination takes place only by combination. The rate constant are as k0 = 3*106 sec1, kp = 176 lit/gmole.sec, kc = 3.6*107 lit/gmole. sec, f = 0.6. [12] Write a note on gel effect in free radical polymerization. [4] OR Discuss the conclusion from kinetics studies in free radical polymerization. [8] Discuss the MWD and reactor choice in polymerization process. [8]
-2-

b) Q10)a) b)

[3764]-355
2

Q11)a) b) Q12)a) b)

Write short note on choice of phase.

[8]

Discuss about the safety of polymerization reactor. [8] OR What are common control problems that can occur in polymerization reactor? [8] Explain the role of controls in batch polymerization process. [8]

[3764]-355
3

-3-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1399

[3764]-417 B.E. (Computer Engg.)


ARTIFICIAL INTELLIGENCE (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates: 1) Answer three questions from Section I and three questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Assume suitable data, if necessary.

Q1) a) b)

SECTION - I What is AI? Give any two applications of AI in detail.

[8]

Q2) a) b) Q3) a) b) Q4) a)

Compare Forward and Backward reasoning. With example explain the Backward reasoning elaborately. [8] OR What are the characteristics of good search strategy? What is a production system? [8] Give an architecture of a typical agent in AI system? Explain in detail.[8] Explain A* algorithm in detail with example. [10] Explain waiting for quiescence and secondary search. [8] OR Apply constraint satisfaction method to solve the cryptarithmetic problem [8] SEND + MORE = MONEY Illustrate AO* algorithm with a typical example. [10]

b) Q5) a)

What are the drawbacks of predicate logic used in representation of facts? Give five examples where it becomes extremely difficult to use predicate logic for representations. [8] Write a note on statistical and probablistic reasoning. OR [8]

b)

P.T.O.
1

Q6) a) b)

Explain the process of resolution with proper example. Write a note on conceptual Dependancy and frames. SECTION - II

[8] [8]

Q7) a) b) Q8) a)

Write a note on Hierarchical planning and least commitment strategy. [8] Explain Rote learning and learning by Analogy. [8] OR Use goal stack method to solve following Block's problem. [10] D B A D C C B A

b) Q9) a) b) c) Q10)a) b) Q11)a) b) Q12)a) b)

Explain the significance and impact of learning in problem solving.[6] Explain RTN with an example. Give a typical Robot architecture. [8] [8]

What is morphological Analysis in NLP. [2] OR In detail discuss all the phases of Natural Language processing. [10] Give the details of Waltz's algorithm. [8]

Draw the multilevel ANN for satisfying EX-OR function of Diginal gate. Explain [8] Design an expert system for chemical synthesis. [8] OR What is Artificial Neural Network? Give any two applications of ANN in detail. [8] Draw and explain typical Expert system architecture. [8]

[3764]-417
2

-2-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1400

[3764]-459 B.E. (Biotechnology)


ANALYTICAL BIOTECHNOLOGY

(416287) (2003 Course) (Theory) (Sem. - II)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidate: 1) Answer 3 questions from Section-I and 3 questions from Section-II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks.

SECTION - I Q1) Give rationale and explain in detail nucleic acid hybridization. When do you use southern hybridization? Draw detailed flow chart of southern hybridization with a brief explanation of role of each solution used in the process. [16] OR Q2) Write notes on: a) b) Microarrays. Flow cytometry. [4 Marks Each] [8 Marks Each]

Q3) Discuss the following DNA modifying enzymes. a) b) c) d) DNA ligase. DNA polymerase. Endonuclease. DNA dephosphorylase.

OR Q4) What are restriction enzymes? Why are they named as 'restriction enzymes? How are they classified? Discuss in detail the classification. [16] Q5) What are expression vectors? Discuss the types, biology and use of them.[18] OR Q6) Why were BAC and YACs developed? Describe in detail the structure and function of both these vectors. Also discuss the M13 vector. [18]
P.T.O.
1

SECTION - II Q7) Elaborate the differences in the genomic DNA library. Also discuss techniques employed in building these libraries. [18] OR Q8) Discuss in detail: [9 Marks Each] a) b) Screening of recombinant clones. PCR based cloning.

Q9) How is transformation of a bacterial call achieved? Describe chemical method of transformation in detail. Write the principle behind chemical transformation. [16] OR Q10)What is conjugation? How is it different from viral transformation? Explain both conjugation and viral transformation. [16] Q11)Write notes on: a) b) Factor VIII. Gene therapy. [8 Marks Each]

OR Q12)Describe in detail about production of Humulin. What various methods have been employed in the process? [16]

[3764]-459
2

-2-

Total No. of Questions : 6]

[Total No. of Pages : 3

P1436

ADVANCED ENGINEERING GEOLOGY WITH ROCK MECHANICS


(2003 Course) (Elective - II)
Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. All questions are compulsory. [Max. Marks : 100

B.E. (Civil)

[3764]-118

SECTION - I Q1) Write notes on : a) Pinching and bulging of dykes. [4] b) Engineering significance of rocks of Dharwarian system occurring in Maharashtra state. [9] c) Regional distribution of Deccan Trap Basalt. OR a) Engineering significance of Kaladjis and Vindhyan rocks of Maharashtra state. [8] b) Criteria for demarcation of flows in Deccan Trap Basalt. c) Field characters of fractures. Q2) a) Tail channel erosion in Ghod dam area. [6] [4] [4] [5]

b) Engineering significance of fractures from dam foundation point of view. [7] c) Engineering significance of Tachylytic basalts. OR a) Discuss how location of spillway is decided on geological grounds. Add a note on case histories due to columnar basalt & volcanic breccias. [10]
P.T.O.

[5]

b) What will happen if reservoir is located on laterite and jointed quartzite? Mention case histories. [6] Q3) a) R.S.R. System of classification of rock masses. b) Describe any two physical properties of rock masses. c) Define rock mechanics. OR a) General R.M.R. value of Compact Basalt. b) Compressive and shear strengths of rock masses. c) Electrical resistivity method. SECTION - II Q4) a) What problems may have to be faced while tunnelling through compact basalt and volcanic breccia with Red Tachylytic Basaltic (RTB) matrix occurring between 15 m. above the crown and 5 m. below the invert level? What treatment will have to be given? [12] b) Location and depth of drill holes to be taken for bridge foundation.[6] OR Write notes on the following : a) A tunnel associated with dyke/dykes. b) Tunnelling through amygdaloidal basalt. Give example. [6] [6] [6] [6] [4] [9] [4] [3]

c) Treatment to be given to a dyke occurring below the foundation of a bridge pier. [6] Q5) Discuss in brief the geological process of soil formation. State the characters of alluvium of Deccan Trap rivers and discuss the suitability of residual soils and alluvium in earth dam activity. [16] OR Write notes on the following : a) Deep drilled wells. b) Chances of getting groundwater along with fractures. c) Success of percolation tanks in Region 1. d) Availability of natural sand in Deccan Trap area.
[3764]-118 -2-

[4] [4] [4] [4]

Q6) Write notes on the following : a) Amygdaloidal basalt as a construction material for rubble for masonry. Discuss objections and facts giving examples. [8] b) Engineering significance of fault / faults in major civil engineering works as dams and tunnels. Give example. [8] OR a) Define with a neat figure focus, epicentre and isoseismal lines of an earthquake. [8] b) Explain giant phenocryst basalt as a construction material. c) Write a note on foundation of monumental buildings. rrrr [4] [4]

[3764]-118

-3-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1446

[3764]-419
B.E. (Computer Engg.)

NETWORK AND INFORMATION SECURITY (2003 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidate: 1) Attempt any three questions from Section-I and three questions from Section-II. 2) Figures to the right indicate full marks. 3) Draw neat diagrams must be drawn wherever necessary. 4) Make suitable assumptions wherever necessary.

SECTION - I Q1) a) b) What do you mean by packet sniffing and snooping? What are the different means to carry out these attacks? [8] What are different security threats? Explain various types of passive and active security attack. [8] OR What do you mean by Code Injection? Differentiate between worms, viruses and Trojan Horses. [8] Explain Man-in-Middle and Replay attacks with suitable example. What are different security measures to control these attacks? [8] "Public key cryptography complements private key cryptography rather than replaces it". Justify with example. [6] What are different requirements of kerberos? Explain the architecture of kerberos. What do you mean by kerberos Realms? [10] OR Differentiate between MD5 and SHA-1 hash algorithms. [6] Explain X.509 Authentication service in details. [10]

Q2) a) b)

Q3) a) b)

Q4) a) b) Q5) a) b)

What are different variations of DES algorithm and how it works? [8] What is elliptical curve cryptography (ECC)? What are various implementation choices for ECC? [10] OR
P.T.O.

Q6) Write short notes on (any Three): a) b) c) d) Security services and mechanisms. Firewall and packet filters. Advanced Encryption standard. Electronic mail security. SECTION - II Q7) a) b) Q8) a) b) Q9) a) b) Q10)a) b) Q11)a) b)

[18]

What are key components of virtual private Networks? Why VPN users require strong authentication? [8] What is tunneling? What are different tunneling protocols used in VPN? [8] OR Explain various services, benefits and applications of IPSec protocol. Elaborate the concept of Security Association. [8] List and explain Encryption and Authentication algorithms used in AH and ESP. [8] Explain the architecture of SSL. Differentiate between SSL and TLS. [10] Explain the security facilities in the TCP/IP Protocol stack. [6] OR Enlist and explain different components of Secure Electronic Transaction (SET). [8] List and explain the techniques used to avoid guessable password. [8] Explain various security measures in VLAN and wireless LAN. [8]

What is OS hardening? Explain the concept of Honeypot with suitable diagram. [10] OR Q12)Write short notes on (any three): [18] a) b) c) d) Router Security. Smart Card Security. Wifi and Max Security issues. Internet standards and the Internet Society.
-2-

[3764]-419
2

Total No. of Questions : 12]

[Total No. of Pages : 3

P1447

[3764]-422
B.E. (Computer Engineering)
DISTRIBUTED SYSTEMS (410451)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam table is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain open middleware-based distributed system. [6] b) Explain different types of problems for scalability in distributed system with possible solutions. [6] c) Explain basic organizations of processors and memories in distributed computer systems. [6] OR Q2) a) Explain different transparencies in distributed system with suitable examples. [8] b) Consider a simple server that carries out client requests without accessing other servers. Explain why it is generally not possible to set a limit on the time taken by such a server to respond to a client request. What would need to be done to make the server able to execute requests within a bounded time? Explain. [6] c) Why is it sometimes so hard to hide the occurrence and recovery from failures in distributed system? [4] Q3) a) Explain how quality of service can be achieved in stream oriented communication. [10]
P.T.O.

b) What are different elements involved in implementation of RPC mechanism? Explain the role of each in RPC mechanism. [6] OR Q4) a) How would you incorporate persistent asynchronous communication into a model of communication based on RMIs to remote objects? [6] b) Explain general organization of a message broker in a message queuing system. [6] c) What is MPI? Explain message passing primitives of MPI. Q5) a) Compare Coda and Plan 9 distributed file systems. b) Explain different approaches to locating mobile host in DNS. OR Q6) a) Explain automounting in NFS. b) Explain the advantages of using stripe groups in xFS. [6] [6] [4] [8] [8]

c) Using self-certifying pathnames in SFS, is a client always ensured it is communicating with a nonmalicious server. Explain. [4] SECTION - II Q7) a) Explain Lamports algorithm for logical clock synchronization with example. [8] b) Explain bully and ring election algorithms. [6] c) Give full algorithm for whether an attempt to lock a file should succeed or fail. Consider both read and write locks and the possibility that file was unlocked, read locked or write locked. [4] OR Q8) a) What is global state of a distributed system and explain how it can be represented? [8] b) Explain clock synchronization algorithms. [6] c) Consider the behavior of two machines in a distributed system. Both have clocks that are supposed to tick 1000 times per millisecond. One of them actually does, but the other ticks only 990 times per millisecond. If UTC updates come in once a minute, what is maximum clock skew that will occur? [4]
[3764]-422 -2-

Q9) a) Explain the solutions for scalable reliable multicasting.

[8]

b) What makes the fail-stop model in the case of crash failures so difficult to implement? [4] c) To what extent is scalability of atomic multicasting important? Explain. [4] OR Q10) a) Explain virtual synchronous multicast with its implementation. b) Explain different types of failures in distributed systems. [8] [4]

c) Explain how the write-ahead log in distributed transactions can be used to recover from failures. [4] Q11) a) Explain the following terms with suitable example. i) ii) Portable Object Adapter in CORBA. Interoperable Object Reference (IOR) in CORBA. [6] [4] [6]

b) Explain different types of Grid systems. c) Explain cluster computer architecture. OR

Q12) a) Explain CORBAs callback and polling model for asynchronous method invocation. [6] b) Explain what is virtual organization and benefits provided by virtual organization in Grid. [6] c) Compare Grid computing and Cluster computing.
rrrr

[4]

[3764]-422

-3-

Total No. of Questions : 8]

[Total No. of Pages : 2

P1449

[3764]-1007
B.E. (Civil)

ADVANCED ENGINEERING GEOLOGY WITH ROCK MECHANICS

(1997 Course) (Elective - II)


Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. [Max. Marks : 100

SECTION - I Q1) Discuss with suitable examples, suitability of compact basalts, amygdaloidal basalts and volcanic breccias from dam foundation point of view. [17] Q2) a) What difficulties may have to be faced while tunnelling through compact basalt? Explain with suitable examples. [10] b) Define rock mechanics. List only various physical properties of rock masses. [6] Q3) a) What is the engineering significance of Tachylytic Basalts? Discuss their origin. [10] b) Write a note on the parameters deciding Safe Bearing Capacity (S.B.C.) for bridge foundation. [7] Q4) a) Explain in detail the validity of Reservoir Induced Seismicity in Deccan trap area. [10] b) What is R.Q.D.? Can a rock give core recovery 100% and R.Q.D. less than 15%? How? [6]
P.T.O.

SECTION - II Q5) Write notes on the following : a) Engineering significance of Pre Cambrian metamorphic rocks. b) Granular disintigration. c) Region 2. Q6) Write notes on the following : a) Significance of fractures from tunnelling point of view. Give suitable examples. [9] b) Deep drilled wells. c) Compact basalt as a construction material. Q7) Write notes on the following : a) Geological conditions resulting to tail channel erosion in Deccan Trap area. Only mention case histories. [8] b) Active fault. c) Waterbearing character of older alluvium. Q8) Write notes on the following : a) Influence of climate on soil formation. b) Volcanic vents. c) Problems with made grounds in cities. d) Treatment to be given to a dyke crossing dam alignment.
rrrr

[9] [4] [4]

[4] [4]

[4] [4]

[4] [4] [4] [4]

[3764]-1007

-2-

Total No. of Questions : 10]

[Total No. of Pages : 2

P1450

APPLIED THERMODYNAMICS - III (1997 Course) (402043)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer any 3 questions from each section. 2) Answers to the two sections must be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

B.E. (Mech.)

[3764]-1012

SECTION - I Q1) a) Standard air at zero velocity expands to M = 0.9. Find change in density. [8] b) Explain the following terms : i) iii) Mach angle. The zone of silence. ii) Mach cone. [8]

Q2) a) Steam enters a convergent-divergent nozzle at a pressure of 22 bar and temperature of 300C. The exit pressure is 4 bar. Steam flow rate is 11 kg/s. Find area of nozzle at throat and exit. [10] b) Discuss supersaturated flow through steam nozzles with neat diagrams.[8] Q3) a) Discuss compounding of impulse steam turbine. [8]

b) Derive the expression of maximum diagram efficiency of single stage impulse turbine. [8] Q4) a) Explain working of air extraction pump with the help of a neat diagram. [8] b) Explain the following terms : i) Partial pressure. ii) iii) Vacuum efficiency. iv) [8] Condenser vacuum. Condenser efficiency.
P.T.O.

Q5) a) A gas turbine operates on Brayton cycle the temperature range is 1000 K and 288 K. Find pressure ratio for maximum power output. Also determine thermal efficiency, work ratio and specific power output. [8] b) Discuss effect of reheating and intercooling on performance of the gas turbine cycle. [8] SECTION - II Q6) a) Explain with the neat sketches, Ram-Jet engine. b) Define the following terms : i) thrust power. iii) thermal efficiency. ii) iv) propulsive efficiency. overall efficiency. [8] [8] [8] [8]

Q7) a) Explain with simple diagram the working of the La Mont Boilers. b) What is fluidised bed combustion? State the advantages of FBC.

Q8) a) Sketch a typical layout of a modern steam power plant with superheating, reheating and regenerative feed heating. [8] b) Explain with a sketch the working of binary vapour power plant. What are its limitations. [8] Q9) a) Explain with diagrams. i) input - output curve. iii) incremental-rate curve. [10] Load factor. Plant use factor. [8] ii) heat rate curve.

b) Explain the following factors. i) Demand factor. ii) iii) v) Diversity factor. Plant capacity factor. iv)

Q10) a) Describe with a neat sketch, the working of Boiling Water Reactor (BWR). [8] b) Compare hydro-power plant with steam power plant. [8]
rrrr

[3764]-1012

-2-

Total No. of Questions : 8]

[Total No. of Pages : 2

P1452

[3764]-1016-A B.E. (Mechanical Sandwich)


MANUFACTURING MANAGEMENT (402067) (1997 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidate: 1) Attempt any three questions from Section-I and Section-II. 2) Answers to the two sections should be written on separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Assume suitable data, if required.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Explain different functions of scientific management. Explain different styles of leadership. Explain the barriers in communication. Explain the principles of motion economy. Differentiate product layout and process layout. What are functions and scope of forecasting. [8] [8] [8] [8] [8] [8] [18]

Q4) Write a any three short note of the following: a) b) c) d) Group dynamics. Time study. X-Y theory for motivation. Plant maintenance. SECTION - II Q5) a) b) Q6) a) b) Explain basic model of EOQ. Differentiate between CPM and PERT. What is OC curve? State the characteristics of OC curve. Differentiate single, double, multiple sampling plan.

[8] [8] [8] [8]


P.T.O.

Q7) a) b)

What is cost? Explain the elements of cost. Explain the procedure for crashing of the network.

[8] [8] [18]

Q8) Write a any three short note of the following: a) b) c) d) ERP ISO 9000 MRP Linear Programming.

[3764]-1016-A
2

-2-

Total No. of Questions : 10]

[Total No. of Pages : 2

P1454

[3764]-1034
B.E. (E & TC)
CONSUMER ELECTRONICS (1997 Course) (404189)

Time : 3 Hours]

[Max. Marks : 100

Instructions to candidates : 1) Answer 3 questions from each section. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) What is magnetic tape recording? Explain basic principle of it. [6] b) Draw tape transport mechanism and explain its recording and playback mode in detail. [10] Q2) a) What are the various techniques of optical recording? Explain any one method with suitable diagram. [9] b) Enlist advantages and disadvantages of digital sound recording over analog sound recording. [7] Q3) a) What is stereophony? What are its limitations? How these can be overcome in quadraphony? [9] b) Explain requirement of PA system. Draw its block diagram. Explain each block in detail. [7] Q4) a) Explain following terms in relation to Television. i) Aspect ratio. ii) Persistance of vision. iii) Kell factor iv) Colour burst. [8]

P.T.O.

b) Draw composite video signal. What are the components of CVS signal? Explain in detail. [8] Q5) a) Enlist CCIR-625-B standards. b) Compare the PAL, NTSC and SECAM systems. SECTION - II Q6) a) With the help of neat block diagram, and waveform explain colour TV Receiver. [10] b) Explain the basic principle used in the vidicon camera tube with diagram. [6] Q7) a) Draw block diagram of capstan servo system. Explain each block in it. [6] b) Explain CCTV system in brief. [6] c) What is high defination television? Explain compatibility considerations of HDTV with conventional TV system. [6] Q8) a) Draw block diagram of mobile phone. Explain each block in brief. [8] b) Enlist the product design features in detail. Q9) a) What do you mean by JPEG? Explain its algorithm in detail. b) What is WWW? Explain in brief. Q10) Write short note on (Any Four) : a) Betamax. b) Fax Machine. c) LCD Display. d) ENG. e) MPEG. f) Solar panel.
rrrr [3764]-1034 -2-

[6] [12]

[8] [10] [6] [16]

Total No. of Questions : 10]

[Total No. of Pages : 2

P1455

[3764]-1037
B.E. (E & TC)
MICROWAVE ENGINEERING (1997 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6)

[Max. Marks : 100

Answer any three questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full makrs. Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) What is Scattering Matrix? List any two properties of S-matrix. b) Derive the S-matrix for a typical three port microwave device. [8] [8]

Q2) a) Explain the working of a PIN diode. List the characteristics and applications. [8] b) Why an isolator is always used in a microwave test bench? Explain the operation of an isolator made out of a three port circulator. [8] Q3) a) With neat and necessary diagrams, explain how a Varactor Diode works. What are the applications? [8] b) What is the principle of operation of a Tunnel Diode? Explain its construction, characteristics and application. [8] Q4) a) Write detailed notes on MESFETs by explaining the construction, performance characteristics & their applications. [10] b) Compare : Parabolic Antenna Vs Horn Antenna at Microwave frequencies? [6]
P.T.O.

Q5) Write short notes on any THREE : a) Losses in waveguides. c) Resonant cavity. e) Microwave tubes. b) d) BALUN. Microwave filters.

[18]

SECTION - II Q6) a) What is a MASER? Explain how it works? Highlight its performance and applications. [8] b) List and explain various Industrial and Medical Applications of microwaves. [8] Q7) a) Write notes on Doppler Effect and Blind Speeds in Radar. [8] b) What are various scanning and tracking methods used in Radars? List and explain them with neat diagrams. [8] Q8) a) Compare : klystron Amplifier Vs TWTA. [6]

b) Derive the equation for maximum range of RADAR in terms of Pmin. What are the effects of noise over the above range? [10] Q9) a) Draw the block diagram of a typical hybrid microwave system for transmitting two audio and two video signal between a distance of 100 k.m. The communication system has a repeater also. Explain various aspects, frequency details and limitations in this regard. [8] b) Explain the block schematics and procedures to measure any two parameters that could be measured in an X-band microwave bench setup. [8] Q10) Write short notes on any THREE : a) Biological hazardous of microwaves. b) Solid state devices in microwave. c) Reflex klystron oscillator. d) Microwave antennas and arrays. e) Slotted section and its applications.
rrrr [3764]-1037 -2-

[18]

Total No. of Questions : 9]

[Total No. of Pages : 2

P1458

[3764]-1087 B.E. (Chemical) (1997 Course)


[Max. Marks : 100

PLANT DESIGN AND PROJECT ENGINEERING


Time : 3 Hours]

Instructions to candidate: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) b) c) Discuss in detail the techno-economic feasibility of report of a project. [10] Explain significance of laboratory data in process development. [8] Discuss various function of pilot plant. [8]

Explain the importance of flow sheet synthesis and development in chemical industry. [8] Discuss the various types of valves and their selection criteria. [6]

Explain the characteristic curves of centrifugal pump and effect of impeller diameter on this curve. [10] What factors are to be considered for pipe design? Explain Normal Pipe size (NPS). What factors govern the selection of piping and insulation? [8] [4] [4] [16]

Q5) Write short note on : a) b) c) d) Waste Water Treatment. Material Selection for Equipment. Capacity utilization and debottle process. Process Instrumentation.

P.T.O.
1

SECTION - II Q6) a) A Project Engineer would like to choose a plant either near market or near source of raw materials for following manufacturing facilities like any other. Please help him during selection of proper site, giving justification. [10] i) Urea Plant. ii) Sulphuric Acid Plant. Explain the primary and secondary process utilities required for process plant. [8] Write the specification sheet and design needs for a calandria type evaporator. [8] Explain the following terms: i) Intrasically safe process. ii) HAZOP List factors to be considered for plant layout and plant design. [4]

b) Q7) a) b)

c)

[4] [16]

Q8) Write short note on: a) b) c) d) NPSH and cavitations Scale up methods. Factories Act. Indian Boiler-Regulation.

Q9) Consider the network shown in the figure. Determine the standard deviation and expected time for each activity. For each activity the three estimates [16] t0 - tm - tp are given along the arrow.

[3764]-1087
2

-2-

Total No. of Questions : 8]

[Total No. of Pages : 3

P1460

[3764]-1092
B.E. (Computer)
DIGITAL SYSTEM DESIGN (1997 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) Answer any three questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain in brief the architecture of CPLD with the help of block diagram. [8] b) Write VHDL code for FSM shown in the following figure. [10]

P.T.O.

Q2) a) With the help of structural diagram of internal architecture explain FPGA. [8] b) Write a VHDL code full Adder. [8]

Q3) a) Explain with the help of waveform Inertial Delay and Transport Delay. [8] b) Explain the different VHDL data types with the help of diagram. [8] Q4) a) Write a VHDL code for 8 : 1 MUX using CASE statement. [8]

b) Explain process sensitivity list. Is it possible to write process without process sensitivity list? Justify. [8] SECTION - II Q5) a) With the help of suitable examples explain the difference between Structural, Data flow and Behavioral style of modelling. [10] b) What is the purpose of a Test Bench? Write a stimulus only test bench for D flip-flop. [8] Q6) a) Write VHDL code for 8-bit counter with an asynchronous reset input (R). The counter also has an disable input (D). On positive edge of the clock, if D = 0, the counter is incremented. If D =1, the counter holds its current value. [10] b) Explain the following VHDL code. PACKAGE Keg24_Package IS COMPONENT Keg12 PORT ( d : IN BIT_VECTOR (12, DOWN TO 0); clk : IN BIT; g : OUT BIT_VECTOR (12, DOWN TO 0); END COMPONENT; END Keg24_Package;
[3764]-1092 -2-

[6]

Q7) a) What is the use of configuration? What is the difference between configuration specification and configuration declaration? [4] b) Explain the following attributes with suitable examples : i) ii) S' DELAYED (T) S' EVENT [12]

iii) S' QUIET (T) iv) S' LAST VALUE. Q8) Write a short note on : a) VHDL synthesis. b) IEEE STD_LOGIC_1164.ALL c) S' TRANSACTION Attributes. d) JTAG. [16]

rrrr

[3764]-1092

-3-

Total No. of Questions : 10]

[Total No. of Pages : 2

P1461

[3764]-1097
B.E. (Computer)
OBJECT ORIENTED COMPONENTS & SYSTEMS

(1997 Course) (Elective - II)


Time : 3 Hours] Instructions to the candidates : 1) 2) 3) Answer any 3 questions from each section. Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. [Max. Marks : 100

SECTION - I Q1) a) Explain n-tier model in client/server architecture state its advantages and disadvantages. [6] b) What are JAR files? How to create JAR files? How to use them with JAR tools? [6] c) What are Java Beans? How are they useful? Q2) a) What are the choices for data structure in Java? b) Compare runnable thread and extending thread. c) Compare object serialization with RMI in Java. Q3) a) Explain the CORBA architecture with block labelled diagram. b) Explain the role of CORBA in OMA reference model. Q4) a) Explain interface repository & IDL object model. [4] [4] [6] [6] [10] [6] [8]

b) Explain the CORBA services for managing resources in distributed object environment. [8] Q5) Write a note on : a) EJB. b) ROC. c) Integration of web & distributed objects.
P.T.O.

[18]

SECTION - II Q6) a) What is a class factory in COM? Explain how the client creates a component using a class factory. [6] b) Explain the difference & similarities of COM library function Co Create Instance and Co Get Class Object. [6] c) What is IDispatch interface in COM? What is its significance. Q7) a) What are major advantages of distributed computing? [4] [8]

b) What is Surrogats Process? What are the benifits of running an Inprocess component in a DLL Surrogats? [8] Q8) a) Explain the Apartments in COM/DCOM. [8]

b) Distinguish between Java Beans & EJB. What is session and Entity beans. [8] Q9) a) Explain Interface Repository & IDL object model. b) Define the term with respect to CORBA. i) ii) Naming context. IIOP/GIOP. [18] [8] [8]

Q10) Write short notes on any three : a) Active X, OLE & COM. b) IDL tutorial. c) XML. d) Windows Registry.
rrrr

[3764]-1097

-2-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1465

[3764]-112
B.E. (Civil)
ADVANCED CONCRETE TECHNOLOGY (2003 Course) (Elective - II)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates : 1) Solve Q. 1 or Q. 2, Q. 3 or Q. 4, Q. 5 or Q. 6 from Section I and Q. 7 or Q. 8, Q. 9 or Q. 10, Q. 11 or Q. 12 for Section II. 2) Answers to the two sections must be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) Give the historical background of development of cementing material.[6] b) State the Bougues equation for the percentage of main compound of composition of Portland cement. [6] c) Explain with charts, the relation between compressive strength of concrete and fineness of cement. [6] OR Q2) a) Determine the amount of water to be added in the mixture of cement and sand, to test ordinary Portland cement weighing 1 kg, for consistency test, soundness test, initial and final setting time & compressive strength. [6] b) Explain the importance of grading curve of aggregates in Civil Engineering. [6] c) Enlist the different properties of fresh concrete. Explain any one of them.[6] Q3) a) Explain and differentiate vacuum concrete and no fine concrete. b) Differentiate shotcreting and guniting. c) Explain jet cement concrete. OR
P.T.O.

[8] [4] [4]

Q4) a) Explain the plasticizer and super-plasticizers with reference to following. [8] i) ii) iii) iv) Their nature. Its effect on compressive stung of concrete. Its effect on workability of concrete. Its dosage to be added in concrete.

b) Explain the different tests to be carried to determine the leakages in hardened concrete. [4] c) What is carbonation of concrete? Explain rate of carbonation and factors affecting it. [4] Q5) a) Design a concrete mix suitable for use in the construction of the dam exposed to severe atmosphere. Ordinary Portland cement is used and course aggregate available is from 5 to 150 mm. other data is as follows: 28 days cylindrical compressive strength = 20 kN/m3 Dry rodded weight of course aggregate = 180 kN/m3 Fine-ness modulus of sand = 2.8 Slum required = 25 to 50 mm Specific gravity of cement, course aggregate and sand is 3.15, 2.7 and 2.65 respectively. [8] b) Describe high performance concrete. c) Explain the infrared thermography test of non destructive testing. OR Q6) a) Design a M45 Concrete Mix by any method for following data. Characteristic strength of concrete after 28 days is 45 MPa and slump of 10-30 mm. type of cement is ordinary Portland cement. Fine aggregate is river sand confirms to Zone-II. Course aggregate is of size 20 mm and confirms IS 383 requirements. Specific gravity of cement, sand and course aggregates is 3.15, 2.63 and 2.61 respectively. Type of exposure is mild, degree of quality is very good. [8] b) Explain the steam curing. [4] c) Explain effect of sea water on concrete. Explain concrete with Ground Granulated Blast Furnace Slag. [4]
[3764]-112 -2-

[4] [4]

SECTION - II Q7) a) Draw and explain uniaxial tensile stress-strain curves for various cement based composites. [6] b) Explain the tensile behavior of fiber cement composites. OR Q8) a) Explain the major parameter affecting fiber interaction with homogeneous cracked matrix with axial stress and shear stress. [6] b) Explain procedure how to find the fracture resistance of concrete. Also explain how to improve it. [6] c) Enlist and explain in brief the various types of natural and artificial fibers in a sequence of they got application in field. [6] Q9) a) State values of the following properties of Glass fiber. b) What is SIFCON material? Write about its physical properties. [6] [4] [6] c) Explain the importance of fiber orientation and aspect ratio in FRC. [6]

Specific gravity, Tensile strength, Modulus of elasticity, strain at break. c) Enlist the applications of Glass and Polymer mixed fiber reinforced concrete. [6] OR Q10) a) Explain the test procedure to evaluate the contribution of steel fiber to drying shrinkage and crack reduction. [6] b) Explain the techniques for toughness measurement for FRC. c) Explain the compliance mechanics. [4] [6]

Q11) a) Explain the details of industrial Precast concrete poles with reference to following : [12] i) A material required along with specification. ii) Analysis and design principals with silent feature. iii) Manufacturing method with flow chart. iv) Testing methodology required. v) Quality control. b) What are the different techniques to improve the durability of SFRC?[4] OR
[3764]-112 -3-

Q12) a) Prepare a technical visit report which you have visited to industrial precast production unit with respect to : [12] i) Material required with specification. ii) Analysis and design principles involved. iii) Manufacturing technology. iv) Testing method employed. b) Explain the shrinkage behavior of light weight FRC.
rrrr

[4]

[3764]-112

-4-

Total No. of Questions : 12]

[Total No. of Pages : 12

P1483

[3764]-251
B.E. (Electronics)
MANAGEMENT INFORMATION SYSTEMS (2003 Course) (404210)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates : 1) Answer any 3 questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks.

SECTION - I Q1) a) Why is a MIS as practiced in industry a pyramid structure made up of decreasing complexity information processing layers? Explain preferably with the help of an example. [8] b) As convergence technologies evolve over the next decade (a forecast), a new world will emerge. Analysts predict : [8] Networks will speed up by an average of 50% a year, the historic norm. In advanced world, faster broadband and mobile systems will be strong enough for commuters to check for traffic jams and watch soap operas on their cell phones. In Japan and Korea, this is a reality in 2004 itself, while U.S. will catch up in a decade. By 2012-13, practically every machine in the realm of communications - every gadget that sings, talks, beams images or messages - will sport powerful computer and a network connection. And every bit of digital information, whether its phone call, a song, a Web page, or a movie, will flow among these machines in the very same river of data. By the end of this 10-year-cycle (i.e., by 2020), the change could be extreme : Web pages will snap to life. Hundreds of thousands of political bloggers, flu fishermen, and chefs will be uploading gobs of video programming creating their own channels.
P.T.O.

This plethora of Web shows will compete for attention with TV fare, Internet radio, video e-mails and games. All of it will play on televisions, computers and cell phones, which will be different flavors of the same machine. The concept of a network or a channel will go away. They are artifacts of old technology. OR

What do you understand by the term Convergence Technology? Q2) a) The dramatic technological shifts ahead are likely to shakeup age-old concepts at the foundation of economic life. In the coming markets of moving bits, who owns what? Will people buy programming and machines? Or will they rent and subscribe? Innovative companies will sort out these questions, leading the way in building new business models for the coming age. Those who figure out how to reach through the networks to deliver customized information and services will be the architects and kings of the converged economy. Discuss preferably with the help of examples business implications of rise of convergence technology. [8] b) With the help of Figure (1) explain how convergence technology enabled information systems will deliver promised business transformations for business value creation? What will be their relationship with quality information systems? [8]
ENABLING TECHNOLOGY The Net
Interenterprise Computing: Shift from linear value chain emphasizing value addition to value network emphasizing value generation Enterprise Infostructure Workgroup Computing: Lotus Notes, Platform approach. Personal Multimedia: Multimedia computing

THE PROMISE
The Internetworked Business The Extended Enterprise The Integrated Enterprise

THE CHANGE
Wealth Creation, Social Development Recasting External Relationships Organizational Transformation

The High Performance Team

Business Process And Job Design

The Effective Individual

Task, Learning Efficiency

Fig. (1): Business Transformation Through Convergence Technology

[3764]-251

-2-

Q3) a) Businesses have changed a lot but given that customer requirements are becoming increasingly local and instant, it is business processes and models that have changed the most. With the help of Figure (2), explain evolution of business models from ad-hoc, open loop business model to a closed loop engineering quality business model to a model describing generic business process as integral to a closed loop information and control system constituting a business process IS view. [8] b) Figures (2) gives a systems view of a business process represented as a generic business process IS view and as integral part of a closed loop information and control system characterized by continuous information origination and processing in the presence of uncertainty and the emergent all encompassing view of Information Integrity for business competitive advantage. Figure (3) models a business process, with a controls interpretation, as integral to a close loop information and control system. Based on Figures (2) and (3) write short notes on any two of the following : [8] i) Uncertainties in business process IS view, ii) Complex error, iii) Information Integrity Risk. OR Q4) a) With the help of Figure (3), describe in your own words an engineering system with its physical variable controls and process controls modeled as an engineering business system with a requirement to meet customer requirement. [8] b) Write short notes on any two of the following (To answer you may refer to Figures (2) and (3)) : [8] i) With external and internal customer requirements becoming local and instant, a system is emerging to be a potential source of information. Explain. ii) In a business IS view, information is function of source, process and recipient. Explain. iii) Shift from data storage and retrieval to information evaluation, storage and retrieval. iv) List the multistage dynamic decision stages constituting the information origination a system undertakes to reduce the uncertainty it (system) experiences about the environment.
[3764]-251 -3-

[3764]-251

-4-

[3764]-251

-5-

Q5) a) The system dynamics approach to complex problems focuses on feedback processes. It takes the position that feedback structures are responsible for the system changes over time. The premise is that dynamic behavior is a consequence of system structure. As a result the system dynamics approach looks within a system for the source of its problem behavior. For example, inventories are not assumed to oscillate merely because consumers periodically vary their orders. The system dynamicist takes the view that inventories behave as they do for reasons internal to the system, for reasons pertaining internal structure of the system. In practice, this internal point of view results in models of feedback that bring external agents inside the system. Within the framework of above statement, explain any three of the following concepts in your own words : [9] a) Complex problem, b) Feedback processes, c) Dynamic behavior, d) Bringing external agents inside the system. b) Fill in the blanks by putting in appropriate word from the set of words given at the appropriate blank indicated by number. [9] ______ (1) ______ problems often become so ______ (2) ______ that understanding ______ (3) ______ and ______ (4) ______ responses to policies are ______ (5) ______ without a formal model. For example consider a ______ (6) ______ structure of a police response system. It will have ______ (7) ______ variables such as Crime Rate, Desired Additional Police Effort, Socioeconomic Effect on Crime Rate, Effort Directed against Addict Criminals, Imprisonment Rate, etc. It is far from easy to ______ (8) ______ how such a model would behave when, for example, community awareness of drug problem is ______ (9) ______, and yet such understanding is what we expect of those charged with designing and implementing public policy for real systems. Set of desired words to choose appropriate word to fill in the blank : {anticipate; many; impossible; increased; feedback; behavior; complex; real world; predicting} Note : You may write answer by pairing the number and the word; OR
[3764]-251 -6-

Q6) a) Define in your own words any three of the following System Dynamics variables : [9] i) ii) Level variable, Rate variable,

iii) Parameters and input variable, iv) Supplementary variable, v) Auxiliary variable.

b) Fill in the blanks by putting in appropriate word from the set of words given at the appropriate blank indicated by number. [9] A simple ______ (1) ______ feedback loop centering on traffic congestion and highway building could include such ______ (2) ______ as the number of cars or ______ (3) ______, extent of the highway system, traffic congestion, driving safety and comfort and highway construction. As the number of cars or the amount of driving ______ (4) ______, traffic congestion increases, ______ (5) ______ driving comfort and safety. That sets up ______ (6) ______ that lead to ______ (7) ______ highway construction to ______ (8) ______ traffic congestion. The loop is negative because an ______ (9) ______ in traffic congestion eventually results in pressures to decrease (negate) it. Set of desired, words to choose appropriate word to fill in the blank : {lesson, increases, more, variables, pressures, increase, reducing, negative, amount of driving} Note : You may write answer by pairing the number and the word.

[3764]-251

-7-

SECTION - II Q7) a) System Dynamics models a system with the help of causal loop diagram. For a police response system assumed in a study of heroin addiction, crime and community response study, figure (4) gives a causal loop representation. [8] i) ii) Describe in your own words the police response system conceptualized in Figure (4). Are there feedback loops in the system conceptualized in Figure (4)? Indicate the feedback loops.

Imprisonment Rate Arrest Rate Standard for crime Effort Directed Against Addict Criminals

Addicts on the street Crime Rate Community Awareness of Drug Problem

Socioeconomic Effect on Crime Rate

Community alarm

Heroin Price Effect

Productivity of Police

Desired Additional Police Effort

Pervasiveness of Addicts Heroin Availability

Police Effort Devoted to Drugs

Police Effort Directed at Heroin

Police Effort Directed at Soft Drugs

Soft Drug Availability

Figure (4) : Conceptualization of a police response system [3764]-251 -8-

b) Briefly describe any two of the following stages in approaching a problem in a system using the System Dynamics methodology. [8] i) Problem identification and definition, ii) System conceptualization, iii) Model formulation, iv) Analysis of model behavior. OR Q8) a) For a basic production sector Figure (5) gives a causal loop representation. [8] i) Describe in your own words the basic production sector conceptualized in Figure (5). ii) Are there feedback loops in the system conceptualized in Figure (5)? Indicate the feedback loops. b) Briefly describe any two of the following stages in approaching a problem in a system using the System Dynamics methodology. [8] i) Model evaluation, ii) Policy analysis, iii) Model use or implementation. Q9) a) Answer following : [8] i) Write a short note on information envelope. ii) For information envelope, preferably with the help of an example, discuss uncertainties in any one of the following information origination process and their integrity implications : 1) From long term design goal set to multiple criterion and many factors, 2) From multiple criterion and many factors to operable goal. b) i) Discuss, preferably with the help of an example, any one of the following elements of the information origination process. 1) Coordination of information origination activities, 2) Selection of flexible information decision and control scheduling, 3) Information origination resource management. What are the uncertainties faced by the element described by you in Question 9(a)? What are their integrity implications? [8] OR
[3764]-251 -9-

ii)

Delivery delay perceived by market Average shipment rate Order backlog Inventory Availability of inventory Recent average shipment rate Desired inventory Desired backlog Shipments Desired shipments Market demand Market share Orders

Receipt into inventory Production

Inventory correction Production OvertimeUndertime Desired production

Backlog correction

Workforce (production capacity)

Figure (5): A causal loop representation of a large development project

[3764]-251

- 10 -

Q10) a) i)

Briefly describe any two of the following existing integrity mechanisms. 1) 2) 3) Security based definitional approach to integrity, Auditing practices as in accounting, Process centered quality approach. [8]

ii)

What is their main limitation? Explain.

b) Existing practice is to verify data for its integrity. However, given the reality of ever changing environment, requirement for the improved decision-making is to view information as a composite good of interrelated attributes, namely, usefulness, usability and integrity. What is Usefulness-Usability-Integrity paradigm? What is its main implication? [8] Q11) a) i) ii) Define attributes of Information Integrity. Equation (1) gives Cost benefit Analysis Equation of Information Integrity.

Define each term in Equation (1).

[9]

b) Figure (6) gives a systems view of a design basis for the Information Integrity Technology Development System. Explain the systems view in Figure (6) in your own words. In the process also explain how it facilitates the system achieving competitive advantage. [9] OR Q12) a) Write short notes on any two of the following : i) ii) [9] Acquisition Cycle under the I*I Technology Development System. Utilization Cycle under the Information Integrity Development System.

iii) Information Integrity Control through Information Integrity Technology. b) Write a note comparing Traditional IS, Quality IS and Integrity IS.[9]
[3764]-251 - 11 -

Input

Process Control Cost optimization

Output

Customer

Environment

Information Flow Rate Factual Information (Fi)

Design Information Normative Information (Ni) Desired Ni

Desired Fi

Fi Error

Ni Error

I*IFi Al Decision

I*INi

|*|value

Desired I*I value Cost benefit analysis (further research).

An

I*IGAP

Figure (6): A systems view of a design basis for the Information Integrity Technology Development System leading to Integrity Information System 0-0-0-0-0

rrrr
[3764]-251 - 12 -

Total No. of Questions : 6]

[Total No. of Pages : 2

P1486

[3764]-303 B.E. (Printing)


OFFSET MACHINES - II

(2003 Course)
Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) All questions are compulsory. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary.

SECTION - I Q1) State and explain with neat diagrams various cylinder configurations used for Web offset presses. [16] OR What is splicing operation? Explain any one type of automatic splicing operation describing sequence. [16] Q2) Describe plate and blanket cylinders of web machines. Explain how they differ from sheet offset cylinders. [16] OR a) Describe anilox inking system used for web offset with neat figure.[8] b) Describe any two modern dampening systems used on web offset.[8] Q3) What is the purpose of dryer and chill rollers on web presses. Explain different types of dryers available. [18] OR Describe the following: a) Combination Folder. [9] b) Ribbon Folder. [9] SECTION - II Q4) a) Describe machine related factors affecting web tension control on press. [8] b) Explain slip and draw. [8] OR Explain three types of web handling mechanism used on presses. [16]
P.T.O.
1

Q5) State and explain a daily maintenance checklist for a 2 colour web offset machine to be used for commercial printing. [16] OR Describe any four types of auxiliary equipments used on web presses. [16] Q6) State any four troubles of dryers and chill rollers occurring on web presses. [18] OR Explain with reasons the use of different substrates used on web presses for different applications and why printability changes accordingly. [18]

[3764]-303
2

-2-

3 : segaP fo .oN latoT[

]21 : snoitseuQ fo .oN latoT

134-]4673[ )ygolonhceT noitamrofnI( .E.B


YTIRUCES METSYS NOITAMROFNI

9941P

)esruoC 3002( )144414(


001 : skraM .xaM[ ]sruoH 3 : emiT :setadidnac eht ot snoitcurtsnI .II-noitceS morf snoitseuq 3 dna I-noitceS morf snoitseuq 3 rewsnA ) 1 .skoob rewsna etarapes ni nettirw eb dluohs snoitces owt eht ot srewsnA ) 2 .yrassecen reverehw nward eb tsum smargaid taeN ) 3 .skram lluf etacidni thgir eht ot serugiF ) 4 .elohw a sa deulav eb lliw srewsna ruoY ) 5 tekcop cinortcele ,strahc reilloM ,elur edils selbat cimhtiragol fo esU ) 6 .dewolla si selbat maets dna rotaluclac .yrassecen fi ,atad elbatius emussA ) 7

I - NOITCES ]01[ :feirb ni nialpxE noitpecretnI )i noitacirbaF )ii noitacifidoM )iii .noitpurretnI )vi )a )1Q

.txetrehpic otni txetnialp gnimrofsnart fo syaw cisab owt eht era tahW ]8[ .elpmaxe htiw nialpxE RO .skcatta evissaP dna evitcA elpmaxe elbatius htiw ,tsartnoc dna erapmoC ]01[ rehpic citeohplaonom si woH .rehpic raseaC fo tpecnoc eht ssucsiD ]8[ .rehpic raseaC morf tnereffid ]8[ ]4[ ]4[
.O.T.P

)b

)a )2Q )b )a )3Q )b )c

.ledom nosliW-kralC liated ni nialpxE .ycilop ytiruces ni tsurt fo elor eht ssucsiD .seicilop ytiruces ni seussi ytilibaliava ssucsiD RO

]8[ ]8[

.ledom ytirgetnI abiB liated ni nialpxE nialpxE yrotadnaM )i yranoitercsiD )ii .slortnoc ssecca desab eloR )iii .sisylanatpyrc raenil dna laitnereffid neewteb hsiugnitsiD

)a )4Q )b

]8[

)a )5Q )b )a )6Q )b )c

]8[.elpmaxe na htiw liated ni mhtirogla yek cirtemmys eno yna nialpxE RO ]5[ .srehpic kcolb dna maerts neewteb hsiugnitsiD ]5[ ]6[ .sedom mhtirogla dniheb aedi ssucsiD .SED fo seitilibarenluv nialpxE II - NOITCES ]8[ ]8[ .tsegid egassem dna CAM neewteb ecnereffid eht si tahW

)a )7Q )b )a )8Q )b )a )9Q )b )a )01Q )b )a )11Q

.ASR nialpxe elpmaxe taen a htiW RO dna cirtemmys fo segatnavdasid dna segatnavda eht ebircseD ]8[ .yhpargotpyrc yek cirtemmysa ]8[ .mhtirogla namlleH-eiffiD nialpxe elpmaxe taen a htiW

]8[.etacifitrec latigid fo noitaerc eht ni AR dna AC a fo elor eht si tahW ]8[ ]8[ ]8[ ]8[ .mlaer sorebreK nialpxe margaid taen a htiW RO .cesPI fo edom tropsnarT dna lennuT tsartnoc dna erapmoC .mhtirogla erutangis latigid nialpxE :ot tcepser htiw LSS nialpxE .kcats PI/PCT eht ni noitisop stI )i .sedivorp ti secivreS )ii .fo desirpmoc si ti slocotorp tahW )iii

dna od nac llawerif tahw nialpxE .selpicnirp ngised llawerif ssucsiD ]01[ .tonnac llawerif tahw RO
-2-

)b

134-]4673[
2

]01[ ]8[

.metsys noitceted noisurtnI nialpxE :owt yna no seton etirW .ytilaitnedifnoC ciffarT )i hsifwolB )ii seikooC )iii . P G P )vi

)a )21Q )b

-3-

134-]4673[
3

Total No. of Questions : 10]

[Total No. of Pages : 2

P1506

[3764]-1049 B.E. (Electronics)

COMPUTER BASED SIMULATION & MODELING (1997 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to candidates: 1) Answer any 3 questions from each section. 2) Neat diagrams must be drawn wherever necessary. 3) Figures to the right indicate full marks. 4) Your answers will be valued as a whole. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Q3) a) b) Q4) a) What do you mean by system? Explain. What are the various types of systems? Give two examples of each type. [9] Draw the flow-chart for system-simulation and explain each block.[9] What do you mean by modeling? Explain its types. [8]

Explain the performance of RLC in series is similar to auto-pilot system. [8] Explain the contineous system simulation with an example. Distinguish contineous system and discrete system simulation. For a 1-server system, determine the wait time in each case. i 1 2 3 4 5 Arrival 5 10 15 20 25 Service time 15 10 0 20 15
P.T.O.

[8] [8] [8]

b)

Write the Modeling equations for i) ii) Poisson's Distributions. Normal Distributions.

[8]

Q5) Write note on: a) b) Servo-system simulation. Advantages and Disadvantages of system simulation. SECTION - II Q6) a) Explain the following terms. i) Mean ii) Mode iii) Median iv) Probability density function and v) Probability distribution Function.

[28]

[10]

b) Q7) a) b) Q8) a) b) Q9) a) b)

If mean = 7 and variance = 9, determine the mean value for y = (3x2-5). [8] Draw the flow-chart for Telephone system simulation. [8]

Suggest the data structure for telephone system with explanation.[10] Draw the flow-chart for digital system simulation. Explain various modeling used for digital system modeling. What do you mean by system dynamics? Explain. Explain the system dynamics terms. i) Rate ii) Constant iii) Auxiliary. [8] [8] [9] [7]

Q10)Write notes on: a) b) Accept-Reject Method for Random numbers. Chi2 Method.

[28]

[3764]-1049
2

-2-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1513

[3764]-136 B.E. (Mech.)

MATERIALS ENGG. AND THEIR PROCESSING (2003 Course)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) A slowly cooled plain carbon steel has proeutectoid ferrite to be 10% of its eutectoid ferrite. What is the carbon content of steel? [6] Explain the effect of following factors on the properties of steel. i) Shape of proeutectoid ferrite. ii) Shape of proeutectoid cementite. iii) Hardness of ferrite and cementite. [6]

c)

Q2) a) b) c) Q3) a)

Compare and contrast Austenitic and Ferritic stainless steels with respect to composition, properties and applications. [6] OR Draw the microstructure of annealed steel. Explain the effect of carbon on mechanical properties of annealed steel. [6] Give the classification of tool steels and state two applications of each. Why tool steels are multitempered? [6] Draw Fe - Fe3C phase equilibrium diagram and label properly. Explain [6] the significance of Fe - Fe3C phase equilibrium diagram. Draw the TTT curve for hypoeutectoid steel and explain the following heat-treatments. [6] i) Austempering ii) Marquenching
P.T.O.

b) c)

Q4) a) b) c)

Draw CCT curve for eutectoid steel. Explain how this curve is used to obtain fine and course pearlite. [4] What is nitriding? Why nitriding is done at lower temperature? State the advantages of nitriding. [6] OR Explain the principle of carburising. State the post carburising heattreatments and explain any one heat-treatment. [6] Explain the transformation of autenite to pearlite and bainite. [4] Draw microstructures of the following and label the phases (Any Three). [6] i) Slowly cooled 1.2% carbon steel. ii) Ferritic Grey cast iron. iii) Annealed 0.4% carbon steel. iv) Widmanstatten structure for 0.6% c steel. Classify the cast irons and two applications of each. Explain the steps in production of S.G. iron. [6] Draw the phase diagram of Cu- Zn alloy and explain the properties and applications of single and double phase alloys. [6] Why cast irons posses better castability than steels? [4] OR Give chemical composition and applications of the following (Any Three): [6] i) Cartridge brass. ii) Muntz metal. iii) Duralumin. iv) Elinvar. v) AISI 4320. vi) White cast iron. Explain the factors affecting the graphitization of Grey cast iron. [4] State suitable material for the following and give reason. (Any Three).[6] i) Guard for electric motor. ii) Bed for machine tool. iii) Heating elements. iv) Piston..
-2-

Q5) a) b) c) Q6) a)

b) c)

[3764]-136
2

SECTION - II Q7) a) b) c) Give the classification of composite materials. Explain metal matrix composite with one example. [6] Compare and contrast the composite and nano materials. [6] Classify the ceramics and state their properties. What is the difference between ceramics and cermets? [6] OR Explain with neat sketch hand lay up moulding. State its limitation and advantages. [6] Explain the effect of following on the properties of composites (Any Three). [6] i) Amount of fibers. ii) Type of fibers. iii) Orientation of fibers. iv) Manufacturing process. Explain the characteristics of the following fibers (Any Three). i) Silicon carbid. ii) Aramid. iii) Glass. iv) Graphite. [6]

Q8) a) b)

c)

Q9) a) b) c) d) Q10)a) b) c) d)

What is DLC coating? State advantages and limitations of DLC coating. [4] Compare and contrast adhesive and abrasive wear with two examples. [4] What is hard facing? State its advantages and limitations. [4] Explain with neat sketch the process of PVD coating. State two applications. [4] OR Explain with neat sketch CVD coating. State its advantages. [4] Why cleaning is necessary before coating? Explain electroless plating process. [4] Compare and contrast between chromate and phosphate coating. [4] Explain with neat sketch plasma spraying process.
-3-

[4]

[3764]-136
3

Q11)a) b) c) Q12)a) b) c) d)

What is liquid crystal polymer? State its properties and applications.[6] How nano materials posses wide range of properties? Explain with one example. [6] Distinguish between single walled and multiwalled nanotubes. [4] OR State the synthesis methods used for nanomaterials. Explain with sketch electric arc method. [6] Define fullerense. Explain the effect of carbon atoms on the fullerense.[4] State the types of biomeric tissue attachment with two examples. [4] What is shape memory alloy? [2]

[3764]-136
4

-4-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1518

[3764]-229 B.E. (E&TC) (404218) (2003 Course)

ROBOTICS AND INDUSTRIAL AUTOMATION


Time : 3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Attempt Q.1 or Q.2, Q.3 or Q.4, Q.5 or Q.6 from section-I and Q.7 or Q.8, Q.9 or Q.10, Q.11 or Q.12 from section-II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Give different ways of classifying a robot. Explain any one method of classification, in detail. [10] Explain the terms. i) Repeatability. ii) Work envelope. iii) Payload. iv) Tip speed. [8]

Q2) a) b) Q3) a) b) Q4) a) b)

OR Draw neat sketch of basic robotic system. Explain the function of each component. [10] Discuss typical specifications of a pick and place robot. Explain the Graphical approach for obtaining Inverse solution. [8] [8]

What do you mean by Forward solution and Backward solution? Give set of Forward and Backward equations. [8] OR Explain different steps in obtaining Forward solution. [8] What is the significance of T-matrix in robotics? Explain symbolic and Numeric T-Matrices. [8]
P.T.O.

Q5) a) b)

Name different types of actuators used in robotics. Explain any one of them in detail. [8] What is the function of end effector in a robot? What factors are taken in account in designing of a gripper? [8] OR What are different types of sensors used in robotics? Explain any one of them in detail. [8] Discuss the Lift and Tray Technique for slip detection with neat sketch. [8] SECTION - II

Q6) a) b)

Q7) a) b)

Explain the term - Robot motion planning. What are the different types of motion used for it. [8] R-R-R manipulator is at initial position (50,90,-50) degrees. It is required to move to (130, 0, 0) degrees. Assume that the joints have maximum absolute acceleration / decceleration of (50, 100, 150) degree/ sec2 and maximum velocities of (20, 40, 50) degree/sec. What is the travel time for each joint using slew motion? [10] OR Draw basic block diagram of Fuzzy Logic Controller and explain the function of each block. Name the application where FLC can be employed in robotics. [8] Explain the Jacobian control of a robotic manipulator in terms of D-H matrices. [10] How robot can be provided with vision? Explain in detail. Also give two applications of robot vision system. [8] Discuss the term Perspective Transformation in Robot Vision System.[8] OR Explain in detail, how object recognition is done in robot vision system? [8] What is the meaning of intelligent sensor? Discuss the use of same in robotics. [8] What is nanorobot? Explain its importance in the field of medical sciences. [8] Explain the terms - MEMS and Microsystems.
-2-

Q8) a)

b)

Q9) a) b) Q10)a) b)

Q11)a) b)

[8]

[3764]-229
2

OR Q12)Write notes on: a) b) c) d) Link and Joint Parameters. Degree of Freedom. Screw Transformation. Rotary to Linear motion conversion. [16]

[3764]-229
3

-3-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1524

[3764]-356 B.E. (Polymer)


RUBBER TECHNOLOGY

(2003 Course) (Backlog) (Elective)


Time : 3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Your answers will be valued as a whole. 6) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 7) Assume suitable data, if necessary.

SECTION - I Q1) a) b) Q2) a) b) Explain the various stages in the raw rubber technology. [8] What are the molecular - structure requirements for a material to act as a rubber? [8] OR Explain the thermodynamic theory for rubber elasticity. [8] Define the following terms: i) Scorch. ii) Mastication. iii) Reversion. iv) Vulcanisation. [8]

Q3) a) b)

List the various types of C-blocks and differentiate between them. [8] Explain the need for addition, mechanism of functioning and two examples of each of the following additives w.r.t. rubbers. [10] i) Peptizers. ii) Tackifiers. iii) Antiozonants. OR
P.T.O.

Q4) a)

Explain the properties of C-block w.r.t. structure, particle porosity, physical nature of the surface, chemical nature of the surface and surface area. [10] What is the need for addition of vulcanising agents? State the different types of vulcanising agents with examples. Also explain the need and mechanism of functioning of activators and accelerators with two examples of each. [8] What is vulcanisation? State the factors which affect the rate of vulcanisation. [8] List the ingredients in a typical vulcanisation mix, identify each one as to purpose, chemical type or structure and approximate amount used.[8] OR Draw and explain the rheometer cure curve. Explain its significance.[8] What is mastication? State its significance. Discuss the mastication curve for Natural rubber. [8] SECTION - II

b)

Q5) a) b) Q6) a) b)

Q7) a) b) Q8) a) b)

List the different types of roll arrangements used in calendaring. Explain roll chambering. [8] What is "roll bending" in calendaring process? What are the remedies to overcome the same? [8] OR Discuss the process of injection molding of rubbers. [8] List the different types of extrusion techniques used for rubbers. Explain any one method with a neat sketch. [8] Define "cellular rubber". What are the three main classes of cellular rubber? Differentiate between them. List a few tests carried out on rubber foams. [8] List the basic types of tyre constructions. Differentiate between Diagonal ply tyre construction and radial ply tyre construction. What are the advantages of radial ply tyres? [10] OR Discuss the rubber hose w.r.t. the following points. [8] i) Construction. ii) Materials used and iii) Manufacture of a moulded hose.
-2-

Q9) a)

b)

Q10)a)

[3764]-356
2

b)

Explain the process for manufacture of rubber conveyor belts. State the applications of rubber conveyor belts. Explain the material requirement in conveyor belts w.r.t. textile reinforcement and types of rubber used. Give a typical formulation used for the carcass compound. [10] Define the term "resilience" and explain the test used to measure rebound resilience. [6] Define "permanent set" and explain the method used to determine permanent set intension. [4] Define volume and surface resistivity. Explain briefly with neat diagrams the methods to measure them. [6] OR Which tests would be carried out for the following products. Why?[8] i) Engine mountings. ii) Seals and Gaskets. iii) Tyres. iv) Diaphragms for values and pumps. Define "fatigue". What are the factors affecting fatigue - cracking? Explain the test to determine fatigue property in rubbers. [8]

Q11)a) b) c)

Q12)a)

b)

[3764]-356
3

-3-

Total No. of Questions : 7]

[Total No. of Pages : 6

P1525

PRODUCT DESIGN AND COMPUTER APPLICATIONS (2003 Course)


Time : 4 Hours] [Max. Marks : 100 Instructions to the candidates : 1) Answer Q. No. 1 or 2, Q. No. 3 or 4, Q. No. 5 or 6 from Section I. Answer Q. No. 7 from Section II. 2) Figures to the right indicate full marks. 3) Use log paper, log-log paper, pocket calculator is allowed. 4) Assume data wherever necessary. 5) Draw neat sketches wherever necessary.

B.E. (Polymer)

[3764]-359

SECTION - I Q1) a) Using creep curve in Fig. number 1, plot isochronous and isometric graphs. Use 1% strain and 1,00,000 sec time. Explain also how isochronous graph can also be obtained by performing series of minicreep and recovery test on plastic. [6]

P.T.O.

b) Explain how fracture mechanics approach can be used to design articles subjected to fatigue loading. [5] c) Write in short about crazing in plastics. [5]

Q2) a) Explain the use of parallel engineering approach in plastic product design. [5] b) Explain the use of time temperature superposition in plastic product design. [6] c) Explain Boltzmann superposition principle for linear viscoelastic material. [5] Q3) a) Explain in short maximum strain failure criteria for biaxial stress system in case of orthotropic material. Reduce the criteria to uniaxially oriented fiber reinforced lamina. [6] b) Discuss & derive restrictions on Poissons ratios for orthotropic material in terms of engineering constants. [6] c) Derive an equation for shear modulus G12 in terms of shear modulus of matrix and shear modulus of fibers. [6] Q4) a) A hub made out of POM is to be press fitted on metal shaft. Hub width is 20 mm and outside diameter is 100 mm. Metal shaft diameter is 50 mm. During the assembly diametral interference of 0.2 mm is used. Calculate shrink fit stress. Poissons ratio of POM is 0.25 and short term modulus is 2 GN/m2 neglect the contraction of metal. [6] b) A unidirectional composite lamina has fibers at 25. Engineering constants in local directions are as follows : E11 = E22 =
12

145.2 GN/m2 15.33 GN/m2 0.278 4.185

G12 =

If lamina thickness is 1 mm, calculate extensional stiffness [A], coupling stiffness [B] and bending stiffness [D] matrix. [8] c) Give plane stress condition for orthotropic lamina.
[3764]-359 -2-

[4]

Q5) a) The Rheological data obtained for polystyrene at 453K is as follows : Shear rate r (sec1) 0.3 0.4 0.5 1 3 6 10 20 30 60 100 Fit Ellis Model to above data. Viscosity, (Pa-sec) 14,800 14,600 14,300 12,000 8,000 5,500 4,000 2,800 2,300 1,500 1,100 [8]

b) Melt flows through a quadratic cross section with length of a side a = 2.62 mm and channel length l = 50 mm. The melt follows power law of the form a = KOR e (T) r n R1 where a = Apporent viscosity in Pa-sec. = 0.00863 nR = 0.3286 KOR = 1,35,990 T = 200C The mass flow rate is 0.01 gm/sec and melt density is 0.7 gm/cm3. Calculate P (pressure drop).
[3764]-359 -3-

[8]

Q6) a) Discuss use of the forth order polynomial of MUENSTEDT and second order viscosity equation of Klein in flow simulation. [4] b) With neat sketch, bring out the difference between butting weld line and meld line. [4] c) Explain how weld angle is used to predict quality of severity of weld. [4] d) Explain how valve gates can be used to control mould filling pattern. [4] SECTION - II Q7) a) Design and draw a multi-impression mould for component in Figure 2 or Figure 3. Draw at least two views including one sectional view to show details of feed, ejection and cooling system. The drawing should clearly show the way the article is ejected. Draw additional views, if required. [35] b) Give design calculations for finger cam, thread withdrawal mechanism if used for the article designed in question number 7 (a). [10] c) Give bill of material and justify the material used for the design in question number 7 (a). [5]
rrrr

[3764]-359

-4-

[3764]-359

-5-

[3764]-359

-6-

[3764]-359

[3764]-359

Total No. of Questions : 10]

[Total No. of Pages : 2

P1529

[3764]-376 B.E. (Petroleum Engineering) (2003 Course) (Elective)

APPLIED COMPUTATIONAL TECHNIQUES


Time : 3 Hours] [Max. Marks : 100

Instructions to the candidates: 1) Answers to two sections should be written in separate answer books. 2) Attempt three questions fron each section. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Use of a electronic pocket calculator is allowed. 6) Assume suitable data, if necessary.

SECTION - I Q1) a) b) c) Find the roots of the equation x3 + 3x2 + 2x - 3 = 0, using Regula Falsi method. [6] Find the roots of the equation using x2 + xy = 10, y + 3xy = 52 by Newton Raphson method. [6] Give one example of linear and non linear equations in Petroleum Engineering. What do the roots represent? [4]

Q2) Given the differential equation, y = 2 xy + x. y (0) = 4, h = 0.1 a) b) c) Using Runge Kutta 4, find y(0.1). [6] Using Adams Bashforth Predictor Corrector Method find y(0.1). [8] Give two examples of differential equations in Petroleum Engineering. [2]

Q3) Write a detailed note on software package in Petroleum Engineering Reservoir Simulation, with reference to data required, equations used. [18] Q4) a) Write an algorithm for solving an integration using simpson 1/3 rule. [7]

P.T.O.
1

b) c)

Write an algorithm for solving an integration using Gauss Quadrature. [7] Give two examples of numerical integration in Petroleum Engineering. [2]

Q5) Do only one interation for the problem below and use (1, 1, 1) as the starting value. a) For the system of equations 3x - 0.1y - 0.2z = 0, 0.1x - 7y - 0.3z = 6, 0.3x - 0.2y + 10z = -2, find x, y, z using SOR method and LU Decomposition method w = 1.1. [16] SECTION - II Q6) a) b) Q7) a) b) Explain the concept of designing the database. What is spatial contiguity analysis? Explain LAN, WAN. [14] [4] [8]

Explain with two examples an application of networking in Petroleum field. [8] Explain fuzzy logic, genetic algorithm and AI in Petroleum Industry.[8] Explain object oriented programming. [8]

Q8) a) b) Q9) a)

Explain the various forms of Inheritance and write a programme for the following problem using Inheritance. Create class PI containing variables q, Pr, and Pwf and find J. Inherit the class PI. J = q/(Pr - Pwf), FE = (Pr - Pwf - dp)/(Pr - Pwf) [10] Explain the concept of classes. [6]

b) Q10)a) b)

Explain the use of Petroleum Engineering Software in real time oil industry. [10] Draw the folwchart to explain any one Petroleum Engineering Software. [6]

[3764]-376
2

-2-

Total No. of Questions : 8]

[Total No. of Pages : 2

P1542

[3764]-391
B.E. (Petrochemical Engineering)
REFINING OPERATIONS (2003 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4)

[Max. Marks : 100

Answer any 3 questions from each section. Answers to the two sections must be written in separate answer books. Figures to the right indicate full marks. Neat diagrams must be drawn wherever necessary.

SECTION - I Q1) a) With the help of flow diagram, describe the petroleum refinery processing sequence in detail. [14] b) Define and explain the term Octane Number. [4] Q2) Give at least four specifications for each of the following fuels : a) Gasoline. b) High Speed Diesel. c) Kerosene. d) Fuel Oil. Q3) a) Elaborate on Crude Distillation Unit. [16]

[8]

b) Give the significance of steam in a vacuum distillation unit of the refinery and draw the flow diagram of the same unit. [8] Q4) Write short notes on following (Any 4) : a) Indian Refining Industry. b) FCC Regenerator. c) Hydrotreating Catalysts. d) Delayed Coking. e) Uses of Petroleum Coke. f) Visbreaking. [16]

P.T.O.

SECTION - II Q5) a) With the help of flow diagram, describe the catalytic reforming, semiregenerative process in detail. [12] b) Elaborate on Reforming Catalyst. Q6) a) Enlist at least six important properties of lube oils. b) Elaborate on Selective Hydrocracking for Dewaxing Lube Oil. [6] [6] [10]

Q7) a) With the help of flow diagram, describe once through Claus sulfur process in detail. [12] b) Elaborate on SCOT Process. [4] Q8) Write short notes on following (Any 4) : a) Alkylation and Polymerization. b) Typical fixed bed downflow Catalytic Reformer. c) Isomerization. d) Hydrofinishing of Lube Oils. e) Carbon - Sulfur Compounds in a Claus Process. f) Refinery Waste Water Treatment.
rrrr

[16]

[3764]-391

-2-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1549

[3764]-324
B.E. (Chemical)
PROCESS EQUIPMENT DESIGN - II (Rev. 2003 Course)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Your answers will be valued as a whole. Assume suitable data, if necessary.

SECTION - I Q1) a) Describe various types of jackets and coils used in reaction vessel with neat sketches. [10] b) Calculate the diameter of shaft used in agitation system. Torque acting over the shaft is 115,000 kg.cm, while bending moment acting over the shaft is 34,600 kg.cm. Ultimate tensile strength of shaft material = 6900 kg/cm2. Ultimate shear stress is 75% of ultimate tensile stress. Factory of safety used is 6.0. [8] OR Q2) a) A reaction vessel is fitted with a plain jacket for heating the reactor contents. With the help of the following data : Vessel shell diameter (internal) = 2130 mm, Jacket internal diameter = 2260 mm, Jacket length = 2500 mm, Pressure inside the reactor = 0.55 N/mm2, Jacket internal pressure = 0.35 N/mm2, Temp. = 150C, MOC = Open hearth steel with allowable stress = 98 N/mm2, Modulus of elasticity = 190 kN/mm2, Poissons ratio = 0.30 Design the shell and jacket for the reaction vessel. [10] b) Explain heat transfer in reaction vessel. [8]
P.T.O.

Q3) a) A certain material was dried under constant drying conditions and it was found that 2 hours are required to reduce the free moisture concentration from 20% to 10%. How much long would be required to reduce the free moisture to 4%. Assume that no constant rate period is encountered with falling rate period is linear and equilibrium moisture content to zero. [10] b) Write a note on selection criteria for dryers. [6] OR Q4) a) It is necessary to dry a batch of 160 kg of wet material from 30% to 5% moisture content under constant rate and falling rate period. The falling rate period is assumed to be linear. Calculate the total drying time considering an available drying surface of 1 m 2/40 kg of dry solid. A constant drying flux of 3 104 kg/m2.sec is given : XC = Critical moisture content = 0.2 kg moisture/kg solid. X* = Equilibrium moisture content = 0.05. [10] b) Describe fluidized bed dryer with neat sketch. [6] Q5) a) Explain the performance diagram for a sieve plate with neat sketch.[8] b) Calculate the plate efficiency for a sieve plate distillation column using Van-Winkles correlation with the help of following data : [8] Density of liquid = 925 kg/m3 Viscosity of liquid = 0.34 103 Ns/m2 Density of vapor = 1.35 kg/m3 Viscosity of vapor = 10 106 Ns/m2 Liquid diffusivity (light key component) = DLK = 4.64 109 m2/s . of weir = 50 mm Hole area = Ah = 0.038 m2. Total column cross sectional area = Ac = 0.5 m2 Superficial vapor velocity = 1.62 m/s = 60 103 N/m Liquid surface tension L OR Q6) a) Write short note on : [10] i) OConnells correlation. ii) AlChE Method of predicting plate efficiency. b) Using O Connells correlation, estimate overall column efficiency for the separation of components in the feed compositions in mole fractions as propane 0.05, i-butane 0.15, n-butane 0.25, i-pentane 0.2, n-pentane 0.35.
[3764]-324 -2-

Avg. Relative volatility of light key a Taking viscosity at average column temp. Viscosity of Propane Viscosity of Butane Viscosity of Pentane

= = = = =

2.0 93C as 0.03 mNs/m2 0.12 mNs/m2 0.14 mNs/m2 [6]

SECTION - II Q7) a) Explain various column intervals in packed column with neat sketches. [10] b) SO2 produced by combustion of sulphur in air is absorbed in water. Pure SO 2 is recoved from solution by steam stripping in packed absorption column. Ceramic Intalox saddle packings of 38 mm size is used. The feed rate of gas is 5000 kg/hr containing 8% V/V SO2 95% recovery of SO2 is required. Estimate the ht. of an overall gas phase transfer unit by Cornells method. Data : : 9 m2/s, D = 1.45 105 m2/s DL = 1.7 10 v Viscosity V = 0.018 103 Ns/m2, L = 103 Ns/m2 Density v = 1.21 kg/m3, L = 1000 kg/m3 Column diameter DC = 1.5 m, Column ht = z = 8 m
Lw = 16.7 kg/m2.sec, k3 = 0.85, h = 80 [8] f1 = f2 = f3 = 1, h = 0.10 OR Q8) a) Write on estimation of packed bed height for an absorption column with relevant equations. [8] b) In packed absorption column find by Ondas method with the help of following data : Temp. of operation = 20C Pressure = 1.013 bar, Total concentration G = 55.6 kmo/m3 Surface tension of liquid = 2 = 70 103 N/m, Molar gas flow rate per unit c/s area = Gm = 0.027 kmo/s.m2 Molar liquid flow rate per unit c/s area Lm = 0.93 kmol/m2.sec
Vw = 0.79 kg/m2.sec, Lw = 17.6 kg/m2.sec Packings used Intalox saddle ceramics = 38 mm a = 194 m2/m3 C for ceramics = 61 103 N/m L = 103 N.s/m2

[3764]-324

-3-

V = 0.018 103 N.s./m2 L = 1000 kg/m3, V = 1.21 kg/m3 DL = 1.7 109 m2/sec DV = 1.45 105 m2/sec.

[10]

Q9) a) Write a note on liquid-liquid separator. [6] b) A liquid-liquid gravity separator is to be designed to handle two phase liquid stream of 0.4 m3/minute. Feed contains 40% by volume of light phase & 60% by volume heavy phase. L = Density of light phase = 900 kg/m3 L = Density of heavy phase = 1100 kg/m3 Required settling time for light phase is 5 minutes while for heavy phase is 4 minutes. [10] OR Q10) a) Write short notes on : [8] i) Knockout Drum. ii) Reflux Drum. b) Design decantor to separate a light oil from water. The oil is dispersed phase. Oil : Flow rate = 1000 kg/hr, Density = 900 kg/m3, Viscosity = 3 m Ns/m2 Water : Flow rate = 5000 kg/hr, Density = 1000 kg/m3, Viscosity = 1 m N.s/m2 Take dd = 150 m [8] Q11) a) Describe various types of pipe supports for pipelines with sketches.[10] b) Explain pipeline design for transportation of crude oil. [6] OR Q12) a) Water is to flow through a pipeline of 25 mm interval diameter for a distance of 2 km. The impressed heat of water is 10 m of H2O. Density of water = 1000 kg/m3 Viscosity of water = 1 103 N.s/m2 Estimate the flow rate of water through the pipeline. [10] b) Write a note on pipe thickness and optimum pipe diameter. [6]
rrrr [3764]-324 -4-

Total No. of Questions : 6]

[Total No. of Pages : 2

P1554

[3764]-302 B.E. (Printing)


SURFACE PREPARATION - II

(2003 Course)
Time : 3 Hours] Instructions to the candidates: 1) Answers to two sections should be written separately. 2) Draw neat diagram wherever necessary. [Max. Marks : 100

SECTION - I Q1) a) b) a) b) Q2) a) Explain the stages involved in Rubber Flexo plate-making. Compare between Photopolymer and Rubber plates. OR Explain in detail requirements for designing a job for Flexography.[12] State the benefits and applications of Flexography. Write notes on: i) Back exposure. ii) Main exposure. [6] [6] [8] [10]

b)

Calculate % shortening and new negative length for 2.84 mm plate thickness having printed length of 60 cm. [10] OR Mention the requirements of negative for Flexo Plate. Mention the safety and Hygiene for Flexo Plate. [8] [8] [16] [10] [6]

a) b)

Q3) Describe the processing of Conventional Flexo Plate. OR a) Explain Video mounting technique for Flexo Plate. b) Write notes on: i) ii) Measuring the Plate thickness. Orientation for Surface and Reverse printing.

P.T.O.
1

SECTION - II Q4) a) b) Explain the stages involved in preparation of Digital Flexo Plate.[10] Write notes on: i) ii) PerC/Bu in Flexo platemaking. Checking the Wash-out Solvent. OR Explain in detail standardization of a Flexo Plate. Q5) a) b) a) b) Q6) a) b) Explain in detail Chemical Etching process for Gravure. Copper is a dominant Image Carrier-Explain. [18] [8] [8] [8]

OR Explain in detail Gravure cylinder-making by electronic engraving process. [10] Explain the effect of Gravure cell structure on ink transfer. Explain in detail the workflow of Gravure cylinder imaging. Write notes on: i) ii) Chrome cracks in Gravure cylinder making. Gravure cylinder proofing. OR [16] [6] [10] [6]

Write notes on (Any Four): a) b) c) d) e) Chemistry of an Electrolyte. Circulation of an Electrolyte. Current Density. Immersion Factor. Leveling effect and Epitaxy.

[3764]-302
2

-2-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1568

[3764]-423
B.E. (Information Technology)
SOFTWARE ARCHITECTURE
(414451) (2003 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) Figures to the right indicate full marks.

[Max. Marks : 100

Answers to the two sections should be written in separate answer books. From Section I, Answer (Q. 1 or Q. 2) and (Q. 3 or Q. 4) and (Q. 5 or Q. 6). From Section II, Answer (Q. 7 or Q. 8) and (Q. 9 or Q. 10) and (Q. 11 or Q. 12) Make suitable assumptions wherever relevant and appropriate.

SECTION - I Q1) a) What do you mean by robust software architecture? [4] b) Software architecture is often compared with building architecture. What are the strengths and weaknesses of this comparison? [8] c) Object Inheritance is white box reuse. Justify. OR Q2) a) What documentation would you need to do performance analysis of an architecture? [4] b) Explain with suitable example : i) ii) Architecture is high-level design. Architecture is the overall structure of the system. [8] [6]

iii) Behavior of each software element is part of the architecture. iv) Architecture has components & connectors. c) Explain : Architecture is the vehicle for stakeholder communication.[6] Q3) a) Discuss Architectural structures and views. b) What are ALLOCATION structures? [4] [4]
P.T.O.

c) Discuss Architectural patterns, reference models and reference architecture. [4] d) What is MTTF & MTTR? OR Q4) a) What is quality attribute? What are the types of quality attributes. [8] b) Explain the following terms with examples : i) Voting tactic. ii) Non Repudiation. iii) Artifact in scenario. iv) Conceptual integrity. [8] [4]

Q5) a) Define design patterns. Discuss the characteristic of design pattern.[4] b) Give the definition, uses and structure of Proxy pattern. [6] c) What are design patterns and anti-patterns? Explain significance of each with reference to software quality. [6] OR Q6) a) What is the difference between Abstract Factory pattern & Factory pattern? Explain with suitable example. [8] b) Give the structure diagram for FACADE pattern. Explain the structure with example. [8] SECTION - II Q7) a) What is JDBC? What are stored procedures? What are the steps required to execute a query in JDBC? What is cold backup, hot backup, warm backup recovery? [10] b) Write short note on : i) JAVA on client side. ii) JXTA. OR Q8) a) What is the difference between Java Bean and EJB? What is EJB container? [6] b) In context of EJB what do you understand by : i) Session beans. ii) Entity beans. iii) Message beans.
[3764]-423 -2-

[8]

[6]

c) What is ACID? What is reentrant? Are session beans reentrant? Are entity beans reentrant? [6] Q9) a) What are the difference between Web Container and Web Server? [4] b) What do you mean by N-tier architecture? Explain briefly with suitable diagram. [6] c) What is the use of CSS in XML document? How will you create CSS for a particular XML file? What are the different kinds of parsers used in XML? [6] OR Q10) Explain with example : a) XHTML. b) XSLT. c) AJAX. d) JSP page navigation. Q11) a) What are the life cycle methods of Applet? Explain them. b) Write short note (Any two) : i) ii) DLL services. COM/DCOM. [4] [6] [6] [4] [8] [16]

iii) Distributed Object. c) Compare components & web services. OR Q12) a) What are .NET assemblies? What do they use? b) Discuss concept : i) ii) Windows Registry. Query Interface. [4] rrrr

c) What is CLR?

[3764]-423

-3-

Total No. of Questions : 12]

[Total No. of Pages : 3

P1569

[3764]-424
B.E. (Computer Engineering & I.T.)
EMBEDDED SYSTEMS
(410451) (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates : 1) Answers to the two sections should be written in separate answer books. 2) In section I attempt : Q. No. 1 or Q. No. 2, Q. No. 3 or Q. No. 4, Q. No. 5 or Q. No. 6. In section II attempt : Q. No. 7 or Q. No. 8, Q. No. 9 or Q. No. 10, Q. No. 11 or Q. No. 12, 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) Assume suitable data, if necessary.

SECTION - I Q1) a) List four important characteristics of Embedded Systems. b) Explain the programmers model of ARM7. c) What are the different operating modes of ARM7. OR Q2) a) Is ARM7 a RISC processor core? If yes, substantiate your answer with appropriate reasons. [8] b) What do you mean by CPSR, SPSR and Link Register? [4] c) List commonly used microcontrollers in small, medium and large scale embedded systems. [6] Q3) a) Explain Automic Operation Unit found in advanced processors. [4] b) In a voice data compression system, bits are generated at the rate of 64 Kbps. The embedded system with instruction cycle time of 0.02 microsecond is supposed to compress these bits. [12] Select i) appropriate processor with suitable structural units and OR
P.T.O.

[4] [8] [6]

ii) memory for the above Embedded System.

Q4) a) What are the advanced processing units found in the processor architecture? [4] b) A robot system has four coil stepper motor with 4-bit input and a DC motor requiring one bit pulse width modulation output. The motors need signaling at the rate of 50 to 100 msec. [12] Select i) appropriate processor with suitable structural units and ii) memory for the above Embedded System. Q5) a) Explain LCD interface with an 8-bit Microprocessor or Microcontroller. How the control word and data is written to LCD? [6] b) Name different features and applications of I2C. [6] c) What are the pipes and sockets? Explain their uses in Embedded system software implementation. [4] OR Q6) a) Explain data transfer mechanism in CAN protocol. Also elaborate on arbitration method used in CAN. [8] b) Explain the following for USB protocol : i) Client Software. ii) USB System software. iii) USB Host controller. iv) USB Topology. SECTION - II Q7) a) What is the role of ICE (In Circuit Emulator) in Embedded Systems? Explain in detail. [6] b) Explain the process of Embedded System development with the help of waterfall model. [12] OR Q8) a) What are the advantages of assembly language programming when used for the development of an Embedded System? Name two Embedded System applications where assembly language programming is preferred. [6] b) How cross compilers are different than compilers? Give two specific instances where one has to use cross compiler. [6]
[3764]-424 -2-

[8]

c) What important features of Embedded Software can be implemented using List - C language data structure? Name two implementations.[6] Q9) a) What are the different alternatives for RTOS to respond to hardware interrupt calls? Explain with the help of neat diagrams. [10] b) Name and explain the best strategy for scheduling dynamic RTOS tasks. [6] OR Q10) a) Define the following : i) Worst case latency period. ii) Dead line. What are the different timings/factors contribute towards the above timings? [7] b) What are the different types of RTOS? Give two examples for each type. [6] c) Name three soft real time scheduling algorithms. Q11) a) Explain the scheduling algorithm used in Micro C/OS - II. [3] [6]

b) Name and explain the functions of different ports used in implementation of automatic chocolate vending machine. [4] c) Name and explain tasks and IPCs used for sending bytes from application layer using TCP/IP stack. [6] OR Q12) a) Given : A smartcard system is to be designed for contact-less card for a bank. A RTOS is decided to be used for this application. The smartcard is expected to have all the security features required for banking application. Design different tasks and define their functions for the above system. Also explain their synchronization. [8] b) What is adaptive cruise control embedded system? Explain with the help of neat block diagram. What controls are provided to the driver for this purpose? [8] rrrr

[3764]-424

-3-

Total No. of Questions : 10]

[Total No. of Pages : 3

P1574

[3764]-1035
B.E. (EC)
FIBRE OPTIC COMMUNICATION
(404210) (1997 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) Answer any 3 questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Assume suitable data, if necessary.

SECTION - I Q1) a) What are Fiber modes? Explain mode theory for optical fiber in detail. [8] b) Compare SM fiber and Graded index fiber. Explain the requirements for fiber materials. [8] Q2) a) A fiber has normalized frequency is 26.6 and wavelength is 1300nm. If the radius of core is 25m. Compute numerical aperture? [6] b) Determine the cutoff wavelength for a step index fiber to exhibit single mode operation when the core refractive index and radius are 1.47 and 4.6 m, respectively, with the relative refractive index difference being 0.30%. [6] c) Multimode step index fiber with core diameter of 80 m and index difference of 1.5% at wavelength of 0.85 m. If the refractive is 1.48, find normalized frequency and no. of modes. [6] Q3) a) What is meant by material dispersion? Derive the expression for the pulse broadening due to material dispersion. [8] b) Discuss various kinds of losses that an optical signal might suffer while propagating through fiber. Which is most important one? What is the effect of these losses on light power and pulse shape? [8]
P.T.O.

Q4) a) A 90 Mb/s NRZ data transmission system that sends two DS3 channels uses a GaAlAs laser diode that has a 1 nm spectral width. The rise time of the laser transmitter is 2 ns. The transmission distance is 7 km over a graded index fiber that has an 800 MHz. km bandwidth distance product. [8] i) If the receiver bandwidth is 90 MHz and the mode mixing factor q = 0.7. What is the system rise time? Does this rise time meet the NRZ data requirement of being less than 70% of pulse width? What is the system rise time if there is no mode mixing in the 7 km link?

ii)

b) Discuss the different noise sources and disturbances in the optical pulse detection mechanism and derive the expression of S/N ratio. [8] Q5) Answer in brief : (2 marks each) a) What is meant by mode and index profile? b) Mention the advantages of Graded Index fiber. c) What is the need of Cladding? d) What do you mean by polarization mode dispersion? e) How are micro bending losses reduced? f) What is meant by population inversion? g) Define internal quantum efficiency of an LED. h) What is meant by impact ionization? In APD. SECTION - II Q6) A long haul optical fiber link uses single mode fiber. Find the link length without repeaters while link is operating at 500 Mbps with BER 108.[16] a) When A receiver has sensitivity of 30 dBm. b) When other type B receiver has sensitivity of 40 dBm. Conditions are as below : i) No dispersion penalty
-2-

[16]

[3764]-1035

ii) There are two types of transmitters available 1) 2) With Output Power = 3 mW. With Output Power = 0 dBm. Connector loss at each end = 1 dB Splice loss = 0.15 dB/km Attenuation per unit length = 0.35 dB/km Safety margin = 5 dB In length / In path connector loss for two connectors = 1 dB/connector Q7) a) Describe the working principle of PIN photo detector and explain the characteristics of pin diode. [8] b) Explain with neat diagram, construction and working of APD. [8]

Q8) a) List out the WDM components. Explain them briefly & list applications of WDM. [10] b) Compare between fusion splicing and mechanical splicing. [8]

Q9) a) Discuss with aid of suitable diagram the method used for the measurement of the total attenuation in an optical fiber. [8] b) Discuss the applications of optical fibers in : i) ii) Local area networks. Optical sensor for current measurement. [16] [8]

Q10) Write short notes on : a) Edge emitting LED. b) Eye diagram measurement. c) Single Mode Laser. d) Rise Time Budget. rrrr
[3764]-1035 -3-

Total No. of Questions : 10]

[Total No. of Pages : 3

P1575

[3764]-1098
B.E. (Information Technology)

OBJECT ORIENTED COMPONENT SYSTEMS


(410452) (1997 Course) (Elective - II)
Time : 3 Hours] Instructions to the candidates : 1) Answer any THREE questions from each Section. 2) 3) 4) Figures to right indicate full marks. Answers to the TWO sections should be written in separate answer books. Neat diagrams must be drawn wherever necessary. [Max. Marks : 100

SECTION - I Q1) What do you understand by the following terms : a) Inheritance, multiple inheritance. b) Maintenance of software. c) Object oriented systems. d) Stubs and marshalling/unmarshalling of parameters. Q2) Explain with examples the given concepts : a) Remote objects and RMI. b) Active X controls. c) Response time. d) Performance bottlenecks for a web application. Q3) Explain concept in brief : a) COM concepts : components, registry, interfaces. b) Client Server systems for web applications. c) Java Servlets. d) Advantages of XML.
P.T.O.

[16]

[16]

[16]

Q4) a) Explain the following with neat diagram : CORBA architecture.

[8]

b) Give example applications to illustrate advantages and use of computer networks, multiple servers, multiple types of clients like mobile, Laptops. [8] Q5) Write short notes on ANY THREE : b) Databases and applications in enterprise systems. c) Object relational Databases. d) Responsibilities of clients in Client Server Systems. e) Classes, methods, attributes, associations. SECTION - II Q6) Banks are modern enterprises with many facilities like loans, savings accounts, credit cards. Why technologies like Internet ie being online, security, components, middleware important for these online banking systems. [16] Q7) a) Write short notes on Java. b) Write short notes on JDBC. c) What is the object oriented principal of polymorphism? Q8) Explain the following concepts in brief : a) How to make websites user friendly? b) Database applications for websites with examples. c) Http protocol. d) HTML with examples.
[3764]-1098 -2-

[18]

a) Challenges like security, network failure etc in networked applications.

[6] [6] [4] [16]

Q9) Explain the following terms/concepts with examples of your own : [16] a) Login/passwords as a security means. b) Components and Enterprise Java beans. c) How dynamic content is handled on web sites? d) Http servers. Q10) Write short notes on ANY THREE : a) Components with GUI component as examples. b) Websites performance. c) Interfaces and classes. d) Open source systems for enterprises. e) .NET or COM. rrrr [18]

[3764]-1098

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1590

[3764]-105
B.E. (Civil)
ADVANCED GEO TECH. ENGINEERING
(2003 Course)

Time : 3 Hours] Instructions to the candidates : 1) Answer 3 questions from each section. 2) 3) 4) 5) 6)

[Max. Marks : 100

Answers to the two sections should be written in separate answer books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables in allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain significance of classification of soils. What are the different systems of classification of soil, and state the basis on which each system classify soils. [7] b) On carrying out dry sieve analysis, it is noticed that,

Cu = 4 and Cc Cu Cc = 9, where, Cu and Cc represent co-efficient of uniformity and coefficient of curvature, respectively. If, effective grain size of soil is 0.1 mm, determine Cu, Cc, D60, D30 and coefficient of permeability. [5]

c) Explain the following two fundamental building blocks involved in the formation of clay mineral structure : [6] i) ii) Tetrahedral unit. Octahedral unit. OR Q2) a) State the criteria that should be satisfied for classifying following soils: SW GP SM MH CI ML. [6]
P.T.O.

b) Explain with the help of neat sketches distinction between the following : [6] i) Single grained structure and honeycombed structure. ii) Flocculant and dispersed structure. c) On carrying out liquid limit and plastic limit test, on a soil sample, following observations are made : [6] % water content when 25 number of blows required to close the gap = 85. Flow index = 0.75 Plastic limit = 25 Natural water content = 65. Determine : i) Toughness index ii) Consistency index iii) Compression index iv) Classify soil. Q3) a) State two classical earth pressure theories and the basic assumptions made in these theories. [5] b) Derive an expression for critical height Hc of an unsupported vertical cut in cohesive soil. [4] c) A retaining wall 4 m high, has a smooth vertical back. The backfill has a horizontal surface in level with the top of the wall. Find total active earth pressure and its point of application using the following data :[7] i) Uniformly distributed surcharge of 30 kN/m 2 intensity over backfill. ii) Properties of backfill r = 18 kN/m3, = 30 & C = 0. iii) Water table is 1.5 m below the top of the wall. OR Q4) a) Explain Rebhanns graphical method to determine lateral earth pressure with a neat sketch. [5] b) State the criteria for design of gravity retaining wall. [4] c) A retaining wall 10 m high retains a cohesionless soil having an angle of internal friction of 30. The surface of the soil is level with the top of the wall. The top 3 m of the fill has a unit weight of 20 kN/m3 and that of the rest is 30 kN/m3. Find the magnitude per metre run and point of application of the resultant active thrust. Assume the same for both the strata. [7]
[3764]-105 -2-

Q5) a) Draw a tree type chart showing different types of geotextiles. Also state important characteristics of each type. [4] b) Draw illustrative labelled sketches showing 4 applications of geotextiles. [4] c) Draw a neat diagram of vertical reinforced earth retaining wall. Explain how length of reinforcement, sectional area of reinforcement is designed. Show on the diagram length, extent and zone of providing reinforcement is provided. [8] OR Q6) a) State the four functions for which geotextiles can be used. [2] b) Draw illustrative sketches showing examples of use of the four functions of geotextiles. Also explain procedure for laying of geotextiles. [6] c) Explain the circumstances/examples under which it is [2] i) Advisiable to use geotextiles. ii) Not advisiable to use geotextiles. d) Explain the design measures to be taken to guard against failure of grouted soil nails. [6] SECTION - II Q7) a) Draw a neat sketch of a curve of strain (X axis) and stress (Y axis) for determination of soil modulus. From this curve explain and demonstrate how would you determine tangent modulus. State where the value of tangent modulus is maximum. b) Explain how would you calculate analytically elastic settlement of foundations. c) Draw a neat sketch of frequency f(X axis) and soil response (Y axis) and explain its behaviour and state how would you calculate critical frequency. d) Define spring constant. Explain how would you determine the same in field as well as from laboratory tests. [17] OR Q8) a) Draw a smooth curve of strain and stress and state how would you determine secant modulus from the curve. Also explain how would you determine the same by empirical method. b) Define tolerable settlement. Explain the factors affecting the same by giving any two numerical examples.
[3764]-105 -3-

c) Draw a neat sketch of general layout of machine foundation showing foundation block, pedustal, machine and vibrating soil and explain the concept of soil mass. Also indicate how would you determine emperically the same. d) Explain with a sketch the concept of damping constant also discuss what are two types of damping in soil? [17] Q9) a) Explain the following with reference to dynamic consolidation with sketches : i) Procedure in details ii) Where useful and why iii) Field control-adopted. b) Explain the following with reference to sand drain and blanket. i) Draw a neat sketch of proposal in plan and section. ii) Principle involved. iii) Specifications for drain & blanket. [17] OR Q10) a) Explain by drawing a table showing size of soil grain with classification (X axis) and eight different methods used for in place treatment on other axis. b) Explain the following with reference to blasting. i) General Procedure. ii) Specifications. iii) Precaution. [17] Q11) Explain sketches the following models with their mathematical formulation and graphical presentation. [16] a) St. Venant Model. b) Maxwell Model. c) Kelvin Voieht Model. OR Q12) Starting with three fundamental models of elastic, viscous and friction develop the models suggested by Burger and Bingham and present them with sketch, mathematical and graphical presentation. [16] rrrr
[3764]-105 -4-

Total No. of Questions : 8]

[Total No. of Pages : 2

P1619

[3764]-395
B.E. (Petrochemical Engineering)
ENVIRONMENTAL ENGINEERING (2003 Course) (Elective - I)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4)

[Max. Marks : 100

Answer any 3 questions from each section. Answers to the two sections should be written in separate answer books. Figures to the right indicate full marks. Neat diagrams must be drawn wherever necessary.

SECTION - I Q1) a) Briefly explain the components of an ecosystem and with the help of diagram, describe an aquatic ecosystem in detail. [10] b) Discuss the environmental impacts of each of the following : [8] i) Coal Mining. ii) Urban Areas. Q2) a) Discuss Classification of Air Pollutants in detail. b) Elaborate on Adsorption of Gaseous Pollutants on Solids. [8] [8]

Q3) a) Enlist at least three basic mechanisms of removing particulate matter from gas streams. Enlist also the three Ts of combustion. [6] b) With the help of neat sketch describe catalytic oxidation method for air pollution control. [10] Q4) Write short notes on following (Any 4) : a) Sanitary Landfilling. b) Solid Waste Disposal by Incineration. c) Fabric Filter Systems. d) Source Correction Methods for Air Pollution Control. e) Medical Waste Management. f) Cyclone Separators. [16]

P.T.O.

SECTION - II Q5) a) Elaborate on Water Pollutants. [10] b) With the help of diagram showing interrelationship of solids found in wastewater, describe the types of solids found in a wastewater. [8] Q6) a) Discuss Biochemical Oxygen Demand in detail. [8] b) With the help of diagrams explain pretreatment step of primary treatment of wastewater in detail. [8] Q7) a) Elaborate on Treatment of Liquid Effluents from Petrochemical Industries. [8] b) Discuss Sludge Treatment and Disposal in detail. [8] Q8) Write short notes on following (Any 4) : a) Facultative Ponds. b) Microstraining. c) Treatment of liquid effluent from a Complex Fertilizer Plant. d) Trickling Filters. e) Activated Sludge Systems. f) Origin of Wastewater.
rrrr

[16]

[3764]-395

-2-

Total No. of Questions : 10]

[Total No. of Pages : 3

P1623

[3764]-1028
B.E. (E & TC)
ADVANCED POWER ELECTRONICS (1997 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to candidates : 1) Answer 3 questions from Section I and 3 questions from Section II. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Figures to the right indicate full marks. 5) All questions carry equal marks. 6) Your answers will be valued as a whole. 7) Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. 8) Assume suitable data, if necessary.

SECTION - I Q1) a) What are phase controlled converters? Explain with circuit diagram & waveforms working of 3 full controlled converter with RL load. Draw suitable waveforms at = 60. [10] i) ii) iii) Supply volt. Out put volt. Supply emt.

b) For 3 converter operating from a 3 415V/50Hz supply is feeding a highly induction load. The emt is continuous & ripple free equal to 100A. Find the thyrister ratings. [8] i) ii) iii) iv) ITH(av). ITH(rms). ITH(peak). PRV.

P.T.O.

Q2) a) What are inverters? Explain with ckt dia. & waveforms working of 3 VSI in 180 conduction mode with R load. [10] b) Compare VSI & CSI. [6]

Q3) a) What are Resonant converters? Explain with ckt diagram & w/fs working of ZVS. [10] b) Compare linear, switched mode & resonant converters. [6]

Q4) a) What is switched mode power supply? Compare with linear regulated power supplies. [8] b) Effect of EMI/EMC for SMPS. Q5) Write short notes on any three : a) Current source Inverters. b) 3 ASCSI with I.M. c) Harmonic Elimination techniques in inverter. d) Dual converters. e) P.F. Improvement techniques. SECTION - II Q6) a) What are dc drives? Explain with ckt dia. & waveform working of 1 semi converter controlled highly inductive load. Comment on Tq & Speed. [8] b) What is dynamic braking? Explain in brief. c) Effect of Ls over converter. [4] [4] [8] [16]

Q7) a) What are UPS? How it is different from AC regulators? Explain with block diagram & waveforms working of off-line UPS. State its specifications. [10] b) Compare ONLINE - ups, line interactive UPS & off line - UPS.
[3764]-1028 -2-

[6]

Q8) a) What are choppers? Justify why choppers are preferred over phase controlled converters for speed control of DC Motors? [8] b) What is stepdown chopper? Explain with ckt diagram & waveforms.[8] Q9) a) What are AC drives? Explain with block diagram working, speed control of 1 I.M. by using V/f techniques. [8] b) What are Stepper Motors? Explain with principle, working of PM Stepper Motor drive. [8] Q10) Write short notes on any three: a) BLDC. b) Flux Vector Techniques. c) based Stepper Motor Control. d) DC Current sensing & speed measurement techniques. e) 4Q-choppers.
rrrr

[18]

[3764]-1028

-3-

Total No. of Questions : 12]

[Total No. of Pages : 4

P1624

[3764]-249
B.E. (Electronics)
SOFTWARE ENGINEERING (2003 Course) (404205)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5)

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Your answers will be valued as a whole. Assume suitable data, if necessary.

SECTION - I Q1) a) What is Software Engineering? b) What is CMMI? Why we need it? [4] [4]

c) Explain waterfall model along with diagram. Explain its 4 advantages & disadvantages. [10] OR Q2) a) Explain following terms w.r.t. Software Engineering. i) Process. ii) Methods. iii) CASE Tools. b) Explain need & advantages of incremental models. c) Explain diagram for RUP. Q3) a) Which are different steps involved in project planning? b) Explain concept of System Engineering. c) Explain term Model. d) Explain meaning of deliverables in project planning. OR
P.T.O.

[6]

[6] [6] [6] [4] [4] [2]

Q4) a) Why we need SRS? Explain IEEE template for SRS?

[10]

b) What is significance of use case diagrams? Which are major participants in diagram? [4] c) Explain concept of Business Process Engineering. [2]

Q5) An automated ticket-issuing system sells rail tickets. When the user presses the start button, a menu display of potential destinations is activated, along with the message to the user to select a destination, once a destination has been selected, users are requested to i/p their credit card. Its validity is checked & the rail ticket is issued & their credit card account is charged PIN is used to validate credit card. [16] a) Find different scenarios for above system. b) Develop use case model. c) Find out classes & draw class diagram. d) Draw state choret for two classes. e) Draw seq. diagram. OR Q6) Library Information System performs following activities. a) Creating Book database. b) Updating & creating customer data. c) Issuing Books automatically. d) Fine calculation if any. e) Book orders as per requirements. f) Write scope statement for LIS. g) Develop use case model. h) Draw class diagram. i) j) Draw sequence diagram. Draw state transition diagram. [16]

[3764]-249

-2-

SECTION - II Q7) a) Explain the term pattern. Explain meaning of pattern based Software Engineering. [6] b) Why it may be necessary to design the system architecture before the specifications are written. [6] c) Explain following principles for UI development. i) ii) User familiarity. Consistency. OR Q8) a) Explain following terms: i) ii) Software reusability. Components [6] [6] [6]

iii) Recoverability.

iii) Software architecture. b) Explain any three software system design principles. c) What is meaning of user interaction? Explain five styles of U Interactions. [6] Q9) a) Explain different team structures associated with software projects. [8] b) Explain different software quality metrices. OR Q10) a) Explain following with example : i) ii) Project risks. Product risks. [8] [8]

iii) Business risks. iv) Risk identification. b) Explain how software metrices can be integrated with software process. Suggest & explain process model which uses this concept. [8] Q11) a) What is feasibility study of project? Explain any method for this w.r.t. software projects. [4]

[3764]-249

-3-

b) Explain COCOMO model. c) Explain software configuration management. OR Q12) Write short notes (WSN) (any 3) : a) Reengineering. b) Reverse engineering. c) Refactoring. d) Forward engineering.
rrrr

[6] [6] [16]

[3764]-249

-4-

Total No. of Questions : 12]

[Total No. of Pages : 2

P1631

[3764]-254
B.E. (Electronics)
ARTIFICIAL INTELLIGENCE (2003 Course)

Time : 3 Hours]

[Max. Marks : 100

Instructions to the candidates : 1) Answer 3 questions from Section I and 3 questions from Section II. 2) 3) 4) Answers to the two sections should be written in separate books. Use of logarithmic tables slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) Explain simulated Annealing algorithm in detail. Also explain how to select an annealing schedule. [10] b) Explain any two applications of Artificial Intelligence in detail. OR [8]

Q2) a) Explain the algorithm in detail which combines the advantages of both depth-first and breadth-first search into a single method. [10] b) Explain Simple Hill climbing algorithm. [8]

Q3) a) Explain resolution in Predicate logic with examples. [8] b) Explain how simple facts are represented in logic. What are different ways to represent a class membership. [8] OR Q4) a) Explain minimax search procedure. How the performance of the minimax procedure can be further improved? [8] b) Explain the need of Natural deduction in detail. [8] Q5) a) Explain in detail Non monotonic Reasoning. b) Explain statistical Reasoning & Fuzzy logic briefly. OR
P.T.O.

[8] [8]

Q6) a) Address the implementation issues of non monotonic reasoning. [8] b) Explain how frames can be used for knowledge representation. Give an example. [8] SECTION - II Q7) a) Explain Nonlinear planning in detail. b) Explain Hierarchical planning in detail. OR Q8) a) What is Planning System. Describe the different components of planning system. [8] b) Explain Goal Stack Planning in detail. Q9) a) Explain Waltz Algorithm in detail. [8] [9] [8] [8]

b) Explain the need of multilayer networks. Also explain the applications of the same in detail. [9] OR Q10) a) Explain Back propagation algorithm in detail. Also explain the term batch processing with training of a neural network. [9] b) Describe in detail various training methods used in Neural Networks with examples. [9] Q11) a) Explain Syntactic & Semantic analysis in short. OR Q12) a) Explain how ATN is used for natural language understanding. b) Write a note on Finite State Machine.
rrrr

[10]

b) Define expert system and give an approach to built an expert system.[6] [10] [6]

[3764]-254

-2-

Total No. of Questions : 10]

[Total No. of Pages : 3

P1840

[3764]-1051
B.E. (EC)
OPTICAL FIBRE COMMUNICATION
(404210) (1997 Course) (Elective - II)

Time : 3 Hours] Instructions to the candidates : 1) 2) 3) 4) 5) 6) Answer any 3 questions from each section.

[Max. Marks : 100

Answers to the two sections should be written in separate books. Neat diagrams must be drawn wherever necessary. Figures to the right indicate full marks. Use of logarithmic tables, slide rule, Mollier charts, electronic pocket calculator and steam tables is allowed. Assume suitable data, if necessary.

SECTION - I Q1) a) What is the basic principle behind optical transmission? Sketch the structure, index profile and path taken by light ray in SI and GI fibers.[6] b) The refractive index of a core is n1 = 1.48, nclad = 1.46. Under what conditions will light be trapped inside the core? [2] c) Define Numerical aperture and give the expression for the same in both SI and GI fibers. For the plastic fibre, n1 = 1.495, n2 = 1.402. Calculate the acceptance angle and Numerical Aperture. [8] Q2) a) What is meant by group velocity dispersion? What are the causes for intramodal dispersion? Explain how intermodal dispersion is reduced in GI fiber as compared to SI fiber. [8] b) What is meant by leaky modes? How do scattering losses arise? Distinguish Linear and Non-Linear scattering. [8]

P.T.O.

Q3) a) What are the basic LED configurations being used for fiber optics? An engineer has two Ga 1-x Alx. As LEDS one has a bandgap energy of 1.54ev and other has x = 0.015. i) Find the aluminum mole fraction x and the emission wavelength for the first LED. ii) Find the bandgap energy and the emission wavelength of the other LED. [8] b) Derive Einstein relationship and Threshold condition for Lasing action. Explain in detail the Laser Diode structures and its Radiation Pattern.[8] Q4) a) Enlist and discuss various types of losses that an optical signal might suffer while propagating through fiber. Which is most important one? What is the effect of these losses on optical power and pulse shape? [10] b) Define Excess Loss and Insertion Loss. A coupler has an excess loss of 1dB and 1 : 1 splitting ratio. How much of the input power reaches the two output terminals. [6] Q5) Write short note on the following (Any Three) : a) O.T.D.R. b) Optical pumping. c) Bending losses. d) Eye-Diagram measurement. SECTION - II Q6) a) What is meant by impact ionization in APD? With a neat sketch explain the principle and operation of Avalanche photodiode. [8] b) Discuss in detail the effect of the various noise mechanism in a Photodetector and its signal to noise ratio. [8] Q7) a) Is WDM efficient for multi-wavelength scheme? Discuss the operational principles of WDM highlighting its key features. [8] b) List some of the principle requirements of a good connector design.[4]
[3764]-1051 -2-

[18]

c) List the steps involved in splicing procedure.

[4]

Q8) a) Explain in detail the rise time budget of a fibre optic point to point link. [8] b) An optical fiber link is designed to operate 8 km length of the link without a repeater. The rise time of different individual components are The rise time of LED source The rise time of p-in photodector Rise time due to modal dispersion Rise time due to material dispersion = = = = 5 ns 8 ns 5 ns/km 1 ns/km

Calculate the sytem rise time and maximum bit rate that can be achieved in the link using (i) RZ format (ii) NRZ format. [10] Q9) Explain the use of optical fibers for the following : a) Measurement fiber losses. b) Optical sensor for current measurement. c) Guided weapons system. d) Optical communication for power sector. Q10) a) Discuss in detail Lansing schemes for power coupling improvement. [8] b) A fiber link includes 5 splices at 0.02 dB/splice, four connectors at 0.2 dB/connector, transmitter power at 10dBm, receiver sensitivity of 25dBm. What length of this link will be allowed if a SM fiber with attenuation of 0.3 dB/km is used and the required power margin is 3dB. [8] rrrr [16]

[3764]-1051

-3-

Potrebbero piacerti anche