Sei sulla pagina 1di 62

Prof Fabio Dias Magalhes

Primeira Lista de exerccios de Bioqumica

Temas: nucleotdeos, cidos nuclicos, aminocidos, protenas, sntese protica, replicao.
Saiba mais em

TEXTO PARA AS PRXIMAS 2 QUESTES. (Uerj 2001) O experimento clssico de Meselson e Stahl, em 1957, demonstrou que a replicao do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua prpria duplicao, formando molculas de DNA idnticas original. Nesse experimento, os cientistas cultivaram clulas de 'Escherichia coli' inicialmente em presena de fonte de N (istopo de nitrognio leve), trocando, a seguir, por N (istopo pesado), que incorporado s bases nitrogenadas do DNA. Colheram, ento, amostras de DNA aps a primeira e a segunda geraes de clulas crescidas em N e analisaram essas amostras quanto densidade do DNA formado. Considere como PESADO o DNA dupla hlice marcado com N; como LEVE o marcado com N; como INTERMEDIRIO o marcado com N e N. 1. Justifique por que, aps a troca da fonte de nitrognio, a primeira gerao de clulas foi totalmente constituda com DNA dupla hlice do tipo INTERMEDIRIO. 2. Calcule as propores dos trs tipos de DNA dupla hlice - LEVE, INTERMEDIRIO E PESADO - formados em clulas da segunda gerao, aps a troca da fonte de nitrognio. 3. (Fuvest 89) O desenho a seguir mostra a sntese de um polipeptdio a partir da molcula de DNA num certo organismo. Esse organismo um procarioto ou um eucarioto? Por qu?


Prof Fabio Dias Magalhes 4. (Ufrrj 2000) A membrana basal das clulas tireoideanas tem a capacidade especfica de bombear iodeto para o interior da clula. Isto chamado de seqestro de iodeto. Na glndula normal, a bomba de iodeto capaz de concentrar o iodeto at cerca de 30 vezes sua concentrao no sangue. Quando a glndula tireide est em sua atividade mxima, a proporo entre as concentraes pode chegar a um valor de at 250 vezes. (...) O retculo endoplasmtico e o complexo de Golgi sintetizam e secretam para dentro dos folculos uma grande molcula glicoprotica chamada de tireoglobulina.

(Adap. de GUYTON, A. C. e HALL, J. E.. "Tratado de Fisiologia Mdica". Rio de Janeiro, Guanabara Koogan, 1997. p.859-860.) A partir da anlise do texto e da figura, responda s questes propostas. a) Que tipo de transporte utilizado para manter as concentraes altas de iodeto no interior da clula? b) De que forma o retculo endoplasmtico rugoso e o complexo de Golgi participam na produo de tireoglobulina?


Prof Fabio Dias Magalhes 5. (Uerj 98) O grfico a seguir demonstra a distribuio citoplasmtica do nmero de ribossomas isolados e polirribossomas, em comparao com o nmero de cadeias polipeptdicas em formao durante um certo perodo de tempo.

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relao existente entre os ribossomas isolados e a formao das cadeias polipeptdicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptdicas e a dos polirribossomas. 6. (Unicamp 96) Um certo tipo de macromolcula destinada membrana plasmtica celular, depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os percursos esquematizados a seguir:

a) Por que essas etapas comeam no ncleo? b) Qual a composio da macromolcula ao final do percurso I? E do percurso II? Esclarea a diferena, baseando-se nas funes das organelas citoplasmticas envolvidas em cada percurso. 7. (Unicamp 92) Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma inativao na Regio Organizadora do Nuclolo? Justifique. pag.3

Prof Fabio Dias Magalhes 8. (Unesp 2003) Criadores e sitiantes sabem que a mula (exemplar fmea) e o burro (exemplar macho) so hbridos estreis que apresentam grande fora e resistncia. So o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a gua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos tm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produo de gametas, explique por que o burro e a mula so estreis. 9. (Ufrj 96) A fenilcetonria uma doena que resulta de um defeito na enzima fenilalanina hidroxilase, que participa do catabolismo do aminocido fenilalanina. A falta de hidroxilase produz o acmulo de fenilalanina que, por transaminao, forma cido fenilpirvico. Quando em excesso, o cido fenilpirvico provoca retardamento mental severo. Por outro lado, o portador desse defeito enzimtico pode ter uma vida normal desde que o defeito seja diagnosticado imediatamente aps o nascimento e que sua dieta seja controlada. A fenilcetonria to comum que mesmo nas latas de refrigerantes dietticos existe o aviso: "Este produto contm fenilcetonricos!". Qual o principal cuidado a tomar com a dieta alimentar de um portador desse defeito enzimtico? Por qu? 10. (G1) Quais so os principais elementos qumicos de que so formados os seres vivos? 11. (Ufrj 97) A glicoquinase e a hexoquinase so duas enzimas que reagem com o mesmo substrato, a glicose. Ambas so enzimas intracelulares que fosforilam a glicose formando glicose 6-fosfato (G6P). Dependendo da enzima produtora, a G6P pode ser degradada na via da gliclise para gerar energia, ou ento ser usada para sntese de glicognio. A gliclise ocorre nos tecidos em geral e a sntese de glicognio ocorre principalmente no fgado. A sntese do glicognio somente acontece quando existe excesso de glicose no sangue. Essa uma forma de armazenar esse acar. Observe a figura a seguir, que apresenta as velocidades de reao dessas duas enzimas em funo da concentrao da glicose. Nveis normais de glicose no sangue esto ao redor de 4mm.

Qual das duas enzimas gera G6P para sntese de glicognio heptico? Justifique sua resposta. pag.4

Prof Fabio Dias Magalhes 12. (Ufrj 99) O gato siams um animal de rara beleza pois a pelagem de seu corpo clara com extremidades - orelhas, focinho, ps e cauda - pretas. A presena do pigmento que d a cor negra a essas extremidades o resultado da atividade de uma enzima que fica inativada acima de 34C. Explique por que esses animais tm a pelagem negra nas extremidades do corpo. 13. (Ufscar 2001) O gene A responsvel pela produo do polipeptdeo X. Seu alelo a no produz o polipeptdeo X. Assim, indivduos de gentipos AA ou Aa produzem o polipeptdeo X, que est ausente nos indivduos aa. Os dois grficos, I e II, referem-se velocidade de formao de um determinado produto (VFP), em mg/hora, em dois indivduos da mesma espcie, quando suas temperaturas variam.

Sabendo que a velocidade de formao do produto (VFP) est relacionada presena ou ausncia do polipeptdeo X, responda. a) Qual dos grficos se refere a indivduo AA ou Aa e qual se refere a indivduo aa? b) Pelos dados dos grficos, qual seria a funo mais provvel do polipeptdeo X no processo de formao do produto? Como voc explicaria o comportamento da curva no grfico correspondente ao indivduo AA ou Aa? 14. (Unesp 2003) Os antibiticos e as vacinas fazem parte do arsenal da medicina, auxiliando-nos no combate s doenas provocadas por agentes infecciosos. Dentre essas doenas, podemos citar: tuberculose, gripe, hepatite, febre-amarela, gonorria. a) Das doenas citadas, para quais delas se prescreve tratamento com antibitico? b) Por que os antibiticos so indicados para os casos de infeces cujos agentes so bactrias, enquanto as vacinas so indicadas para a preveno de infeces virais? 15. (Unesp 2003) So muitas as lojas que vendem animais exticos para serem criados em casa como animais de estimao. Em uma dessas lojas, lagartos eram expostos em caixas de vidro, nas quais havia uma lmpada acesa. a) Qual a razo da lmpada na caixa em que est colocado o animal? Este procedimento tem alguma relao com algo que o animal experimenta em seu ambiente natural? b) Se esta caixa fosse deixada na vitrine, diretamente sob luz solar intensa, durante todo o dia, haveria prejuzo ao lagarto? pag.5

Prof Fabio Dias Magalhes 16. (Ufscar 2003) Em artigo publicado na "Folha de S.Paulo" (29.09.2002), I. Raw, P. Buss, E. Camargo e A. Homma afirmam: Vacinas so usadas para prevenir doenas infecciosas. Soros so usados, junto de outras medidas, para controlar as doenas que no puderam ser prevenidas. a) De que modo as vacinas previnem doenas? b) De que modo os soros controlam doenas que no puderam ser prevenidas? 17. (Uerj 2005) As estatinas, por seu grande xito na preveno da doena coronariana, esto entre os medicamentos mais prescritos no mundo. Essas substncias atuam sobre a enzima que regula a sntese de colesterol pelo fgado, denominada, simplificadamente, de HMG-CoA redutase. Para testar a eficincia de vrios derivados de estatinas, utilizou-se uma preparao de HMG-CoA redutase isolada de tecido heptico. A velocidade de reao dessa preparao enzimtica foi medida em funo de concentraes crescentes de seu substrato HMG-CoA, na ausncia e na presena de uma concentrao fixa de trs derivados de estatina. Nesses experimentos, o pH, a temperatura, a concentrao da enzima e a concentrao dos co-fatores necessrios foram sempre mantidos constantes. O grfico a seguir representa os resultados encontrados; a curva 1 foi obtida na ausncia de estatinas.

a) Nomeie o tipo de mecanismo de ao das estatinas sobre a enzima HMG-CoA redutase heptica e justifique sua resposta. b) Aponte uma substncia sintetizada a partir do colesterol em nosso organismo, no caracterizada como hormnio, e sua respectiva funo.


Prof Fabio Dias Magalhes 18. (Ufrj 2005) A anemia falciforme causada por uma mutao que produz uma alterao na seqncia de aminocidos da hemoglobina. Essa alterao pode ser detectada pela tcnica da eletroforese. O diagrama a seguir mostra o resultado do fracionamento por eletroforese da hemoglobina extrada de trs indivduos: A, normal, e B e C com anemia falciforme. Cada banda representa uma hemoglobina, alterada ou no.

Explique por que o indivduo B apresenta os dois tipos de hemoglobina. 19. (Unesp 2008) Em abril de 2007, astrnomos suos, portugueses e franceses descobriram um planeta semelhante Terra fora do sistema solar, o Gliese 581c. A descoberta desse planeta representa um salto da cincia na busca pela vida extraterrestre, visto que os cientistas acreditam que h gua lquida em sua superfcie, onde as temperaturas variam entre 0 C e 40 C. Tais condies so muito propcias existncia de vida. Por que a gua na forma lquida e temperaturas entre 0 C e 40 C so propcias para a existncia da vida tal como a conhecemos? 20. (G2) Por que as mitocndrias e os cloroplastos apresentam vida relativamente independente dentro das clulas eucariticas? 21. (Unicamp 2002) A indstria do entretenimento tem mostrado imagens ilusrias de robs de fico como o jovial R2D2 e o chato C3PO, de "Guerra nas Estrelas", e o Exterminador do Futuro. Entre os brinquedos japoneses, h uma srie de robs que imitam movimentos de seres humanos e de animais. Isso deixa as pessoas desapontadas quando se deparam com os robs reais, que executam tarefas repetitivas em fbricas. Eles no so to esplndidos como os anteriormente citados, mas significam menos esforo muscular no mundo real. (Adaptado de James Meek, "Robs mais baratos tomam fbricas europias", "O Estado de S. Paulo", 23/9/2000.) a) Uma das diferenas entre robs e seres humanos que nos homens existem quatro grupos de molculas orgnicas. Quais so esses grupos? Explique o que essas molculas tm em comum na sua composio. b) O sistema robtico armazena energia em baterias. Indique dois rgos ou tecidos de armazenamento de energia nos seres humanos. Que composto armazenado em cada um desses rgos ou tecidos?


Prof Fabio Dias Magalhes 22. (Unesp 2003) A ilustrao apresenta o resultado de um teste de paternidade obtido pelo mtodo do DNA-Fingerprint, ou "impresso digital de DNA".

a) Segundo o resultado acima, qual dos homens, A ou B, o provvel pai da criana? Justifique. b) Em linhas gerais, como feito o teste de identificao individual pelo mtodo do DNA-Fingerprint? 23. (Unesp 2004) Os bilogos moleculares decifraram o cdigo gentico no comeo dos anos 60 do sculo XX. No modelo proposto, cdons constitudos por trs bases nitrogenadas no RNA, cada base representada por uma letra, codificam os vinte aminocidos. Considerando as quatro bases nitrogenadas presentes no RNA (A, U, C e G), responda. a) Por que foram propostos no modelo cdons de trs letras, ao invs de cdons de duas letras? b) Um dado aminocido pode ser codificado por mais de um cdon? Um nico cdon pode especificar mais de um aminocido?


Prof Fabio Dias Magalhes 24. (Ueg 2005) A figura a seguir refere-se hereditariedade:

a) Qual a caracterstica do DNA, enquanto molcula mandatria da informao gentica, que permite a transmisso dessa informao do organismo para seus descendentes? b) A ocorrncia de mutaes importante para a evoluo da espcie? Justifique sua resposta. 25. (G2) Quais so as duas propriedades fundamentais do DNA que permitem a essa substncia desempenhar o papel de material gentico? 26. (G2) Por que o processo de replicao do DNA chamado semiconservativo? 27. (G2) Dada a seqncia de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? 28. (G2) Dada a seqncia de bases nitrogenadas de um segmento de DNA a seguir, responda aos itens adiante. TTT AAT GGG CAT a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? 29. (Fuvest 95) No DNA de um organismo, 18% das bases nitrogenadas so constitudas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que propores? Justifique sua resposta. pag.9

Prof Fabio Dias Magalhes 30. (Unitau 95) Considerando o modelo da estrutura molecular do DNA como representado na figura adiante, responda o que representam os componentes 1, 2 e 3, respectivamente.

31. (G2) Para funcionar como material gentico o cido desoxirribonuclico (DNA) apresenta a capacidade de autoduplicao. Utilizando seus conhecimentos sobre o material gentico, responda: a) Qual a importncia de o DNA autoduplicar-se? b) Por que essa replicao semiconservativa? 32. (G2) No DNA de um organismo, 20% das bases nitrogenadas so constitudas por adenina. Que outras bases nitrogenadas devem existir neste DNA e em que propores? 33. (G2) Mencione duas diferenas de natureza molecular entre o DNA e o RNA. 34. (G2) Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicao do DNA. 35. (G2) O que so NUCLEOTDEOS? Quais so as molculas que entram em sua composio qumica? 36. (G2) Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA?


Prof Fabio Dias Magalhes 37. (G2) O que representa o desenho a seguir? Qual o nome das molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo que se trata da unidade estrutural do cido desoxirribonuclico (DNA)?

38. (G2) No desenho a seguir, que representa a estrutura da molcula de DNA, o que representam os nmeros 1, 2 e 3 respectivamente?

39. (G2) Uma molcula de DNA contm 15% de guanina. Que outras bases nitrogenadas possui essa molcula e em quais propores? 40. (G2) Os cidos nuclicos so macromolculas definidas como polinucleotdeos. a) Represente um nucleotdeo apontando seus trs constituintes moleculares. b) Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA?


Prof Fabio Dias Magalhes 41. (G2) Para funcionar como material gentico o DNA apresenta duas propriedades fundamentais. So elas: I - AUTODUPLICAO II - TRANSCRIO Explique essas duas propriedades. 42. (G2) Sabendo-se que numa molcula de DNA formada por uma dupla hlice h 21% de timina, responda quais so as outras bases dessa molcula e em que propores ocorrem. 43. (G2) Considere um segmento de DNA com a seguinte seqncia de bases nitrogenadas: ATT CTA CGC AAA GGC a) Quais so as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produo de RNA, qual ser a seqncia de bases desse RNA? 44. (G2) Considere a seqncia de bases nitrogenadas de um segmento de DNA: AAA GGC ATT Responda: a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? 45. (G2) No DNA de um organismo, 32% das bases nitrogenadas so constitudas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que propores? 46. (Unesp 90) A anlise qumica de duas molculas de DNA revelou a seguinte composio de bases: Molcula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina; Molcula B 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanas entre estas duas molculas de DNA? b) Justifique sua resposta. pag.12

Prof Fabio Dias Magalhes 47. (Ufrj 96) O genoma da bactria "Escherichia coli" tem um tamanho de 410 pares de nucleotdeos. J o genoma haplide humano tem 310 pares de nucleotdeos. Para replicar o genoma, antes da diviso celular, existe uma enzima, a DNA polimerase, cuja velocidade de reao equivalente a cerca de 800 nucleotdeos/s. Assim, para replicar todo o genoma de uma bactria, a DNA polimerase consumiria cerca de 83 minutos e, para o genoma humano, aproximadamente 43 dias! Sabemos, no entanto, que o tempo de gerao da "E.coli" de cerca de 20 minutos, e que o tempo mdio de replicao de uma clula eucariota de 12 horas. Assumindo que a DNA polimerase apresenta uma velocidade de reao constante para todas as espcies analisadas, explique essa aparente contradio. 48. (Ufrj 96) O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genmica. Isto significa que cada indivduo possui variaes discretas e caractersticas na seqncia de seu DNA, ou seja, a seqncia de nucleotdeos do DNA de cada pessoa nica (excetuando-se o caso de gmeos monozigticos). Assim, a tipagem do DNA revela um padro de bandas que estvel (presente no DNA de todos os tecidos) e transmitido aos descendentes seguindo as leis de Mendel. Graas a essas caractersticas possvel atualmente realizar testes de paternidade que comparam os padres de bandas de DNA das pessoas e revelam se um homem de fato o pai biolgico de uma outra pessoa. Suponha agora a seguinte situao: um homem acusado de ser o pai de uma criana tenta burlar o teste de tipagem de DNA; um amigo o aconselha a receber uma transfuso de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de clulas nucleadas). a) Qual a influncia da transfuso sugerida no resultado do exame? b) Que precaues podem ser tomadas para desmascarar a tentativa de fraude? 49. (Unesp 97) A anlise qumica em amostras de cinco lminas com cidos nuclicos apresentou os seguintes resultados: 1. lmina: ribose 2. lmina: uracila 3. lmina: dupla-hlice 4. lmina: timina 5. lmina: 15% de guanina e 25% de citosina. a) Entre estas lminas, quais se referem a DNA? b) Justifique o resultado obtido com a 5. lmina.


Prof Fabio Dias Magalhes 50. (Unicamp 97) Em 1952, Hershey e Chase cultivaram bactrias em meio de cultura contendo fsforo radioativo (P) e colocaram bacterifagos (vrus) para infectar essas clulas. Os novos bacterifagos formados estavam marcados radioativamente. Estes bacterifagos marcados foram utilizados para infectar outras clulas bacterianas cultivadas sem a presena de fsforo radioativo. A marcao radioativa foi detectada dentro destas bactrias. a) Como se explica que o fsforo radioativo tenha passado para o bacterifago? b) Como se explica que as bactrias cultivadas sem a presena de fsforo radioativo tenham sido marcadas? c) Se, em vez de fsforo, tivesse sido usado enxofre radioativo (S) para marcao de protenas, os resultados seriam os mesmos? Justifique. 51. (Uerj 97) CLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTRIA DA EVOLUO DA HUMANIDADE Estas clulas formam um livro, conservado em tanques de nitrognio lquido que guarda informaes desconhecidas sobre a humanidade. Os captulos contam diferentes detalhes da saga do homem na terra: suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas. (adaptado de, "O Globo") a) Explique por que o processo de autoduplicao do DNA d significado hereditariedade permitindo revelar a histria da evoluo da humanidade. b) "... suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas" podem ser estudados atravs de observaes de caractersticas morfolgicas e fisiolgicas da clula. Nomeie o processo atravs do qual o DNA capaz de controlar e interferir nas caractersticas morfolgicas e fisiolgicas da clula. 52. (Ufrj 99) A tipagem de DNA uma tcnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivduos. Para se realizar uma anlise patrilnea, isto , a investigao dos ancestrais paternos, usa-se um marcador do cromossomo Y, que no se altera ao longo das geraes (salvo em casos de mutaes). Por outro lado, para uma anlise matrilnea (materna), lana-se mo do DNA mitocondrial. Por que o DNA mitocondrial deve ser usado para a anlise matrilnea?


Prof Fabio Dias Magalhes 53. (Uerj 99) Em clulas eucariotas mantidas em cultura, adicionou-se o nucleosdeo uridina marcado radioativamente com H ao meio de cultura. Aps algum tempo, as clulas foram transferidas para um novo meio que no continha o istopo. Amostras destas clulas foram retiradas 3, 15 e 90 minutos aps a transferncia, sendo, ento, colocadas em lmina de vidro, fixadas e submetidas a auto-radiografia. Esse processo marca a posio aproximada do istopo dentro da clula, como representado no esquema a seguir.

a) Cite o tipo de molcula qual a uridina se incorporou. Justifique sua resposta. b) Nomeie o compartimento celular que seria marcado, se o nucleosdeo radioativo usado fosse a timidina e justifique sua resposta. 54. (Uff 99) A mutao em um gene humano provoca cegueira. Com a utilizao de tcnicas de gentica clssica e molecular, verificou-se que este gene est localizado no genoma mitocondrial. Sabe-se que todas as mitocndrias dos indivduos afetados pela cegueira no possuem o gene normal, mas sim o gene mutado. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher normal e o homem cego; II) cuja mulher cega e o homem normal. b) Justifique as respostas ao item a. 55. (Ufrrj 99) Considerando as propriedades de duplicao do DNA, observe o resultado do experimento a seguir. 1 etapa: Em uma cultura com N, obtm-se o crescimento de colnias de bactrias; aps esse crescimento promove-se o desenvolvimento de mais duas geraes, em cultura com N. 2 etapa: Extrai-se o DNA de todas as bactrias e obtm-se o seguinte resultado: - Cultura de crescimento com N: 300 molculas de DNA todas com N. - Cultura de 1 gerao com N: 600 molculas de DNA todas com N e N. - Cultura de 2 gerao com N: 1200 molculas de DNA nas quais 600 com N e 600 com N e N Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. Justifique sua resposta.


Prof Fabio Dias Magalhes

56. (Ufrj 2001) No ADN, a transcrio dos genes no est restrita a somente uma das suas cadeias. Para alguns genes, a seqncia de nucleotdeos transcrita pode estar em uma cadeia, ao passo que a seqncia do outro gene pode estar localizada na cadeia oposta. No entanto, sabe-se que no mesmo trecho nunca ocorre a transcrio simultnea das duas cadeias de uma molcula de ADN. Tal evento inibiria o processo da traduo. Explique por que ocorreria a inibio da traduo se a transcrio de uma cadeia do ADN ocorresse ao mesmo tempo em que a transcrio da sua cadeia complementar, no mesmo trecho. 57. (Ufal 99) Para desempenhar sua funo como material hereditrio, o DNA possui duas propriedades. Identifique-as e descreva resumidamente cada uma delas.


Prof Fabio Dias Magalhes 58. (Unirio 2002) A figura a seguir mostra um trecho da estrutura do cido desoxiribonuclico, ressaltando a interao entre as duas cadeias do polmero. Na figura, A, C, G & T representam as bases adenina, citosina, guanina e timina, respectivamente.

As linhas pontilhadas indicam as pontes de hidrognio que so formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrognio podem ser rompidas por calor, o que produz a dissociao das cadeias. Esse processo reversvel chama-se de desnaturao. A temperatura necessria para desnaturar o DNA depende de vrios fatores, mas um deles a composio dos nucleotdeos de um determinado DNA. Observe as duas seqncias de DNA a seguir e determine qual delas precisar de uma temperatura de desnaturao maior. Justifique a sua resposta. 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT 59. (Unifesp 2003) Cientistas criaram em laboratrio um bacterifago (fago) composto que possui a cpsula protica de um fago T2 e o DNA de um fago T4. Aps esse bacterifago composto infectar uma bactria, os fagos produzidos tero a) a cpsula protica de qual dos fagos? E o DNA, ser de qual deles? b) Justifique sua resposta.


Prof Fabio Dias Magalhes 60. (Unifesp 2003) No heredograma seguinte, a pessoa A possui uma mutao no DNA de todas as suas mitocndrias, que faz com que a produo de energia para os msculos seja deficiente, ocasionando dificuldades motoras para os portadores do problema. Essa pessoa casou-se com outra, aparentemente normal. O casal (P) teve filhos (F1) e estes, por sua vez, tambm tiveram filhos (F2).

a) Copie o heredograma, pintando quais sero as pessoas afetadas pela doena em F1 e em F2 b) Justifique sua resposta.


Prof Fabio Dias Magalhes 61. (Fuvest 2004) Bactrias (Escherichia coli) foram cultivadas durante vrias geraes em um meio de cultura na qual toda a fonte de nitrognio era o istopo pesado N. De uma amostra dessas bactrias (amostra A), extraiu-se o DNA que foi submetido a uma tcnica de centrifugao que permite separar molculas de DNA de acordo com sua densidade. O restante das bactrias foi transferido para um meio de cultura em que todo o nitrognio disponvel era o istopo normal N. Retirou-se uma segunda amostra (amostra B), quando as bactrias completaram uma diviso celular nesse novo meio e uma terceira amostra (amostra C), quando as bactrias completaram duas divises celulares. O DNA das bactrias das amostras B e C foi tambm extrado e centrifugado.

A figura mostra o resultado da centrifugao do DNA das trs amostras de bactrias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediria entre o que constitudo apenas por N e o que contm apenas N? b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior X, que quantidade de DNA h na faixa superior? 62. (Ufrj 2004) Estudos recentes compararam as seqncias completas de DNA mitocondrial de indivduos de vrias regies geogrficas do planeta. Os resultados revelaram que a variabilidade gentica no DNA mitocondrial de indivduos africanos era quase o dobro da observada no DNA mitocondrial de no-africanos. Esses resultados foram importantes para corroborar a idia de que o ancestral comum mais recente do 'Homo sapiens' viveu na frica h cerca de 200.000 anos. Explique por que a maior diversidade do DNA mitocondrial apia a idia da origem africana do 'Homo sapiens'. 63. (Ufrj 2005) A soma das porcentagens de guanina e citosina em uma certa molcula de ADN igual a 58% do total de bases presentes. a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G) e timina (T), nessa molcula. b) Explique por que impossvel prever a proporo de citosina presente no ARN mensageiro codificado por esse trecho de ADN. pag.19

Prof Fabio Dias Magalhes 64. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma nica pgina na revista inglesa "Nature" intitulado "A estrutura molecular dos cidos nuclicos", quase ignorado de incio, revolucionou para sempre todas as cincias da vida sejam elas do homem, rato, planta ou bactria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o cdigo gentico determinante para a sntese protica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimos" e os "degraus" dessa escada. b) Que relao existe entre DNA, RNA e sntese protica? c) Como podemos diferenciar duas protenas? 65. (Uerj 2006) Num experimento, foram comparadas as caractersticas genotpicas e fenotpicas de clulas retiradas de um tecido de anfbio, ainda no estgio de girino, com as de clulas de tecido similar do mesmo indivduo aps atingir a idade adulta. Explique por que, entre essas clulas: a) as caractersticas genotpicas so iguais; b) as caractersticas fenotpicas so diferentes. 66. (G2) Que papis desempenham o RNA mensageiro e do RNA transportador no processo de sntese das protenas? 67. (G2) Observe o esquema adiante e responda:

a) Quais so as molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo-se que trata-se da unidade estrutural do cido ribonuclico (RNA). b) Qual o nome dessa unidade estrutural? 68. (G2) Uma cadeia de RNA tem 200 nucleotdeos. Quantos nucleotdeos tinha o DNA que originou esse RNA?


Prof Fabio Dias Magalhes 69. (G2) Um segmento de RNA mensageiro apresenta a seqncia de bases nitrogenadas a seguir: AAA UUC GGG GAU. a) Quais so as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotdeos existem no DNA que deu origem a essa molcula de RNA mensageiro? 70. (Uerj 2004) A enzima poligalacturonase, que digere a parede celular de clulas vegetais, a principal responsvel pela maturao de frutos como o tomate. Para retardar o amadurecimento e evitar as perdas durante o armazenamento, utilizou-se uma tcnica na qual o gene que codifica a enzima citada foi inserido, de maneira invertida, no genoma de um tomateiro. O esquema adiante mostra os produtos da transcrio do gene normal da enzima e do gene inserido, ambos ativos nesse tomate geneticamente modificado.

a) Descreva a interao que ocorre entre os produtos da transcrio dos genes normal e inserido no tomate geneticamente modificado e indique a caracterstica dessas molculas que permite a interao. b) Explique por que haver um aumento no tempo de amadurecimento desse tomate geneticamente modificado. 71. (Fuvest 92) De que maneira o DNA determina a seqncia de aminocidos das molculas de protenas?


Prof Fabio Dias Magalhes 72. (Fuvest 96) Uma doena gentica de herana dominante causada por mutaes em um gene localizado em um autossomo. Os indivduos A, B e C tm mutaes em um segmento de DNA desse gene, cuja seqncia normal est representada a seguir. Usando a tabela que relaciona alguns cdons aos respectivos aminocidos e considerando que a fita molde a ser transcrita aquela assinalada com a letra m, responda: a) Quais sero os segmentos de protenas produzidos, respectivamente, pelos indivduos A, B e C? b) Como ser o fentipo (normal ou afetado dos indivduos A, B e C? Por qu? Seqncia normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

73. (Ufrj 97) O ADN um polmero constitudo por vrios nucleotdeos e as protenas so polmeros constitudos por vrios aminocidos. Um gene constitudo por um nmero N de nucleotdeos que codifica uma protena constituda por P aminocidos. Por que sempre encontramos N > P?


Prof Fabio Dias Magalhes 74. (Ufrj 99) Com o auxlio da tabela do cdigo gentico representada a seguir, sempre possvel deduzir-se a seqncia de aminocidos de uma protena a partir da seqncia de nucleotdeos do seu gene, ou do RNA-m correspondentes.

Entretanto, o oposto no verdadeiro, isto , a partir da seqncia de aminocidos de uma protena, no se pode deduzir a seqncia de nucleotdeos do gene. Explique por qu. 75. (Ufv 2000) Considere a tabela abaixo, contendo cdigos de trincas de bases do DNA com os aminocidos correspondentes, para resolver os itens seguintes:

a) Determine a seqncia de bases do RNAm que foi utilizado para sintetizar o polipeptdeo esquematizado abaixo da tabela. b) Se ocorresse uma substituio, por uma purina, na 3 base do cdigo correspondente ao 6. aminocido do polipeptdeo, qual seria o aminocido da tabela a ser incorporado? c) Qual anticdon correspondente ao novo aminocido incorporado?


Prof Fabio Dias Magalhes 76. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya constitudo pelos mesmos 4 tipos de bases dos seres vivos terrestres. J o cdigo gentico desses organismos determinado por cdons de 2 bases. a) As protenas A, B e C, encontradas nos organismos da Terra, apresentam, respectivamente, 13, 16 e 19 tipos diferentes de aminocidos. Explique a possibilidade da ocorrncia dessas trs protenas nos seres de Zbohrnya. b) Sabendo que a vida em Zbohrnya e na Terra existe h 3,5 bilhes de anos, faa uma comparao entre a diversidade dos organismos encontrados nesses dois planetas. c) Se o gene de uma protena respiratria de um organismo zbohrniano for introduzido numa bactria terrestre, a protena produzida pela expresso desse gene ser idntica da espcie zbohrniana? Justifique sua resposta. 77. (Uff 2004) O fumo est relacionado ao aumento de risco para o cncer de pulmo. O hbito de fumar expe os fumantes a substncias com atividade carcinognica. O Benzo[a]pireno, um dos principais agentes carcinognicos presentes na fumaa do cigarro, tem a capacidade de promover mutaes no DNA levando a mudana da base Guanina para Timina. Suponha que um trecho da fita molde de DNA do gene X, representado a seguir, possa ser alterado em presena do Benzo[a]pireno, em um dos dois stios indicados na figura 1. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. Indique as alteraes que ocorrero na sntese da protena X quando a mutao for localizada nos diferentes stios, justificando cada resposta com a utilizao do cdigo gentico da figura 2:


Prof Fabio Dias Magalhes 78. (Ufv 2004) A tabela adiante representa uma verso fictcia do cdigo gentico. Entretanto, esse cdigo segue o padro do cdigo gentico universal, no qual trs bases codificam um aminocido.

Analise a tabela e faa o que se pede: a) Cite o nome da enzima que catalisa a sntese de RNA mensageiro. b) Cite a seqncia do anticdon correspondente ao cdon de iniciao. c) Qual a seqncia de aminocidos que resultar da traduo da molcula de RNA mensageiro? Ver figura anterior. d) Qual a seqncia de aminocidos que resultar da traduo da mesma molcula de mRNA, aps uma deleo do TERCEIRO nucleotdeo?


Prof Fabio Dias Magalhes 79. (Ufg 2005) As globinas constituem um bom exemplo da importncia da informao gentica na estrutura primria e na funo das protenas. a) Considere o segmento de DNA, cuja seqncia de nucleotdeos 5' - GTG - CAC - CTG - ACT - CCT - GAG - GAG - AAG - 3' e, utilizando-se da tabela do cdigo gentico apresentada a seguir, fornea o produto da sntese protica (polipeptdio parte da cadeia beta prevista para a globina humana).

b) Utilize um exemplo de alterao estrutural da globina humana (cadeia beta) para explicar como uma mutao pontual, do tipo substituio, pode afetar a sade e a qualidade de vida do portador dessa mutao.


Prof Fabio Dias Magalhes 80. (Ueg 2007) O esquema a seguir uma representao do cdigo gentico.

De acordo com o esquema apresentado, responda ao que se pede. a) O que o cdigo gentico? b) Explique por que se diz que ele degenerado. 81. (Unifesp 2003) O jornal "Folha de S.Paulo" (23.09.2002) noticiou que um cientista espanhol afirmou ter encontrado protenas no ovo fssil de um dinossauro que poderiam ajud-lo a reconstituir o DNA desses animais. a) Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqncia de DNA, obtm-se uma protena. b) A partir de uma protena, possvel percorrer o caminho inverso e chegar seqncia de DNA que a gerou? Justifique.


Prof Fabio Dias Magalhes 82. (Fuvest 2005) A seguir est representada a seqncia dos 13 primeiros pares de nucleotdios da regio codificadora de um gene. --- A T G A G T T G G C C T G ----- T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas esquerda, corresponde ao aminocido metionina. A tabela a seguir mostra alguns cdons do RNA mensageiro e os aminocidos codificados por cada um deles.

a) Escreva a seqncia de bases nitrogenadas do RNA mensageiro, transcrito a partir desse segmento de DNA. b) Utilizando a tabela de cdigo gentico fornecida, indique a seqncia dos trs aminocidos seguintes metionina, no polipeptdio codificado por esse gene. c) Qual seria a seqncia dos trs primeiros aminocidos de um polipeptdio codificado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotdios (ou seja, a deleo do par de bases T = A)? 83. (Unicamp 94) Considere um fragmento de DNA com a seguinte seqncia de bases: GTA GCC TAG e responda: a) Qual ser a seqncia do RNAm transcrito a partir deste DNA? b) O mesmo peptdio ser obtido a partir deste RNAm e do RNAm da fita complementar? Explique. 84. (G2) Dado um segmento de RNA mensageiro com a seguinte seqncia de bases: AAU GUA GGC pergunta-se: a) Qual a seqncia de bases do DNA que deu origem a esse RNA? b) Quantos aminocidos ter o polipeptdeo traduzido, no ribossomo, a partir desse RNA?


Prof Fabio Dias Magalhes 85. (G2) Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma destruio do(s) nuclolo(s) de uma clula?. 86. (Ufrj 97) Em um organismo pluricelular com vrios tecidos, como no caso dos seres humanos, todas as clulas possuem um genoma idntico. Analogamente, correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos so todos idnticos? Justifique sua resposta 87. (Unesp 2003) Em um segmento da cadeia ativa de DNA, que servir de molde para a fita de RNA mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da fita complementar do DNA h 12 timinas e 10 guaninas. Levando-se em considerao essas informaes, responda. a) Quantas uracilas e quantas guaninas comporo a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminocidos devero compor a cadeia de polipeptdeos que ser formada? Justifique sua resposta. 88. (G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqncia de bases TAC TCC GCT TAG e, em sua cadeia complementar, a seqncia ATG AGG CGA ATC, quais so as seqncias de bases de RNAm por ele produzido? 89. (G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqncia de bases ACTCCGCTT / TGAGGCGAA, quais poderiam ser as seqncias de bases do RNA por ele produzido?


Prof Fabio Dias Magalhes 90. (Ufrj 98) Suponha um gene de um eucarioto responsvel pela sntese de uma protena. Nesse gene existem ntrons, ou seja, regies do ADN cujas informaes no esto presentes na protena em questo. As regies do ARN transcrito correspondentes aos ntrons so eliminadas aps o processo de transcrio. A figura a seguir representa o resultado de uma experincia de hibridao do ARN mensageiro com a cadeia de ADN que lhe deu origem.

A figura mostra cinco regies, identificadas por nmeros de 1 a 5. Quais dessas regies correspondem aos ntrons? Justifique sua resposta. 91. (Unirio 2002) Atualmente os genes podem ser desmembrados em trs classes diferentes: os genes que expressam mRNA que codificam polipeptdios diversos; os genes reguladores que codificam protenas que regulam outros genes; e uma terceira classe de genes que no codificam polipeptdios. Qual o produto final da classe de genes que no codificam polipeptdios? 92. (Uerj 2004) Analisando o genoma de alguns tipos de vrus formados por fita simples de RNA, encontramos aqueles que so RNA (-), como o do resfriado comum, e os que so RNA (+), como o da poliomielite. Observe que: - nos vrus RNA (-), apenas o RNA complementar a seu genoma capaz de funcionar como mensageiro na clula infectada; - nos vrus RNA (+), o genoma viral funciona diretamente como mensageiro; - ambos os vrus necessitam, para sua replicao, da enzima RNA replicase, que sintetiza um RNA complementar a um molde de RNA; - o gene da enzima RNA replicase est presente no genoma dos dois tipos de vrus, mas a enzima s encontrada nas partculas virais RNA (-). a) Explique por que necessrio, para sua replicao, que os vrus RNA (-) j contenham a enzima RNA replicase, enquanto os RNA (+) no precisam armazenar esta enzima. b) Apresente um argumento contrrio hiptese de que os vrus, devido simplicidade de sua estrutura, foram precursores das primeiras clulas.


Prof Fabio Dias Magalhes 93. (Unicamp 2002) O esquema a seguir representa a seqncia de reaes que levam formao do pigmento da pelagem de uma espcie animal. Os genes autossmicos A, B e C so responsveis pela produo das enzimas A, B e C que atuam nesse processo metablico. Mutaes nos genes A, B e C produzem respectivamente os alelos recessivos a, b e c.

a) Do ponto de vista gentico, quantos tipos de albinismo podem ocorrer nessa espcie? Por qu? b) Demonstre o fentipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. c) possvel ocorrer uma mutao em um gene sem que se altere a enzima correspondente? Justifique. 94. (Fuvest 93) O que so cidos nuclicos? Como atuam na sntese de protenas? 95. (G2) Quais os papis do gene e do ribossomo na sntese das protenas celulares?


Prof Fabio Dias Magalhes 96. (Fuvest-gv 91) Certos mutantes nutricionais do fungo Neurospora s conseguem crescer quando aminocidos so adicionados ao meio de cultura. Na tabela a seguir, o sinal (+) significa crescimento, e o sinal (-) significa ausncia de crescimento.

Sabe-se que as etapas que levam sntese da arginina so: substrato (gene1) ornitina (gene2) citrulina (gene3) arginina Supondo que em cada mutante h apenas um gene alterado, explique o porqu do mutante Z s crescer quando se adiciona arginina ao meio de cultura.


Prof Fabio Dias Magalhes 97. (Ufrj 95) Na espcie humana h dois tipos de hemoglobinas, conhecidas como hemoglobinas A e S, que diferem apenas em um aminocido: Hemoglobina A: ...valina-histidina-leucina-treonina-prolina-cido glutmico... Hemoglobina S: ...valina-histidina-leucina-treonina-prolina-x... Essa pequena diferena suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme. Os cdons de RNA-m que codificam esses aminocidos so: valina - GUU, GUG, GUC, GUA histidina - CAU, CAC leucina - UUG, UUA treonina - ACU, ACC, ACG, ACA prolina - CCU, CCC, CCG, CCA cido glutmico - GAG, GAA A mutao pode ocorrer no ADN como mostra o esquema a seguir:

a) Qual o aminocido que aparece, na hemoglobina S, no lugar do cido glutmico? Justifique sua resposta. b) Todas as clulas, a partir da clula que sofre a mutao, sero anmalas? Justifique sua resposta. 98. (Unicamp 98) O metabolismo celular controlado por uma srie de reaes em que esto envolvidas inmeras protenas. Uma mutao gnica pode determinar a alterao ou a ausncia de algumas dessas protenas, levando a mudanas no ciclo de vida da clula. a) Explique a relao que existe entre gene e protena. b) Por que podem ocorrer alteraes nas protenas quando o gene sofre mutao? c) Em que situao uma mutao no altera a molcula protica?


Prof Fabio Dias Magalhes 99. (Unicamp 2000) Abaixo esto esquematizadas as seqncias de aminocidos de um trecho de uma protena homloga, em quatro espcies prximas. Cada letra representa um aminocido.

a) Quantos nucleotdeos so necessrios para codificar a seqncia de aminocidos nas espcies 1 e 2? Justifique. b) Pode-se dizer que seqncias idnticas de aminocidos so sempre codificadas por seqncias idnticas de nucleotdeos? Justifique. c) Considerando que as espcies 2, 3 e 4 se originaram da espcie 1, que tipo de mutao originou cada seqncia? 100. (Unirio 2002) Sabe-se que a bactria 'E.coli' cresce mais rapidamente na presena da glicose (um monossacardeo) do que na presena de lactose (um dissacardeo). Isso se deve a dois fatos: primeiro, a lactose no to facilmente incorporada pelas bactrias; segundo, porque a lactose necessita ser hidrolisada pela enzima -galactosidase em glicose e galactose. O grfico a seguir resultou de experimento em que 'E.coli' foi inoculada num meio contendo uma mistura de glicose e lactose. As curvas no grfico adiante representam a concentrao da enzima -galactosidase, a concentrao de glicose e o nmero de bactrias no meio de cultura em funo do tempo.

Identifique as curvas da figura, correlacione os parmetros concentrao de -galactosidase, concentrao de glicose e nmero de bactrias e explique o comportamento da curva da enzima -galactosidase.


Prof Fabio Dias Magalhes 101. (Ufrj 2002) Nos procariotos, o sinal para o incio da sntese das protenas (traduo) geralmente sinalizado no ARNm pelo cdon AUG, que corresponde ao aminocido metionina. No entanto, alm do cdigo AUG, existe uma seqncia curta de nucleotdeos que antecede esse cdon. Essa seqncia, que chamada de Shine-Dalgarno, em homenagem aos pesquisadores que as detectaram, permite que o stio correto de iniciao da traduo seja selecionado. O diagrama a seguir ilustra a localizao dessa seqncia. A seqncia de Shine-Dalgarno est em vermelho e o cdon de iniciao, em azul.

Explique a importncia desse duplo controle da iniciao para a traduo correta da mensagem contida no ARNm. 102. (Ufscar 2005) Nos anos 50 e 60, quando se iniciavam as pesquisas sobre como o DNA codificava os aminocidos de uma protena, um grupo de pesquisadores desenvolveu o seguinte experimento: - Sintetizaram uma cadeia de DNA com trs nucleotdeos repetidos muitas vezes em uma seqncia conhecida: ...AGCAGCAGCAGCAGCAGCAGCAGC... - Essa cadeia de DNA foi usada em um sistema livre de clulas, porm no qual haviam todos os componentes necessrios sntese protica, incluindo os diferentes aminocidos. - Nesse sistema, essa cadeia de DNA sempre produzia uma protena com um nico tipo de aminocido. Diferentes repeties do experimento demonstraram que at trs protenas diferentes poderiam ser produzidas, cada uma delas com um nico tipo de aminocido: serina ou alanina ou glutamina. a) Por que as protenas obtidas possuam apenas um tipo de aminocido? b) Por que foram obtidos 3 tipos de protenas?


Prof Fabio Dias Magalhes 103. (Uerj 2006) Para investigar possveis efeitos de uma determinada droga, utilizou-se uma cultura de clulas, qual foram adicionadas quantidades adequadas das seguintes substncias, marcadas com istopos: uridina C, timidina H e leucina N. Aps algum tempo, a droga foi tambm introduzida no meio de cultura. Ao longo do experimento, amostras das clulas foram coletadas a intervalos regulares. A incorporao dos istopos foi medida em uma preparao que contm os cidos nuclicos e as protenas da clula. Os resultados do experimento esto mostrados no grfico a seguir.

a) Considere as etapas de replicao, transcrio e traduo nas clulas analisadas. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. b) As protenas, aps sintetizadas, adquirem uma conformao tridimensional. Cite duas ligaes ou interaes que atuam na manuteno da estrutura enovelada das protenas. 104. (Unifesp 2006) Uma fita de DNA tem a seguinte seqncia de bases 5'ATGCGT3'. a) Considerando que tenha ocorrido a ao da DNA-polimerase, qual ser a seqncia de bases da fita complementar? b) Se a fita complementar for usada durante a transcrio, qual ser a seqncia de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para sntese de protenas? 105. (Uerj 2007) Diversas tcnicas so utilizadas para determinar, em genes de uma clula eucariota, a seqncia de bases nitrogenadas codificantes, ou seja, aquela que define a estrutura primria da protena a ser sintetizada. A abordagem experimental mais freqente, hoje, consiste em, primeiramente, extrair os RNA-mensageiros da clula, sintetizar os seus DNA-complementares e, ento, proceder ao seqenciamento das bases presentes nesses DNA. Em uma bactria, no entanto, possvel determinar a seqncia codificante diretamente a partir de seu cromossomo. Explique o motivo pelo qual, em organismos eucariotos, prefervel utilizar o RNA-mensageiro para determinar a regio codificante do DNA.


Prof Fabio Dias Magalhes 106. (Ufg 2007) Os grficos a seguir representam o efeito inibitrio de dois antibiticos (I e II) sobre a sntese protica em culturas de 'Staphylococcus aureus'. As setas nos grficos indicam o momento em que foram administrados os antibiticos nas culturas.

Com base nos grficos, explique a atuao dos antibiticos I e II sobre a sntese protica. 107. (Ufrj 2008) Se extrairmos o DNA total de clulas de msculo, bao e rim de um mesmo indivduo, verificaremos que os tecidos apresentam genomas idnticos. Os RNA mensageiros das clulas desses trs tecidos sero os mesmos? Justifique sua resposta. 108. (G2) Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformao" de bactrias pneumococos sem cpsula, no-patognicas, em pneumococos com cpsula, patognicas. 109. (G2) Como os cientistas O. Avery, M. MacLeod e M. McCarthy chegaram concluso, em 1944, de que o "agente transformante" capaz de permitir o desenvolvimento da cpsula em pneumococos no-capsulados era o cido desoxirribonuclico? 110. (G2) O que so bacterifagos? Qual sua importncia na identificao do DNA como material gentico? 111. (G2) Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como "experincia do liquidificador" na qual utilizaram istopos radioativos de enxofre (S) e de fsforo (P) para 'marcar' vrus parasitas de bactrias, bem como suas concluses a partir deste trabalho. 112. (Ufrj 2004) Aps tratar culturas de bactrias com doses de um agente mutagnico capaz de induzir uma nica mutao pontual (que afeta apenas um nucleotdeo por clula), analisou-se a seqncia de aminocidos de uma determinada protena em diversos mutantes gerados. Verificou-se que um desses mutantes produzia uma dada protena que diferia da original pela ausncia de 35 aminocidos em uma das extremidades da cadeia peptdica. Explique como essa nica mutao pontual pode fazer com que a sntese da protena seja interrompida prematuramente. pag.37

Prof Fabio Dias Magalhes 113. (G2) Qualquer alterao no DNA pode modificar o funcionamento de uma clula? Justifique. 114. (G2) A substituio de uma nica base na molcula de DNA leva necessariamente substituio de um aminocido na protena a ser sintetizada pela clula. Certo ou errado? Justifique. 115. (Ufrj 2007) As seqncias de RNA mensageiro a seguir codificam peptdeos com atividades biolgicas especficas. Suponha que mutaes no DNA tenham causado as seguintes mudanas nas duas molculas de mRNA (1 e 2). A tabela resumida do cdigo gentico mostra alguns cdons e seus aminocidos correspondentes.

Em qual das mudanas (1 ou 2) h risco de perda ou de diminuio da atividade biolgica? Justifique sua resposta.


Prof Fabio Dias Magalhes 116. (Ufc 2008) Uma biotecnologia conhecida como "construo anti-senso" (sem sentido) foi utilizada para a produo de tomate transgnico. A transformao gentica do tomateiro consistiu na incorporao (no genoma da planta) e na expresso de um segmento de DNA, que apresenta uma seqncia de nucleotdeos, complementar quela do gene natural. Esse gene natural codifica para a produo de uma enzima, essencial biossntese do etileno. Com base no exposto, responda as questes a seguir. a) Qual o resultado da transcrio do gene natural (I) e do "gene anti-senso" (II), presentes no segmento de DNA (molde) das plantas modificadas, mostrado a seguir? 3'___ATTCGGC___TAAGCCG___TAAGCCG___5'(DNA) b) Segundo as regras de emparelhamento dos pares de bases, que fenmeno ocorrer como resultado do encontro, no citoplasma, entre esses dois RNA mensageiros, determinados no item anterior, e qual a conseqncia para o processo de traduo? c) A transformao gentica foi realizada de modo que a expresso do "gene anti-senso" ocorra apenas nos tecidos do ovrio floral. Qual o resultado final mais provvel de todo esse processo? d) Qual a principal vantagem para os produtores de tomate que passarem a utilizar essas plantas transgnicas? 117. (Ufrn 2005) O teste de paternidade usando o DNA tornou-se muito freqente hoje. No entanto, as pessoas tm muitas dvidas a respeito desse tipo de exame. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet ( I. "O exame de DNA s pode ser feito com sangue." II. "Sou primo da me e estou com medo do resultado ser positivo, mesmo que eu no seja o verdadeiro pai." III. "Ele j morreu e no deixou nenhum outro parente vivo. Nunca poderei provar que ele era o pai do meu filho." Justifique por que cada uma das frases constitui um "mito". 118. (Ufrn 2002) Uma prtica corriqueira na preparao de comida colocar um pouco de "leite" de mamo ou suco de abacaxi para amaciar a carne. Hoje em dia, os supermercados j vendem um amaciante de carne industrializado. a) Explique o amaciamento da carne promovido pelo componente presente no mamo, no abacaxi ou no amaciante industrializado e compare esse processo com a digesto. b) Se o amaciante, natural ou industrializado, for adicionado durante o cozimento, qual ser o efeito sobre a carne? Por qu? TEXTO PARA A PRXIMA QUESTO (Uerj 2001) A enzima transcriptase reversa encontrada em retrovrus. Muitos pesquisadores, atualmente, procuram descobrir novas substncias que sejam inibidoras especficas dessa enzima. 119. Descreva a funo da transcriptase reversa no mecanismo de replicao do vrus da Aids. TEXTO PARA A PRXIMA QUESTO (Unicamp 2002) A Qumica est presente em toda atividade humana, mesmo quando no damos a devida ateno a isso... Esta pag.39

Prof Fabio Dias Magalhes histria narra um episdio no qual est envolvido um casal de policiais tcnicos, nossos heris, famosos pela sagacidade, o casal Mitta: Dina Mitta, mais conhecida como "Estrondosa" e Omar Mitta, vulgo "Rango". A narrativa que se segue fico. Qualquer semelhana com a realidade pura coincidncia. 120. Os nossos heris estranharam a presena dos dois copos sobre a mesa, indicando que teria passado mais algum por ali. Alm disso, havia leite e, pela ficha cadastral, eles sabiam que o guarda no podia tom-lo, pois sofria de deficincia de lactase, uma enzima presente no intestino delgado. Portanto, se o guarda tomasse leite, teria diarria. Na presena de lactase, a lactose, um dissacardeo, reage com gua dando glicose e galactose, monossacardeos. a) Complete a equao a seguir, que representa a transformao do dissacardeo em glicose e galactose: CHO + = + CHO

b) Se, com a finalidade de atender as pessoas deficientes em lactase, principalmente crianas, um leite for tratado com a enzima lactase, ele ter o seu "ndice de doura" aumentado ou diminudo? Justifique. Lembre-se de que o "poder edulcorante" uma propriedade aditiva e que traduz quantas vezes uma substncia mais doce do que o acar, considerando-se massas iguais. A lactose apresenta "poder edulcorante" 0,26, a glicose 0,70 e a galactose 0,65. 121. (Unesp 2000) Escreva a frmula estrutural e d o nome oficial de: a) uma cetona, de cadeia carbnica ramificada saturada, com o total de 7 tomos de carbono. b) um aminocido, com 4 tomos de carbono. 122. (Unicamp 99) O cido para-amino-benzico (PABA) j foi muito utilizado em protetores solares, por conseguir absorver uma parte da radiao ultravioleta oriunda da luz solar. O PABA pode ser considerado como derivado do benzeno no qual um hidrognio foi substitudo por um grupo carboxila e outro por um grupo amino. a) Escreva a frmula estrutural do PABA. b) Um di-peptdeo uma molcula formada pela unio entre dois amino-cidos atravs de uma ligao peptdica. Escreva a frmula estrutural de uma molcula que seria formada pela unio de duas molculas de PABA atravs de uma ligao peptdica.


Prof Fabio Dias Magalhes 123. (Unifesp 2002) Pacientes com o mal de Parkinson apresentam deficincia de dopamina, um neurotransmissor. L-dopa uma das drogas usadas no tratamento desses pacientes (D-dopa menos efetiva e mais txica do que a forma L e, por isso, no usada). A L-dopa, ao contrrio da dopamina, capaz de atravessar a barreira sangue-crebro e ento produzir dopamina pela ao da dopa decarboxilase.

a) Explique o que voc entende por forma L da dopa, ilustrando-a por meio de figura. b) Explique a funo da dopa decarboxilase na transformao da L-dopa em dopamina. 124. (Unicamp 95) Os -aminocidos so molculas que tm um grupo amino e um grupo carboxila ligados a um mesmo tomo de carbono. Um dos vinte -aminocidos encontrados em protenas naturais a alanina. Esta molcula possui tambm um tomo de hidrognio e um grupo metila ligados ao carbono . Na formao de protenas, que so polmeros de aminocidos, estes se ligam entre si atravs de ligaes chamadas peptdicas. A ligao peptdica forma-se entre o grupo amino de uma molcula e o grupo carboxila de uma outra molcula de aminocido, com a eliminao de uma molcula de gua. Com base nestas informaes, pede-se: a) A frmula estrutural da alanina. b) A equao qumica que representa a reao entre duas molculas de alanina formando uma ligao peptdica.


Prof Fabio Dias Magalhes 125. (Ufrj 96) Os aminocidos so molculas orgnicas constituintes das protenas. Eles podem ser divididos em dois grandes grupos: os essenciais, que no so sintetizados pelo organismo humano e os no-essenciais. A seguir so apresentados dois aminocidos, um de cada grupo:

a) A glicina pode ser denominada, pela nomenclatura oficial, de cido amino etanico. Por analogia, apresente o nome oficial da leucina. b) Qual desses dois aminocidos apresenta isomeria ptica? Justifique sua resposta. 126. (Unicamp 2000) Esta prova uma homenagem Qumica, evidenciando alguns de seus aspectos relevantes que ajudaram a entender, a continuar ou a melhorar a vida na Terra. Comecemos por procurar entender, do ponto de vista qumico, a origem da vida na Terra. Ainda hoje persiste a dvida de como surgiu a vida na Terra. Na dcada de 50, realizou-se um experimento simulando as possveis condies da atmosfera primitiva (pr-bitica), isto , a atmosfera existente antes de originar vida na Terra. A idia era verificar como se comportariam quimicamente os gases hidrognio, metano, amnia e o vapor d'gua na presena de fascas eltricas, em tal ambiente. Aps a realizao do experimento, verificou-se que se havia formado um grande nmero de substncias. Dentre estas, detectou-se a presena do mais simples -aminocido que existe. a) Sabendo-se que este aminocido possui dois tomos de carbono, escreva sua frmula estrutural. b) Este aminocido poderia desviar o plano da luz polarizadas? Justifique. c) Escreva a frmula estrutural da espcie qumica formada quando este aminocido colocado em meio aquoso muito cido.


Prof Fabio Dias Magalhes 127. (Fuvest 2000) O aspartame, adoante artificial, um ster de um dipeptdeo.

Esse adoante sofre hidrlise, no estmago, originando dois aminocidos e uma terceira substncia. a) Escreva as frmulas estruturais dos aminocidos formados nessa hidrlise. b) Qual a terceira substncia formada nessa hidrlise? Explique de qual grupo funcional se origina essa substncia. 128. (Unifesp 2002) Glicina, o -aminocido mais simples, se apresenta na forma de um slido cristalino branco, bastante solvel na gua. A presena de um grupo carboxila e de um grupo amino em sua molcula faz com que seja possvel a transferncia de um on hidrognio do primeiro para o segundo grupo em uma espcie de reao interna cido-base, originando um on dipolar, chamado de "zwitterion". a) Escreva a frmula estrutural da glicina e do seu "zwitterion" correspondente. b) Como o "zwitterion" se comporta frente diminuio de pH da soluo em que estiver dissolvido?


Prof Fabio Dias Magalhes 129. (Ufg 2001) No rtulo de alguns refrigerantes light encontram-se as informaes "sem acar" e "contm fenilalanina". As frmulas estruturais planas da fenilalanina e do acar, s quais o rtulo se refere, so representadas, a seguir:

a) A qual classe de biomolculas pertencem I e II? b) Circule, nas estruturas I e II, trs grupos funcionais diferentes, citando seus nomes. c) Cite uma propriedade qumica comum s substncias I e II. 130. (Fuvest 97) Protenas so formadas por vrias cadeias peptdicas que se mantm unidas atravs de ligaes do tipo I, II e III, formando uma estrutura complexa, como a esquematizada a seguir:

a) Explique de que tipo so as ligaes I, II e III assinaladas no esquema da protena. b) Assinale, com um crculo, uma ligao peptdica na protena esquematizada acima. 131. (G2) Os cdons AGA, CUG, e ACU do RNA mensageiro codificam, respectivamente os aminocidos arginina, leucina e treonina. Escreva esses aminocidos na ordem correspondente seqncia TGA - TCT - GAC de um segmento de DNA.


Prof Fabio Dias Magalhes

1. Na primeira gerao, cada hlice do DNA que contm N molda a sua hlice complementar usando bases com N. Forma-se, portanto, DNA dupla hlice do tipo intermedirio. 2. leve = zero intermedirio = 50% pesado = 50% 3. Procarioto porque no existe a carioteca separando o material gentico (DNA) do citoplasma, onde se localizam os ribossomos. 4. a) Transporte ativo que ocorre com gasto de energia. b) O retculo endoplasmtico rugoso o responsvel pela sntese da poro protica da tireoglobulina. O complexo de Golgi realiza a associao das partes protica e glicdica na formao da tireglobulina iodada. 5. a) Em ribossomos isolados no h sntese de cadeias polipeptdicas. O RNA mensageiro necessrio pois transmite a mensagem gentica para a sntese dos polipeptdeos. b) Polipeptdeos so formados a partir do encadeamento de aminocidos. Polirribossomos so constitudos de ribossomos ligados ao RNA mensageiro. 6. a) O ncleo contm DNA que comanda a produo das protenas atravs da sntese de RNA. b) Protenas e Glicoprotenas porque os ribossomos produzem as protenas que so associadas aos acares no Complexo de Golgi. 7. a) Transcrio no ncleo ao nvel dos cromossomos e traduo no citoplasma ao nvel dos ribossomos. b) Sem a regio organizadora do nuclolo no haver RNA ribossmico, matria-prima para a produo destes organides e, conseqentemente, cessar a sntese de protenas na clula. 8. a) Os animais tm 2n = 63 cromossomos, porque so resultantes da unio de espermatozide, com n = 31 cromossomos, e vulo, com n = 32 cromossomos. b) Os cromossomos so de 2 espcies diferentes e, portanto, no ocorre pareamento dos chamados cromossomos homlogos, impossibilitando a meiose e a gametognese. 9. Evitar a ingesto de alimentos que contenham o aminocido fenilalanina, pois os "fenilcetonricos" so incapazes de metabolizar essa substncia e correm risco de apresentar graves distrbios metablicos com conseqncias irreversveis. 10. Carbono, Hidrognio, Oxignio e Nitrognio. 11. A hexoquinase possui uma grande afinidade pela glicose, ou seja, ela atinge a velocidade mxima com uma concentrao muito pequena de glicose. A glicoquinase exibe uma afinidade bem menor pois somente atinge sua velocidade mxima em concentraes bem mais altas do substrato. Logo, a enzima que contribui para a formao de glicognio heptico a pag.45

Prof Fabio Dias Magalhes glicoquinase, pois esta somente produz G6P com mxima eficincia quando h excesso de glicose no sangue. 12. As extremidades do corpo perdem calor para o meio ambiente com mais facilidade e costumam, portanto, apresentar uma temperatura inferior do restante do corpo. Como a enzima s ativa abaixo de 34C, a sntese do pigmento que confere cor negra s ocorrer nas extremidades do corpo. 13. a) O grfico I refere-se a um indivduo AA ou Aa, capazes de produzir o polipeptdeo. O grfico II representa a formao da substncia no indivduo aa. b) O polipeptdeo X uma enzima. A anlise do grfico I revela que a velocidade da formao do produto dependente da temperatura, o que indica tratar-se de uma reao catalisada. 14. a) Tuberculose e gonorria. b) Os antibiticos atuam como bacteriostticos (impedindo a reproduo de bactrias) ou bactericidas (provocando a morte de bactrias), sendo incuos em relao aos vrus. As vacinas levam produo de anticorpos que atuam sobre os vrus, neutralizando sua ao. 15. a) A lmpada aumenta a temperatura ambiental. O aumento da temperatura eleva a taxa metablica do animal, aumentando a sua atividade, uma vez que ele pecilotermo. No ambiente natural, o animal expe-se periodicamente luz solar para aumentar a temperatura corprea. b) Sim. O lagarto teria um aumento excessivo da temperatura corprea, o que poderia levar desnaturao de suas enzimas (hipertermia), podendo, inclusive, ocorrer a morte do animal. 16. a) As vacinas contm antgenos, substncias que estimulam o sistema imunolgico para a produo de anticorpos especficos. b) Os soros possuem anticorpos especficos que apresentam um efeito teraputico. 17. a) Inibio competitiva. Na inibio enzimtica do tipo competitivo, o inibidor, mantido em concentrao constante, exerce seu efeito com maior intensidade em concentraes baixas de substrato. Com o aumento da concentrao do substrato, devido ao efeito competitivo, a inibio tende a diminuir. Dessa forma, em excesso de substrato, a velocidade mxima de reao a mesma na ausncia ou na presena do inibidor. b) Uma dentre as substncias e respectiva funo: - sais biliares - emulsificao de gorduras durante a digesto. - vitamina D (D) - metabolismo do clcio e desenvolvimento do tecido sseo. 18. Porque o indivduo B um heterozigoto, portador do alelo para anemia falciforme e do alelo normal, e por isso produz as duas formas de hemoglobina. 19. Toda forma de vida depende de reaes enzimticas. As enzimas so catalizadores que dependem, para seu funcionamento, de gua (na forma lquida) e temperaturas adequadas, geralmente entre 0 C e 40 C. 20. Porque possuem DNA e RNA prprios, podendo sintetizar suas protenas e se autoduplicar.


Prof Fabio Dias Magalhes 21. a) Os seres humanos possuem em sua composio os seguintes compostos orgnicos: - carboidratos (hidratos de carbono ou glicdios) - protenas - lipdios (gorduras) - cidos nuclicos (DNA e RNA) - vitaminas Todos os compostos citados anteriormente possuem em sua composio qumica tomos de carbono, alm de hidrognio e oxignio. b) Msculos, fgado e tecido adiposo so estruturas armazenadoras de substncias energticas. Glicognio armazenado nos msculos e no fgado, gorduras ou lipdios so armazenadas no tecido adiposo. 22. a) As trs bandas de DNA de origem paterna (no encontradas na me) ocorrem no homem B. b) O teste feito comparando-se as bandas do DNA repetitivo da me da criana com os possveis pais. Estas bandas no correspondem aos genes e so altamente especficas para cada organismo, da o seu uso. 23. a) Pois cdons de duas letras codificam poucos aminocidos b) Pela existncia do cdigo degenerado, poder mais de um cdon determinar um nico aminocido, porm o cdon sempre especifica um nico tipo de aminocido. 24. a) A duplicao e replicao semi-conservativa das molculas de DNA. b) Sim, pois junto com a recombinao gnica, as mutaes aumentam a variabilidade gentica. 25. REPLICAO para que possa ser transmitido descendncia e TRANSCRIO, ou produo do RNA, para controlar as atividades celulares atravs da sntese de protenas. 26. A replicao do DNA sempre CONSERVA, nas molculas-filhas, metade da molcula-me. 27. a) TTACCGTAG b) UUACCGUAG 28. a) AAATTACCCGTA b) AAAUUACCCGUA 29. Na fita dever existir 18% de guanina, 32% de adenina e 32% de timina. O DNA formado por uma dupla cadeia de polinucleotdeos. Sabendo-se que as cadeias so complementares e o pareamento sempre adenina com timina e citosina com guanina, a quantidade de citosina de ser igual a de guanina e a quantidade de adenina de ser igual a de timina. 30. 1) cido fosfrico 2) Desoxirribose 3) Base nitrogenada


Prof Fabio Dias Magalhes 31. a) Os genes so constitudos por DNA e se duplicam para que possam ser transmitidos da clula-me para as clulas-filhas durante as divises celulares e tambm descendncia dos seres vivos. b) A replicao semiconservativa porque as molculas-filhas produzidas sempre conservam metade da molcula-me. 32. Timina = 20%, Guanina = 30% e Citosina = 30% 33. O DNA um polinucleotdeo formado por uma dupla hlice, contm a pentose desoxirribose e Timina como base pirimdica exclusiva. No RNA observa-se uma hlice simples contendo nucleotdeos com ribose e como base pirimdica exclusiva encontramos a Uracila. 34. As molculas-filhas sempre conservam metade da molcula-me 35. Unidades estruturais dos cidos nuclicos (DNA e RNA). Constitudos por cido fosfrico + acar + base nitrogenada 36. DNA - Desoxirribose (pentose) e Timina (base nitrogenada exclusiva) RNA - Ribose (pentose) e Uracil (base nitrogenada exclusiva) 37. 1 - cido fosfrico 2 - acar desoxirribose 3 - base nitrogenada (Adenina, Guanina, Citosina ou Uracila) 38. 1 - fosfato (PO) 2 - desoxirribose 3 - base nitrogenada 39. Segundo a relao de Chargaff (A + G = T + C), pode-se concluir que as outras bases so: Citosina (C) = 15%, Adenina (A) = 35%, Timina (T) = 35%. 40. a) Observe a figura a seguir:

b) DNA - desoxirribose e timina RNA - ribose e uracila pag.48

Prof Fabio Dias Magalhes 41. A autoduplicao permite que o DNA produza cpias e possa ser transmitido descendncia. Transcrio a capacidade do DNA produzir o RNA que ser traduzido em protena especfica nos ribossomos das clulas. 42. Timina = 21% Guanina = 29% Citosina = 29% 43. a) TAA GAT GCG TTT CCG b) UAA GAU GCG UUU CCG 44. a) TTT CCG TAA b) UUU CCG UAA 45. As outras bases sero: Guanina =32% Adenina = 18% Timina = 18% 46. A nica afirmao possvel, face aos dados, que as duas molculas possuem as mesmas propores de bases nitrogenadas. Somente seriam idnticas se a ordenao das bases fosse exatamente a mesma nas duas molculas. 47. Vrias molculas de DNA-polimerase iniciam a replicao do DNA, simultneamente, em diversos stios do genoma denominados stios de origem de replicao. 48. a) A influncia pode ser crucial pois analisado o DNA fornecido por clulas nucleadas, como os glbulos brancos, que podem viver muitos anos e se duplicar ativamente. b) A fraude pode ser evitada colhendo-se clulas brancas da medula ssea vermelha do indivduo a ser testado. 49. a) Contm DNA as lminas de nmeros 3 e 4. b) As propores desiguais de citosina e guanina indicam a presena, na quinta lmina, de um cido nuclico formado por uma hlice simples, podendo ser DNA ou RNA. 50. a) Os bacterifagos utilizam nucleotdeos que contm P da bactria para construir seu material gentico (DNA). b) Os bacterifagos injetam seu DNA com P no interior da bactria hospedeira, deixando-a marcada com radioatividade. c) No. Os vrus no injetam sua capa protica na clula bacteriana. O S radioativo entra na composio de protenas e no no DNA introduzido pelo vrus. 51. a) O DNA produz cpias idnticas de si mesmo. b) Sntese protica. 52. Durante a fertilizao, somente o DNA nuclear do espermatozide penetra no vulo. Por esse motivo, o DNA mitocondrial do pag.49

Prof Fabio Dias Magalhes zigoto necessariamente materno. 53. a) Tipo de molcula: cido ribonuclico (RNA) Justificativa: a uridina se incorpora ao cido ribonuclico. Este cido principalmente sintetizado no nuclolo, deslocando-se posteriormente para o citoplasma. b) Compartimento: ncleo Justificativa: a timidina exclusiva do DNA, encontrado principalmente no ncleo. 54. a) I) filhas: 0% filhos: 0% II) filhas: 100% filhos: 100% b) Em seres humanos, a herana do genoma mitocondrial , exclusivamente, materna, pois as mitocndrias do espermatozide no penetram no vulo. Portanto, o pai no transmitir esta caracterstica (cegueira) para a sua prole. Por outro lado, no caso de a me ser afetada (cega), esta caracterstica ser transmitida para todos os seus filhos. 55. Cultura de crescimento N 100% de molculas de DNA com N. Cultura de 1 gerao 100% de molculas, cada uma com parte da hlice do DNA com N e parte com N. Cultura de 2 gerao 50% de molculas com N e 50% com N - N. A justificativa se baseia na propriedade semiconservativa da duplicao do DNA. 56. Se houvesse a transcrio simultnea das cadeias complementares dos genes, as molculas de ARN sintetizadas tambm teriam seqncias complementares. Tal situao provocaria ento a formao de molculas de ARN de cadeia dupla, que no poderiam ser traduzidas nos ribossomas. 57. REPLICAO: duplicao do material gentico (DNA), relacionado com a transmisso das caractersticas hereditrias. TRANSCRIO: sntese de RNA, relacionada com o controle das atividades celulares atravs da sntese de protenas. 58. Na cadeia 2 h maior quantidade de pares CG. Devido a este fato, maior o nmero de pontes de hidrognio a serem rompidas, o que justifica a necessidade de uma temperatura de desnaturao mais elevada. 59. a) Os bacteriofagos produzidos pela bactria infectada tero a cpsula protica e o DNA do fago T4. b) Durante a infeco, apenas o DNA do fago T4 penetra na bactria hospedeira. O DNA do fago, passa a comandar a produo da nova linhagem viral. 60. a) Observe a figura a seguir: pag.50

Prof Fabio Dias Magalhes

b) O tipo de herana se justifica, pois apenas o DNA mitocondrial, presente no vulo (gameta feminino) ser transmitido descendncia. 61. a) no tubo B a densidade intermediria devido a presena do istopo normal e do istopo pesado, dada a caracterstica do DNA ser semiconservativo. b) na faixa superior, h X de DNA, com densidade menor (istopo normal). 62. As mutaes ocorrem aleatoriamente, com uma taxa mdia constante. Logo, a variabilidade gentica diretamente proporcional antiguidade, o que confirma que nosso ancestral comum mais recente viveu na frica. 63. a) C = G = 29% e A = T = 21%. b) Porque a proporo de bases apresentada refere-se s duas cadeias da molcula de DNA, no sendo possvel determinar a proporo de citosina na cadeia que ser transcrita. 64. a) Os 'corrimos' correspondem a uma sucesso alternada de fosfato e desoxirribose (acar). Os 'degraus' so constitudos por pares de bases nitrogenadas, unidas por pontes de hidrognio, onde adenina pareia com timina, e citosina com guanina. b) O DNA realiza a transcrio, isto , produz o RNA mensageiro, que conduz os cdons para a sntese da protena nos ribossomos. c) As protenas podem ser diferenciadas pelo nmero, tipos e seqncias de seus aminocidos. 65. a) Porque elas possuem DNA idnticos. b) Porque, embora essas clulas possuam o mesmo DNA, diferentes genes podem ser ativados ou no durante as etapas do desenvolvimento do indivduo. 66. RNA mensageiro - determina a ordem dos aminocidos na cadeia polipeptdica RNA transportador - ativao e transporte de aminocidos para os ribossomos no processo de sntese protica pag.51

Prof Fabio Dias Magalhes 67. a) (1) = cido fosfrico, (2) = ribose, (3) = base nitrogenada b) nucleotdeo 68. 400 nucleotdeos porque o DNA constitudo por duas cadeias complementares e apenas uma cadeia com 200 nucleotdeos serviu de molde para a produo de RNA. 69. a) TTT AAG CCC CTA b) 12 nucleotdeos. 70. a) Os RNA mensageiros transcritos do gene normal e do gene inserido formam um RNA de dupla hlice ou hbrido. A disposio das bases destes dois RNA mensageiros so exatamente complementares. b) Havendo a interao entre os RNA mensageiros transcritos a partir destes dois genes, restaro menos mensageiros normais (fita simples) capazes de serem traduzidos em enzima, ao nvel ribossomal. Em conseqncia, a concentrao da enzima diminuir nas clulas, o que retardar o processo de maturao. 71. O DNA um polinucleotdeo capaz de produzir o RNA mensageiro. Cada trs nucleotdeos (cdon) do RNAm ser traduzido por um aminocido ao nvel dos ribossomos. 72. a) Protena normal: Val - Leu - Tre - Pro - Tir - Val - Lis Indivduo A: Val - Leu - Tre - Pro Indivduo B: Val - Leu - Tre - Pro - Tir - Val - Lis Indivduo C: Val - Met - Tre - Pro - Tir - Val - Lis b) A afetado porque produz uma protena menor. B normal, apesar da substituio de uma base nitrogenada no seu DNA, porque o cdigo gentico degenerado. C afetado porque possui um aminocido diferente em sua protena. 73. Com a descoberta do cdigo gentico sabe-se que um aminocido sempre codificado por trs nucleotdeos. Logo, o gene que codifica uma protena tem sempre maior nmero de nucleotdeos que de aminocidos. Sabe-se ainda que existem vrios nucleotdeos do gene que servem para a funo de regulao e no so transcritos. 74. Porque o cdigo gentico degenerado, isto , para um mesmo aminocido existem vrios cdons diferentes. 75. a) RNAm: UCC GUU AAU UCC GGC AAG b) O cdon mutado, TTA, especificaria o terceiro aminocido da tabela. c) UUA 76. a) As protenas produzidas pelos extraterrestres em questo poderiam ter, no mximo, 16 tipos diferentes de aminocidos. pag.52

Prof Fabio Dias Magalhes Seu cdigo gentico, formado por pares de bases, permite a formao de apenas 16 cdons diferentes. Isso sem considerar a possibilidade da existncia de um, ou mais, cdons de finalizao. Neste caso, no seria possvel a produo das protenas B e C com, respectivamente, 16 e 19 aminocidos. b) A diversidade no planeta Terra seria maior, pois o cdigo gentico dos terrqueos formado por 64 cdons, sendo 3 cdons de finalizao. Assim o nmero de tipos distintos de aminocidos presentes nos polipeptdeos seria, obviamente, maior. c) A protena produzida pela bactria terrestre "transgnica" no ser idntica ao polipeptdeo aliengena, uma vez que o equipamento ribossmico da bactria que incorporou o gene, est capacitado para traduzir cdons constitudos por 3 bases nitrogenadas consecutivas. 77. Quando a mutao for localizada: a) no stio 1 A seqncia do DNA ser modificada pelo benzo[a]pireno de ATG para ATT levando, na transcrio, a formao de um RNAm com a seqncia UAA ao invs de UAC. UAA um cdon de terminao, portanto, a mutao provocar a produo de uma protena menor. b) no stio 2 A seqncia do DNA de CCG ser modificada para CCT levando na transcrio, a formao de um RNAm com a seqncia GGA ao invs de GGC. Nessa situao, a modificao de GGC para GGA no provocar alterao na protena; os dois cdons na traduo produzem uma protena com o aminocido glicina, nesta posio. 78. a) RNA-polimerase. b) UAC. c) W - A - T - S - O - N - E - C - R - I - C - K. d) A protena no ser formada, pois foi alterado o cdon de iniciao. 79. a) Produto da sntese protica (polipeptdio): val - his - leu - thr - pro - glu - glu - lys b) Exemplo de mutao pontual no gene que codifica a cadeia da globina humana: substituio do nucleotdeo A por T no cdon correspondente ao cido glutmico. Conseqncia: anemia falciforme - alterao estrutural do polipeptdio (substituio do cido glutmico pela valina); - alterao da funo da protena (globina); - reduo da capacidade de transporte de oxignio; - manifestao dos sintomas da anemia falciforme. 80. a) a correspondncia entre as trincas de bases dos cdons e os aminocidos por eles codificados. b) Por que um nico aminocido pode ser codificado por mais de um cdon.


Prof Fabio Dias Magalhes 81. a) Observe a figura a seguir:

b) No. Sendo o cdigo gentico degenerado, diferentes trincas de nucleotdeos especificam o mesmo aminocido. 82. a) AUG AGU UGG CCU G b) Serina - triptofano - Prolina c) Metionina - Serina - Glicina 83. a) CAU CGG AUC b) Somente se formar o mesmo peptdeo se os cdons transcritos a partir da fita complementar especificarem os mesmos aminocidos, devido degenerao do cdigo gentico. 84. a) TTA CAT CCG b) trs 85. a) ncleo e ribossomos. b) cessa o processo de traduo. 86. No. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes protenas que contm. Assim, a diferenciao dos tecidos resulta principalmente da transcrio de genes diferentes, o que naturalmente produz uma composio de RNAm qualitativamente diferente de tecido para tecido. 87. a) DNA cadeia complementar: 30A-20C-12T-10G cadeia ativa: 30T-20G-12A-10C RNA-mensageiro: 30A-20C-12U-10G Portador, o RNA-m ter 12 uracilas e 10 guaninas. pag.54

Prof Fabio Dias Magalhes b) A cadeia ativa apresenta 72 bases. Cada aminocido codificado por um cdon constitudo por 3 bases. Da conclumos que 72 bases formam 24 cdons que produziro uma cadeia polipeptdica com 24 aminocidos. 88. AUG AGG CGA AUC e UAC UCC GCU UAG 89. UGA GGC GAA e ACU CCG CUU 90. As regies 2 e 4. Essas regies formam alas justamente por no possurem as seqncias de nucleotdeos complementares, que foram eliminadas aps o processo de transcrio. 91. Os genes que no codificam polipeptdeos transcrevem para produzir RNA ribossmico e RNA transportador. 92. a) Para que o genoma RNA (-) seja expresso em protenas na clula infectada, primeiro necessrio que seja transcrito em RNA complementar, o que feito, apenas, pela RNA replicase, que no existe na clula. Desta forma, o prprio vrus ter de j possuir a enzima em sua estrutura. Os vrus RNA (+) j funcionam como mensageiros na clula infectada, sendo diretamente traduzidos em protenas virais, inclusive a RNA replicase. b) Os vrus s existem em virtude de sua habilidade de utilizar a maquinaria metablica das clulas hospedeiras, direcionando-a para a formao de novas partculas virais. Portanto, os vrus s devem ter surgido aps o aparecimento das primeiras clulas. 93. a) Do ponto de vista gentico, poderiam ocorrer trs tipos de albinismo, pois esto envolvidos trs pares de genes para a produo do pigmento no animal. Defeitos no gene A, impedem a formao do composto 1, interrompendo toda a cadeia de reaes que levam ao desenvolvimento da cor. Alteraes no gene B, acarretam a no formao do composto 2, resultando tambm na no formao da pigmentao. Mutaes no gene C, impedindo a sntese do composto 3, tambm causariam albinismo. b) Pais genotipicamente puros portadores de dois tipos distintos de albinismo: AAbbCC x AABBcc Gerao: AABbCc - 100% pigmentados

c) Devido degenerao do cdigo gentico, um aminocido pode ser determinado por diferentes cdons. Assim, uma mutao em um gene, pode no causar qualquer alterao na protena codificada. 94. So molculas (DNA e RNA) que comandam, atravs da sntese de enzimas, todo o metabolismo celular. Segmentos de DNA (genes) transcrevem o RNAm que, nos ribossomos, associados ao RNAt realizam a traduo do cdigo gentico em uma protena. 95. O gene (cstron) determina a ordenao dos aminocidos das protenas produzidas em uma clula. Os ribossomos fazem a traduo do cdigo gentico do DNA atravs da leitura do RNA mensageiro. 96. Cada mutante possui um gene alterado. Z s cresce em meio com arginina, logo apenas o gene 3 do mutante Z apresenta pag.55

Prof Fabio Dias Magalhes alterao. 97. a) Valina, porque houve uma substituio (T x A) no codon do DNA correspondente a esse aminocido. b) No, porque aps a replicao do DNA semiconservativa. 98. a) Gene um segmento do DNA localizado nos cromossomos. Possui um cdigo qumico representado por seqncias de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases capaz de codificar um aminocido de uma protena. A seqncia de trincas determinar a seqncia dos aminocidos de um polipeptdeo. b) Mutaes so modificaes na seqncia ou na composio das bases do DNA (gene) que podem causar a produo de uma protena alterada, ou mesmo a no produo da protena. c) A substituio de uma base nitrogenada no DNA pode no causar nenhuma alterao na protena produzida pela clula porque o cdigo gentico degenerado, ou seja, um mesmo aminocido pode ser codificado por diferentes trincas de bases. 99. a) So necessrios pelo menos 84 nucleotdeos pois cada aminocido de uma protena codificado por uma trinca de nucleotdeos. b) No. Devido degenerao do cdigo gentico, um aminocido pode ser codificado por mais do que uma trinca de nucleotdeos. c) A mutao que originou a espcie 2 foi uma SUBSTITUIO. Uma INVERSO produziu a alterao verificada na espcie 3 e uma DELEO acarretou o surgimento da espcie 4. 100. Os crculos pretos representam o nmero de bactrias; os crculos brancos representam a concentrao de glicose; os tringulos pretos a concentrao da enzima -galactosidase. Enquanto existe glicose no meio a -galactosidase est reprimida. Quando a glicose se esgota a expresso dessa enzima induzida. 101. Como o ARNm pode conter outros cdons AUG, alm do cdon de iniciao, a iniciao da traduo poderia ocorrer em qualquer regio onde houvesse um outro cdon AUG, o que geraria peptdeos truncados ou incompletos. A traduo s ocorre quando a seqncia de Shine-Dalgarno e o cdon AUG esto presentes. 102. a) As protenas obtidas possuam apenas um tipo de aminocido porque o DNA utilizado apresentava um nico tipo de cdon (AGC). b) O tipo de aminocido utilizado na produo da protena poder variar dependendo do local onde os ribossomos iniciam a traduo do cdigo gentico. O aminocido utilizado a serina quando a leitura comea no A, do cdon AGC. O aminocido a alanina quando a leitura comea no G, do cdon GCA. O aminocido utilizado a glutamina, quando a leitura comea no C, do cdon CAG. 103. a) Replicao: no interfere; no h alteraes na incorporao de timidina marcada no DNA. Transcrio: no interfere; no h alterao na incorporao de uridina marcada no RNA. Traduo: interfere; esta etapa bloqueada porque h uma queda acentuada na incorporao de aminocido marcado na protena.


Prof Fabio Dias Magalhes b) Duas dentre as ligaes ou interaes: - ponte dissulfeto - ponte de hidrognio - foras de van der Walls - interaes hidrofbicas - interaes eletrostticas 104. a) 3'TACGCA5'. b) 5'AUGCGU3'. O RNA que ser utilizado na traduo o RNAm (RNA mensageiro). 105. Os organismos eucariotos possuem ntrons, regies no codificantes em seu DNA, que sero eliminadas no processo de maturao do RNA-mensageiro, antes que ele seja traduzido em protena. 106. O antibitico I atua sobre a traduo, pois, ao ser administrado, reduz imediatamente a sntese protica. O antibitico II pode atuar inibindo a transcrio e/ou a replicao gnica, pois no momento da administrao at o incio da reduo da sntese protica, decorrem 20 minutos; isso significa que havia cido ribonuclico mensageiro sendo traduzido e produzindo protena. 107. No, porque a diferenciao celular envolve a expresso (transcrio) e a inativao de diferentes genes nos diversos rgos. 108. Experimento realizado com bactrias 'Pneumococo pneumoniae' sem cpsula (no patognicas) e com cpsula (patognicas). 1.) bactrias pneumococo sem cpsula ratos = ratos vivos. 2.) bactrias pneumococo com cpsula ratos = ratos mortos. 3.) bactrias pneumococo sem cpsula + bactrias capsuladas mortas pelo calor ratos = ratos vivos. 4.) bactrias sem cpsula + extrato de bactrias capsuladas mortas pelo calor ratos = ratos mortos. Concluso: Existe algum agente transformante no extrato de bactrias capsuladas mortas pelo calor que capaz de modificar as no capsuladas. Esse agente seria o cido Desoxirribonuclico (DNA). 109. Trataram o extrato de bactrias pneumococo capsuladas mortas pelo calor com a enzima desoxirribonuclease. Esta enzima hidrolisa o DNA, destruindo, portanto, o agente transformante capaz de modificar as bactrias sem cpsula no patognicas em capsuladas patognicas e letais para os ratos utilizados nos experimentos. 110. Vrus utilizados nos experimentos que serviram para demonstrar que o DNA de fato o material gentico. 111. 1.) bactrias 'Escherichia coli' cultivadas em meio contendo P e S bactrias marcadas com os elementos radioativos. 2.) Vrus bacteriofagos parasitam as bactrias marcadas e ficam tambm marcados com P no DNA e S na cpsula protica.


Prof Fabio Dias Magalhes 3.) Vrus marcados parasitam bactrias no marcadas. 4.) Antes da lise bacteriana o preparado levado ao liquidificador e centrifugado. 5.) O sobrenadante apresenta as cpsulas proticas marcadas com S e no precipitado h bactrias contendo DNA marcado com P. Concluso: O DNA viral a substncia capaz de TRANSFORMAR as bactrias em "fbricas" de novos vrus bacteriofagos. Assim o DNA foi definitivamente identificado como sendo a substncia que controla a hereditariedade. 112. A mutao deve ter alterado um cdon que codificava um aminocido transformando-o em um cdon de parada, que interrompe a leitura do ARNm pelo ribossoma. 113. No necessariamente, pois a substituio de bases nitrogenadas na cadeia do DNA poder determinar os mesmos aminocidos, na mesma ordem, em uma protena, j que o cdigo gentico degenerado. 114. No. O cdigo gentico degenerado, ou seja, diferentes trincas podem especificar o mesmo aminocido na sntese das protenas celulares. 115. A mudana 2, pois essa a nica que provoca troca de aminocidos. Essa troca altera a estrutura do peptdeo, o que pode alterar sua funo. 116. a) (I): UAAGCCG; (II): AUUCGGC; b) b1. Emparelhamento dos RNA / Formao de RNA de fita dupla; b2. A traduo ser inibida; c) No haver a sntese de etileno nos tecidos do fruto, e o fruto no amadurecer; d) Podero armazenar os frutos por mais tempo, depois de colhidos. 117. I. O teste de paternidade viabilizado atravs da obteno de DNA no somente de clulas sanguneas, mas de qualquer tecido que contenha DNA. II. O filho apresenta 50% do seu material gentico proveniente da me e 50% do pai. A semelhana gentica do primo em questo seria menor que 50%. III. O material gentico pode ser colhido de cadveres a partir de restos mortais, tais como ossos ou fios de cabelo. 118. a) Os amaciantes naturais e industrializados contm proteases, enzimas relacionadas com a hidrlise das protenas fibrosas que "endurecem" a carne. No corpo humano, a digesto das protenas da carne tem incio na cavidade gstrica, por ao da enzima pepsina. Prossegue no duodeno, onde atua a tripsina presente no suco pancretico e finalizada pela atividade das peptidases existentes no suco entrico. b) O cozimento causar a desnaturao das enzimas presentes nos amaciantes. Desta forma, a carne no sofrer qualquer efeito, pois as enzimas desnaturadas no podero desempenhar seu papel como catalisadores biolgicos. 119. O vrus da AIDS um retrovrus que, para multiplicar-se em clulas humanas, precisa transcrever o cdigo gentico contido pag.58

Prof Fabio Dias Magalhes em sua molcula de RNA, sintetizando um DNA que ser incorporado ao genoma da clula infectada. Para isso, emprega a transcriptase reversa contida no prprio vrus. 120. a) CHO + HO = CHO + CHO b) O leite tratado com enzima lactase ter o seu "ndice de doura" aumentado, pois o "poder edulcorante" da lactose inferior ao "poder edulcorante" da glicose e da galactose. 121. a) Uma das vrias cetonas de cadeia ramificada saturada, com total de 7 tomos de carbono, :

122. Observe as figuras a seguir

123. a) A forma L da dopa representa o ismero ptico levgiro (desvia o plano de luz polarizada para a esquerda). b) A dopa decarboxilase atua como catalisador. 124. Observe a figura a seguir:


Prof Fabio Dias Magalhes

125. a) cido 2 - amino - 4 - metilpentanico b) A leucina, pois apresenta carbono assimtrico. 126.

a) frmula estrutural figura I. b) Este aminocido no desvia o plano da luz polarizada porque no representa carbono assimtrico ou quiral, ou seja, sua molcula no assimtrica. c) frmula estrutural figura II. 127. a) Observe a figura a seguir:

b) A terceira substncia formada o metanol, HC-OH, que produzida na hidrlise do grupo ster. 128. a) Observe a frmula estrutural a seguir: pag.60

Prof Fabio Dias Magalhes

b) Como base de Bronsted-Lowry e transforma-se em um on positivo. 129. a) I - Protena II - Carboidrato do tipo halosdeo b) Observe o esquema a seguir:

c) Ambas sofrem hidrlise. 130. a) I - Ponte dissulfeto, ligao covalente pelo compartilhamento de eltrons entre os tomos de enxofre. II - Ponte de hidrognio, ligao intermolecular entre elementos que apresentam grande diferena de eletronegatividade. III - Ligao inica, atrao eletrosttica entre ons positivo (ction) e negativo (nion). b) Observe as ligaes peptdicas assinaladas na figura a seguir:


Prof Fabio Dias Magalhes

131. Treonina - Arginina - Leucina

Conhea os cursos da Sala Bioqumica em

1.Qumica , com o professor Adriano Guimares, nas tardes de quarta-feira. Aulas tericas e simulados objetivos e discursivos semanais.
Contedos para Julho, Agosto, Setembro e Outubro: Ligaes Qumicas, Qumica Orgnica, Funes Inorgnicas e Estequiometria, Equilbrio, Termoquimica, Cintica e Eletroqumica. Curso de Qumica (Novembro e Dezembro): Reviso para a 2 etapa UFMG com simulados discursivos semanais e carga horria mais elevada, com mais de 6 horas semanais.

2.Biologia, com o professor Fabio Dias Magalhes

Maro:Mtodo Cientfico, Biotecnologia e Caractersticas Gerais da Vida Abril a Maio:Gentica e Evoluo Junho:Ecologia Agosto e Setembro: Por dentro: aprofundamento em fisiologia para o vestibular de Medicina. Outubro: Ambiente e Sade Novembro e Dezembro: Reviso e aprofundamento para 2a etapa Dias 26 a 30 de dezembro (ltima semana do ano): Curso Intensivo de Reviso Encontre e Destrua

Cursos direcionados para estudantes que j fizeram pr-vestibular e procuram aprofundamento e reviso para o vestibular de Medicina.
