End of Course Assessment Review Packet

Name:

"OTXFS
,FZ

Unit 1:
1. Name 5 pieces of evidence that might be obtained at a crime scene that could help solve the crime.
1. Blood
2. Hair
3. Fingerprints
4. Footprints
5. Bodily Fluids

2.

All five pieces of evidence can possibly contain DNA of the victim, attacker, witness, etc.
This DNA can help identify those involved in the crime, leading to correct accusations
and further processes to identify how the person died.

Draw a diagram showing the relationship between the following terms: nucleotide, gene, DNA Double
Helix, chromosome. LABEL ALL TERMS.

- nucleotide; composed of a 5 carbon sugar covalently bonded to a

phosphate group and a nitrogenous base
- gene; a discrete unit of hereditary information consisting of a specific
nucleotide sequence in DNA
- DNA; nucleic acid containing genetic information shaped in a double
helix and composed of nucleotides- resides in the nucleus of the cell
and directs all body functions
- chromosome; any of the linear bodies in the cell nucleus that contain
genetic information

Chromosomes contain genes, which

are made of DNA, which contains
nucleotides. DNA is shaped in a
double helix and is spiraled together
tightly to form Chromosomes.

3. . Using simple shapes, draw and label all parts of a nucleotide:

4. Name all four bases of DNA which bases are structurally similar to one another? Which bases pair with
each other? Which base is NOT present in RNA?
Adenine- purine base
Thymine- pyrimidine base
Guanine- purine base
Cytosine- pyrimidine base

5.

Purine Bases:
- 1 carbon ring, 2 hydrogen
bonds
- smaller

What do restriction enzymes do?

Pyrimidine Bases:
- 2 carbon rings, 3 hydrogen
bonds
- bigger

Adenine<-->Thymine
Cytosine<-->Guanine
Thymine is not present
in RNA- changes to U

Restriction enzymes are programmed to cut DNA at specific base pairs, creating Restriction Length
Polymorphisms, consisting of different fragments of DNA cut at specific sites.

6. What does gel electrophoresis do? Which way does DNA run on the gel?

Gel electrophoresis separates fragments of DNA by length as the DNA travels through an electrical current.
The DNA runs to the positive end of the gel, due to the negatively charged phosphate groups. The smaller
fragments move faster.

7. . How does DNA differ from person to person?

DNA differs from person to person in terms of the order of the base pairs. The combinations of the arrangements of
the nitrogenous bases cause the DNA to differ.

8. Write the strand of DNA that would bind with this strand: ATCGTCAGG
TAGCAGTCC
9. . Mark on this strand of DNA where the restriction enzyme HaeIII would cut (GG-CC).
ATTCCGGTATACGGCTAATACCGGTTATAGCG
TAAGGCCATATGCCGATTATGGCCAATATCGC

End of Course Assessment Review Packet

Unit 2:
1. Create a chart that compares Type 1 and Type 2 diabetes - include symptoms, treatment, how it works,
and who generally suffers from it.
acute
symptoms:
fatigue, rapid
weight loss,
excessive
thirst,
ketonacidosis

Type 1 Diabetes:
- The pancreas does not produce any insulin, therefore
not allowing glucose to enter the cells
- acute symptoms- immediate need for medical care
- cells don't produce energy- body does not function
properly
- usually effects those in adolescence- insulin shots
are needed so that glucose can get into cells and
produce energy

Type 2 Diabetes:
- Insulin is created, but the insulin receptors do not
respond to it
- chronic symptoms- can be managed
- blood glucose gets very high and the cells to not
create enough energy
- effects adults who are obese and have a diet that
has damaged their pancreas

- chronic
symptoms;
pill
manageable

2. Draw a graph showing the results of glucose tolerance testing for someone with Type I diabetes and
someone with Type II Diabetes.
Type 1

Type 2

3. Draw a graph showing the results of insulin testing for someone with Type I Diabetes, someone
with Type II diabetes, and a healthy person.

4. Explain the difference between negative and positive feedback. Give an example of each.
Negative feedback reduces the output of something in order to return to homeostasis. Positive feedback increases the output of
something in order to return to homeostasis. Negative: Body temperature rises, body releases sweat, evaporation cools the body,
normal temp reached. Positive: Body temperature lowers, body shivers, involuntary muscles generate heat, normal temp reached

5. Diagram the feedback relationship of blood glucose and the hormones insulin and glucagon.
separate picture

End of Course Assessment Review Packet

6. Explain the difference between dehydration synthesis and hydrolysis.
dehydration synthesis; H2O is taken out to make a bond
hydrolysis; H2O is put in to break a bond
bonds are made when glucose is stored as glycogen, and bonds are broken when glycogen is separated back
into glucose

7. Draw an example (include name of monomer and polymer) of each of the following:
b) carbohydrate c) protein
Lipid: Glycerol
H
H

Carb: glucose

a) lipid

Protein: glycine

8. Explain the process of calorimetry and how it is used to measure the amount of energy in a food.
Calorimetry is used to measure the amount of energy in food by burning the food in an air tight area.
The energy is measured by studying how many degrees the water increases in C. 1 degree is equal to 1 calorie.
This is measured in chemistry calories, which is 1,000 in one calories.

9. What is osmosis - explain it in your own words. Draw a simple picture if you need to.
Osmosis is the movement of water from a higher concentration to a lower concentration through a slelectively
permeable membrane until equilibrium is met.

10. For each beaker below, a) label the solution as either hypotonic, hypertonic, or isotonic and b) draw an
arrow showing water movement

isotonic

hypotonic; cell swells

hypertonic; cell shrivels

11. Why are diabetics constantly dehydrated and urinating so often? Relate your answer to osmosis and the
lab we performed using the model cells (dialysis tubing).
Diabetics are constantly dehydrated because their kidneys are attempting to remove some of the sugar within their blood. Their
blood is hypertonic because of all of the sugar, taking all water out of cells through osmosis. The kidneys are working very hard
to filter the water, leaving the person dehydrated and thirsty.

12. List 3 complications of diabetes, give a brief description of it, and tell what body system it affects.
Oral health problems: plaque build up due to high levels of glucoseplaque can get into blood and cause heart attack, gingivitis, infected gums, etc.
Hearing problems; nerves are damaged in the ear due to the lack of oxygen.
Vision loss: optic nerve blood vessels are pinched due to high b.g., b.g. hardens blood vessels

End of Course Assessment Review Packet

Unit 3:
1. Draw normal blood cells and then draw sickled blood cells. Describe the differences between these two cells.
Normal RBCs are round, plump, and hemoglobin rich. They are healthy and can properly transport oxygen, and
deliver carbon dioxide back to the lungs as waste, as well as move through capillaries and vessels with a low clot
rate. Sickle cells are sickled in shape because the hemoglobin protein due to a mutation in the DNA. These cells
can be very damaging to the vessels due to their sharp structure. They have difficulty making their way through the
capillaries and cause an increased plaque rate, episodes of pain, and blood clots. They can also cause an oxygen
deficiency throughout the body.

2. How is anemia diagnosed? Describe and name the procedure and give the results expected for someone with
anemia (hint: see 3.1.1)
Anemia is diagnosed through a hematocrit test. In order to perform this test, a blood sample is taken from a patient
and centrifuged so that all of the red blood cells separate from the plasma. This is easy to see because the red blood
cells settle at the bottom of the container and the platelets rise to the top. The height of the red blood cells in cm is
divided by the total height of blood in order to determine the percentage that is rbcs. Anemia is diagnosed if the
hematocrit is abnormally low- far below the normal 50%.

3. Name and describe the role of each of the four component of blood.

Plasma; regulates the movement of all elements of blood, through circulatory system
Red Blood Cells; transport oxygen throughout the blood and return carbon dioxide to the lungs as waste
White Blood Cells; protect the body from infection
Platelets; aid in blood clotting process by gathering at site of injury

4. Name 3 main symptoms of sickle cell anemia and how they affect daily life.
Pain; caused by possible blockages of sharp cells in blood vessels- decreased physical activity and production in life
Fatigue; an insufficient amount of oxygen is being delivered to the cells, causing body systems to have to work harder to function properly
Swelling; loss of circulation due to blockage caused by sickled blood cells- swelling in hands and feet

5. Fill in the blanks with the correct word in describing protein synthesis:
DNA which is located in a cells
All instructions for proteins, like hemoglobin, are stored in our _______,
______________.
This DNA must first be turned into __________,
through a process called
nucleus
mRNA
mRNA then takes the
nucleus
transcription
__________________.
This process takes place in the _______________.
The _______
translation
message to the _____________,
specifically to a ribosome. This is where the process of ________________
cytoplasm
codon
takes place. A tRNA matches itsanticodon
_______ to a _______ on the mRNA. The tRNA then drops off its
amino
acid
protein chain
__________.
Many of these monomers make up the final _______________
of hemoglobin.

6. Name and describe the job of each of the three types of RNA:
mRNA; travels to the ribosome and begins protein synthesis
tRNA; matches the mRNA codon to an appropriate anticodon carrying an amino acid- once a peptide bond is made
with two amino acids, tRNA falls off and protein chain is made
rRNA; part of the ribosome that reads the mRNA three nucleotide bases at a time

valine
7. In Sickle Cell Anemia, Glutamic acid is changed to _________________
through a type of mutation called a
hydrophilic meaning it likes water; but valine is
_____________
in the DNA code. Glutamic acid is ________,
substitution
hydrophobic meaning it hates water. How does this property affect the entire hemoglobin protein?
___________,

this change causes the polypeptide to have an incorrect shape, bending because the valine is trying to fit into the
pocket formed by the hemoglobin, hiding from the water and sticking together

8. Transcribe this DNA sequence into mRNA, then tRNA, and then translate it into an amino acid sequence using the
genetic code found in Activity 3.2.2
ATCCGAAAATTTGATTTG
UAGCUUUUAAACUAAAC
AUCGAAAAUUUGAUUUG
PHEGLUASNLEUetc

End of Course Assessment Review Packet

9. What is a karyotype? What sorts of diseases can and cannot be diagnosed using a karyotype?
A karyotype is a display of chromosome pairs of a cell arranged by size and shape. Diseases that are chromosome
related, in terms of a rearrangement, additional, or missing chromosomes, like down syndrome.

mitosis
10. This process makes new body cells for repair & replacement: _______________
meiosis
This process makes sex cells of sperm and egg: ___________________

46 chromosomes. Each gamete has _____

23 chromosomes.
11. Each body cell has ____
12. What does HIPAA stand for and what does it say (in a one sentence summary)?
Stands for Health Insurance Portability Accountability Act- only authorized people are able to look at medical records.
even family members who are not authorized cannot see the documents.

13. Why does sickle cell disease run in families, yet is not present in every generation?
Sickle cell disease runs in families because it is a homozygous recessive genetic disease. It can be passed
from parents to offspring in a family, but due to the fact that carriers are more likely than full blown diseased,
the disease does not remain frequent in generations.
14. Remember that Bests disease is a dominant disease. Draw a Punnett square to show the cross between a woman
without Bests disease and a man who has one allele for Best disease and one allele without Bests disease.
What is the chance that they will have a child with Bests disease?

15. Examine the pedigree below. Is this disease dominant or recessive how do you know?

This disease is recessive because it shows up so sparsely

throughout the generations. Most of the family members
shown are carriers, only passing their diseased traits to a
few people.

16. Draw the pedigree for the following family. Label all known GENOTYPES and put the individuals name on the
pedigree: Natasha and Nathan are planning on having children. Each has a sister with sickle cell disease.
Neither Natasha nor Nathan nor any of their parents have the disease, and none of them has been tested to
see if they have the sickle cell trait.

End of Course Assessment Review Packet

Unit 4
1. In most of the body the arteries carry oxygenated blood and the veins carry deoxygenated blood.
The exception to this pattern is the heart. List the specific arteries and veins of the heart that are different from
the pattern seen in the rest of the body and explain how and why they are different.
The pulmonary artery in the heart carries deoxygenated blood because it receives the blood from the
right ventricle and must send it to the lungs. The pulmonary veins carry oxygenated blood, because
they have received it from the lungs and must send it to the left atrium. The pulmonary circulation
violates the rules of the typical arteries and veins in order to provide proper circulation.
2.
What is the pathway blood takes as it passes through the heart? Briefly state the path from body to heart to
lungs to heart to body.
Blood from the body enters the heart through the Superior/Inferior Vena Cava and the goes into the right atrium. After
passing the tricuspid valve, it enters the right ventricle, and then through the pulmonary valve to the pulmonary artery. It
goes to the lungs to pick up oxygen, and then to the pulmonary veins to enter the left atrium. From here, it passes the
mitral valve, and into the left ventricle. The aortic valve is passed and the blood flows out of the aorta, to the body.
3.
What is heart rate? (Be sure to include units of measure!!)

Heart rate is a measure of cardiac activity expressed in beats per minute.

4.
What is blood pressure? How is it measured? What are the units of blood pressure?
Blood pressure is a measure of the pressure exerted by the blood onto the walls of arteries and veins. It is measured
in systolic pressure, contraction, and diastolic, relaxation, pressure in millimeters of mercury.
5.
What does EKG stand for? What does it measure?
EKG stands for electrocardiogram and it measures the heart's electrical activity, in terms of the P-QRS-T waves,
atrial contraction, ventricular contraction, and ventricular repolarization.
6.
Name the two nodes of the heart and where each is located. Which one is called the pacemaker?
The heart's two nodes are called the sinoatrial node and the atrioventricular node. The SA node is called the pacemaker
and is located in the right atrium. The AV node is also located in the right atrium.
7.
Trace the conduction of electrical impulses through the heart
SA node -->AV node (also branches off to left atrium) --> AV Bundle --> AV Bundle branches --> Purkinje fibers
8.
What are two major functions of cholesterol in our bodies?
Cholesterol functions as a precursor for many important hormones in the human body, as well as a
limiting factor that brain cells need to make connections with one another, essential to learning and
memory.
9.
Is cholesterol hydrophobic or hydrophilic? How can it be carried in our hydrophilic bloodstream?
Cholesterol is water-insoluble, meaning that it is hydrophobic, such as waxes, oils, and fats. It can't dissolve in watery
substances like blood, so it can't travel in the blood stream on its own. It must be attached to a lipoprotein in order
to travel through the blood.
10.
What is atherosclerosis? How can it affect blood pressure?

Atherosclerosis is the compromising of blood vessel walls due to an increased amount of plaque build up. It can
affect blood pressure by causing it to increase, due to a decreased diameter through which to travel.

11.

12.

Name four risk factors for developing heart disease.

- High blood pressure
- High cholesterol
- Belly Fat
- Diabetes
Make a chart comparing and contrasting LDL and HDL include structure and function.
Which one is the major carrier of cholesterol? LDL
Which one has more protein in its molecule? HDL
Which one should have a level below 100 mg/dL? LDL
Which one should have a level of above 40 mg/dL? HDL

End of Course Assessment Review Packet

13.

What is a problem with a person with the FH mutation? Be specific.

A problem with a person with the FH mutation is that they have high cholesterol that is not
their fault. They cannot really control it and can be at a greater risk of heart disease.
14.
What does PCR stand for? What is the purpose of PCR?
PCR stands for Polymerase Chain Reaction. The purpose of PCR is to amplify DNA so that there is enough
DNA in order to sufficiently test it.
15.

In this unit, we reviewed about three different DNA techniques from Unit 1. List them in the order that they
are performed

DNA isolation --> PCR --> Restriction enzymes --> Gel electrophoresis
16.
What is a RFLP and how is it used in DNA analysis be specific.
An RFLP is a restriction fragment length polymorphism, which is a fragment of DNA isolated by a
restriction enzyme. It is used in DNA analysis by being compared to other RFLPs to diagnose diseases.
17.
Name and explain 3 procedures that could help treat a blockage in the heart.
Coronary Bypass; grafting a piece of another artery or vein around the section of the blocked coronary artery
Stent; Inserting a metal expandable object which pushes the plaque to the walls of the artery, creating a passage way
Angioplasty; Inserting a balloon into a blocked artery, pushing the plaque to the sides of the vessel
1.

Unit 5
Label all parts to the bacterial cell below:

Capsule

cell wall
plasma membrane
ribosomes

cytoplasm

plasmid

Pili

Flagellum
Nucleoid

2.

Explain the structural differences between gram + and gram - bacteria. Which one stains pink?

Gram positive bacteria have a very thick cell wall of peptidoglycan, while gram negative bacteria have a very thin
cell wall of peptidoglycan. The gram negative bacteria stain pink, while the positive stain purple.

3.

How can viruses be prevented? How can bacterial infections be prevented? How can each be
treated?

Viruses can be prevented by maintaining sterile environments, not touching your mouth and nose, and washing your
hands and becoming vaccinated for prevalent viruses.
Bacterial infections can be prevented by staying away from airborne sick people and keeping clean. Both can be treated
with antibiotics and over the counter medicines.

End of Course Assessment Review Packet

4.
Briefly explain the function of each part of the immune system below:
Skin boundary between germs and the body- keeps dirt out and releases antibacterial chemical, nonspecific stage 1
Phagocytes (like macrophages) swallow and digest any foreign and harmful microbes, nonspecific stage 2, but can also be
specific

Inflammation blood vessels release fluid into tissues and foreign substances are contained; non specific stage 2
B Cells produce antibodies and multiply, remembering specific antigens, specific and activated by t cells
T Cells attack antigens directly- specific

Unit 6
1.

Match the organ to its body system:

B
____1.
Bladder

A. Cardiovascular System

A
____2.
Heart

B. Urinary System

C
____3.
Lungs

C. Respiratory System

C
____4.
Trachea

D. Digestive System

D
____5.
Pancreas

E. Immune System

____6. Kidneys
F
____7.
Brain
D
____8.
Gall Bladder
A
____9.
Vein

F
____10.
Eye
E
____11.
Lymph Node

D
____12.
Teeth
B

____13. Urethra
E
____14.
Thymus

____15. Spleen
C
____16.
Larynx

F. Nervous System