Sei sulla pagina 1di 14

Introduzione alla

biologia
BIOLOGIA la scienza della vita,
che indaga le caratteristiche dei sistemi viventi
biologia cellulare
biologia animale biologia molecolare
La BIOLOGIA una ricerca,
una indagine continua sulla natura della vita.
VITA ?
GLI ESSERI VIVENTI
nonostante lenorme variet di forme,
hanno propriet comuni
! FACILE DA RICONOSCERE, MA DIFFICILE
DA DEFINIRSI
! E lo stato o qualit che distingue gli esseri o
organismi viventi
Un organismo vivente una entit biologica pi o meno
complessa, dotata di vita.
PROPRIETA COMUNI
degli
ESSERI VIVENTI
riproduzione
crescita e sviluppo
morte
programma
interno
ordine
reattivit
capacit di
ASSUMERE,
TRASFORMARE
USARE
energia e materia
dellambiente
esterno
adattamento
allambiente
omeostasi
ORGANIZZAZIONE
GERARCHICA
DELLE STRUTTURE
BIOLOGICHE
ORDINE
RELAZIONI
BIOLOGIA DEI SISTEMI
Il termine sistema indica il campione
di materia in esame (teoria dei sistemi):
-PROPRIETA EMERGENTI
-MODULARITA
sono necessarie
INFORMAZIONI o ISTRUZIONI
ORDINE
INFORMAZIONE
INFORMAZIONI
CONSERVATE
TRASMESSE
ESPRESSE
DNA RNA proteine
replicazione o duplicazione
trascrizione
della
informazione
traduzione
della
informazione
"DNA makes RNA, RNA makes protein, and proteins make us.
Francis Crick
Dogma fondamentale della biologia molecolare
Albert Einstein,
non c' nulla che ti impedisce di cercare come il fatto di credere
di sapere gi! (Socrate)
ncRNA non coding RNA
Nature, 14 aprile 2003:
sequenza completa ed accurata
dei 23 cromosomi componenti
il genoma umano
1990: lancio del PROGETTO
GENOMA UMANO
TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAA TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAA
ATGCTAGTCGATCTATCGATCGGCTATTCGCAAAGCTG ATGCTAGTCGATCTATCGATCGGCTATTCGCAAAGCTG
CGCGACTGCGATGCGCTAGCATGCGATTCGCGATCGCC CGCGACTGCGATGCGCTAGCATGCGATTCGCGATCGCC
GAGCGCTCGCGAGCGCGCTAGCGGAATACTATATAGC GAGCGCTCGCGAGCGCGCTAGCGGAATACTATATAGC
GCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA GCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA
GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCG GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCG
CGGCTATTTAGGCTTAGAGGATTCGGAGATTCGGAGCT CGGCTATTTAGGCTTAGAGGATTCGGAGATTCGGAGCT
TAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTATCG TAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTATCG
CTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCA CTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCA
ATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCA ATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCA
TGATAGGCTCGATGAGCATGAGATGCATGTACGACTG TGATAGGCTCGATGAGCATGAGATGCATGTACGACTG
CATAGGCATGACTGATCGACTGCATCATGACGCATGAC CATAGGCATGACTGATCGACTGCATCATGACGCATGAC
TGCATGCATGACTGCATATGACGGACTCGCATTAGCAC TGCATGCATGACTGCATATGACGGACTCGCATTAGCAC
TACCGTATTTGCGCATTACCAGATTAGAGAAATGCTAG TACCGTATTTGCGCATTACCAGATTAGAGAAATGCTAG
TCGATCTATCGATCGGCTATTCGCAAAGCTGCGCGACT TCGATCTATCGATCGGCTATTCGCAAAGCTGCGCGACT
GCGATGCGCTAGCATGCGATTCGCGATCGCCGAGCGC GCGATGCGCTAGCATGCGATTCGCGATCGCCGAGCGC
TCGCGAGCGCGCTAGCGGAATACTATATAGCGCGGAT TCGCGAGCGCGCTAGCGGAATACTATATAGCGCGGAT
CAGTCTAGATCTATGAGATCGATAGCGATCTAGAGATA CAGTCTAGATCTATGAGATCGATAGCGATCTAGAGATA
GGATCGAGATCGAGGCGAGATCATATGAGCGCGGCTA GGATCGAGATCGAGGCGAGATCATATGAGCGCGGCTA
TTTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAGGAT TTTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAGGAT
TACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCA TACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCA
TCCCATATTAAAATCTATCGATCGAGCTCTCCAATGCG TCCCATATTAAAATCTATCGATCGAGCTCTCCAATGCG
ATCGATAGGACTAGTAGCTAGCTAGCTGAGCATGATA ATCGATAGGACTAGTAGCTAGCTAGCTGAGCATGATA
GGCTCGATGAGCATGAGATGCATGTACGACTGCATAG GGCTCGATGAGCATGAGATGCATGTACGACTGCATAG
GCATGACTGATCGACTGCATCATGACGCATGACTGCAT GCATGACTGATCGACTGCATCATGACGCATGACTGCAT
GCATGACTGCATATGACGGACTCGCATTAGCACTACCG GCATGACTGCATATGACGGACTCGCATTAGCACTACCG
TATTTGCGCATTACCAGATTAGAGAAATGCTAGTCGAT TATTTGCGCATTACCAGATTAGAGAAATGCTAGTCGAT
CTATCGATCGGCTATTCGCAAAGCTGCGCGACTGCGAT CTATCGATCGGCTATTCGCAAAGCTGCGCGACTGCGAT
GCGCTAGCATGCGATTCGCGATCGCCGAGCGCTCGCG GCGCTAGCATGCGATTCGCGATCGCCGAGCGCTCGCG
AGCGCGCTAGCGGAATACTATATAGCGCGGATCAGTC AGCGCGCTAGCGGAATACTATATAGCGCGGATCAGTC
TAGATCTATGAGATCGATAGCGATCTAGAGATAGGATC TAGATCTATGAGATCGATAGCGATCTAGAGATAGGATC
GAGATCGAGGCGAGATCATATGAGCGCGGCTATTTAG GAGATCGAGGCGAGATCATATGAGCGCGGCTATTTAG
GCTTAGAGGATTCGGAGATTCGGAGCTTAGGATTACA GCTTAGAGGATTCGGAGATTCGGAGCTTAGGATTACA
GAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCATCCC GAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCATCCC
ATATTAAAATCTATCGATCGAGCTCTCCAATGCGATCG ATATTAAAATCTATCGATCGAGCTCTCCAATGCGATCG
ATAGGACTAGTAGCTAGCTAGCTGAGCATGATAGGCT ATAGGACTAGTAGCTAGCTAGCTGAGCATGATAGGCT
CGATGAGCATGAGATGCATGTACGACTGCATAGGCAT CGATGAGCATGAGATGCATGTACGACTGCATAGGCAT
GACTGATCGACTGCATCATGACGCATGACTGCATGCAT GACTGATCGACTGCATCATGACGCATGACTGCATGCAT
GACTGCATATGACGGACTCGCA GACTGCATATGACGGACTCGCA
TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAA TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAA
ATGCTAGTCGATCTATCGATCGGCTATTCGCAAAGCTG ATGCTAGTCGATCTATCGATCGGCTATTCGCAAAGCTG
CGCGACTGCGATGCGCTAGCATGCGATTCGCGATCGCC CGCGACTGCGATGCGCTAGCATGCGATTCGCGATCGCC
GAGCGCTCGCGAGCGCGCTAGCGGAATACTATATAGC GAGCGCTCGCGAGCGCGCTAGCGGAATACTATATAGC
GCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA GCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA
GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCG GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCG
CGGCTATTTAGGCTTAGAGGATTCGGAGATTCGGAGCT CGGCTATTTAGGCTTAGAGGATTCGGAGATTCGGAGCT
TAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTATCG TAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTATCG
CTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCA CTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCA
ATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCA ATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCA
TGATAGGCTCGATGAGCATGAGATGCATGTACGACTG TGATAGGCTCGATGAGCATGAGATGCATGTACGACTG
CATAGGCATGACTGATCGACTGCATCATGACGCATGAC CATAGGCATGACTGATCGACTGCATCATGACGCATGAC
TGCATGCATGACTGCATATGACGGACTCGCATTAGCAC TGCATGCATGACTGCATATGACGGACTCGCATTAGCAC
TACCGTATTTGCGCATTACCAGATTAGAGAAATGCTAG TACCGTATTTGCGCATTACCAGATTAGAGAAATGCTAG
TCGATCTATCGATCGGCTATTCGCAAAGCTGCGCGACT TCGATCTATCGATCGGCTATTCGCAAAGCTGCGCGACT
GCGATGCGCTAGCATGCGATTCGCGATCGCCGAGCGC GCGATGCGCTAGCATGCGATTCGCGATCGCCGAGCGC
TCGCGAGCGCGCTAGCGGAATACTATATAGCGCGGAT TCGCGAGCGCGCTAGCGGAATACTATATAGCGCGGAT
CAGTCTAGATCTATGAGATCGATAGCGATCTAGAGATA CAGTCTAGATCTATGAGATCGATAGCGATCTAGAGATA
GGATCGAGATCGAGGCGAGATCATATGAGCGCGGCTA GGATCGAGATCGAGGCGAGATCATATGAGCGCGGCTA
TTTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAGGAT TTTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAGGAT
TACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCA TACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCA
TCCCATATTAAAATCTATCGATCGAGCTCTCCAATGCG TCCCATATTAAAATCTATCGATCGAGCTCTCCAATGCG
ATCGATAGGACTAGTAGCTAGCTAGCTGAGCATGATA ATCGATAGGACTAGTAGCTAGCTAGCTGAGCATGATA
GGCTCGATGAGCATGAGATGCATGTACGACTGCATAG GGCTCGATGAGCATGAGATGCATGTACGACTGCATAG
GCATGACTGATCGACTGCATCATGACGCATGACTGCAT GCATGACTGATCGACTGCATCATGACGCATGACTGCAT
GCATGACTGCATATGACGGACTCGCATTAGCACTACCG GCATGACTGCATATGACGGACTCGCATTAGCACTACCG
TATTTGCGCATTACCAGATTAGAGAAATGCTAGTCGAT TATTTGCGCATTACCAGATTAGAGAAATGCTAGTCGAT
CTATCGATCGGCTATTCGCAAAGCTGCGCGACTGCGAT CTATCGATCGGCTATTCGCAAAGCTGCGCGACTGCGAT
GCGCTAGCATGCGATTCGCGATCGCCGAGCGCTCGCG GCGCTAGCATGCGATTCGCGATCGCCGAGCGCTCGCG
AGCGCGCTAGCGGAATACTATATAGCGCGGATCAGTC AGCGCGCTAGCGGAATACTATATAGCGCGGATCAGTC
TAGATCTATGAGATCGATAGCGATCTAGAGATAGGAT TAGATCTATGAGATCGATAGCGATCTAGAGATAGGAT
CGAGATCGAGGCGAGATCATATGAGCGCGGCTATTTA CGAGATCGAGGCGAGATCATATGAGCGCGGCTATTTA
GGCTTAGAGGATTCGGAGATTCGGAGCTTAGGATTAC GGCTTAGAGGATTCGGAGATTCGGAGCTTAGGATTAC
AGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCATCC AGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCATCC
CATATTAAAATCTATCGATCGAGCTCTCCAATGCGATC CATATTAAAATCTATCGATCGAGCTCTCCAATGCGATC
GATAGGACTAGTAGCTAGCTAGCTGAGCATGATAGGC GATAGGACTAGTAGCTAGCTAGCTGAGCATGATAGGC
TCGATGAGCATGAGATGCATGTACGACTGCATAGGCA TCGATGAGCATGAGATGCATGTACGACTGCATAGGCA
TGACTGATCGACTGCATCATGACGCATGACTGCATGCA TGACTGATCGACTGCATCATGACGCATGACTGCATGCA
TGACTGCATATGACGGACTCGCA TGACTGCATATGACGGACTCGCA
DNA
come un libro,
ma non si legge
come tale!
Le pagine
sono scritte
secondo pi
codici in parte
ancora ignoti
epigenetica
ambiente
Sydney Brenner,
premio Nobel per la medicina 2002:
Se avessi a disposizione un computer
abbastanza grande e la sequenza
completa del DNA di un organismo,
riuscirei ad elaborare quell'organismo
proprio vero?
Si pu affermare che lessere umano semplicemente
linsieme dei suoi geni?
caso
Epigenetica
Ambiente
Caso
studia la trasmissione di caratteri ereditari non attribuibili direttamente
alla sequenza di DNA (es. assetto nucleare/cromatinico).
gli scienziati indicano con questo termine tutto ci che esterno al
sistema in considerazione con cui il sistema pu porsi in relazione.
Modificazioni stabili e transienti dellambiente cellulare possono
indurre cambiamenti del proteoma che dipendono per es. dalla
presenza di metaboliti e/o condizioni chimico-fisiche del momento o
mantenute nel tempo da circuiti autoregolativi .
avvenimento che si verifica senza una causa definita o identificabile,
evento tale da non rendere predicibili gli effetti dello stesso,
contraddicendo cos ogni teoria deterministica.
I 4 processi biologici tramite i quali lembrione costruito sono:
specializzazione cellulare (differenziamento)
proliferazione cellulare
interazioni cellulari o comunicazione cellulare
movimento cellulare
Levoluzione ha scelto la cellula per veicolare linformazione e per
consentirne lutilizzo, per la propriet elettiva cellulare pi importante:
la capacit riproduttiva della cellula
Le cellule
1 cellula ! tante cellule ! 1 cellula !tante cellule
Adulti pluricellulari diploidi (2n = 46)
GONADI
MEIOSI
Gameti aploidi (n = 23)
FECONDAZIONE
Zigote diploide
(2n = 46)
Mitosi e
sviluppo
CICLO
VITALE
Levoluzione ha consentito,
sulla base di singole e
simili unit cellulari,
di affermare la diversit
genetica ambiente caso
I fattori sono:
DIVERSITA BIOLOGICA
INTER-SPECIFICA
DIVERSITA BIOLOGICA
INTRA-SPECIFICA