Sei sulla pagina 1di 196

6

,
5
0

M
E
N
S
I
L
E

A
N
N
O

2
3


-

N


1
2
8

-

F
E
B
B
R
A
I
O

2
0
1
2



S
P
E
D
I
Z
.


I
N

A
.

P
.

-

4
5
%

A
r
t
.
2

c
o
m
m
a

2
0
/
b

l
e
g
g
e

6
6
2
/
9
6

-

F
i
l
i
a
l
e

d
i

F
i
r
e
n
z
e

FEBBRAIO 2012
www.olympian.it
COME
SCONFIGGERE
LO STRESS
E CRESCERE
Nuovo Anno
NUOVO
CORPO
Il vostro programma
completo di
8 SETTIMANE
PER COSTRUIRE
MUSCOLO
regole
per
costruire
spalle da
uomo
AGGIUNGETE
2 CM DI MUSCOLI!
4 settimane
per braccia
pi grosse
MASSIMIZZATE LA VOSTRA CONDIZIONE FISICA
3 Campionato
italiano
NBFI
Report completo
Potete
sopravvivere
alla nuova
prova sica?
5 allungamenti
che aumentano
la forza
EDI ZI ONE I TALI ANA
7
PD WHEY 100
Il 100% di assimilazione grazie a 5 miliardi
di fermenti lattici vivi e attivi per dose e
Bromelina
La Creatina
ad altissima
assimilazione
con
PDbar50
La barretta ad alto contenuto proteico
arrichita con bre studiata per favorire
un ottimale assorbimento del contenuto
aminoacidico nel tempo (4 ore c.a.)
studiata per chi pratica sport.
REAL FUEL
Massimizza lenergia
e lespolsivit muscolare
SHAKE UP
Perfetto anabolismo
muscolare e recupero
rapido ed ottimale.
PD MASS
Un solo prodotto ad altissima
assimilazione.... in 50 gr tutti gli elementi
necessari per la tua crescita e il recupero
muscolare
con
I
.
P
.
w
w
w
.r
e
p
o
r
t
i
t
a
l
i
a
.
it
aminoacidico nel tempo (4 ore c.a.)
studiata per chi pratica sport.
LLLLL
aaaa
aaa
c
menti
upero
REAL FUEL
M i i l i
e
SHAKE UP
Perfetto anabolismo
SH K AKEE UP UP SHHAK AK
INTRODUCING EAS PRO SCIENCE. BUILDING A BETTER BODY THROUGH BETTER SCIENCE.
Quello che aspettavate. Finalmente arrivato. Una linea di integratori
completamente nuova per aiutarvi a portare i vostri workout ad un nuovo livello.
Pro Science utilizza formule composte da proteine della pi alta qualit, HMB,
beta-alanina, glutamina e creatina, per aiutarvi a ottenere i migliori risultati da ogni
allenamento, scienza al vostro servizio. Scegliete il meglio, non accontentatevi
di prodotti mediocri!
PRO SCI ENCE
Q
c
P
b
a
d
2010 Abbott Laboratories MADE IN USA
Per informazioni ed ordini: Nutrilife Srl - Tel. 051.593994 - Email: info@nutrilife.it
oppure visitate il nostro sito www.nutrilife.it - Leggere attentamente le avvertenze
prima delluso.
SOMMARIO
FEBBRAIO 2012
MASSIMIZZATELAVOSTRACONDIZIONEFISICA
EDIZIONE ITALIANA
Nuovo anno,
nuovo corpo,
nuovi muscoli
Il vostro programma completo
di otto settimane per costruire
muscolo velocemente.
DI BILL GEIGER, MA
72
Fare stretching
per aumentare la forza
Rubate questi allungamenti semplici
allatletica leggera e allo yoga per
diventare pi forti. DI JERRY
KINDELA, MA, DHS
86
Aggiungete 2 cm
di muscoli alle braccia
in 30 giorni
Costruite le braccia velocemente come mai
prima con il nostro allenamento innovativo.
DI ERIC VELAZQUEZ, NSCA-CPT
100
ABC della
costruzione
della schiena ideale
Come usare la presa larga, stretta e neutra
per modellare la schiena nella V perfetta.
DI JIMMY PEA, MS, CSCS
108
7 regole per
costruire spalle
da uomo
Seguite le nostre soluzioni dimostrate e una
routine di esempio e costruite spalle dalle
proporzioni perfette. DI BILL GEIGER, MA
60
Allenamento
Publisher/Executive Editor/Creative Director: Robert Kennedy
Group Editorial Director: Jerry Kindela, MA, DHS
Group Editorial Director (TRAINING): Bill Geiger, MA
Group Creative Director: Michael Touna
Managing Editor: Sarah Wells
Associate Editor: Jacqui Rusciolelli
Senior editor: Michal Kapral
Contributing director of strenght and conditioning: Jimmy Pea, MS, CSCS
Art Directors: Wil McKeown, Derek Hounsell
Photo Editor: Jeff Maltby
Contributing Photographers: Alex Ardenti, Gregory James, Ian Logan, Paul Buceta,
Robert Reiff, Michael Butler
SUPER FITNESS
www.facebook.com/olympians.news
Siamo anche su
Diventa nostro fan!
EDITORE:
Sandro Ciccarelli Editore S.r.l.
DIRETTORE RESPONSABILE:
Mario Furlan
REDATTORE CAPO:
Sandro Ciccarelli
REDAZIONE:
Sandro Ciccarelli Editore S.r.l.
Via Brodolini, 35/b
Tel. 055/0513467 055/0513600
50063 Figline Valdarno (FI)
e-mail: sandro@olympian.it
CONTRIBUTO EDITORIALE:
Reps!
COLLABORATORI ITALIANI ED ESTERI:
Sandro Ciccarelli, Isabella Desci, David DeAngelis,
Mario Civalleri, Claudio Bisca, Roberto Del Gaudio,
Carlo Buzzichelli, Matteo Guida, Marco Ceriani,
Umberto Miletto, Antonio Parolisi, Mauro Friundi,
Armando Vinci, Paolo Evangelista, Anthony
McDougall, Stuart McRobert (Cipro), Berend
Breitenstein (Germania), Dott. Mauro
G. Di Pasquale (Canada), Charles Poliquin
(Canada), John Berardi (Canada), Nelson Ayotte
(Canada), Brian Johnston (Canada).
CORRISPONDENTI DAGLI STATI UNITI:
John Balik, Steve Holman, Dave Draper, Jerry
Brainum, Millard Baker, Charles Staley, Author
L. Rea, Dott. Bryan Haycock, Dott. Dan Wagman,
Stephen Adel, Tom Venuto, Rehan Jalali, Hugo
Rivera, Judd Biasiotto, Ori Ofmekler, Karlis Ullis,
Pavel Tsatsouline, Louie Simmons, Dana Hamm.
IN COPERTINA:
Modello: Brandon White
Foto: Ian Logan
FOTOGRAFIE:
Michael Neveux, Eric Jacobson, Irvin J. Gelb,
Alex Ardenti, Ralph DeHaan, Jason Ellis,
Jason Breeze
TRADUZIONI:
Massimo Bani, www.abptranslations.it
FOTOLITO e STAMPA:
STIGE ARTI GRAFICHE S.p.A
via Pescarito, 110 - 10099 San Mauro (To)
IMPAGINAZIONE
Sandro Ciccarelli Editore S.r.l.
PUBBLICIT:
Per informazioni telefonare allo
(055) 0513467 (055) 0513600
E-mail: ads@olympian.it
Olympians news si riserva il diritto di
accettare o meno le pubblicit
Copie arretrate 7,75 + spese spedizione
DISTRIBUZIONE PER LITALIA:
ITALIAN PRESS S.r.l.
Via G.Falcone, snc - Loc. Bariana
20024 Garbagnate Milanese (MI)
Tel. (02) 9944991
www.italianpress.it
e-mail: info@italianpress.it
OLYMPIANS NEWS
REGISTRAZIONE TRIBUNALE DI FIRENZE
N. 3982 DEL 5-7-1990 e successive modiche.
Iscritto nel ROC (Registro Operatori
Comunicazione) con il n19710.
ISSN:1126-0874
MENSILE ANNO XXIII n128
FEBBRAIO 2012
STAMPATO IN ITALIA
Per collaborare con OLYMPIANS news si pu inviare il materiale in formato word e le foto al direttore. La prima volta si devono inviare anche le referenze e i dati anagraci. Il materiale (testi e foto) inviato a OLYMPIANS news diviene
propriet del periodico e non potr essere restituito. Il materiale apparso su OLYMPIANS news non potr essere ristampato se non dietro richiesta scritta e conseguente autorizzazione del direttore. Il direttore e editore responsabile si
riserva la facolt di pubblicare il materiale inviatogli. Per tutti i testi che verranno pubblicati sar assunta la responsabilit dellautore. Le opinioni e le conclusioni contenute negli articoli sono quelle dellautore e non riettono necessa-
riamente quelle delleditore. Le domande e gli articoli pubblicati potranno essere modicati per necessit di lunghezza e/o chiarezza. 2012 Sandro Ciccarelli Editore - Figline Valdarno - Firenze. Tutti i diritti riservati. Nessuna parte
di questa pubblicazione potr essere riprodotta senza lautorizzazione scritta delleditore. Prima di iniziare qualsiasi attivit sica o dieta siete pregati di consultare il vostro medico. Luso delle informazioni pubblicate su OLYMPIANS
news a proprio rischio e pericolo. OLYMPIANS news cita i nomi commerciali di integratori, farmaci o altri prodotti per la completezza dellinformazione e per libera scelta della redazione. Le informazioni contenute nelle pagine pub-
blicitarie sono di esclusiva responsabilit del committente. Per gli abbonati: le copie non ricevute potranno essere richieste con notica scritta alleditore, la notica dovr essere inviata dopo 2 mesi di ritardo dalla data di pubblicazione.
Gli articoli tradotti e ristampati in questo numero da REPS! sono Copyrighted 2012 by
Robert Kennedy Publishing. Tutti i diritti riservati sia in lingua inglese che in italiano. Edizione
originale, in lingua inglese, pubblicata da Robert Kennedy Publishing, 400 Matheson Blvd.
West , Mississauga, Ontario Canada L5R 3M1. Qualsiasi forma di riproduzione, in qualsiasi
linguaggio, per intero o in parte, senza la preventiva autorizzazione scritta da parte di Robert
Kennedy Publishing espressamente vietata. Ristampa in lingua Italiana previa autorizzazione di
Maximum Fitness. Edizione Italiana a cura di Olympians News
REPS! stampata in lingua italiana da Sandro Ciccarelli Editore S.r.l.
dietro speciale accordo con International Licensing Representative
Robert J. Abramson and Associates, Inc. Ms. Libby Abramson, President
abramson@bestweb.net
96
Combatti o fuggi?
Gestite lormone dello stress
cortisolo per massimizzare i
guadagni muscolari e la perdita di
grasso, migliorando anche la salute.
DI STEVEN STIEFEL
Rubriche
Articoli
76
Prova questo
test, bello!
Scoprite come siete messi
in confronto alla nuova generazione di soldati-atleti
statunitensi eseguendo il nuovo test proposto per
il fitness con cinque esercizi dellesercito USA. DI
MICHAL KAPRAL
80
Il sangue non acqua
Ecco come la potenza dei muscoli ha raforzato il
legame fra padre e figlio quando il modello fitness
Kyle Clarke ha spinto suo padre 61enne, Dale, a
mettersi nella forma migliore della sua vita.
DI MICHAL KAPRAL
44
Principianti 1 - Partire con il piede giusto
Se siete dei principianti, mettete in pratica i consigli dati in questo articolo e risparmiatevi le
frustazioni e le delusioni sperimentate da gran parte dei principianti. DI STUART MC ROBERT
4 Editoriale
9 Posta
22 Impatto massimo
24 First Rep
Senape per la massa, tecniche di intensit
per migliorare il fitness, cadenza migliore
per i guadagni muscolari, alimenti che
proteggono la prostata, la dura verit sulle
bevande analcoliche e molto di pi.
52 Hardgainer D&R 93 parte
Su come costruire un fisico imponente.
56 Weight-loss salvation
Come perdere peso senza riacquistarlo e
come potrete farcela anche voi!
UOMINI REPS!
116

Il combattente
All-American Brian Stann della UFC
parla dellistinto per il combattimento.
118

Il poliziotto SWAT
Il dificile passaggio di Jim Vaglica dalla
lotta alla criminalit alla ribalta della
televisione.
120

Il supereroe
Il ragazzo di copertina Reps! Brandon
Myles White parla di fumetti, di cinema
e del suo migliore amico Tank.
122 I consigli degli esperti
Come usare attrezzi insoliti per accelera-
re i progressi.
124 Macchina magra
Ultime notizie! Conservate il muscolo du-
ramente guadagnato e dimagrite usando
questo amminoacido.
126 Alimenta la bestia
Alimenti comuni che stimolano il
metabolismo, pi spuntini energetici
per la palestra consigliati dallo sciatore
migliore al mondo: Sarah Burke.
130 Anti-aging
Stress menagement e sovrappeso.
136 Reps! Estremo
Strisciare nel fango, saltare sul fuoco
e ricevere scosse elettriche al Tough
Mudder, tutto per divertimento, per
meglio farsi accompagnare da muscoli
fisici e mentali.
Alimentazione e salute
139 NBFI News
di Isabella Desci
142 Cucina blindata contro il doping
di Marco Ceriani
144 3 Campionato italiano NBFI di
Natural Bodybuilding e
2 Campionato Ms. Fit Body
del Prof. Pasquale Cozza
178 Cronaca di un trionfo
di Kristian Montevecchi
182 I fantastici 4
... alla conquista di New York
di Gabriele Tampellini
internet: www.olympian.it
e-mail: sandro@olympian.it
Questo periodico associato alla
Unione Stampa Periodica Italiana

Seguici su
Informativa sulla riservatezza dei dati
La rivista Olympian's News La informa che: 1. Il trattamento dei Suoi dati personali svolto mediante elaborazione automatizzata, nalizzato alla gestione del suo abbonamento: 2. Il conferimento dei Suoi dati a Olympian's News facoltative ed un Suo eventuale riuto
non comporter alcuna conseguenza pregiudizievole per Lei; 3. ove da lei conferiti i Suoi dati personali potranno essere comunicati ad altre imprese che svolgono informazione commerciale, inviano materiale pubblicitario ed operano nel settore delle vendite per corrispon-
denza; 4. L'art 13 della legge n. 875 del 31 Dicembre 1996 le attribuisce, fra gli altri, i seguenti diritti: - di conoscere l'esistenza di trattamenti di dati che possono riguardarLa mediante accesso gratuito al registro istituto presso il Garante per la protezione delle persone e di
altri soggetti rispetto al trattamento dei dati personali; - di essere informato dal Garante su alcuni contenuti della noticazione del trattamento che la riguarda; - di ottenere la conferma dell'esistenza o meno di dati personali che La riguardano - con un contributo di spese
a suo carico ove fosse confermata l'esistenza degli stessi presso di noi - anche se non ancora registrati, la loro comunicazione in forma illegibile, la loro origine, la logica e nalit del trattamento (potr rinnovare la predetta richiesta con intervallo non minore di 90 giorni),
la cancellazione ovvero la trasformazione in forma anonima o il blocco dei dati trattati in violazione della legge, l'aggiornamento, la retticazione degli stessi, l'attestazonele operazioni predette siano portate a conoscenza di coloro ai quali i dati siano stati comunicati; - di
opporsi, senza alcun costo per Lei, al trattamento di dati personali che la riguardano, previst ai ni di informazione commerciale o di invio di materiale pubblicitario o di vendita diretta ovvero per il compimento di ricerche di mercato o di comunicazione commerciale
interattiva, nonch per motivi legittimi, o qualsiasi altro trattamento dei dati; 5. il titolare del trattamento dei Suoi dati Sandro Ciccarelli Editore S.r.l., con sede in Figline Valdarno (FI); il responsabile del medesimo trattamento lo stesso.
distribuita da Olympians s.r.l. via Brodolini 35 50063 Figline Valdarno (Fi)
tel. 055/958058 - 055/959266 Fax 055/958255 e-mail: info@olympianstore.it
www.olympianstore.it
tel.

A.N.LABS A.N.LABS
INTERNATIONAL
GLUCORAM


la risposta
agli intensi
sforzi
muscolari!
I RAMIFICATI CON UNA MARCIA IN PI!
L
e
g
g
e
r
e

a
t
t
e
n
t
a
m
e
n
t
e

l
e

a
v
v
e
r
t
e
n
z
e

e

l
e

m
o
d
a
l
i
t

u
s
o

r
i
p
o
r
t
a
t
e

i
n

e
t
i
c
h
e
t
t
a
.
Ogni sport ha le sue esigenze...


H
o
i
s
t

F
i
t
n
e
s
s
Salve, mi chiamo Andrea, ho 30 anni e peso
87 kg. Vado in palestra da 4 anni con una
certa frequenza (3 volte a settimana) anche
se ho interrotto per alcuni periodi, causa infortuni.
Vi scrivo in seguito ad una questione riguardan-
te il mio lavoro: sono turnista in una fabbrica
metalmeccanica. Ho letto che di notte, quando si
dorme si ha un incremento del GH e che alle prime
ore della mattina si ha un aumento del cortisolo.
Ho letto che il cortisolo aumenta la distruzione
della massa muscolare, incrementi dello stesso
sarebbero da evitare, ma dovendo stare sveglio tutta
notte, andando a dormire alle 6 del mattino, non
mi possibile.
Volevo chiedervi quale possa essere unalimenta-
zione adeguata per incrementare il GH e ridurre il
cortisolo nelle ore notturne di lavoro.
Lallenamento settimanale di 3 volte a settimana
suddiviso in: gambe+schiena / petto+spalle / circui-
to, con lobiettivo di mettere massa muscolare.
Integratori utilizzati: whey protein, maltodestrine,
vit. C, glutammina, creatina, multivitaminico.
Grazie per la risposta,
Andrea
Risponde Matteo Guida
I
l GH uno degli ormoni anabolici pi potenti del
nostro corpo. Prodotto ad ondate dallipofisi localizzata
alla base del cervello:
aumenta la massa magra
riduce la massa grassa
WWW. OLYMPI AN. I T Olympians News / SUPER FITNESS 9
Copyrighted 2012, by Sandro Ciccarelli Editore
Le risposte alle domande pubblicate nella Posta di Olympians news sono a cura di vari autori esperti nei settori alimentazione e integrazio-
ne (Rehan Jalali e Marco Ceriani), e allenamento teorico e pratico (Stuart McRobert, Matteo Guida, Roberto Del Gaudio). Potete inviare le
vostre domande al vostro autore preferito, specificando come oggetto uno degli argomenti seguenti: Allenamento B.I.I.O., Hardgainer, inte-
gratori alimentari alla redazione di Olympians news, via Brodolini 35/b, 50063 Figline Valdarno (FI) e-mail: sandro@olympian.it.
INFORMAZIONI SULLE MODALIT DI UTILIZZO DELLA RUBRICA POSTA: questa rubrica offre ai lettori la possibilit di contattare gli esperti
della rivista, ponendo domande di interesse generale e ricevendo, tramite la rivista, una accurata risposta. Le domande devono quindi riguar-
dare unicamente argomenti di interesse comune. Richieste specifiche e personali di valutazioni nutrizionali, schemi di integrazione e/o alle-
namenti non sono di interesse per questa rubrica e NON saranno inoltrate ai titolari della rubrica. Nota: gli esperti sono disponibili in forma
privata per forme di consulenza individuali.
La crescita muscolare avviene se la
sintesi proteica maggiore della
disgregazione muscolare. Lallenamento
stimola la sintesi ma senza adeguata
nutrizione ci avviene con difficolt.
F
o
t
o
:


E
r
i
c

J
a
c
o
b
s
o
n

-

(
w
w
w
.
i
m
p
a
c
t
-
p
h
o
t
o
g
r
a
p
h
y
.
c
o
m
)
aumenta lenergia
stimola il sistema immunitario
aumenta lattivit sessuale
stimola lattivit ossea.
rilasciato principalmente durante il sonno, ecco perch
importante dormire di notte.
Il CORTISOLO, prodotto dalle ghiandole surrenali,
serve per:
mantenere il ritmo cardiaco
mantenere la pressione ematica
rilasciare ladrenalina nei momenti di stress.
Una sua alterazione in alto o in basso crea ritenzione idri-
ca. Ogni stress produce cortisolo.
Il cortisolo in eccesso:
disgrega le proteine muscolari;
trattiene sodio alzando la pressione;
espelle potassio.
Inoltre il cortisolo inibisce il GH, abbassa gli ormoni
tiroidei abbassando il Metabosimo Basale, e sembra essere
responsabile delle peggiori e meno note malattie.
Il 90% della secrezione di GH avviene di notte.
Rendere favorevole il sonno in quantit e qualit quindi
importante. Si comincia con unalimentazione adeguata
per favorire il sonno ed il rilascio di GH. La crescita
muscolare avviene se la sintesi proteica maggiore della
disgregazione muscolare. Lallenamento stimola la sintesi
ma senza adeguata nutrizione ci avviene con difficolt.
Le proteine, per essere sintetizzate in nuovo tessuto,
hanno bisogno dellazione degli ormoni tra cui un ruolo
rilevante dato dal GH e dal testosterone. Quindi allena-
mento e proteine, senza GH, non servono a molto. Il
momento chiave per fissare gli aminoacidi per riparare e
incrementare i muscoli durante la notte. Quindi un
sonno sereno deve essere preceduto da una adeguata for-
nitura di aminoacidi, oltre che di sostanze che abbassino
il cortisolo (disgregatore) (fosfatidilserina 400-800 mg) e
che aumentino il GH e il testosterone notturno (tribulus,
ZMA 500-800 mg). La Glutammina (5-10 g) favorisce
ulteriormente il tutto.
Il rilascio di GH, TESTOSTERONE E CORTISO-
LO notturni hanno un andamento diverso tra chi si alle-
na e chi sedentario:
Nel sedentario GH e T sono pi alti nella prima parte
del sonno e pi bassi verso la fine della notte. Il cortisolo
ha il picco nella seconda met.
Nello sportivo il contrario: picco iniziale di cortisolo,
e picchi di GH e T verso la seconda met della notte.
Considerazione: lo sportivo potrebbe avere problemi ad
addormentarsi specie nei primi giorni dello scarico (in cui
lo stress alto ma non si stancato troppo in palestra).
Dormire poco fa pi danni nello sportivo che nel seden-
tario. Il sonno buono per lo sportivo sono le seconde 3-
4 ore della notte. Alla lunga, dormire poco abbassa le
difese immunitarie. 3 mg di melatonina possono aiutare
ad avere un sonno profondo. I cicli del sonno durano
circa 90 quindi la sveglia andrebbe messa (in realt sareb-
be meglio la sveglia naturale) dopo 7,5 ore o dopo 9 ore.
Venendo al tuo problema premesso che sarebbe otti-
male dormire di notte anzich di giorno la strategia che
mi sento di consigliarti quella di trattare il periodo del
sonno come se fosse in tutto e
per tutto una notte vera.
Certamente non proprio cos,
ma non vedo alternative.
Pertanto la strategia che ti con-
siglio per massimizzare il GH e
minimizzare il Cortisolo, la
seguente (contiene regole valide
per tutti):
fare 6 piccoli pasti al giorno;
ogni pasto deve contenere
proteine nobili;
i primi 4 pasti dovrebbero
contenere carboidrati a basso
indice glicemico;
gli ultimi due della giornata
dovrebbero essere privi di car-
boidrati (per non intralciare il
rilascio di GH);
il primo pasto della giornata
deve essere abbondante (relati-
vamente parlando) in carboi-
drati;
il pasto post allenamento deve
essere ricco di carboidrati ad
10 Olympians News / SUPER FITNESS WWW. OLYMPI AN. I T
F
o
t
o
:


M
i
c
h
a
e
l

N
e
v
e
u
x
Dormire poco fa pi danni nello sportivo che nel
sedentario. ... Il sonno buono per lo sportivo sono le
seconde 3-4 ore della notte. Alla lunga, dormire poco
abbassa le difese immunitarie.
alto indice glicemico e di proteine in rapporto 3C/1P
(per abbassare il cortisolo e ricaricare i muscoli).
STRATEGIA INTEGRATORI
Per abbassare il cortisolo:
Vitamina C = 0,5-1 g
Glutammina = 5/10 g post allenamento e 5 g prima
di dormire;
Fosfatidilserina = 400 mg post allenamento e prima di
dormire;
Melatonina = 3 mg (prima di dormire).
Per stimolare il GH:
Omega 3 = 6/9 g al giorno suddivisi ai pasti.
Inoltre:
BCAA post allenamento (stimolare la sintesi proteica)
= 2 g/10 kg di peso massa magra;
ZMA = 500 mg (aumenta il testosterone);
ricorda che mangiare troppo poco alza il cortisolo;
cerca di creare ogni occasione per rilassarti, ad esem-
pio creando spazi cuscinetto tra i tuoi impegni per
recuperare eventuali ritardi, gestire lansia, relax puro.
Per quanto riguarda lallenamento se vuoi lipertro-
fia perch fai la terza seduta a circuito? O ne fai solo 2
possibilmente equi-distanziate tra loro (p.es.: lun/giov o
mar/ven o merc/sab) oppure suddividi il programma con
una split a 3! Saluti!
Saluti a tutti!, volevo sapere se vero che il
miele fa bene allo sport, e se s, in che dosi?
Grazie.
Massimo
Risponde Marco Ceriani
E
hi, accidenti Massimo stai utilizzando internet con
una mail, non twitter o un telegrafo, potresti scrivere
anche qualche parola in pi!
In che senso un alimento, in questo caso il miele, fa
bene allo sport? Penso tu ti riferisca al fatto che il miele
sia un alimento fortemente energetico, ricco come di
zuccheri semplici, ma il tuo sport energetico? Nel senso
sei un ciclista, un maratoneta, un fondista? Se cos,
bene, altrimenti a cosa ti serve tutta questa energia da un
alimento che un mix di carboidrati semplici (fruttosio e
glucosio) altamente concentrato (85-95%)? Non certa-
mente per un ottimale controllo glicemico e neppure per
la tua definizione muscolare...
Il miele infatti, dal punto di vista nutrizionale pu
essere considerato alla stregua di uno zucchero in grado
di apportare allorganismo calorie prontamente disponibi-
li (ben oltre le 320 kcal per 100 g), in pratica, senza
richiedere alcun processo digestivo. Si tratta quindi di un
integratore energetico alla stregua dei gel in uso negli
sport di endurance (ciclismo in primis).
Io consiglio il miele in caso di difficolt di assorbi-
mento di cibi solidi, essendo ottimo nelle terapie riabili-
tative, nei malati, negli inappetenti e negli anziani (diabe-
tici a parte). un alimento che nutre velocemente senza
impegnare le attivit gastrointestinali del nostro corpo. Il
mio parere che si tratti di un alimento di molto soprav-
valutato. Infatti, oltre agli zuccheri, ha altre molecole bio-
disponibili a livello nutrizionale ma in percentuali molto
basse e nella maggior parte dei composti, quasi irrilevanti
(come acqua, sali minerali, acidi organici ed enzimi).
Il consumo del miele, al pari di altri alimenti tipici
(come i formaggi) pu semmai essere un conforto al
gusto e al palato, essendoci infinite tipologie di questo
prodotto (acacia, millefiori, castagno, ecc.), e in questo
caso si tratta di gusti naturali e certamente migliori dei
gusti chimici di arancia, limone o cola dei gel industriali.
Un saluto (rapido come nel tuo stile).
Ciao Paolo, mi piacerebbe provare a prepa-
rare una gara di Powerlifting, ma sono un
po spaventato da quanto leggo in giro.
Larco dorsale nella panca potrebbe farmi male? Poi
ho sentito dire che chi fa queste cose si strappa i
WWW. OLYMPI AN. I T Olympians News / SUPER FITNESS 11
Il miele, dal punto di vista nutrizionale
pu essere considerato alla stregua di
uno zucchero in grado di apportare
allorganismo calorie prontamente
disponibili (ben oltre le 320 kcal per
100 g), in pratica, senza richiedere
alcun processo digestivo.

O
l
g
a

L
a
n
g
e
r
o
v
a
-

F
o
t
o
l
i
a
.
c
o
m
pettorali, poi ho sentito che ti viene la spondilisi. A
me piacerebbe, ma ho 23 anni e vorrei continuare a
fare i pesi per altri 23 anni. Tu ti sei mai fatto male?
Ciao.
Beppe
Risponde Paolo Evangelista
C
iao Beppe, la tua una domanda complicatissima.
Banalmente: piazzarsi sulla schiena 150 kg di ferro
pi rischioso per la tua schiena che non farlo, come nuo-
tare in piscina pi rischioso per affogare rispetto al
prendere il sole sotto lombrellone vicino al bordo. Ci
che va valutato se il rischio di farsi male nel Powerlifting
maggiore del rischio che si avrebbe in attivit differenti.
Per fare un po di polemica, il mondo dei pesi sem-
pre stato afflitto da questa nomea di distruggi-schiena o
addirittura di distruggi-corpo, paradossalmente anche dal-
linterno. Il corpo umano considerato fragilissimo, tante
volte, quando non lo . Nessuno si lagna, ad esempio, nel
motocross dove cadere fa parte del gioco, o nella moun-
tain bike, nessuno si lagna nel rugby o nella boxe per gli
stessi motivi. Invece, appena metti un peso sulla schiena,
nascono ernie, spondilolisi, spondilolistesi, bulging, pro-
trusioni come se piovesse.
Ora, chiaro: da fessi farsi male per fare fitness o
wellness, un controsenso rispetto al significato della paro-
le. Idem, da fessi farsi male in uno sport per il semplice
motivo che se ti fai male non puoi allenarti n migliorare.
A fronte di pesi immensi sollevati, le statistiche del solle-
vamento pesi mostrano che la percentuale degli infortuni
bassa, meno di altri. I punti di maggior stress sono la
bassa schiena e le spalle. La gara in s non levento a
maggior traumaticit e, sebbene non abbia valore di stati-
stica, seguo il powerlifting dal 2004, ho partecipato e assi-
stito a moltissime gare, ho letto resoconti e visto clip di
atleti e su migliaia di alzate gli infortuni brutti sono
stati pochissimi: stiramenti ai femorali, problemi ai bicipi-
ti, ma di sicuro nessuno rimasto sotto al bilanciere con
urla disumane per essere portato via in barella paralizzato.
Ripeto: questo non significa NULLA e ti dir che la
bassa percentuale di infortuni (nel powerlifting come in
tutti gli sport) pu semplicemente essere dovuta alla rile-
vazione sbagliata di questi. Se io mi faccio male alla schie-
na, una bella ernia, chi registra che ce lho? Chi registra
che questa connessa a ci che ho fatto?
Analogamente, ci sono studi che fanno vedere come ci
siano casi di spondilolisi che degenerano in spondiloliste-
si, cio le vertebre vanno soggette a fratture da stress per
poi slittare mutuamente. Il problema che questo avviene
in qualsiasi sport, anche nel ciclismo. Ovvio, con i pesi
avviene in misura maggiore, ma non c chiarezza su
quanto sport, quanto carico, a che et e per quanto
tempo questo possa provocare questo problema che, ad
aggiungere confusione su quella esistente, quasi sempre
asintomatico e ce ne accorgiamo magari per una risonan-
za fatta per tuttaltri motivi.
Per cos non si hanno informazioni per prendere
decisioni serene. Ti dico la mia.
Ci che vedo che il Powerlifting come il Lato Oscuro
della Forza: ti alleni per diventare un Jedi e ti trasformi
regolarmente in un Sith.
Il Powerlifting fare i pesi in modo competitivo: un
ragazzo di 20, 23 anni come te e che ama i pesi naturale
che sia attratto da questo modo nuovo di mettersi in
gioco. sicuramente affascinante, intrigante. Un modo di
allenarsi differente in cui c attenzione alla tecnica, al
gesto, gli schemi di allenamento sono nuovi e portano,
per chi ci si applica, a migliorare anche di molto. Non in
un mese, ma magari in un anno e ti posso assicurare che
conosco persone che, picchiando duro per 3, 4, 5 anni si
sono trasformate migliorando, dati e video alla mano, a
dismisura. Ah natural perch su questi amici ci met-
terei la mano, anzi le mani, sul fuoco.
Dopo una fase iniziale in cui apprendi le basi di sche-
mi e tecniche, c un momento in cui i carichi aumentano
12 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Continua a pag. 14
A fronte di pesi immensi sollevati, le
statistiche del sollevamento pesi
mostrano che la percentuale degli
infortuni bassa, meno di altri.
G
r
e
g

S
m
y
e
r
s
-

F
o
t
o
:


M
i
c
h
a
e
l

N
e
v
e
u
x
rapidamente: pi ti alleni da palestra, a cedimento, con
tecniche orribili, pi questo effetto vistoso.
qui che puoi farti male: ti fai prendere la mano per-
ch troppo divertente, vuoi sempre di pi, tendi a gonfia-
re gli allenamenti, a farne troppi, a caricare perch puoi
farlo. Per se i tuoi muscoli possono sollevare quei carichi,
le tue articolazioni, i tuoi tendini, i tuoi tessuti connettivi
invece mal li sopportano. E allora puoi beccarti uninfiam-
mazione, uno stiramento o anche di peggio. Perch aumen-
ti il rischio, non accorgendotene. Questo ci che devi evi-
tare. Come? Ragionando, come sempre. Se ragioni, se sei
graduale, il Powerlifting rischioso come qualsiasi altro
sport, il che significa che devi mettere sempre in conto di
farti male, ma non pi che a giocare a calcio (nel powerlif-
ting i crociati, se non altro, non si rompono).
Io in 26 anni di onorata carriera di fissato dei pesi mi
sono ovviamente infortunato pi e pi volte. Mi infortu-
navo per molto di pi quando facevo atletica. Con i pesi
ho avuto alcune contratture, 3 stiramenti ma principal-
mente una gravissima lesione al pettorale sinistro.
Veramente grave e da manuale, non lo nego.
Per non per fare il Powerlifting: mi ero fissato che
volevo fare 10 ripetizioni di panca con 120 kg, mi allena-
vo facendo una serie secca ogni 3 giorni, partendo da 90
kg. Sono arrivato a 17 ripetizioni con 100 kg e 9 con 120
kg. Il giorno in cui avrei dovuto testare le 10 ripetizioni
mi sono quasi asportato il muscolo. Ma per fare unidiozia
da palestra e, se vuoi, con un allenamento da 2 serie di
panca a settimana.
Non assolutamente vero che chi fa Powerlifting
intorno a te si strappi NECESSARIAMENTE i pettorali,
questa una balla che gira nellambiente.
Insomma, io non mi sento di dirti vai tranquillo ma
ci sono prove empiriche che puoi gestire la pericolosit
della pesistica. Informati, valuta, stai attento, non fare gli
errori degli altri, tipo i miei. Poi, come si dice, aiutati
che Dio ti aiuta!
Gentile staff, seguo alla lettera il metodo
B.I.I.O. ma da qualche tempo mi alleno la
mattina appena sveglio. Sono arrivato al 2
macrociclo Ibrido 2. La mia domanda questa:
visto che mi alleno mezzora dopo la sveglia, va
bene unintegrazione di BCAA e glutammina pre
workout e il mitico recovery post workout?
Gianluca
Risponde Marco Ceriani
C
iao Gianluca, faccio un po fatica a rispondere a que-
sta domanda che, come molte che sono didascaliche
e non curano la forma, richiederebbe qualche informazio-
ne fondamentale come peso, altezza, alimentazione ecc.
(ma quante volte ho scritto queste cose e quante dovr
ancora scriverne?).
Detto questo, la tua domanda richiede poco tempo,
basterebbe un semplice NO, non va bene. Ma ovviamente
non me la cavo con cos poco, questa rubrica richiede un
minimo di approfondimento, eccolo.
Il fatto che ti alleni dopo mezzora dalla sveglia, credo
che debba fare intuire che tu lo faccia a digiuno. Posto
questo, ti chiedo: a che servono gli aminoacidi? Per un
carico proteico rapido? Se s, non meglio una fonte pro-
teica alimentare? Ma, a proposito, per avere
una risposta sensata dovresti magari svelarci
il quantitativo assunto.
Se il tuo scopo non quello anabolico
ma energetico, allora non bastano i sem-
plici BCAA ma dovresti sostituirli con
formulazioni comprendenti aminoacidi
glucogenetici (mai sentito parlare del
Glucoram

?).
Ok per la glutammina, che un
14 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
... se i tuoi muscoli possono sollevare
quei carichi, le tue articolazioni, i tuoi
tendini, i tuoi tessuti connettivi invece
mal li sopportano. E allora puoi
beccarti uninfiammazione, uno
stiramento o anche di peggio.
G
r
e
g

S
m
y
e
r
s
-

F
o
t
o
:


M
i
c
h
a
e
l

N
e
v
e
u
x
aminoacido essenziale (anche se sui libri lo trovi tra i non
essenziali o come condizionatamente essenziale) ed per-
fetta sia come carico proteico che come munizione per il
tuo apparato immunitario. Ma il mio un ok condiziona-
to dal dosaggio che non dici...
Per il mitico recovery post workout, siamo daccor-
do, anche se servirebbe avere qualche idea sulla tua cola-
zione anchessa, credo, post.
Nota: se vuoi veramente dei consigli utili eccotene
uno da appendere allingresso della tua cucina: Non
dimenticare mai di mangiare e non avere mai unaspettati-
va miracolistica verso gli integratori.
Lalimentazione infatti la base per incrementi
muscolari e ricariche energetiche, gli integratori, come
suggerisce il termine, devono semplicemente supportare la
nutrizione, arrivando a sostituirla nei casi in cui
impossibile alimentarsi in modo tradizionale.
Buon allenamento, dieta e integrazione.
Ciao Roberto, rileggendo Brawn c
una routine dove McRobert dice di
fare, ad esempio, una serie di panca
da 12 e poi una da 8 ... dice di lasciare lo
stesso peso oppure di aumentare peso in
relazione al tempo di recupero. Ho fatto 2
sedute cos (tranne che sullo squat che,
ormai mi son fatto coraggio, lo faccio
1x20...) e devo dire che il mio corpo rispon-
de alla grande. Tu che ne pensi? In pi,
facendo 3 full-body ogni 15 giorni (lunedi-
sabato-mercoledi) e aumento i carichi alla
grande. Dammi un tuo parere...
Risponde Roberto Del Gaudio
E
cco unaltra domanda che mi giunge ogni
tanto mediante Facebook. Questa citazione
inserita nella nuova versione di Brawn, seconda
versione aggiornata a gennaio 2010, pag.153.
Ti dar il mio parere in merito alle iniziative da
te intraprese. Allora, hai letto che Stuart consi-
glia un piramidale a due set con una serie da
12 ed una da otto, o sei, ripetizioni: come
prima cosa noto che i due set rientrano nella
media standard di volume di serie per esercizio,
non solo del tecnico di Cipro, ma anche di
molti autori di Hardgainer. Leccezione luti-
lizzo del piramidale a due serie: ci denota che
nellambito di un ciclo il far uso dei tre set per
abbinare le alte alle basse ripetizioni, per stimolare la forza
e la massa nella medesima seduta, non sia decisamente
rilevante per Stuart. Lo testimonia il fatto che, nellesem-
pio che mi hai chiesto, le reps si evidenziano per lo stimo-
lo allincremento di massa magra. Questa modalit di
proporre il piramidale sottolinea il primo elemento del-
lapplicazione di un B.I.I. classico: la Brevit nel volume
anche per esercizio (e non solo con riguardo allintera
seduta allenante).
Altra caratteristica di questo 2x12-8, che pi facile
di un 2x12, ad esempio. Logico, se nella seconda serie fai
scendere le ripetizioni ed utilizzi il medesimo carico del
set a dodici reps, sar pi facile per te vincere lesercizio
target, e non la serie target, cio lobiettivo dei due set per
un determinato esercizio. Non penso che Stuart intenda
luso classico del piramidale: un aumento del carico alla
diminuzione delle ripetizioni, poich unapplicazione del
genere non avrebbe senso in un ciclo dove non c un fine
che ha un limite di tempo per essere raggiunto. Come,
del resto, il medesimo piramidale non dovrebbe essere
applicato come prima o seconda serie target. Perch?
Perch nel caso di prima serie target, non avrebbe senso
eseguire il secondo set; mentre, nella seconda opzione, si
rivelerebbe inutile prestancarsi con il set da dodici reps,
poich si annullerebbe quel concetto di serie viva che ho
spiegato in modo approfondito un paio di numeri fa sulla
rivista.
Riguardo il concetto di recupero che menzioni: qui si
tratta di unapplicazione parziale di tale termine. Trattasi
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 15
cerca di valutare bene il recupero anche tra
le sedute, potresti accorgerti che i quindici
giorni di un micro potrebbero essere pochi, se
magari ti rendessi conto di avere bisogno di
qualche giorno in pi di riposo dopo il brutale
squat a 20.
G
r
e
g

S
m
y
e
r
s
-

F
o
t
o
:


M
i
c
h
a
e
l

N
e
v
e
u
x
WWW. OLYMPI AN. I T
16 Olympians News / SUPER FITNESS
di vittoria, o meno, delle serie target, e non ci si riferisce
invece allaccezione stuartiana di pacchetto completo
nellapplicazione di allenamenti di Body Building senza
farmaci (progressione dei carichi, esecuzione corretta degli
esercizi, alimentazione equilibrata e sonno adeguato al
singolo atleta).
In merito allo squat a 20, cerca di valutare bene il
recupero anche tra le sedute, poich con il progredire del
ciclo, potresti accorgerti che i quindici giorni di un micro
potrebbero essere pochi, se magari ti rendessi conto di
avere bisogno di qualche giorno in pi di riposo dopo il
brutale squat a 20.
In conclusione, se il ciclo prosegue bene, vai avanti
cos. Nel momento in cui la scheda da te applicata si
dovesse arrestare, valuta tutti gli elementi, non solo relati-
vi al recupero, ma anche con riguardo alla progettazione
della scheda stessa. Esempio: sei sicuro che quella scheda
non sia troppo onerosa per te, in questo momento della
tua vita, perch magari sei in debito di sonno per svariati
motivi? Pensaci.
Mi chiamo Vincenzo ho 30 anni altezza 1.73
peso 79 Kg. Alla visita plicometrica mi
hanno riscontrato i seguenti valori: Torace 8,
Addome 15, Gambe 15, con una percentuale quindi
di +11%. Da questesame ne derivato il seguente
regime alimentare:
Colazione: spremuta; 4 albumi; caff; fetta di pane;
Spuntino: mela; dose di proteine (Body Protein);
Pranzo: 80 g di riso; verdura cruda;
Spuntino: mela; dose di proteine (Body Protein);
Cena: passato di verdura; pesce (300 g) o Carne Bianca
(250 g); legumi 50 g;
Colazione - Pranzo - Cena: aminoacidi (circa 7,5 mg a
razione).
Il mio istruttore, circa 2 mesi fa, mi ha dato la
seguente scheda di allenamento:
Pettorali: Panca Alta Bil., Panca Piana, Pullover Man.,
Aperture Alte;
Bicipiti: Curl Manubri Alt., Panca Scott Bil., Curl con-
centraz.;
Spalle: Lento Dietro Bil., Alzate Lat Sing., Alzate Avanti
90, Alzate Avanti Bil.;
Tricipiti: Manubrio a 90, French Press, Pulley Machine;
Dorsali: Lat Machine D., Rematore Man., Pulley Basso.
Questa scheda la seguivo maldestramente, da quan-
to evinco dai vostri consigli, poich facevo:
Lunedi e Giovedi (Pettorali e Bicipiti)
Martedi e Venerdi (Spalle e Tricipiti)
Mercoledi e Sabato (Dorsali)
questo la mattina dalle ore 12:30 alle 13:45 poich
a questora c poco traffico in palestra, poi la sera,
anche per il piacere di chiacchierare, mi sottopone-
vo ad una seduta di aerobica (19:30 20:30)
Ora il dietologo e il maestro di BB e voi mi fate
capire che tutto ci non serve e che mi stresso sol-
tanto e mi hanno detto di fare:
Lunedi/Mercoledi/Venerdi Pesi, Martedi e Giovedi
Aerobica, sempre, a questo punto, di sera.
Ora i miei problemi sono, dato che sono stati un
po vaghi sullargomento:
1. La scheda si conf con la dieta e le sedute o
vanno apportate delle modifiche?
2. Come devo ripartire i vari esercizi nellarco delle
tre giornate?
3. Devo completamente cambiare piano dallena-
mento? Se s come?
Risponde David De Angelis
D
ue semplici parole in merito allalimentazione: una
delle valutazione pi ardue e difficili proprio quel-
la alimentare. I fattori da valutare sono talmente tanti e
variabili che ci portano ad evitare di dare giudizi su piani
alimentari e soprattutto a consigliare quella combinazione
di alimenti ed in quella data quantit. Quando si impara
a guidare unautomobile listruttore NON ti dice che
dopo 72 metri devi premere il pedale centrale per frenare,
ma ti dice che devi farlo ad uno stop o quando c un
Continua a pag. 18
ci che veramente conta ed ha
validit una corretta abitudine
PROTRATTA NEL TEMPO non una
sporadica ECCEZIONE (che spesso
fa tanto bene a livello mentale).


Y
u
r
i

A
r
c
u
r
s

-

F
o
t
o
l
i
a
.
c
o
m
DOMENICA15 APRILE 2012
ORE 17,30
MOSTRA DOLTREMARE
NAPOLI NAPOLI
INTEGRATORI PER LO SPORT
CATEGORIA ALTEZZA/PESO
gli atleti saranno suddivisi in 3 categorie
no a 173 cm + 0 Kg
no a 178 cm + 3 Kg
oltre 178 cm + 5 Kg
CATEGORIA Body Building
Piccole Taglie (no a 173 cm)
Medie Taglie (no a 178 cm)
Alte Taglie (oltre 178 cm)
CATEGORIA OVER 40
1 classif.assoluto B.B 1.000
2 classif.assoluto B.B 500
3 classif.assoluto B.B 300
1 classif.assoluto H.P. 1.000
2 classif.assoluto H.P. 500
3 classif.assoluto H.P. 300
III GRAND PRIX
OPEN ALTEZZA/PESO & BODY BUILDING
1 classicato assoluto H/P 1.000
1 classicato assoluto B.B. 1.000
lassoluto maschile e femminile
saranno ospiti
allo stand GENSAN RIMINI WELLNESS 2012
ISCRIZIONI:www.sebsevento.com
INFO:Sig. Nino Blasio 348.2625433
ccccclllllaaaassssssssssiiiiffff. 222222000000000000
CATEGORIA FEMMINILE SOFT BIKINI/ROUTINE /
CCCCAAAAATTTTTTEEEEGGGGGOOOOOORRRRRRRIIIIIAAAAAAAA HHHHHHEEEEEEEAAAAAAASSSSSYYYYY HHHHH--33333 kkkkkkkgggggggg
CCCCCCCCCCAAAAAAAAAATTTTTTTTTEEEEEEEEEGGGGGGOOOOOOOORRRRRRRRIIIIIAAAAAAA UUUUNNNNNNDDDDDDDEEEEEEEERRRRRRRR 2222223333333
muro davanti: con questo voglio dirti che ci che credia-
mo veramente importante sia IL PERCH mangiare certi
cibi e limitarne altri, il perch, a parit di calorie giorna-
liere sia importante fare piccoli pasti durante la giorna-
ta e cos via dicendo.
inutile diventare schiavi di una determinata scheda,
invece opportuno acquisire una cultura sulla corretta
alimentazione, non solo per laumento della performance
sportiva ma, soprattutto, per la SALUTE INDIVIDUA-
LE e PUBBLICA, in quanto lo stato di salute di un indi-
viduo strettamente legato non solo allattivit svolta ma
anche, e soprattutto, al tipo di alimentazione seguita.
Personalmente, e lo affermo pubblicamente su un mezzo
come questo, mi capita, A VOLTE, di fare colazione al
bar (a dispetto di ogni regola alimentare): con questo
voglio dire che ci che veramente conta ed ha validit
una corretta abitudine PROTRATTA NEL TEMPO non
una sporadica ECCEZIONE (che spesso fa tanto bene a
livello mentale).
Concludendo il discorso alimentare: apprendi i princ-
pi di una corretta alimentazione (5 Segreto del mio libro
Super Training Sette segreti per un corpo e una mente
forti, flessibili e resistenti) magari leggendo ottimi libri
(vedi lappendice a fine libro). Prendi con cautela le diete
tipo 80 g di questo e 20 di quello ma tengono vera-
mente conto del tuo metabolismo a riposo e del tuo effet-
tivo dispendio in, e fuori la, palestra? Non avere paura di
fare eccezioni: ci che conta la regola.
PER QUANTO RIGUARDA LALLENAMENTO:
vista nellottica di un body builder natural che abbia
come principale obiettivo la massa muscolare non posso
che ribadire quanto detto nelle risposte precedenti: ci
che fa crescere il muscolo ladattamento specifico ad un
tipo di lavoro e quindi di sforzo: perch un muscolo
dovrebbe variare nella sua struttura fisiologica se il lavoro
richiesto riesce tranquillamente a svolgerlo con la stessa
quantit e qualit di fibre muscolari? Anche in questo
caso lo squilibrio che crea il cambiamento.
Ma qual il FATTORE DETERMINANTE per imprime-
re al muscolo un impegno tale da generare un adattamento
fisiologico? LINTENSIT. Perch diluire lintensit di una
seduta di allenamento, nonch i tempi di recupero e di cre-
scita muscolare (come ben sai il muscolo cresce dopo che
ha recuperato e NON mentre lo si allena) con allenamenti
ad alto volume (con numerosi esercizi per gruppo muscola-
re) quando con due/tre esercizi base (tipo squat, panca
piana, lento dietro, parallele, sbarra ecc. TIRATI AL MAS-
SIMO e cio AD ESAURIMENTO) si potrebbe letteral-
mente imprimere uno shock positivo alla muscolatura?
Non credere che il pi sia meglio, prova a seguire lal-
lenamento HIGH INTENSITY con laiuto di un fidato
ed esperto compagno di allenamento (che ti faccia fare
quella ripetizione in pi tanto produttiva).
Per quanto riguarda la scheda:
LUNED
Squat 1 x 5
(con quattro serie progressive di riscaldamento)
Panca orizzontale 1 x 5
(con quattro serie progressive di riscaldamento)
Lat-inversa 3 x 8
Scrollate 3 x 8
Curl Bilanciere 2 x 8
GIOVED
Mezzi stacchi 1 x 6
(con quattro serie progressive di riscaldamento)
Panca orizzontale 3 x 6
Lat-machine 3 x 6
Lento dietro 2 x 6
Panca stretta 2 x 6
Polpacci 4 x 20
Nota bene: aggiungi 2 kg a settimana sullo squat, alla
panca, allo stacco e 1 kg a tutti gli altri esercizi. Tutto
questo ad oltranza per tutte le settimane che puoi.
Non credere che il pi sia meglio,
prova a seguire lallenamento HIGH
INTENSITY con laiuto di un fidato ed
esperto compagno di allenamento (che
ti faccia fare quella ripetizione in pi
tanto produttiva).
WWW. OLYMPI AN. I T
18 Olympians News / SUPER FITNESS
S
p
e
n
c
e
r

N
e
v
e
u
x

e

W
h
i
t
n
e
y

R
e
i
d
-

F
o
t
o
:


M
i
c
h
a
e
l

N
e
v
e
u
x
Quando gli incrementi rallentano scarica
il 20% del peso e fai le stesse ripetizioni
e poi ricarica. Spero di averti aiutato.
Spett.le Dott Marco Ceriani,
mi chiamo Ivano, 36 anni,
praticante non agonista di
MMA, grappling, brazilian ju-jitsu ed
appassionato di dietologia e cultura
fisica, classica e funzionale. Ho acqui-
stato il suo libro Fight Diet e approfit-
to per porgerle sinceri complimenti
per il libro che ho letto in due pome-
riggi, appassionatamente. Dopo averlo
letto e per non andare troppo contro i
miei principi ho pensato di adottare
una dieta vegana, puntando soprattut-
to su proteine vegetali e pochi carbs,
integrando con alcuni prodotti non
vegan (olio di pesce in capsule). Per
il resto mi avvarr, ciclizzando, di
proteine di soia in polvere, proteine
di riso in polvere, ramificati, glutam-
mina, arginina, ZMA, melatonina.
Cosa ne pensa di questa strategia?
Volevo chiederle anche il suo parere sulla dieta
vegana e soprattutto di quella fruttariana e se sono
compatibili con il mio stile di vita (sveglia alle 4 per
lavoro fino alle 13, nel tardo pomeriggio 2 ore circa
in palestra per 5 giorni settimanali). Spero in una
sua anche breve risposta... grazie.
Risponde Marco Ceriani
S
alve Ivano, come hai certamente notato nel mio libro,
dedico grande attenzione alle scelte alimentari non
convenzionali (oltre alla filosofia Veg, penso di essere stato
il primo, se non lunico, in Italia a parlare di Bugs Diet,
di cui si sentir parlare molto spesso in futuro. Per inciso
la Bugs Diet viene prima della Paleo Diet ed molto pi
proteica...).
Venendo alle tue domande di fondo, direi proprio che
i regimi dietetici che ami non sono proprio in sintonia
con la tua attivit fisica e i ritmi di lavoro a cui sei sotto-
posto. Puntare ogni giorno la sveglia alle 4 non da tutti
e incide sulla qualit del sonno. Non si tratta solo di sem-
plice riposo ma della corretta induzione ormonale. Rischi
cio che la ciclizzazione corporea dei tuoi ormoni venga
pesantemente messa alla prova, o alterata, dal tuo ciclo
veglia/sonno. A questo proposito ti consiglio anche la let-
tura del mio libro Bella Forza Advanced, dove dedico un
F
o
t
o


r
e
d
d
i
t
i
NBFI

Natural Bodybuilding and Fitness Italy


Natural uno stile di vita!
La NBFI ha lo scopo di formare atleti e allenatori veramente Natural!
Affiliata alla WNBF/NBFI statunitense, gli atleti hanno la possibilit di arrivare alla Card di
professionisti negli USA. Gare con controlli antidoping.
Organizza corsi per allenatori e personal trainer ampiamente formativi convalidati dallACSI
(Ente di promozione sportiva riconosciuto dal CONI), con la quale la NBFI convenzionata.
Se anche per voi il bodybuilding natural uno stile di vita, sostenete questa Federazione,
affiliando il vostro centro sportivo, la vostra palestra o semplicemente diventando soci sostenitori.
Per informazioni: www.nbfi.it oppure info@nbfi.it
Convenzionata ACSI
(Ente di promozione sportiva riconosciuto
dal CONI ai sensi del D.L. n.242/1999)
Leonardo Casagrande, campione
italiano e Campione del mondo
WNBF Cat. leggeri, New York
Novembre 2011
... le diete hanno una loro territorialit, sono cio
formulate tenendo in debita considerazione i luoghi
e le situazioni climatiche...


G
i
u
s
e
p
p
e

P
o
r
z
a
n
i

-

F
o
t
o
l
i
a
.
c
o
m
grande spazio allargomento. Includerei quindi anche la
melatonina tra i tuoi integratori di riferimento (ricorda
che ha un preciso timing di assunzione, mai prima delle
20 e mai dopo le 22).
Le diete che citi hanno in comune una carenza protei-
ca, data dalla scarsa sostenibilit di regimi alimentari
carenti nei confronti degli aminoacidi essenziali. La quali-
t dei tuoi muscoli potrebbe certamente essere migliore
(idem per lesplosivit muscolare). Considera inoltre che
le diete hanno una loro territorialit, sono cio formulate
tenendo in debita considerazione i luoghi e le situazioni
climatiche ( per questo motivo che in montagna si man-
gia polenta e formaggio e in Brasile si pu quasi vivere di
sola frutta, ehi, ho detto quasi...).
Il mio parere sullargomento diete veg e fruttariane,
parlo da un punto di vista nutrizionale (non mi permetto
di certo di criticare scelte personali e filosofiche), che la
dieta vegetariana, comprendendo i derivati animali, uova e
formaggi, non evidenzi alcuna carenza proteica e risulti
quindi migliore per le persone attive. Carenza limitata alla
sola vitamina B12 e al ferro, specie nelle donne. La scelta
fruttariana pu essere una buona idea come periodo detox,
la consiglio solo destate, quando lattivit fisica ridotta e
la richiesta di idratazione e antiossidanti maggiore.
Osservare un periodo di 10-15 giorni a base di frutta e
verdura frullata e/o centrifugata pu essere ideale (anche
questo argomento trattato nel mio libro Bella Forza
Advanced, vedi modulo Arancione e sezione Ricette), ma a
patto di integrarlo con supplementi anabolici specifici
(aminoacidi e non solo i ramificati, glutammina & C.).
In ultimo gli integratori che assumi sono ok, io consi-
glierei di estendere la supplementazione degli aminoacidi
allintero pool e includerei anche lHMB e una buona
dose di vitamine (lintero gruppo B) e di sali minerali
(ferro). Cordiali saluti.
Salve, stavo leggendo linteressantissimo
articolo sui pistol squat e vedo che dedichi
molti esercizi allo stretching. In termini di
tempo quanto dovrei dedicare alla flessibilit in
ogni allenamento?
Secondo te deleterio eseguire dello stretching
prima di un allenamento?
Ciao e complimenti!
Michele
Risponde Mauro Friundi
C
iao Michele! S, in effetti per una esecuzione ottimale
del Pistol Squat, ho dedicato unintera fase solamente
allo sviluppo della flessibilit.
Essendo un esercizio che grava prevalentemente sul-
lanca, importante che le articolazioni coinvolte (anca,
ginocchio e caviglia) abbiano un buon grado di escursione
prima di cimentarsi con lesercizio.
Eseguire esercizi di questo tipo senza avere un efficien-
te grado di apertura influenza negativamente il gesto
motorio, che si assesta insegnando agli arti coinvolti a
lavorare in situazione di brevit muscolare, anzich lungo
lintero raggio.
Un sartorio o un flessore dellanca troppo retratti non
permettono unaccosciata fluida, influenzando negativa-
mente il baricentro e creando una cattiva abitudine a
chiuderci sempre di pi.
Il tempo da dedicare relativo al tuo grado di prepa-
razione, ad ogni modo, 10-15 minuti di esercizi di mobi-
lit e di attivazione dovrebbero bastare. buona cosa
cominciare lallenamento con esercizi di mobilit specifica
per lanca, con tempi di tensione ridotta ed esercizi di
mobilit di tipo dinamico (fai oscillare gli arti lungo lin-
tero raggio di escursione controllando il movimento) e
balistico (come lo slancio della gamba frontale a pendo-
lo, aumentando sempre pi lampiezza delle oscillazioni).
Gli allungamenti di tipo rilassato, cio dove mantie-
ni le posizioni per detensionare la muscolatura, riservali
alla fine dellintero work-out. Tienici aggiornati e buon
allenamento!
20 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
buona cosa cominciare lallenamento
con esercizi di mobilit specifica per
lanca, con tempi di tensione ridotta ed
esercizi di mobilit di tipo dinamico e
balistico.
C
h
r
i
s
t
i
n
a

V
a
r
g
a
s
-

F
o
t
o
:


M
i
c
h
a
e
l

N
e
v
e
u
x
PESI, BILANCIERI, ATTACCHI SPECIALI PER CAVI, ATTREZZI
SPECIALI, MICROCARICHI, QUADRA BAR, KETTLEBELL E...
TUTTO CI CHE SERVE
A CHI SI ALLENA SUL SERIO!
Distribuito in Europa da Olympians S.r.l.
Figline Valdarno (FI) tel 055 958058 fax 055 958255
www.olympianstore.it
22 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
MASSIMO
IMPATTO
PER VEDERE LAMBIENTE
URBANO DI ROB RICHES A
LOS ANGELES, GUARDATE IL
SUO VIDEO UTILIZZANDO
QUESTO CODICE SMART PHONE.
Copyright 2012 by Robert Kennedy Publishing
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 23
CON TUTTI QUEI MUSCOLI, SAI
FARE QUALCOSA DI UNICO?. Ecco
la domanda che abbiamo posto a
Rob Riches nel corso di un servi-
zio fotograco per Reps!. Questa
la sua risposta: una essione sulle
braccia con propulsione verso lalto
e battito di mani dietro la schiena.
Osservate lintensit di Rob, guardate
che altezza, che concentrazione e
non ha nemmeno sbattuto la faccia
sul pavimento. Lettore di Reps!, cosa
possono fare i tuoi muscoli funzio-
nali? Inviate le vostre fotograe a
editorial@repsmag.com.
FOTO DI CORY SORENSEN
DA NON PERDERE!!!
I LIBRI PI VENDUTI:
LA GUIDA ILLUSTRATA PASSO PER PASSO
AL PERFEZIONAMENTO DELLESECUZIONE DEGLI ESERCIZI
PER I MASSIMI RISULTATI SENZA INFORTUNI
Tutto quello che
dovete sapere sulla corretta
Tecnica di
allenamento
con i pesi
TERZA EDIZIONE
RIVISTA E AGGIORNATA
363
FOTO
Stuart McRobert
LA SCIENZA DEL NATURAL
BODYBUILDING
DI CLAUDIO TOZZI
DECIMA RISTAMPA
2 EDIZIONE AGGIORNATA
560 pagine
Cod. L44N
29,00
DCSS
TRAINING SYSTEM
DI PAOLO EVANGELISTA
TEORIA E PRATICA
PER OTTENERE
IL MEGLIO CON I PESI
700 pagine
COD. L118
39,00
TECNICA DI
ALLENAMENTO
CON I PESI
DI STUART MCROBERT
NUOVAMENTE
REVISIONATO DA
STUART McROBERT.
320 pagine
COD. L22N
25,00
SCONTO
SU TUTTO
RICHIEDILA A SOLI 20
IL CATALOGO ONLINE CON
15%
RICHIEDILI SUBITO!!!
SCONTO DEL 15%
P
H
O
T
O


r
s
t
r
e
p
Picco del bicipite
Uno dei movimenti di rinitura migliori per i
bicipiti il curl di concentrazione che allena il
capo lungo del muscolo. Fra le varie versioni
esistenti, questa coinvolge vari muscoli di
stabilizzazione del tronco perch, per stare
in equilibrio, dovrete appoggiare la mano non
allenata sulla coscia della gamba che resta
indietro. Per evitare di oscillare troppo, dovrete
bloccare il pi possibile busto e articolazioni.
ISTRUZIONI
1) Piegatevi in avanti, tenendo la spina dor-
sale dritta (cio senza inarcare la schiena).
2) Appoggiate il gomito allenato
contro i muscoli della parte interna della
coscia, non contro il ginocchio.
3) Nel punto alto del curl, ruotate il mi-
gnolo verso il petto e, intanto, contraete con
forza il muscolo; in questo modo aumentere-
te ulteriormente la contrazione massima.
M
O
D
E
L
L
O


F
R
A
N
K

J
O
N
E
S

D
I

P
A
U
L

B
U
C
E
T
A


r
s
t
r
e
p
Copyrighted 2012 by Robert Kennedy Publishing
24 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
26 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
I
N

A
L
T
O
:

M
O
D
E
L
L
O

K
U
R
T

W
E
B
E
R

D
I

M
I
C
H
A
E
L

B
U
T
L
E
R
;

LO STRAPOTERE DEGLI ALLENATORI
Se avete bisogno di un personal trainer per raggiungere i vostri obiettivi di tness,
importante fare qualche ricerca prima di sceglierne uno. Uno studio canadese recente
ha mostrato che il 53,9% degli allenatori esaminati era laureato, anche se non necessa-
riamente in una disciplina collegata alla salute e il 15% aveva una certicazione come
personal trainer, mentre tutti gli altri (poco pi del 31%) ne avevano conseguito pi di
una i numeri non mentono. Tuttavia, oltre la met di questi allenatori offriva consulenze
non pertinenti alla loro area di esperienza e professione. Conclusione: non afdatevi a
un allenatore per tutte le vostre esigenze siche e psicologiche ( molto probabile che
non sia n un medico, n uno psichiatra). Per un programma completo di allenamento e
alimentazione, cercate informazioni (ad esempio leggendo sempre Olympians News) e
rivolgetevi a esperti nei vari campi.
Secondo la U.S. Food and
Drug Administration e un
sondaggio interattivo della
Harris, tanti sono i milioni
di statunitensi che hanno
almeno un tatuaggio. Ora,
molti hanno sollevato il pro-
blema dei possibili rischi
per la salute prodotti dallu-
so di inchiostri contaminati
(a quanto pare, sarebbero
usati in molti negozi) che
conterrebbero qualsiasi
cosa, da noti cancerogeni
a metalli pesanti.
45
% approssimativa
Variazione del peso corporeo
Flessioni standard 65%
Piedi appoggiati su una pedana di 30 cm 70%
Piedi appoggiati su una pedana di 60 cm 75%
Mani appoggiate su una pedana di 30 cm 55%
Mani appoggiate su una pedana di 60 cm 40%
Carponi 50%
Migliorate la
prestazione nelle
essioni sulle braccia
Quanta resistenza usate effettivamente
nelle essioni? Un nuovo studio
pubblicato sul Journal of Strength
and Conditioning Research presenta
le percentuali seguenti. Per imparare
come fare le essioni a un braccio,
andate a pag. 29.


r
s
t
r
e
p
QAllenamento
28 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Con un peso di 350 g per scarpa (meno di 4 mazzi di
carte da Texas Hold Em), le Mizuno Wave Enigma
sono dei veri fenomeni, specialmente perch miglio-
rano moltissimo la sensazione del piede sulla strada.
Grazie alla wave technology brevettata dalla Mizuno
(un paio di suole dotate di speciale essibilit per
tutta la loro lunghezza), ogni volta che appoggiate
il piede a terra sentirete una leggera sensazione di
propulsione, un fenomeno difcile da descrivere,
ma che si percepisce chiaramente. Se ne do-
vrebbero accorgere anche gli atleti dal passo
pi pesante, sia quando bruciano calorie sul
tapis roulant, sia quando camminano.
La tomaia delle Wave Enigma composta
di maglia leggera e traspirante, coperta da un
sofce rivestimento in camoscio che, pur es-
sendo essibile, riesce a trasmettere una forte sen-
sazione di stabilit che fornisce supporto e comodit,
specialmente durante affondi, leg press o squat. Se
il gergo tecnico usato ossessivamente da alcuni
patiti della corsa con gambe sottili come stec-
che non vi familiare (pensate a concetti come
falcata troppo lunga, correre appoggiando a terra
solo la punta dei piedi o la moda attuale di correre a
piedi scalzi o con scarpe dal design minimalista), queste
splendide scarpe potrebbero essere la calzatura ideale
per la palestra e laerobica. 128,00; Mizuno.com
2/0/2
stato scoperto che questa ca-
denza di allenamento (2 secon-
di gi, zero pausa, 2 secondi
su) permette di aumentare la
quantit totale di lavoro svolto
(cio carichi e ripetizioni) pi
della cadenza 2/0/4. Tuttavia,
le risposte metaboliche e or-
monali sono state simili con
entrambe le cadenze, quindi
scegliete quella che preferite,
ma ricordate che la variet
sempre uno dei segreti per una
crescita prolungata. Se deci-
dete di spostare il carico pi
lentamente per aumentare il
tempo totale sotto tensione,
sappiate che, probabilmente,
dovrete usare carichi un po
pi leggeri.
G
R
E
G
O
R
Y

J
A
M
E
S


F
R
A
N
C
E
S
C
O

R
I
D
O
L
F
I

/
i
S
T
O
C
K
P
H
O
T
O
.
C
O
M


r
s
t
r
e
p
Scontro
generazionale
Due uomini entrano in un bar. Uno un
20enne pigro e laltro un 50enne che si allena
in palestra. Chi pi in forma? Istintivamente,
potreste rispondere che il ventenne sem-
plicemente perch pi giovane, ma molto
probabile che sbagliereste.
Secondo una ricerca del K.G. Jebsen Cen-
ter of Exercise in Medicine della Norwegian
University of Science and Technology, il livello
di attivit sica svolto uno degli indicatori
migliori della forma sica generale. Tuttavia, se
avete 50 anni non aspettatevi che basti fare
qualche allenamento frettoloso ogni settimana.
Il fattore decisivo sempre lintensit, quindi
pi dura la sessione, maggiori sono i risultati.
Inoltre, lo studio ha scoperto che aumenta-
re la frequenza e lintensit dellallenamento
riduce i fattori di rischio per diabete, ictus e
malattie cardiache. Quindi, o vi allenate seria-
mente o ringiovanite di 20 anni!
Provate subito uno dei semplici trucchi
seguenti per aumentare lintensit
1) Fate intervalli pi brevi fra le serie e gli esercizi.
2) Eseguite la parte eccentrica di ogni ripetizione
pi lentamente.
3) Aumentate il carico.
4) Aumentate il numero delle ripetizioni.
5) Fate una serie a scalare nellultima serie di ogni esercizio
per una data parte corporea.
PIEDI SUPERDINAMICI
Mizuno Wave Enigma
QAllenamento
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 29
Qtraining


S
H
U
T
T
E
R
S
T
O
C
K
P
E
R

G
E
N
T
I
L
E

C
O
N
C
E
S
S
I
O
N
E

D
I

Y
O
U
T
U
B
E
.
C
O
M
IL FUTURO DEI MUSCOLI QUI?
Latleta che pratica esercizi con peso corporeo e si rma con il nome Hanni-
bal for King ha, probabilmente, il rapporto pi straordinario fra forza e peso
corporeo che avrete mai occasione di vedere. Hannibal usa i muscoli della parte
superiore del corpo in modi arditi e incredibili e rappresenta un trend in crescita
nella realt urbana: la capacit di eseguire prove muscolari straordinarie (spesso
in ambito agonistico) usando solo ci che si trova nei parchi gioco (non stiamo
parlando di pesi liberi). A quanto pare, le prove di forza di questo tipo potrebbero
essere lequivalente contemporaneo di quei giorni eccitanti degli anni 50 vicino
al pontile di Santa Monica in cui esercizi di equilibrio sulle mani o agli anelli an-
davano di pari passo con muscoli costruiti alla perfezione. Con Hannibal for King
avete tutto questo e molto di pi. Per vedere di cosa stiamo parlando, basta pas-
sare allo scanner dello Smart Phone il codice QR qui a anco: rimarrete a bocca
aperta. Il futuro appartiene alla muscolatura funzionale, come quella di Hannibal?
(A proposito, il video accompagnato dalla voce di un rapper serbo).
Prove di forza alla portata di tutti
IMPARATE A FARE LE
FLESSIONI A UN BRACCIO
Eseguire le essioni a un braccio non una cosa
facile, ma si pu imparare e, una volta appresa
la tecnica, diventa unimpresa di grande effetto.
Per riuscire a eseguire questo movimento, non
dovete per forza avere unesperienza ginnica
(con parallele, anelli e simili), basta seguire le
semplici istruzioni qui a anco. Dopo circa 6
settimane di pratica regolare, diventerete un
esempio per gli altri (e, magari, rimarrete stupi-
ti della vostra abilit).
Robert Kennedy, Editore
Fase 1: ogni 2 giorni,
allenatevi nelle essioni a
due braccia, eseguendo 2
serie con il maggior nume-
ro di ripetizioni possibile
in ogni sessione. Braccia
e piedi devono essere leg-
germente pi distanti delle
spalle. Quando riuscite a
eseguire una serie singola di
25-50 ripetizioni di essioni
standard, passate alla fase
successiva.
Fase 2: posizionatevi
come nelle essioni stan-
dard, poi, mentre abbas-
sate il busto, spostate il
peso verso il vostro lato pi
forte (in genere, abbiamo
tutti un lato dominante),
in modo da aumentare la
tensione e allenare pi
bre muscolari in quella-
rea. Mentre vi risollevate
per tornare con le braccia
tese, cercate di fare forza
soprattutto sul braccio
dominante. Ripetete no
allincapacit. Continuate
ad allenarvi in questo modo
a giorni alterni per 3 setti-
mane: lobiettivo eseguire
3 serie no allincapacit
per sessione.
Fase 3: posizionatevi
come nelle essioni stan-
dard, ma aumentate la
distanza fra i piedi (circa
30 cm pi del normale).
Chiedete a vostra moglie,
alla vostra ragazza o al
compagno di allenamento
di stare a gambe divaricate
sopra il vostro punto vita,
reggendo le estremit di
un asciugamano che
stato fatto passare sotto il
vostro busto, come unim-
bracatura.
Sostenetevi sul braccio
pi forte, o dominante,
mantenendo il corpo rigi-
do; poi, appoggiate la mano
del lato non dominante
sulla parte alta della gam-
ba, nellarea del posteriore
della coscia. Abbassatevi il
pi possibile e, poi, cercate
di sollevarvi e tornare alla
posizione iniziale. Men-
tre ci provate, il vostro
compagno deve tirare
leggermente le estremit
dellasciugamano in modo
che possiate stendervi
completamente. Eseguite
6 serie di 3 ripetizioni per
2 settimane. A quel punto,
dovreste essere in grado
di eseguire una essione a
un braccio perfetta e fare
colpo sugli astanti.
Allenamento su
HANNIBAL FOR KING
8.794
Numero di essioni a un braccio
eseguite in 5 ore da Paddy Doyle per
entrare nel Guinness dei Primati.
QAllenamento
un progetto
13
th
Expo and International Congress
for Fitness, Wellness & Aquatic Clubs
23-24-25 febbraio 2012
Fiera di Bologna
www.forumclub.it
Avanti veloce
Il mercato, la formazione, le novit del fitness: tutto al ForumClub.
Vietato restare indietro. Il mondo del fitness si muove rapido, ForumClub l'occasione per rimanere al
passo. Anche nel 2012 l'appuntamento per i professionisti alla Fiera di Bologna, per scoprire le ultime
novit del fitness, delle palestre e delle spa. Tutto quello che c' da vedere e da sapere qui: ci sono i convegni
e i seminari con i migliori specialisti per approfondire le tendenze del mercato; c' l'esposizione per scoprire
attrezzature, prodotti, accessori e tutte le novit del settore. In contemporanea, negli stessi padiglioni, si tiene
ForumPiscine, l'appuntamento internazionale dedicato a piscine e centri acquatici. Due eventi per
conoscere due mondi sempre pi vicini.
Segreteria organizzativa:
ABSOLUT eventi&comunicazione - tel. +39 051 272523 - fax +39 051 272508
Segreteria scientifica e vendita stand:
EDITRICE IL CAMPO srl - tel. +39 051 255544 - fax +39 051 255360 - forum@ilcampo.it
in collaborazione con: top sponsor:
32 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T


i
S
T
O
C
K
P
H
O
T
O
.
C
O
M
Sete,
ragazzi?
Vi allenate regolarmente
e, di solito, seguite una
dieta salubre e bilanciata,
quindi le uscite del vener-
d sera con gli amici o il
rito della partita della do-
menica non hanno grandi
ripercussioni sul vostro
sico, giusto? Sbagliato.
Prima di scolarvi un altro
bicchiere, date unocchia-
ta alle notizie qui sotto:
150 quantit approssima-
tiva di calorie contenuta in
una birra (per bruciare una
lattina di birra, a un uomo
di 90 kg servono circa 18
minuti di allenamento leg-
gero alla cyclette).
5 allincirca il prezzo
che pagate per ogni drink
che potrebbe danneggiare
la vostra salute.
45 numero di drink con-
siderato eccessivo dai
Centers for Disease Con-
trol and Prevention (CDC).
Ehi, ragazzi, meno di una
confezione da sei lattine!
Volete forticare il corpo contro infortuni e malattie? La
palestra un ottimo posto per riuscirci, ma ci che mangiate
ancora pi importante. Una ricerca recente ha mostrato che
i topi cui era stata somministrata una dieta povera di verdure
correvano un rischio maggiore di soffrire di malattie e infortu-
ni, oltre a impiegare pi tempo per guarire rispetto agli animali
che, invece, avevano ricevuto una dieta ricca di vegetali. Gli
scienziati ipotizzano che le diete povere di verdura compro-
mettano un tipo di cellule protettive intestinali e cutanee chia-
mate linfociti intraepiteliali (o IEL). Quindi, colorate di verde
i vostri piatti mangiando spinaci, cavolo verde, broccoli e vari
tipi di lattuga con foglia verde scuro. Cos, otterrete il massimo
dai vostri sforzi in palestra e ridurrete il rischio di infortuni.
Costo approssimativo di una sola seduta di terapia a base di plasma
ricco di piastrine (PRP) che, grazie alle sue propriet antiinammatorie
potenti, dovrebbe stimolare la produzione di collagene per la guarigio-
ne delle ferite (pensate al tessuto articolare). Il trattamento consiste di
pi sessioni con PRP e, secondo dimemag.com, Kobe Bryant dei Los
Angeles Lakers avrebbe viaggiato no in Germania per provare questo
nuovo procedimento misterioso. Naturalmente, lui se lo pu permettere.
Passando alle tecniche pi economiche, forma di esecuzione cor-
retta, tempo di recupero adeguato dopo le sessioni e assunzione degli
integratori giusti per potenziare unalimentazione bilanciata sono accor-
gimenti semplici che possono fare molto per aiutare tutti noi che guada-
gniamo meno di 25.000.000 $ a stagione e in banca non abbiamo un
conto netto di 140 milioni di dollari per prevenire o limitare gli infortuni
alle articolazioni.
Mangiate
pi verdura
$
6
.
0
0
0


r
s
t
r
e
p
QSalute
34 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
I
N

A
L
T
O

A

S
I
N
I
S
T
R
A
:


i
S
T
O
C
K
P
H
O
T
O
.
C
O
M
;

M
O
D
E
L
L
O

M
A
T
T
H
E
W

B
U
C
U
R

D
I

M
I
C
H
A
E
L

B
U
T
L
E
R
Avete problemi di pelle? Potrebbe essere ora di rive-
dere il tipo e la quantit di proteine animali contenuti
nella vostra dieta. La dott.ssa Lisa Airan, specialista in
dermatologia estetica di New York, avverte dei pericoli
delle diete molto ricche di carne rossa. Un eccesso di
grassi animali pu aumentare la produzione di radicali
liberi che si ritiene possano interferire con il funziona-
mento cellulare normale, spiega. Il risultato pu esse-
re un rilassamento della pelle, e questo non certo un
buon biglietto da visita per chi vanta pance muscolari
grosse. La Airan consiglia di ridurre un po il consumo
di carne rossa e cercare di assumere una quantit ade-
guata di acqua (per chi si allena regolarmente come voi,
circa 4 l al giorno).
Curare il
diabete con
una pillola?
Forse abbiamo una buona no-
tizia per chi soffre di diabete.
Secondo uno studio pubblicato
su Cell Metabolism, i ricercatori
della Washington University
School of Medicine di St. Louis
(MO) potrebbero aver gettato
le basi per la cura o persino per
la prevenzione del diabete. Gli
scienziati hanno scoperto che, nei
topi diabetici, la somministrazione
di una sostanza naturale chiamata
mononucleotide nicotinamide (o
NMN) ha migliorato notevolmente
o, addirittura, normalizzato del
tutto la risposta al glucosio.
necessario proseguire le ri-
cerche (soprattutto sul diabete di
tipo 2, la forma della malattia che
dura per tutta la vita), ma mante-
nendo il vostro peso nella nor-
ma, adottando un programma
di allenamento che comprenda
sia aerobica, sia esercizi con
opposizione di resistenza e
seguendo unalimentazione
salubre potete ridurre molto
il rischio di sviluppare questa
malattia metabolica. In questo
caso, la medicina preventiva
nelle vostre mani.
Proteggete la pelle


r
s
t
r
e
p
QSalute
12
Miliardi di tonnellate
di manzo mangiati
negli Stati Uniti
nel 2010.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 35
T
O
P

L
E
F
T
:


i
S
T
O
C
K
P
H
O
T
O
.
C
O
M
;

R
O
B
E
R
T

R
E
I
F
F
MIGLIORATE IL
METABOLISMO
Quando saltate la colazione
il vostro metabolismo ne
subisce le conseguenze per
tutto il resto della giornata.
I ricercatori della University
of Nottingham hanno fatto
fare colazione a un gruppo
di soggetti e lhanno fatta
saltare a un altro. Poi, a
pranzo, entrambi i grup-
pi potevano mangiare
quanto volevano. Bene,
chi aveva fatto colazio-
ne ha assunto il 17% di
calorie in meno.
Ma non nita qui. In
unaltra parte dello studio,
dopo lora di colazione i
ricercatori hanno sommini-
strato a entrambi i gruppi
una bevanda a base di pro-
teine del siero e, poi, hanno
condotto delle analisi del
sangue. Dopo aver assunto
la bevanda, chi non aveva
fatto colazione aveva livelli
ematici di zuccheri pi alti
dei soggetti che, invece,
lavevano fatta.
Questo studio dimostra
che saltare la colazione
esercita un effetto negativo
potente sia sullappetito, sia
sul metabolismo. Quindi,
ecco la conclusione: facen-
do tutti i giorni una colazione
completa potete rimanere
magri e ridurre il rischio
di aumento degli zuccheri
ematici. Per altri metodi per
migliorare il metabolismo,
andate a pag. 126.
Un piccolo
frutto
che apporta
grandi beneci
Recentemente i ricercatori della University of Western Ontario
hanno scoperto che il avonoide Nobiletin, contenuto nei manda-
rini, esercita un effetto protettivo contro una serie di anormalit
metaboliche: colesterolo e trigliceridi alti, livelli ematici elevati di
insulina e glucosio, e fegato grasso. In studi pi prolungati su topi,
il Nobiletin ha persino ridotto laccumulo di placca nelle arterie.
Fino a che non saranno svolte altre ricerche, forse mangiare un
paio di mandarini al giorno (disponibili soprattutto fra ottobre e
febbraio) non vi dar gli stessi risultati, ma questo non deve fer-
marvi: un mandarino piccolo fornisce l87% del valore giornaliero
(VG) per la vitamina C, che potenzia moltissimo il sistema im-
munitario, e il 27% del VG per la vitamina A che protegge la vista,
stimola la formazione di dentina (il rivestimento duro sulla super-
cie dentale) e agisce come antiossidante potente che combatte i
radicali liberi, compresi quelli prodotti dallattivit sica intensa.
$
150
Approssimativamente questo il costo annuale delle cure
mediche per lobesit negli Stati Uniti. Recepito il messaggio?
ora di fare qualcosa: per migliorare la salute generale, rendete pi
salubre la dieta, siate pi attivi e fate attenzione al vostro corpo.
E, se seguite gi lo stile di vita di Olympians News, continuate cos.
miliardi
di dollari
QSalute
Salsa di
pomodoro
rapida in
22 minuti
Ricetta: Alison Kent
Questa salsa di pomodoro batter
la maggior parte delle versioni pre-
confezionate che trovate nei negozi.
Potete usarla per quasi tutte le
ricette di pasta (a parte quelle con
panna.
INGREDIENTI PER LA SALSA DI
POMODORO SEMPLICE E VELOCE
2 cucchiai di olio doliva
1 cipolla, spezzettata
3 spicchi daglio, tritati
1 lattina, bottiglia o confezione
da 80 cl di pomodori tagliati a
dadini, senza sale
3 cucchiai di concentrato
di pomodoro senza sale
di cucchiaino ciascuno di sale
marino e pepe nero fresco maci-
nato
1 foglia grande di basilico fresco
(facoltativo)
INPREPARAZIONE: scaldate lolio
in una padella di media grandezza,
a amma media; poi, aggiungete
laglio e la cipolla. Fate saltare,
mescolando no a farli ammorbidire
(circa 2 minuti). Unite i pomodori, il
concentrato di pomodoro, il sale, il
pepe e il basilico (se presente). Por-
tate a ebollizione, poi abbassate il
fuoco e lasciate sobbollire, coperto,
per 10 minuti. Togliete il coperchio
e continuate a far sobbollire, mesco-
lando occasionalmente, no a che
la salsa leggermente addensata
(circa 10 minuti).
36 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
M
O
D
E
L
L
O
:

D
I
E
G
O

S
E
B
A
S
T
I
A
N

D
I

C
O
R
Y

S
O
R
E
N
S
E
N
;


i
S
T
O
C
K
P
H
O
T
O
.
C
O
M
Vi piacerebbe riuscire a preservare pi muscolo duran-
te laerobica? Presumendo che la risposta sia s, potre-
ste iniziare sorseggiando una bevanda ricca di leucina
durante la vostra prossima sessione sul tapis roulant.
Una ricerca condotta dallesercito degli Stati Uniti ha
scoperto che, assumendo 1,8-3,5 g di leucina durante
una sessione alla cyclette, la sintesi proteica muscolare
dei soggetti aumentata del 33%. Questo aminoacido
pu essere un aiuto prezioso per chi cerca di dimagrire
con laerobica, proteggendo il pi possibile i muscoli.
Per una spiegazione pi completa del perch la leucina
dovrebbe fare parte del vostro programma nutriziona-
le, leggete Macchina Magra a pag. 124.
Proteggete i muscoli
Percentuale della dose giornaliera
raccomandata di ferro contenuta in una
sola tazza di spinaci cotti. Il ferro
essenziale per aumentare
lenergia e migliorare la
prestazione sica, inoltre favorisce
la produzione di globuli rossi e il trasporto
dellossigeno al tessuto muscolare.
35


r
s
t
r
e
p
QAlimentazione
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 37


i
S
T
O
C
K
P
H
O
T
O
.
C
O
M
TABELLA NUTRIZIONALE DEL LATTE, VALORI MEDI PER 24 cl
TIPO DI LATTE CALORIE PROTEINE (G) GRASSI (G) GR. SATURI (G)
Intero (3,5% di panna) 149 8 7.9 5
Povero di grassi (2% di panna) 122 8 4.8 3
Molto povero di grassi (1% di panna) 102 8 2.4 2
Privo di grassi (scremato) 83 8 0.2 0
QUAL
IL LATTE
MIGLIORE
PER PERDERE
GRASSO?
Se credete che bere latte ma-
gro invece di quello intero vi aiu-
ti a dimagrire, ripensateci. Uno
sguardo alla tabella qui a anco
rivela che il latte magro contiene
molte calorie e oltre il 50% dei
grassi contenuti nel latte intero.
Per ottenere beneci dai vostri
sforzi per perdere grasso e
proteggere la salute cardiaca, la
cosa migliore bere latte molto
povero di grassi (1%) o, ancora
meglio, privo di grassi.
Mangiate pi
cibi rossi!
Pensate ai peperoni
rossi dolci come a
mini fabbriche per la
salute. Oltre a fornire
quasi il 300% della
dose giornaliera di
vitamina Ce oltre il
100% di quella di vita-
mina A, una sola tazza
contiene quasi 30
tipi di carotenoidi,
sostanze naturali che
migliorano lattivit del
sistema immunitario
e agiscono come
antiossidanti che
proteggono il cor-
po contro i danni
dei radicali liberi
(alcuni dei qua-
li sono prodotti
dallattivit sica
intensa e prolun-
gata, oltre che dai
soliti colpevoli: fumo
di sigaretta, anche
passivo, inquinanti am-
bientali specialmen-
te se vivete in citt
inquinate stress e
luce del sole). Inoltre,
i carotenoidi possono
aiutarvi a contrastare
le malattie cardiache
perch riducono la
formazione del cole-
sterolo LDL (quello
pericoloso). facile
aggiungere i peperoni
a insalate, omelette e
sughi per la pasta.
I
N
T
E
R
O

2
%
1
%
S
C
R
E
M
A
T
O
C
A
L
O
R
I
E

(
p
e
r

2
4

c
l
)
TIPO DI LATTE
149
83
QAlimentazione
38 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
La prossima volta che mangiate linsalata, aggiungeteci una
manciata di pistacchi senza sale, cos sarete sicuri che i muscoli
allenati ricevano tutti i nutrienti assunti dopo lallenamento
per proteggere il cuore e mantenere aperte le arterie. Infatti, i
risultati di una serie di ricerche pubblicati sul Journal
of Nutrition rivelano che le diete che contengono
ogni giorno i pistacchi (no a 85 g, cio circa
150) hanno aumentato i livelli ematici di beta-
carotene, luteina (essenziale per la salute degli
occhi) e gamma-tocoferolo. Questi 3 antiossi-
danti potenti possono ridurre e, forse, anche
evitare che il colesterolo LDL si ossidi e,
poi, sotto forma di placca, attacchi le pareti
delle arterie. I ricercatori hanno osservato
beneci gi dopo 4 settimane e, per i let-
tori questo signica pompaggio migliore,
crescita muscolare efciente e salute
cardiaca a lungo termine. Che cosa state
aspettando?
Costruite muscolo con i pistacchi
M
O
D
E
L
L
O

J
A
M
E
S

E
L
L
I
S

D
I

R
O
B
E
R
T

R
E
I
F
F
;


M
A
L
C
O
L
M

R
O
M
A
I
N

/
i
S
T
O
C
K
P
H
O
T
O
.
C
O
M


r
s
t
r
e
p
Una ricerca recente della University of Toronto suggerisce che
sostituire ogni giorno carboidrati pi comuni con 55 g di frutta
secca a guscio pu fare molto per contrastare il diabete di tipo 2.
Il ricercatore capo dello studio, dott. David Jenkins, spiega che,
La frutta secca mista a guscio, senza sale, cruda o
tostata migliora sia il controllo sul glucosio, sia quello
sui lipidi ematici e mangiarla pu essere un buon metodo per
tenere meglio sotto controllo il diabete, senza ingrassare.
aspettando?
50 G DI FRUTTA
SECCA MISTA A
GUSCIO
QAlimentazione
45
Percentuale di riduzione dellaumento di peso quan-
do i topi che seguivano una dieta ricca di grassi
hanno ricevuto anche EGCG (epigallocatechina-
3-gallato), lingrediente attivo del t verde. La ricerca
stata pubblicata su un numero recente di Obesity.
Lezione per gli uomini: per riuscire a perdere grasso,
assumete 500 mg di un integratore di estratto di t
verde, 3 volte al giorno prima dei pasti.
WWW. OLYMPI AN. I T
Come dire basta agli
spuntini, sin da oggi
Sapete gi che le proteine stimolano la costruzione di mu-
scolo e che i muscoli bruciano calorie, ma la quantit di
proteine assunte essenziale per aiutarvi a restare magri a
lungo perch allevia la voglia di fare spuntini a base di cibi
meno salubri (come il cibo spazzatura e i dolciumi pieni
di calorie vuote). I ricercatori hanno scoperto che, in 4
giorni, i soggetti che seguivano una dieta povera di protei-
ne (10% delle calorie totali) hanno assunto il 12% di calorie
in pi rispetto a quanto accaduto quando hanno ricevuto
una dose lievemente pi alta di proteine. Per ridurre la
voglia di cibo fra i pasti e mantenere i guadagni muscolari
costanti, cercate di assumere ogni giorno 2 g di proteine
per chilogrammo di peso corporeo e di ingerire proteine
in ognuno dei 6-7 pasti e spuntini giornalieri.
Pi
massa con
la senape?
La prossima volta che condite
il vostro panino al tacchino,
ricordatevi di aggiungere una
doppia dose di senape. Una
nuova ricerca pubblicata sul
FASEB Journal mostra che
lhomobrassinolide (una forma
di brassinosteroide contenuto in
piante come la senape) esercita
un effetto stimolante
sulla sintesi proteica
muscolare, la massa
muscolare e la prestazione
sica.
6
Secondo uno studio
recente della Norwegian
University of Science and
Technology, questi sono
i giorni impiegati da una
dieta ricca di carboidrati
per aumentare
linammazione
sistemica, incrementando
il rischio di malattie
cardiovascolari, diabete di
tipo 2, cancro e demenza.
I ricercatori hanno suggerito
che meglio distribuire
uniformemente le calorie
nellarco della giornata,
cio fare 3 pasti bilanciati
e 2-3 spuntini per
bilanciare i macronutrienti.
M
O
D
E
L
L
O

D
E
R
E
K

D
U
S
Z
Y
N
S
K
I

D
I

R
O
B
E
R
T

R
E
I
F
F
Olympians News / SUPER FITNESS 39
QAlimentazione
40 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Se volete migliorare il modo in cui il vostro corpo meta-
bolizza il cibo, provate ad aggiungere curcuma, cannel-
la, pepe nero, chiodi di garofano e altre spezie ai vostri
piatti. Il Journal of Nutrition riporta che alcuni uomini
di 30-65 anni hanno mangiato un pasto speziato pre-
parato con rosmarino, origano, cannella, curcuma, pepe
nero, chiodi di garofano, aglio in polvere e paprika,
mentre altri hanno ricevuto un pasto di controllo, senza
le spezie. La miscela di spezie ha aumentato lattivit
antiossidante ematica del 13% e ha ridotto di circa il
20% la risposta allinsulina.
Migliorate la risposta
allinsulina con le spezie
Ora, provate questo
A volte, seguire una dieta per la costruzio-
ne muscolare pu signicare monotonia in
cucina, soprattutto se siete golosi. Se limi-
tate luso degli edulcoranti articiali, forse il
vostro menu diventer ancora pi insapore,
ma gli scienziati potrebbero aver scoperto
un modo per dolcicare i cibi, senza usare
lo Splenda. Un nuovo rapporto pubblicato
su Trends in Pharmacological Sciences
suggerisce che le piccole molecole che
regolano i recettori per i sapori dolci nel
corpo potrebbero trasmettere il vero
sapore dello zucchero, senza bisogno
dei dolcicanti esistenti. Non sappiamo
esattamente che cosa sia un modulatore
allosterico positivo, ma in futuro speriamo
di trovarne di pi nei nostri dolci con ridotto
contenuto di zuccheri.
Comunque, no a che non ne sapre-
mo di pi, meglio evitare gli edulcoranti
articiali. Secondo uno studio recente,
sembra che bere due sole bevande
con dolcicanti articiali al giorno basti
ad aumentare il giro vita del 70% in pi
di quanto avvenga non bevendo bibite
dietetiche. Questo dato conferma i risultati
di uno studio del 2005 dello University of
Texas Health Science Center di San Anto-
nio, secondo il quale ogni bibita dietetica
che beviamo al giorno aumenta del 65%
la possibilit di diventare sovrappeso nei 7
anni successivi.
Quindi, lasciate perdere gli edulcoranti
articiali che, a quanto pare, ostacolano il
raggiungimento dei vostri obiettivi di tness
e allenamento, e iniziate a bere pi acqua.
Asse sul tapis roulant


i
S
T
O
C
K
P
H
O
T
O
.
C
O
M
;

M
O
D
E
L
L
O

B
R
A
N
D
O
N

M
Y
L
E
S

W
H
I
T
E

D
I

I
A
N

L
O
G
A
N
D
igitate asse su
YouTube e troverete
un fenomeno che
conta innumerevoli video
divertenti (e molti milioni di
visitatori). In pratica, in questa
versione dellasse dovete
essere rigidi come una tavola
(lavete capita, asse-tavola!)
e, poi, dovete posizionare la
vostra carcassa immobile su
un oggetto insolito. Durante
una seduta fotograca recente
di Reps! abbiamo chiesto
a Brandon Myles White di
eseguire lasse per noi e
qui accanto potete vedere
ci che ha fatto in palestra.
Inviate la foto del vostro
asse a editorialrepsmag.
com, scrivendo planking
nelloggetto e potreste
ritrovarvi su Reps!.
provate
QAlimentazione


r
s
t
r
e
p
questasse!
42 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Pensavamo che vi
sarebbe piaciuto
vedere
ALTEZZA: 167 cm
PESO: 52 kg
MISURE: 86-64-88
OCCHI: verdi
CAPELLI: neri
ANNI DI ALLENAMENTO: 8
LUOGO DI NASCITA: Transilvania, Romania
RESIDENZA ATTUALE: Santa Monica, CA
SITO WEB: ancamarcus.com
GARE: 2009 - NPC Orange County
Muscle Classic, Ia; NPC California
State Championships, IIa; 2010
IFBB Bikini Tournament of Champions,
IIIa; 2011 IFBB Muscle Contest,
5
a
e nalista allOlympia.
Le caratteristiche
che mi vengono in
mente sono: atletico,
in forma, sicuro di
s e determinato.
Aiuta se rude fuori,
ma dentro ha un
cuore doro.
Anca
Marcus
CHE COSA
RENDE UN
UOMO SEXY?


r
s
t
r
e
p
Troverete pi di 2.000 prodotti online
MUSCLE MEALS
Concentrato del siero del latte, caseina micellare,
proteine dellalbume delluovo, ricco di lattoferrina,
carboidrati con basso indice glicemico, peptidi della
glutamina, forticato con una miscela bilanciata di sali
minerali e vitamine. Dolcicato con sucralosio.
Confezione da 20 buste da 73g.
1 confezione 77,00 46,20
3 confezioni 231,00 115,50
Leggere attentamente le avvertenze e le modalit duso riportate in etichetta.
MUSCLE-LINK
TM
importata e distribuita in Italia da Olympians S.r.l. - divisione dietetici.
RECOVER X
Siero del latte idrolizzato, peptidi della glutamina, carboidrati veloci,
l-arginina, metossisoavone, senza aspartame... solo sucralosio.
Confezione da 1760 g.
1 confezione 72,00 43,20
3 confezioni 216,00 108,00
PRO FUSION
Concentrato di proteine del latte, proteine complete del latte,
caseina micellare, peptidi della glutamina, lattoferrina,
senza aspartame, dolcicato con sucralosio.
Confezione da 907g.
1 confezione 66,00 39,60
3 confezioni 198,00 99,00
C
p
ca
glut
1111 ccc
3 co
0
0
0
,
60
9
te
a,
9,
9
at
na
39
el
rri
o.
3

de
fe
osi

te
tto
alo

let
lat
cra
0
0
mp
a,
uc
.
00
0
om
na
n s
7g 7g
,0
8
c
m
con
0 907
6,
9
N
ne
ta
o c
a 9
66
1
O
ot
a g
ca
ee

SIO
pr
lla
ci
oon

S
e,
de
olc
zzi
eeee
i
US
att
di
d
ffee
nnnn
FU
la
tid
e
oon
oooo
i
F
el
ep
am
CC
zzziii
O
e d
p
rta
ez ez ee
RO
ne
re,
pa
ffff nfe
PR
tei
ar
asp
oonnnn
P
rot
el
a a
oo co co
P
p
ic
za
ccc
3
di
m
en
1111
3
to
na
s
rat
ein
nt
as
ce
ca
onc Co
Visitate i nostri siti www.olympian.it www.olympianstore.it
o chiamate il numero verde 800.776.999
SHAKER IN OMAGGIO CON 3 CONFEZIONI
GUSTI:
CACAO
E VANIGLIA
GUSTO
CREM
A
ALLARAN
CIA
G
U
STI:
CA
CA
O
E
V
A
N
IG
LIA
Sconto
40%
Sconto
50%
Sconto
50%
Sconto
50%
Sconto
40%
Sconto
40%
44 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Principianti 1
D
opo molti anni di
questa rubrica,
voglio concentrarmi
maggiormente sui
principianti. Forse non
siete dei principianti,
per conoscete dei
bodybuilder che stanno
cominciando. Consigliate
loro questo articolo. Se
siete dei principianti,
mettete in pratica i
consigli dati in questo
articolo e risparmiatevi le
frustrazioni e le delusioni
sperimentate da gran parte
dei principianti.
Partire
con il
piede
giusto
Fotografie Michael Neveux / Modello: Spencer Neveux
di STUART McROBERT
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 45
In questa introduzione minimizzo
tutto il materiale teorico
perch voglio prepararvi subito
allallenamento. Presenter il
materiale teorico nei prossimi
articoli.
Prima di tutto, se avete pi di 35 anni, fatevi control-
lare dal medico. Avete bisogno del suo consenso per
intraprendere un programma di allenamento che, in
seguito, diventer molto impegnativo.
Comunque, n da subito, dimenticatevi dei meto-
di di allenamento delle stelle del bodybuilding di oggi.
Questi atleti sono tutti geneticamente dotati spesso
in modo marcato e aiutati dai farmaci. Quello che
funziona per loro completamente diverso da quello
che funziona per i bodybuilder naturali con genetica
nella media.
Il primo allenamento si basa su tre principi.
SEMPLICIT
Tutte le routine efcaci di bodybuilding per gli atleti
naturali e con genetica nella media sono semplici, do-
minate dai grandi esercizi e relativamente infrequenti.
Qualsiasi cosa in pi vi mander in superallenamento.
Il superallenamento non vi far costruire un sico
migliore.
Non confondente le routine di bodybuilding con
le routine organizzate per afnare massa muscolare gi
esistente. Per costruire massa muscolare dovete impe-
gnarvi per molti anni in routine relativamente sempli-
ci. Solo DOPO aver sviluppato una massa muscolare
sostanziale potete prendere in considerazione luso di
altri tipi di routine.
PRIORIT TECNICA
Non costruirete mai un bel sico se subite infortuni.
Per evitare gli infortuni dovete usare la tecnica di ese-
cuzione corretta. Se vi prendete libert con la tecnica
di esecuzione, passerete da un infortunio allaltro e
vi dovrete sempre allenare intorno agli infortuni. Gli
infortuni compromettono o impediscono totalmente il
progresso. La tecnica di esecuzione riguarda la presa, la
distanza dei piedi, la posizione del corpo e il percorso
del bilanciere. Riguarda anche la cadenza e il controllo
delle ripetizioni. Non abbassate mai di colpo un cari-
co. Abbassatelo sempre sotto controllo. Non strattona-
te mai un peso. Spingete e tirate sempre con controllo.
Non fate mai rimbalzare il bilanciere e non utilizzate
mai lo slancio.
Ci sono uomini molto muscolosi che usano il
cheating ricorrendo a tecniche di esecuzione scaden-
ti, per ricordatevi sempre che quelli che possono farla
franca pur prendendosi continuamente libert nella
tecnica (almeno nel breve termine ma non necessaria-
mente nel lungo termine) non sono bodybuilder con
genetica nella media. Hanno una struttura corporea
che pi robusta della vostra. Quello che loro possono
tollerare e addirittura sfruttare a proprio vantaggio,
potrebbe essere la vostra rovina.
CARICHI
DI ALLENAMENTO
PROGRESSIVI
il fondamento del bodybuilding: diventare sempre
pi forti, per serie di almeno sei ripetizioni, usando la
tecnica di esecuzione corretta.
I muscoli pi grossi non sono necessariamente
quelli pi forti e gli uomini pi forti non hanno neces-
sariamente i muscoli pi grossi, per, fra i bodybuilder
nella media, il rapporto fra la forza (per un numero
1
2
3
Non costruirete mai un bel sico
se subite infortuni. Per evitare
gli infortuni dovete usare la
tecnica di esecuzione corretta.
Se vi prendete libert con la
tecnica di esecuzione, passerete
da un infortunio allaltro e vi
dovrete sempre allenare intorno
agli infortuni. Gli infortuni
compromettono o impediscono
totalmente il progresso.
sufciente di ripetizioni) e la massa muscolare in-
negabile. Nella palestra dove vi allenate, quanti sono
quelli fra i pi grossi ma non fra i pi forti? Nella
palestra dove vi allenate, quanti sono quelli forti per
almeno sei ripetizioni per serie che non hanno anche
una massa muscolare decente?
Lasciate perdere gli specialisti della forza pura,
loro si allenano in modo diverso, con obiettivi diversi.
Alcuni di loro possono essere molto forti pur non
avendo muscoli molto grossi.
Il bodybuilding non solo lo sviluppo di muscoli
grossi, per nessun altra cosa molto importante se
non costruite muscoli di dimensione decente. Per
costruire muscoli di dimensione decente necessario
riuscire a usare carichi di allenamento decenti. Se non
aumentate gradualmente i carichi di allenamento con
il passare delle settimane e dei mesi, state facendo
qualcosa di sbagliato e dovete cambiare qualcosa per
far crescere i muscoli.
I carichi di allenamento sono il barometro del
vostro progresso nel bodybuilding. Se i carichi aumen-
tano gradualmente per serie di almeno sei ripetizioni
e usate sempre la tecnica di esecuzione corretta, allora
state facendo bene, indifferentemente da quanto pu
essere radicale il vostro approccio allallenamento rela-
tivamente alla norma nel mondo del bodybuilding.
IL VOSTRO PRIMO
PROGRAMMA
DI ALLENAMENTO
Eseguite questa routine due volte la settimana, in due
giorni distanziati uniformemente, per esempio luned-
gioved o mercoled-sabato.
1. Crunch
(addominali)
2. Squat
(quadricipiti, adduttori, glutei,
parte bassa della schiena)
3. Distensione su panca
(pettorali, deltoidi, tricipiti)
4. Estensione del dorso
(parte bassa della schiena,
posteriori delle cosce, glutei)
5. Trazione alla lat machine
(dorsali, parte alta della schiena,
pettorali, bicipiti, avambracci)
6. Sollevamenti sulle punte dei piedi
(polpacci gastrocnemio e soleo)
Questa routine di soli sei esercizi intenzionalmente
molto semplice, PER IN FUTURO USERETE PI
ESERCIZI. Quella suddetta solo una routine inizia-
le. La gran parte dei principianti comincia con troppi
esercizi.
La qualit dellallenamento pi importante della
quantit. Eseguire sei esercizi correttamente pi im-
portante delleseguire dodici esercizi in modo scorret-
to. Anche se eseguiste i dodici esercizi correttamente,
vi superallenereste, progredendo poco o affatto, esau-
rendo velocemente lentusiasmo per lallenamento.
Voglio che vi alleniate per 20 anni, non che vi bruciate
dopo pochi mesi.
Non concentratevi sullallenarvi duramente per
pochi mesi. I PRINCIPIANTI NON HANNO
BISOGNO DI ALLENARSI MOLTO INTENSA-
MENTE. Lallenamento molto intenso pu addirit-
tura OSTACOLARLI. Al corpo deve essere data lop-
portunit di adattarsi ai rigori dellallenamento con i
pesi intenso. Non pu farlo nel giro di una settimana
o due. Sono necessari alcuni mesi.
Eseguite solo due serie di ogni esercizio, per per il
momento andateci piano (una serie un gruppo di ri-
petizioni; per esempio, 2 x 8 signica due serie di otto
ripetizioni).
46 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
I carichi di allenamento
sono il barometro
del vostro progresso
nel bodybuilding. Se
i carichi aumentano
gradualmente per serie
di almeno sei ripetizioni
e usate sempre la
tecnica di esecuzione
corretta, allora state
facendo bene.
Ecco un riassunto di come eseguire ogni esercizio.
Per ottenere successo nel bodybuilding, dovete stu-
diare quanto prima i dettagli fondamentali dellese-
cuzione degli esercizi. Vi invito a studiare il mio libro
TECNICA DI ALLENAMENTO CON I PESI. Non
voglio fare il venditore, per ho investito molto tempo
ed energie in quel libro per far s che altre persone si
risparmino le sofferenze che ho patito io.
Se in passato non avete mai svolto allenamento
con i pesi, probabilmente la vostra forma di esecuzione
sar incerta inizialmente, specialmente nello squat e
nella distensione su panca. Per dopo pochi allena-
menti migliorerete notevolmente la forma di esecu-
zione adattandovi allequilibrio e al controllo necessari
per svolgere gli esercizi.
LIMPORTANZA DELLELASTICIT
Dovete essere elastici. Non necessario essere estrema-
mente elastici, per necessaria unelasticit superiore
alla media, specialmente per lo squat. Altrimenti in
quellesercizio non potrete utilizzare la tecnica corretta.
Dopo ogni allenamento con i pesi, eseguite una
routine di stretching moderato usando una proce-
dura molto attenta, lenta e graduale. NON FATE
STRETCHING ESTREMO, AFFRETTATO O
FORZATO. Molte persone si sono infortunate fa-
cendo stretching. Allungate i polpacci, i posteriori
delle cosce, gli adduttori, i glutei, le spalle e i pettorali.
Trattenete ogni allungamento per circa 20 secondi.
Avvaletevi di un istruttore competente che vi mostri
come fare stretching.
Potreste impiegare uno o due mesi, secondo il
livello da cui partite, per sviluppare unelasticit suf-
ciente. In seguito, mantenete quellelasticit facendo
stretching con continuit.
CRUNCH
Distendetevi supini sul pavimento a anco di una
panca. Piegate le gambe a 90, con le cosce verticali.
Avvicinatevi alla panca e appoggiate i polpacci sulla
panca. Incrociate gli avambracci sul petto. Questa la
posizione di partenza.
Sollevate lentamente la parte alta del busto dal
pavimento no a staccare le scapole dal pavimento.
Questo esercizio utilizza un arco di movimento solo
parziale. Non cercate di sollevare tutto il busto dal
pavimento. Con la parte alta del busto staccata dal
pavimento, contraete forte gli
addominali espirando, poi abbas-
satevi lentamente al pavimento.
Fermatevi un secondo con la testa
appoggiata sul pavimento, inspi-
rate e poi eseguite il crunch lento
successivo. Impiegate circa tre
secondi per sollevarvi lentamente,
spremete gli addominali per due
secondi e poi impiegate tre secon-
di per abbassarvi.
Eseguite altre una o due ripeti-
zioni dopo che gli addominali han-
no cominciato a dolere e poi fer-
matevi. Riposatevi circa tre minuti
e poi eseguite una seconda serie.
Se questa tecnica troppo dif-
cile per il momento, appoggiate
le mani sul pavimento invece che
sul petto.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 47
Dopo ogni allenamento
con i pesi, eseguite una
routine di stretching
moderato usando una
procedura molto attenta,
lenta e graduale.
Sollevate lentamente la
parte alta del busto dal
pavimento no a staccare
le scapole senza sollevare
tutto il busto e contraete gli
addominali espirando...
SQUAT
Quanto bene eseguite lo squat dipende dalla lunghezza
assoluta e relativa del busto e degli arti E dalla vostra
elasticit. Se non siete elastici, non riuscirete a fare
squat correttamente. Non potete sapere se siete o no
adatti allo squat prima di aver sviluppato lelasticit
necessaria e aver provato lesercizio per un po di tem-
po. Poich potreste aver bisogno di un mese o due per
aumentare lelasticit, potete migliorare la vostra capa-
cit di squat nel corso di questo
periodo.
Mettete un bilanciere scarico
sugli appoggi del power rack,
altezza met petto. Posizionatevi
afnch per eseguire leser-
cizio dobbiate camminare
INDIETRO sorreggendo il bi-
lanciere.
Mettete le mani sul bilan-
ciere a circa met strada fra le
spalle e gli appoggi, dove risulta
comodo, per non afferratelo
veramente. Mettete i piedi sotto
al bilanciere e tenendo le spalle
retratte (e perci la parte bassa
della schiena leggermente inarca-
ta), inlatevi sotto il bilanciere.
Sistemate il bilanciere sulla parte
alta della schiena, NON alla base
del collo. La gran parte delle
persone sistema il bilanciere 2-5-
8 cm troppo in alto quando fa
squat.
Tenendo le spalle e la schie-
na nella posizione corretta e il
petto in fuori, stendete le gam-
be. Adesso fate scivolare i piedi
indietro quanto basta per stac-
care il bilanciere dagli appoggi
e non colpirli con il bilanciere
durante lo squat. Distanziate i
talloni quanto la larghezza delle
anche e poi divaricate le punte
nella posizione delle lancette
dellorologio cinque minuti alle
una. Fate un respiro profondo
e abbassatevi al punto in cui la
sommit delle cosce parallela
al pavimento, poi risalite imme-
diatamente espirando. Guardate
sempre avanti e tenete il petto in fuori e le scapole
ravvicinate.
importante tenere le ginocchia in asse con i pie-
di. Le punte dei piedi devono essere un po divaricate,
afnch abbiate abbastanza spazio per fare lo squat,
perci dovete aprire le ginocchia durante la discesa e
tenerle aperte durante lascesa.
Impiegate tre secondi per abbassarvi, un po
meno per rialzarvi. Eseguite ogni ripetizione in modo
FLUIDO.
Se avete difcolt a restare in equilibrio e tendete
a cadere in avanti, provate a distanziare i piedi un po
di pi. Se ci non aiuta, provate a divaricare un po
di pi le punte. Variate la posizione no a che trovate
quella che funziona meglio per voi.
Chiedete a un assistente di osservarvi lateralmente
mentre fate lo squat. Se la parte bassa
della schiena si incurva prima che
la sommit delle cosce raggiunga la
posizione parallela, arrestate la discesa
5 cm prima del punto in cui la parte
bassa della schiena comincia a incur-
varsi. una cosa importante per la
sicurezza della parte bassa della schie-
na. Con il migliorare dellelasticit e
della capacit di fare squat, potreste
riuscire ad abbassarvi un po di pi
senza incurvare la parte bassa della
schiena.
Le prime volte che eseguite lo
squat, utilizzate un bilanciere scari-
co, per familiarizzare con la tecnica.
Eseguite ogni volta due o tre serie di
12 ripetizioni deliberate. Rimettete il
bilanciere sugli appoggi fra le serie.
Se potete fare squat con una tecni-
ca ragionevole n da subito senza
cadere in avanti, senza sollevare i tal-
loni, abbassandovi almeno vicino alla
parallela mantenendo inarcata la parte
bassa della schiena cominciate ad
aggiungere un po di carico al bilan-
ciere a partire dalla terza settimana.
Aggiungete 2,5 kg al bilanciere a ogni
allenamento. Se per non riuscite a
eseguire lo squat con tecnica ragione-
vole n da subito, continuate a usare
il bilanciere scarico.
Parler di nuovo dello squat suc-
cessivamente. Per il momento basta
cos. Sebbene sia possibile che non
siate strutturalmente adatti allo squat
con bilanciere, dovete provarlo per
un po per capirlo davvero. Molti
di quelli che hanno abbandonato lo
squat usavano una tecnica scorretta,
sperimentando problemi e infortuni.
Avessero avuto elasticit sufciente, avessero usato la
tecnica corretta e fossero progrediti gradualmente, for-
se avrebbero potuto eseguire lo squat bene. Eseguito
correttamente e abbastanza a lungo per costruire un
carico importante, lo squat con bilanciere un eserci-
zio eccellente.
48 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
COSTRUIRE MUSCOLO
PERDERE GRASSO
APPARIRE AL MEGLIO
COSTRUIRE MUSCOLO
PERDERE GRASSO
APPARIRE AL MEGLIO
TUTTO QUELLO CHE DOVETE SAPERE
PER TRASFORMARE IL VOSTRO CORPO
di Stuart McRobert
In realt, 4 libri in uno!...
per costa soltanto poco pidi UN libro tipico sullallenamento.
Un ottimo rapporto valore/costo.
Nelle 3 sezioni in cui si suddivide il libro troverete:
Libro 1: un programma di allenamento passo dopo passo di 12 mesi
Libro 2: versione corretta e aggiornata sulla tecnica di esecuzione degli esercizi con i pesi
Libro 3: Nozioni supplementari e preziose per massimizzare lefcacia del programma
Libro 4: Il resoconto del recupero da infortuni debilitanti, informazioni di cui avete bisogno
per superare gli infortuni esistenti che forse pensavate impossibili da superare
e informazioni di cui avete bisogno per prevenire altri infortuni.
Questa guida denitiva per gli uomini e le donne di tutte le et. Ed per voi
se siete principianti o anche se avete anni di esperienza nellallenamento.
Ordinate subito il bellissimo libro di Stuart McRobert
per non perdere il piacere di leggere subito,
questo fantastico volume.
39,95
+ spese di spedizione
640 pagine
24 capitoli
400 fotograe
S
C
O
N
TO
SU TUTTO
RICHIEDILA A SOLI 20
IL CATALOGO ONLINE CON
1
5
%
PER INFORMAZIONI: SANDRO CICCARELLI EDITORE TEL. 055/959530 FAX 055/958255 E-mail: sandro@olympian.it s www.olympian.it
DISTENSIONE SU PANCA
Distendetevi supini su una panca piana, con i piedi
appoggiati sul pavimento e gli occhi sotto il bilanciere
sistemato sugli appoggi. Sistemate le mani sul bilan-
ciere distanziandole un po di pi della larghezza delle
spalle. Afferrate il bilanciere SCARICO e stendete le
braccia sopra al petto. Chiedete a
un assistente di aiutarvi a sollevare
il bilanciere dal rack, se necessario.
Abbassate lentamente il bilanciere
portandolo 2-5 cm sotto i capezzoli,
alla base dei pettorali. Tenete gli
avambracci sotto i polsi. Toccate
dolcemente il petto e poi rispingete
immediatamente il bilanciere al
punto alto. Fermatevi nel punto
alto per un secondo e poi abbassate
di nuovo il bilanciere. Impiegate 2-3
secondi per abbassare il bilanciere e
un po meno per sollevarlo.
Eseguite due o tre serie di otto
ripetizioni uide. Riportate il bi-
lanciere sugli appoggi fra le serie.
Concentratevi sulleseguire leserci-
zio senza oscillazioni e tremolii del
bilanciere. Potreste impiegare un
paio di allenamenti per apprendere
il controllo. Per gli allenamenti successivi, fate una
serie di riscaldamento con il bilanciere scarico, poi
aggiungete un po di carico. Dovreste essere in grado
di eseguire FACILMENTE due o tre serie di allena-
mento di otto ripetizioni. Ancora non dovete sforzarvi.
Se dovete sforzarvi, riducete il carico. La priorit il
consolidamento della tecnica corretta.
Eseguite due o tre
serie di otto ripetizioni
uide concentrandovi
sulleseguire lesercizio
senza oscillazioni e
tremolii del bilanciere.
ESTENSIONE DEL DORSO
Qualcuno la chiama iperestensione ma non dovete
mai iperestendere! Per sicurezza, sollevate il busto
solo no a che leggermente sopra al parallelo con
il pavimento. Utilizzate un attrezzo specico per le-
stensione del dorso. Dovrete sperimentare per trovare
la posizione pi comoda. Tenete le braccia sul petto,
NON dietro al collo. Sollevate lentamente il busto
alla posizione appena sopra al parallelo, impiegando
circa tre secondi. Fermatevi nel punto alto per un se-
condo e poi abbassatevi impiegando circa tre secondi.
Continuate no a che lesercizio comincia a farsi un
po impegnativo. Poi fermatevi e scendete dallattrez-
zo. Riposatevi alcuni minuti e poi eseguite una secon-
da serie comoda.
Lestensione del dorso non un esercizio fonda-
mentale, per vi aiuter a prepararvi alluso futuro di
un esercizio fondamentale per la schiena.
TRAZIONE ALLA LAT MACHINE
Usate una presa supina (palmi su, in questo caso) ap-
pena pi stretta della larghezza delle spalle. Ottimizzate
la larghezza della presa per determinare quella pi co-
moda per voi un po pi stretta pu essere meglio.
Tirate lentamente la sbarra no a portarla allal-
tezza delle clavicole o appena sotto. Durante la discesa
inarcate la schiena e inclinate la testa allindietro.
Avvicinate le scapole e riportate lentamente il bilan-
ciere alla posizione con le braccia stese. Impiegate
tre secondi per abbassare la sbarra, fate un secondo
di contrazione e poi riportate la sbarra nel punto al-
tro impiegando tre secondi. Fermatevi per un secondo
o due nel punto alto di ogni ripetizione, per tenete
le spalle contratte, non rilassatele. Eseguite tutte le
ripetizioni che potete no a che i muscoli cominciano
a sentirsi stanchi. A questo punto fermatevi, riposate
alcuni minuti ed eseguite una seconda serie.
Nellallenamento successivo, modicate il carico
come necessario per renderlo adatto allo schema di
serie e ripetizioni descritto nella sezione sulla disten-
sione su panca.
50 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
...non dovete mai iperestendere!
Per sicurezza, sollevate il busto
solo no a che leggermente
sopra al parallelo con il
pavimento.
Tirate lentamente la
sbarra no a portarla
allaltezza delle
clavicole o appena
sotto. Durante la
discesa inarcate la
schiena e inclinate
la testa allindietro.
Avvicinate le scapole e
riportate lentamente il
bilanciere alla posizione
con le braccia stese.
SOLLEVAMENTO SULLE PUNTE DEI PIEDI
Usate una macchina per il sollevamento sulle punte
senza carico. Tenetevi alle maniglie e appoggiate gli
avampiedi sulla pedana. Piegate le ginocchia e appog-
giate le imbottiture sulle spalle tenendo le scapole re-
tratte e quindi la parte bassa della schiena leggermente
inarcata. Raddrizzate le gambe e tenetele bloccate,
oppure, se risulta pi comodo per le ginocchia, tene-
tele appena sbloccate. Abbassate lentamente i talloni
n dove potete SENZA forzare lallungamento. Poi
sollevate lentamente i talloni. Fermatevi per un mo-
mento nel punto alto e trattenete la contrazione, poi
abbassate di nuovo lentamente. Non rimbalzate nel
punto basso. Impiegate circa due secondi per lascesa,
fate un secondo di pausa e impiegate tre secondi per
la discesa. Continuate no a che i polpacci comincia-
no a essere doloranti, quindi fermatevi e uscite dalla
macchina.
Eseguite una serie in ogni allenamento della prima
settimana, poi nelle due settimane successive eseguite
due serie per allenamento. Cominciate piano, altri-
menti potreste avere problemi a camminare nei giorni
successivi. Poi, se riuscite a fare almeno 20 ripetizioni
nella prima serie, nellallenamento successivo aumen-
tate un po il carico e fate serie di 15 ripetizioni.
SCHEMA DI
PROGRESSIONE GENERALE
I carichi iniziali sono una questione personale. Nelle
prime due settimane concentratevi sullapprendere la
tecnica di ogni esercizio. Ogni serie deve essere agevo-
le, quindi riducete il carico se capite di dovervi sfor-
zare un po. In questa fase non dovete mai spingere a
fondo nelle serie. Se spingete a fondo troppo presto,
vi indolenzirete troppo e non imparerete la tecnica
corretta perch vi concentrerete sullo sforzo. Dovete
prima concentrarvi sulla forma di esecuzione.
Nella settimana quattro, ECCETTO che per lo
squat, per ogni esercizio trovate il carico che vi per-
metterebbe di eseguire almeno cinque ripetizioni in
pi rispetto al numero obiettivo SE SPINGESTE A
FONDO. Per non spingete a fondo. Limitatevi al
numero di ripetizioni pressato, non andate oltre. Per
determinare i carichi dovrete sperimentare un po.
Siate attenti e conservativi. Sbagliate per difetto invece
che per eccesso.
Per lo squat, invece, seguite le indicazioni date in
questa sezione.
Dopo 3-4 settimane, la routine deve assomigliare a
questa:
Riscaldamento generale
1. Crunch: 2 o 3 serie di quante ripetizioni potete
fare agevolmente, senza sovraccarico
2. Squat: 3 serie di 10 ripetizioni
3. Distensione su panca: riscaldamento con bilan-
ciere scarico, pi 2 o 3 x 8
4. Estensione del dorso: 2 serie di quante ripetizio-
ni potete fare agevolmente, senza sovraccarico
5. Trazione alla lat machine: 2 o 3 x 8
6. Sollevamento sulle punte dei piedi: 2 o 3 x 15
Prima di cominciare a usare i pesi, eseguite unattivit
di riscaldamento generico. Per esempio, usate il re-
matore, la cyclette, larrampicatore o il simulatore di
sci di fondo. Se non avete nessuno di questi attrezzi a
disposizione, fate una camminata di passo svelto sul
tapis roulant, procedendo no a che cominciate a su-
dare, poi iniziate lallenamento con i pesi.
Ricordatevi, fate stretching subito dopo ogni alle-
namento con i pesi.
Per il momento non pensate al lavoro cardiovasco-
lare. Cominciate con allenamenti brevi con i pesi e la
routine breve di stretching. Non fate il classico errore
dei principianti di fare troppo troppo presto.
Adesso avete le vostre prime quattro settimane di
allenamento con i pesi. Mantenete le cose semplici,
imparate come eseguire i sei esercizi, perfezionate la
tecnica, incrementate i carichi gradualmente, per
restate a unintensit leggera-moderata. Il prossimo
mese continuer con il programma, fornendo anche
materiale teorico importante.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 51
Prima di cominciare
a usare i pesi,
eseguite unattivit
di riscaldamento
generico. Per
esempio, usate
il rematore,
la cyclette,
larrampicatore o il
simulatore di sci di
fondo.
ASSURDIT
D
Dove mi alleno c un tipo con un busto
massiccio, braccia enormi, cosce medie e
polpacci striminziti. Ha la pancia flaccida e
non fa mai aerobica. Ha un aspetto assurdo. Il
bodybuilding non dovrebbe prendersi cura di
tutto il corpo?
R
S, e la somma delle parti corporee pi impor-
tante delle singole parti corporee. Un uomo
con muscoli medio-grandi, per con tutte le parti svi-
luppate in modo equilibrato e con grasso corporeo
pari al 10% o meno, surclasser di gran lunga il sog-
getto che hai descritto. Non importa se laltro ha
delle parti corporee enormi. Le parti corporee enormi
non fanno altro che evidenziare mancanze altrove.
Il bodybuilding soprattutto un fatto estetico,
che significa sviluppo bilanciato e proporzionato e
definizione. Anche un uomo con potenziale per la
massa muscolare solo nella media, se sfrutta appieno
il suo potenziale medio per il fisico e si mantiene
asciutto, avr sempre un aspetto pi imponente di chi
ha potenziale per la massa muscolare molto maggiore
ma non costruisce un fisico bilanciato e definito.
Luomo di cui parli ha un aspetto ridicolo e di
certo non si sente in salute, il modo in cui sta
implementando la sua versione assurda del bodybu-
ilding dannoso per la sua salute. Dubito che possa
muoversi in modo agile e probabilmente non usa le
scale perch resta a corto di fiato facilmente. Poich

LA CONOSCENZA DELLALLENAMENTO PER GLI

93 PARTE
di Stuart McRobert
HARDGAINER

la denizione ideata da Stuart McRobert che indica gli individui nella media, poco dotati, che hanno difcolt ad
aumentare la massa muscolare. La losoa di hardgainer prevede di allenarsi senza fare uso di sostanze dopanti , con esercizi adeguati, prin-
cipalmente multiarticolari come squat, stacchi da terra ecc., allenamenti brevi, pesanti ed infrequenti, corretta alimentazione e giusto riposo.
Il bodybuilding soprattutto un fatto estetico,
che significa sviluppo bilanciato e proporzionato
e definizione.
K
r
i
s
K
r
i
s
K
r
i
s
K
i
K
r
i
s
K
r
K
GG
e
t
G
e
t
G
e
tt
e
t
GGG
h
i
n
h
i
n
h
i
n
h
i
n
FFF
-

F
o
-

F
o
-

F
o
FFF
tt
o
:
t
o
:

t
o
:

t
o
:

tttt

M
i

M
i
M
i


M
i


M
i

M
i


M
i

M
i

M
i


M
i
M

c
h
a
e
c
h
a
e
c
h
a
e
c
h
a
e
c
h
a
e
hhhhhhhhh
N
e
l

N
e
l

N
e
N
e
l
N
e
N
e
N
e
N
e
NNN
l

NNN
l

N
ll

ll
v
e
u
x
v
e
u
x
v
e
u
x
v
e
u
x
v
e
u
xx
v
e
v
e
vvvvvvvvvvvvvvvvvv
52 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 53
GUANTI PER
LALLENAMENTO
D
Quando indosso i guanti per lallenamento,
mi sembra che la forza della presa si riduca
nel corso della serie. I guanti non dovrebbero ser-
vire a rafforzare la presa?
R
Quando usi i guanti, il tessuto dei guanti
aumenta il diametro del bilanciere o delle impu-
gnature dei manubri. Tenere un oggetto di diametro
maggiore pi difficile.
Poich i guanti possono ridurre lo scivolamento
del metallo, possono sembrare rafforzare la presa sul
bilanciere. Per le mani possono scivolare allinterno
dei guanti.
Se il bilanciere o le impugnature dei manubri
sono zigrinati, se metti del gesso sulle mani e se usi la
presa giusta, avrai
una presa sugli
attrezzi pi salda
rispetto alluso
dei guanti. Se
rafforzi le mani
e gli avambracci
con del lavoro
specifico per la
presa, rafforze-
rai ulterior-
mente la presa
sugli attrezzi.
ha busto massiccio e braccia enormi, probabilmente
sta assumendo steroidi.
Invecchiando, probabilmente vedr peggiorare
ulteriormente salute, punto vita e condizione, bench
possa conservare il busto massiccio e le braccia enormi
per un po, fin quando la sua salute sar talmente
compromessa che anche le sue parti corporee pazze-
sche spariranno.
QUADRICIPITI
D
Solitamente, il giorno dello squat faccio un
paio di serie di allenamento di leg extension
e di leg curl, dopo lo squat. Sto sprecando tempo
ed energie facendo questi esercizi di isolamento?
R
Se mentre fai squat ti trattieni un po, conscia-
mente o inconsciamente, perch sai che dovrai
fare gli esercizi di isola-
mento, allora questi esercizi ridurranno il tuo progres-
so complessivo.
Se esegui lo squat davvero in modo intenso, allora
non hai bisogno di altri esercizi per i quadricipiti,
quindi puoi eliminare il leg extension.
Se ti impegni davvero nello squat, indipendente-
mente dal leg curl che esegui pochi minuti dopo, una
buona idea inserire il leg curl almeno in alcuni cicli,
facendo una serie di riscaldamento e 2-3 serie di allena-
mento. un esercizio di isolamento utile perch allena
i posteriori delle cosce in modo diverso e complemen-
tare rispetto a quanto fanno squat e stacco da terra.
Per devi usare una buona macchina per il leg
curl, regolata in modo appropriato per te e devi usare
la tecnica corretta e una cadenza controllata e fluida.
Accertati di usare una macchina e regolazioni che
ti permettono di posizionare lasse di rotazione della
macchina in modo che sia allineato con il centro delle
ginocchia. Se questi due punti non sono allineati, il
leg curl irriter le ginocchia e dar pi problemi che
benefici. Quella che alcune persone possono pensare
sia irritazione delle articolazioni dovuta allo squat,
pu essere dovuta al leg extension o al leg curl.
Eseguiti in modo improprio, leg estensione e leg curl
possono essere dannosi.
Se esegui lo squat davvero in modo
intenso, allora non hai bisogno di altri
esercizi per i quadricipiti...
F
o
t
o
:


E
r
i
c

J
a
c
o
b
s
o
n
se metti del gesso sulle mani e se usi la
presa giusta, avrai una presa pi salda
rispetto alluso dei guanti.
54 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
LUNGHEZZA DEI CICLI
DI ALLENAMENTO
D
Perch preferisci cicli di progressione lunga
ma lenta invece dei cicli brevi con progressio-
ne rapida? evidente che due cicli di squat di 13
settimane in cui si verifica in ognuno un guadagno
di forza di 20 kg sono molto meglio di un ciclo
lungo per guadagnare gli stessi 20 kg ma in cui si
guadagnano solo 500 g la settimana. Il ciclo breve
assolutamente superiore al ciclo lungo.
R
I cicli brevi sono molto pi produttivi SE il pro-
gresso fattibile e possibile. Per gli atleti naturali
nella media non pi principianti, non possibile gua-
dagnare 20 kg in ciascuno di due cicli successivi di 13
settimane. Puoi riuscire a guadagnare cos velocemente
in modo occasionale e per un periodo breve, per non
un approccio che pu essere usato in modo costante.
Per gran parte delle persone, gran parte delle volte,
cercare di progredire cos velocemente produce infor-
tuni e/o stagnazione, perch il corpo pu sviluppare
forza e massa muscolare solo a ritmo lento. Se cerchi
di progredire troppo velocemente, il corpo ceder.
Lento e costante , per gran parte delle persone gran
parte delle volte, una strategia pi sicura e pi effica-
ce. un approccio conservativo, per il metodo
migliore per il lungo termine.
PROORMONI
D
I proormoni possono essermi di aiuto? Cosa ne
pensi? Se naturalmente non riuscir a diventa-
re enorme, prover a farlo in ogni modo possibile.
Non riesco ad accettare il mio aspetto attuale.
R
Non ho tempo da perdere con i proormoni. Le
promesse pubblicizzate per molte di queste cose
sono assolutamente disoneste, quindi non fidarti di
quello che leggi nelle pubblicit. Se i prodotti fanno
davvero quello che promettono di fare e li usi, allora
vai ad alterare lequilibrio delicato del sistema endocri-
no. Anche alcuni endocrinologi, che dovrebbero sape-
re quello che fanno, hanno messo nei guai molti
pazienti alterandone i sistemi endocrini. Non bisogna
MAI alterare il sistema endocrino senza la supervisio-
ne medica di un esperto; e anche in questo caso pu
essere pericoloso. Deve esserci una buona ragione
BODYBUILDER ALTI
D
Quale tipo di esercizi consigli per
un uomo molto alto e magro? Ho
21 anni e vorrei arrivare a pesare 120 kg.
R
Ti consiglio lo stesso gruppo di eser-
cizi che consiglio a qualsiasi altro
bodybuilder, per, come qualsiasi altro
bodybuilder, devi modificare la scelta
degli esercizi in base alla tua struttura. Se
sei molto alto, probabilmente lo squat con
bilanciere non sar adatto a te. Lo stacco
da terra con presa parallela o il leg press pos-
sono essere pi sicuri e pi efficaci per te e la flessione
alle parallele pu essere per te un esercizio pi efficace
della distensione su panca. Per luso della tecnica di
esecuzione corretta IMPERATIVO, ovviamente.
Non so quanto pesante puoi diventare. Per so
che se ti alleni in modo appropriato puoi guadagnare
MOLTO peso. Hai solo 21 anni ed probabile che
tu non ti sia mai allenato in modo appropriato.
120 kg un obiettivo tipo Mr. Olympia, anche se
probabilmente sei molto pi alto dei vincitori di
quella gara. Dimenticati di uno sviluppo di questo
genere, salvo che tu abbia una genetica pazzesca.
Punta a 5 kg in pi rispetto al tuo peso corporeo
attuale, costruiscili e poi punta ai 5 kg successivi e
cos via. Arriva fin dove puoi, NATURALMENTE.
Quale tipo di esercizi consigli
per un uomo molto alto e magro?
F
o
t
o
:



v
l
o
r
z
o
r

-

F
o
t
o
l
i
a
.
c
o
m
LA CONOSCENZA DELLALLENAMENTO PER GLI
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 55
MEDICA per interferire con il sistema endocrino. Il
semplice non riuscire a guadagnare bene in palestra
NON una giustificazione sufficiente.
Ci sono persone che hanno veramente problemi al
sistema endocrino ma si tratta di problemi GRAVI.
Per le persone sane, come probabilmente sei te, pos-
sibile correggere gran parte dei problemi legati ai gua-
dagni in palestra semplicemente ALLENANDOSI
MEGLIO e soddisfacendo APPIENO gli elementi del
recupero. Dimenticati dellapproccio soluzione rapi-
da e usa soltanto quello che funziona in modo sicuro
e naturale.
Sebbene tu possa pensare di avere un problema
solo perch non diventi abbastanza grosso, NIENTE
in confronto a un problema del sistema endocrino
causato da una sua cattiva gestione. Prima di tutto la
salute. Chiedi a chi ha compromesso la propria salute.
Dimenticati dei proormoni e impara ad allenarti e
a recuperare bene in modo naturale. Rispetta i tuoi
limiti. Pochissimi hanno la genetica pazzesca per uno
sviluppo muscolare ENORME. Per, anche un
potenziale genetico nella media, SE sfruttato, e
accompagnato dalla definizione in modo da vedere
chiaramente il sei tasselli, produrr risultati eccellenti.
Non vincerai una gara di bodybuilding a causa della
prevalenza dei fisici aiutati dai farmaci, per avrai
comunque un fisico eccezionale che impressioner la
stragrande maggioranza delle persone. Punta a questo
e al mantenerti in salute, invece di correre rischi e fare
qualcosa che potrebbe danneggiare la tua salute al
punto di arrivare addirittura a pentirti di aver intra-
preso il bodybuilding.
Stuart McRobert stato leditore e il fondatore della rivista Hardgainer, lautore di BRAWN, OLTRE BRAWN, GUIDA PER LALLENAMENTO DI MUSCOLI E
POTENZA, TECNICA DI ALLENAMENTO CON I PESI e SUPPLEMENTO A OLTRE BRAWN tutti pubblicati in lingua italiana da Sandro Ciccarelli Editore. Il suo ultimo
libro COSTRUIRE MUSCOLI, PERDERE GRASSO, APPARIRE AL MEGLIO disponibile presso Olympians, Tel. 055/959530.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 94
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 94
Stuart McRobert
da
Stuart McRobert
il metodo esperto per muscoli e potenza
Nel complesso i cinque libri costituiscono il pacchetto didattico pi completo
e responsabile per raggiungere gli obiettivi per il fisico e la forza
I LIBRI POSSONO ESSERE RICHIESTI A: OLYMPIANS NEWS TEL. 055/958058-959266 FAX 055/958255 e-mail: ordini@olympian.it www.olympian.it
Chiamate oggi stesso! 055-959530
Supplemento a Oltre BRAWN
320 pagine 23,24
Se volete trarre il massimo dallallenamento, anche se siete un atleta esperto, le oltre 230
domande affrontate in SUPPLEMENTO A OLTRE BRAWN vi forniranno unenormit di
informazioni aggiuntive a quelle presenti negli altri nostri libri.
Oltre
Oltre
LENCICLOPEDIA
DEDICATA
AGLI ESPERTI
PER COSTRUIRE
MUSCOLI
E POTENZA
Tecnica di allenamento con i pesi
grande formato, 320 pagine con 363 fotografie 25,00
Nuovamente revisionato da Stuart McRobert. Insegner precisamente come eseguire con
sicurezza e in modo produttivo tutti gli esercizi che sar veramente necessario usare.
Oltre BRAWN 496 pagine 25,82
Tutto sulla realizzazione dei programmi e su quasi ogni altro aspetto del bodybuilding
eccetto la tecnica di esecuzione.
BRAWN 258 pagine 18,08
Un libro storico, il primo in assoluto della serie che ha cambiato per sempre il corso della
storia del bodybuilding.
Guida per lallenamento di muscoli e potenza
grande formato, 138 pagine 18,07
Oltre Brawn d il massimo in assoluto quando viene usato insieme a entrambi i suoi due
volumi di accompagnamento, Tecnica di allenamento con i pesi e Guida per lallenamento
di muscoli e potenza. Guida per lallenamento di muscoli e potenza un diario di lavoro
che contiene tutto ci di cui c bisogno per tenere sotto controllo i propri miglioramenti
giorno dopo giorno.
S
C
O
N
TO
SU
TU
TTO
RICHIEDILA A SOLI 20
IL CATALOGO ONLINE CON
1
5
%
fondatore di
HARDGAINER
LA GUIDA ILLUSTRATA PASSO PER PASSO
AL PERFEZIONAMENTO DELLESECUZIONE DEGLI ESERCIZI
PER I MASSIMI RISULTATI SENZA INFORTUNI
Tutto quello che
dovete sapere sulla corretta
Tecnica di
allenamento
con i pesi
TERZA EDIZIONE
RIVISTA E AGGIORNATA
363
FOTO
Stuart McRobert
Terza
Edizione
rivista e
aggiornata
Nuova
edizione
aggiornata
Sebbene tu possa pensare di avere un
problema solo perch non diventi
abbastanza grosso, niente in confronto
a un problema del sistema endocrino
causato da una sua cattiva gestione.
F
o
t
o
:



O
O
Z

-

F
o
t
o
l
i
a
.
c
o
m
A
seconda del vostro Paese dorigine, il cibo comfort pu
essere culturalmente diverso. Il termine cibo comfort
di solito si riferisce a una variet di alimenti semplici e
naturali, che vengono spesso consumati tramite pasti ve-
loci o preparati a casa. Il termine cibo comfort pu anche
descrivere certi snack, che hanno un signicato emotivo e
forniscono un certo grado di soddisfazione e sicurezza.
Mentre Brad stato esposto al cibo comfort base della
cultura americana, come le patatine, gli hamburger dei fast
food, la pizza e il gelato, molte persone di altri Paesi e cul-
ture preferiscono alimenti diversi. Per esempio, i giapponesi
potrebbero considerare cibi comfort piatti come la zuppa
miso e il ramen; per gli spagnoli potrebbero essere le uova
con patate fritte o riso; alcuni abitanti del Regno Unito
estratto dal libro di Stuart McRobert e Bradley Cailor
COME PERDERE PESO SENZA RIACQUISTARLO
E COME POTRETE FARCELA ANCHE VOI!
Cibi comfort nel mondo
56 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
potrebbero adorare le salsicce con il pur, il pudding e
i curry indiani, mentre gli italiani potrebbero preferire
la pasta, la pizza e la crema di cioccolato.
Indipendentemente dalla cultura o dal Pae-
se dorigine, la maggior parte del cibo comfort
ha un elemento in comune: la combinazione di
grassi, zucchero e sale. Potreste pensare che non
sia cos, ma se date unocchiata alle tabelle nutri-
zionali potreste rimanere sorpresi.
Dovete eliminare
il cibo comfort?
Prima o poi dovrete smettere di fare spuntini di cibo
comfort. Ma eliminarlo non necessariamente la soluzio-
ne. Se ci neghiamo ci che desideriamo con tanta forza,
niremo per desiderarlo anche di pi.
Dovete godervi la vita. Se adorate i biscotti, godetevene
uno, occasionalmente. Se amate la cioccolata, fatevene un
piccolo pezzetto occasionalmente. Se amate la pizza, mangia-
tene una occasionalmente.
Per la maggior parte delle persone alcuni cibi comfort,
mangiati con moderazione controllata, sono accettabili.
il resto che conta e un piccolo, strategico imbroglio non vi
svier dallobiettivo a lungo termine che vi siete
pressati.
Per altri, invece, godersi il cibo comfort
con moderazione controllata non affatto
semplice. Molti mangiano per lenire emo-
zioni dolorose o per ottenere un nutrimento
emotivo. Per questo hanno molti problemi a
controllarsi. Brad ha ancora questo problema,
specialmente con pizza e patatine.
Cibi comfort come i biscotti, la torta, la
pizza e le patatine, sono di solito di una variet contenente
quantit strategiche di grassi, zucchero e sale, altamente
trattata. Quando li mangiate, i vostri livelli di serotonina
aumentano e il vostro cervello si sente pi rilassato e calmo.
Unite queste sensazioni al modo in cui questi cibi rilasciano
la dopamina, creando desiderio di mangiare. Non c da
meravigliarsi se i cibi comfort possono creare assuefazione.
Come frenare il vostro
desiderio di cibi comfort
Questi sono piccoli consigli seguiti da persone
che sono riuscite a perdere peso, evitando di
soddisfare il desiderio di snack e cibi comfort.
Seguiteli anche voi.
Molte di queste persone hanno escogita-
to lespediente di bere un grosso bicchiere
dacqua (preferibilmente freddissima) quando
provavano il bisogno disperato di mangiare.
Funziona la maggior parte delle volte. In
alternativa, bere acqua aromatizzata. Brad e
sua moglie ci mescolano spesso tre litri e
mezzo di Kool-Aid

senza zucchero o
Crystal Light

, che contengono solo


cinque calorie a porzione.
Un altro diversivo molto usato
la regola dei cinque minuti. Se
desiderate tantissimo qualcosa, aspettate
cinque minuti prima di aprire, per esempio,
il barattolo dei biscotti. Potete anche farvi una
breve camminata rigenerante, durante questi cinque mi-
nuti. Questo ritardo pu darvi la possibilit di ripensare alle
vostre azioni e decidere di fare qualcosa
di pi salutare che mangiare. molto
facile che dimentichiate addirittura di
aver avuto voglia di uno spuntino.
Mangiate solo a tavola. Se mangiate
uno snack davanti alla televisione,
ogni volta che vi siederete comodi pro-
verete lo stimolo a mangiare ancora.
Scegliete un posto a tavola dove consu-
mare tutti i pasti e gli spuntini e mantenete quello.
Prima di prendere un mufn o un sacchetto di
patatine, considerate quante calorie non salutari state
per assumere e quanto esercizio dovrete fare per bruciar-
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 57
Se ci neghiamo ci che desideriamo con
tanta forza, niremo per desiderarlo anche
di pi... Se amate la cioccolata, fatevene
un piccolo pezzetto occasionalmente.
Per la maggior parte delle persone alcuni
cibi comfort, mangiati con moderazione
controllata, sono accettabili.
F
o
t
o
:


a
m
o
w
e
r
y

-

F
o
t
o
l
i
a
.
c
o
m
v
v
58 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
le tutte. Per esempio, a seconda della
vostra velocit, dovrete camminare
allincirca per 15-20 chilometri, per
bruciare le calorie assunte con solo
170 grammi di patatine. Quindi
considerate se ne vale la pena. Questa
regola aritmetica mentale uno dei
trucchetti pi efcaci. utile sapere
che, per esempio, solo cinque minuti di
spuntino possono vanicare un giorno intero
(o diversi giorni) di sacrici.
Se dovete per forza prendere un sacchetto di pa-
tatine, sceglietene uno a porzione singola. In questo
modo sarete limitati a una porzione di 30 grammi e 150
calorie, invece di continuare a inghiottire cibo da un
sacchetto apparentemente senza fondo. In uno studio
condotto dallUniversit dellIllinois, stato scoperto
che attingere da una confezione pi grande con-
duce a un aumento del 22% nel numero
delle calorie che vengono consuma-
te, indipendentemente dal vostro
livello di fame.
Placate la fame con
una gomma senza zuc-
chero, lavandovi i denti o
mangiando qualcosa di dolce a
porzione singola, come un cetriolino
sottaceto o un peperoncino piccante.
Invece di mangiare, fatevi un bagno
caldo immersi nelle bolle di schiuma, o
fate una telefonata a un amico.
Potete anche creare un sistema
basato sulla sensazione di ottenere un
premio, per imbrogliare la vostra dieta. Per
esempio, se sapete che andrete a man-
giare una pizza con gli amici o a bere
qualcosa, prima di godervi la serata andate
a fare una lunga camminata o fate un allena-
mento, cos potete almeno pensare di esservi
meritati quella piccola dissolutezza.
Fermatevi per qualche minuto e siate
sicuri di avere davvero fame prima di mangiare.
La fame sica deve essere la base, un bisogno naturale,
mentre invece la fame emotiva vi far sentire colpevoli,
dopo. Un po di petto di tacchino non vi far
sentire tanto colpevoli quanto un biscotto
o un sacchetto di patatine.
Per aiutare a sviluppare questo
effetto colpa, prendetevi un minuto o
due (durante la pausa della regola dei cinque minu-
ti) per valutare ci che state pensando di man-
giare. Una volta che avrete realizzato che state
per inghiottire un prodotto chimico carico
di grassi, zucchero e sale con pi o meno
1000 calorie che, in qualche modo, dovrete
bruciare il senso di colpa di solito prevarr
e sarete inclini a fare una scelta migliore.
Per la maggior parte, il desiderio di
spuntini e cibi comfort un prodotto della
noia. Ecco perch importante tenersi impegnati
con hobby diversivi e attivit (come lesercizio sico),
per tenere la mente lontana dal cibo.
Tenete le tentazioni in luoghi difcili da rag-
giungere o lontani, cos si aggiunger unulteriore
sda per ottenerli.
La migliore tattica diversiva di non avere
nessuna prelibatezza o dolcetto in casa. Pu sembrare
eccessivo, ma forse lunica soluzione. E a mali estremi,
estremi rimedi. Questa stata la soluzione di Brad con
le patatine, perch era lunico cibo sul quale non riusciva
ad avere nessun controllo. Adesso considera quella schi-
fezza un suo nemico.
i
ti
spu
i E
1
7
0
g
patatine
=
15-20 km
F
o
t
o
:


e
l
e
c
t
r
o
s
h
o
t

-

F
o
t
o
l
i
a
.
c
o
m
La migliore tattica diversiva di non
avere nessuna prelibatezza o dolcetto
in casa. Pu sembrare eccessivo, ma
forse lunica soluzione.
F
o
t
o
:


M
i
c
h
a
e
l

P
e
t
t
i
g
r
e
w

-

F
o
t
o
l
i
a
.
c
o
m
Mano a mano che la gente migliora la propria
salute e perde peso, comincia a imbrogliare di meno,
perch non vuole deludere se stessa e rovinare i progressi
raggiunti a un prezzo cos alto. Non vorrete deludere
voi stessi, una volta che avrete fatto buoni progressi.
Questa stata forse la migliore soluzione al disordine
alimentare di Brad.
Alla ne sarete capaci di individuare una serie di tat-
tiche, che vi aiuteranno a non prendere decisioni sba-
gliate. Considerate queste tattiche come le vostre regole.
Seguendole, a poco a poco diventeranno una parte di
voi, perch riallenerete il vostro cervello.
E, come la maggior parte delle nuove abitudini, vi ci vor-
ranno non pi di 21 giorni per interiorizzarle, se le praticate
quotidianamente.
SANDRO CICCARELLI EDITORE S.R.L. Via Brodolini, 35/b - 50063 Figline Valdarno (FI)
Tel. 055/0513467 055/0513600 e-mail: sandro@olympian.it - www.olympian.it
di Stuart McRobert e Bradley Cailor Z 480 pagine Z formato 15x21 cm Z brossura | Cod. L116 | 24,95
Sandro Ciccarelli Editore
Olympians News
WEIGHT-LOSS SALVATION racchiude informazioni pratiche
ed efficaci sul tema del dimagrimento, offrendovi il modello definitivo per perdere peso
e non riacquistarlo. Questo libro per chiunque abbia problemi di peso.
Dedicato in particolar modo a chi stanco dei fallimenti derivati da diete restrittive,
alla moda, da pillole e trucchetti vari.
Questo nuovo libro di stuart mcrobert rivolto a uomini e donne
che vogliono perdere grasso corporeo e poi rimanere in forma!
Weight loss salvation fornisce le informazioni a tutti,
dallappassionato di tness a chi vuole semplicemente
perdere grasso corporeo.
Il libro weight loss salvation aiuter chiunque interessato
ad arrivare a circa il 10% di grasso corporeo!.
, meno,
rogressi
dere
ssi.
dine
i tat-
i sba-
e regole.
rte di
ci vor-
praticate
Alla ne sarete capaci di individuare una serie
di tattiche, che vi aiuteranno a non prendere
decisioni sbagliate. Considerate queste tattiche
come le vostre regole. Seguendole, a poco a
poco diventeranno una parte di voi, perch
riallenerete il vostro cervello.
F
o
t
o
:


A
a
r
o
n

A
m
a
t

-

F
o
t
o
l
i
a
.
c
o
m
P
H
O
T
O

C
R
E
D
I
T
I
L
V
O
S
T
R
O
P
R
O
G
R
A
M
M
A
D
I

8
S
E
T
T
I
M
A
N
E
!

BRANDON
WHITE
60 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 61
DI BILL GEIGER, MA | FOTO DI IAN LOGAN
Non niente di trascendentale! un ritornello che si sente dire frequente-
mente dai principianti riguardo allallenamento con i pesi. Ed esattamente il modo in cui il 95% della
gente che si iscrive in palestra comincia: sostanzialmente guardando quello che fanno gli altri e poi
seguendo il loro esempio. Purtroppo, molte delle persone che sono emulate sono loro stesse poco infor-
mate, e ripetere i loro errori signica, a dir poco, fare molti sforzi inutili ottenendo piccoli guadagni; alla
peggio, si pu perno subire un infortunio che intralcia lallenamento (magari anche in modo grave). In
tali circostanze, la maggior parte della gente molla dopo solo qualche mese per mancanza di progressi.
Anche se afdarsi a un personal trainer qualicato sarebbe una cosa eccellente, nella situazione eco-
nomica attuale spendere 30-70 lora al di sopra delle capacit della maggior parte della gente. Tutta-
via, imparando alcuni principi fondamentali e seguendo un programma di base che attacca ciascuno dei
gruppi muscolari principali, comincerete a costruire muscoli solidi come la roccia a partire dal vostro
prossimo allenamento.
C
o
m
in
c
ia
te
a
c
o
s
tr
u
ir
e
v
e
lo
c
e
m
e
n
te
m
u
s
c
o
li
m
o
z
z
a
a
to
c
o
n
q
u
e
s
to
p
r
o
g
r
a
m
m
a
c
o
m
p
le
to
in
tr
e

fa
s
i p
e
r
p
r
in
c
ip
ia
n
ti (
c
h
e

p
e
r
fe
tto
a
n
c
h
e
p
e
r
c
h
i
r
ic
o
m
in
c
ia
a
d
a
lle
n
a
r
s
i d
o
p
o
u
n
a
lu
n
g
a
in
te
r
r
u
z
io
n
e
!)
.
I
L

S
O
L
O
P
R
O
G
R
A
M
M
A
N
E
C
E
S
S
A
R
I
O

A
L

P
R
I
N
C
I
P
I
A
N
T
E
WWWWWWWWW WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW W. OLYMPI AN. I T
DI BILL
Non
mente da
gente ch
seguendo
mate, e r
peggio, s
tali circo
Anch
nomica a
via, impa
gruppi m
prossimo
C
o
m
in
c
m
o
z
z
a

fa
s
i p
e
r
ic
o
m
i
Copyrighted 2012 by Robert Kennedy Publishing
62 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
TRAINING
ALLENAMENTO
CONSIGLIO: SVILUPPATE PRIMA DI TUTTO LA COORDINAZIONE NELLALLENAMENTO
COMINCIARE
Lallenamento con i pesi non serve solo a
costruire muscoli mozzaato; utile anche
per ridurre i livelli di grasso corporeo e sti-
molare il metabolismo, aumentare la forza,
costruire ossa e articolazioni, ridurre i rischi
per la salute, sviluppare la funzionalit basa-
ta sulla prestazione e aumentare lautostima.
Qualunque sia la vostra motivazione, sappia-
te per che, indifferentemente da quello che
dicono gli articoli pubblicitari dei guru,
nellallenamento con i pesi non esistono
scorciatoie. Si tratta di unattivit impegnati-
va che richiede disciplina, dedizione e
pazienza. Se siete principianti, prendete in
considerazione questi punti.
Q Se avete pi di 40 anni o avete
qualche problema sico preesistente,
prima di cominciare un programma di
allenamento ottenete lautorizzazione
del vostro medico.
Q Siate realistici per positivi. Fate
una valutazione della vostra condizione
attuale e individuate il livello a cui vorre-
ste essere fra tre mesi e poi fra un anno.
Restate concentrati sul raggiungimento
dei vostri obiettivi li raggiungerete,
anche se, a volte, in modo progressivo.
Q Impegnatevi in un programma mi-
nimo di tre mesi, e solo dopo giudicate
i risultati dei vostri primi sforzi. Il fatto
che nessuno ottiene cambiamenti da
un giorno allaltro, per, nel corso di 90
giorni, vedrete sicuramente dei migliora-
menti. Gli uomini e le donne che vedete
nella rivista Reps! hanno impiegato anni
per costruire il loro sico, per tutti han-
no fatto questo primo passo e poi si sono
messi a lavorare duramente.
Per far s che impariate ad allenarvi corret-
tamente ai ni sia della sicurezza sia della
crescita muscolare ottimale, il programma
di otto settimane per principianti di Reps!
suddiviso in tre fasi: il primo periodo di due
settimane, il secondo di due settimane e
lultimo di quattro settimane. Se seguite
scrupolosamente questa progressione,
alla ne di otto settimane avrete ot-
tenuto qualche guadagno muscola-
re serio e avrete costruito una base
bilanciata incredibile per i guadagni
muscolari futuri.
FASE 1
Settimane una e due
sviluppare la sensazione
Uno degli errori commessi pi comune-
mente dai principianti nella loro smania di
costruire muscolo eseguire troppi esercizi
e serie n dallinizio, il che arreca loro inva-
riabilmente un enorme indolenzimento
durante i giorni successivi. In generale lalle-
namento con i pesi prevede un certo grado di
disagio, per, durante le prime due settima-
ne, invece di cercare di massimizzare i danni
indotti alle bre muscolari, dovete concen-
trarvi sullimparare la forma corretta degli
esercizi e sviluppare la sensazione con i
movimenti. Lobiettivo stabilire le vie neu-
rali che vi permettono di eseguire ogni ripe-
tizione con la forma corretta mano a mano
che completate il programma di Reps!.
Nella fase 1 del programma eseguite due
esercizi per ciascun gruppo muscolare per
un totale di sedici movimenti (i gruppi
muscolari principali sono petto, spalle, schie-
na, gambe, tricipiti, bicipiti e addominali;
usiamo il termine gruppo muscolare per-
ch solitamente un esercizio attacca pi di
un singolo muscolo per volta; generalmente
attacca diversi muscoli piccoli che lavorano
insieme, anche se si parla semplicemente di
esercizi per la schiena, per i quadricipiti,
eccetera). Siccome un muscolo pu lavorare
lungo diversi piani o direzioni, per costruirlo
in modo pi completo, raccomandato di
eseguire diversi esercizi, ciascuno da unin-
clinazione leggermente diversa cos da mas-
simizzare la crescita. Dunque, potreste ese-
guire le distensioni su una panca piana e
anche su una inclinata che focalizza su un
punto pi alto del petto.
Vi consiglio caldamente di cominciare
ogni sessione di allenamento con un riscalda-
mento generale del corpo di 5-10 minuti, per
esempio usando una cyclette, cos da stimola-
re la circolazione sanguigna e rendere pi
essibili i muscoli e i tessuti connettivi.
Alcuni atleti tendono a saltare questo passo
apparentemente dispendioso, per vi avver-
to: nel caso in futuro progettiate di allenarvi
in modo pesante, se saltate il riscaldamento
comprometterete la vostra prestazione e
ITN NES ESSS
WW WWW. W. OL OLYM YMPI PI AN AN. I T
di dizi zion ne e
ui ui vvor orre re--
nn aann nno. o.
im imen entoo
rret ete,
es essi s vo.
mma ma mammmii- i-
ud udic icat atee
IIl l fa fatt ttoo
nt nti i da d
so di 90
miglioraa--
vedete e
ato anni
utti han--
i si sono
vi corret--
sia dell laa
ogra ramma
di Reeps!
o o di i due
ma mane ne ee
gu uit itee
one,
t-
-
ee
ii

oonneee
omu mune ne-
mania ia ddi i
es e er erci cizi zi
or o o in inva va--
nzzim imen e to to
Aumentare la
temperatura corporea
con una sessione di
riscaldamento favorisce
la costruzione
muscolare.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 63
CONSIGLIO: ESEGUITE RIPETIZIONI CON ARCO DI MOVIMENTO COMPLETO PER MASSIMIZZARE GLI EFFETTI
ESERCIZI SETTIMANE 12 SETTIMANE 34
PETTO SERIE RIPETIZIONI SERIE RIPETIZIONI
Distensione su panca con bilanciere 2 15 3 15, 1012, 1012
Distensione su panca inclinata alla macchina 2 15 3 15, 1012, 1012
SPALLE SERIE RIPETIZIONI SERIE RIPETIZIONI
Distensione sopra la testa alla macchina da seduti 2 15 3 15, 1012, 1012
Sollevamento laterale alla macchina 2 15 3 15, 1012, 1012
SCHIENA SERIE RIPETIZIONI SERIE RIPETIZIONI
Trazione alla lat machine con presa larga 2 15 3 15, 1012, 1012
Rematore alla T bar con appoggio per il petto 2 15 3 15, 1012, 1012
GAMBE SERIE RIPETIZIONI SERIE RIPETIZIONI
Leg Press 2 15 3 15, 1012, 1012
Leg Extension 2 15 3 15, 1012, 1012
Leg Curl da distesi 2 15 3 15, 1012, 1012
Sollevamento sulle punte in piedi 2 15 3 15, 1012, 1012
BRACCIA SERIE RIPETIZIONI SERIE RIPETIZIONI
Curl al cavo con sbarra EZ in piedi 2 15 3 15, 1012, 1012
Preacher curl alla macchina 2 15 3 15, 1012, 1012
Flessioni per i tricipiti alla macchina 2 15 3 15, 1012, 1012
Spinte in basso al cavo per i tricipiti 2 15 3 15, 1012, 1012
ADDOMINALI SERIE RIPETIZIONI SERIE RIPETIZIONI
Sollevamento delle ginocchia da appesi 2 Allincapacit 3 Allincapacit
Crunch su panca declinata 2 Allincapacit 3 Allincapacit
Riposatevi 12 minuti tra le serie PER LE SETTIMANE 58, VOLTARE PAGINA XXX
capacit di sollevare carichi pesanti.
Durante le prime due settimane, lobietti-
vo sviluppare la coordinazione eseguendo
gli esercizi e imparando la forma corretta di
ciascun movimento. Non userete subito
alcun carico pesante perch i primi guadagni
di forza dipendono maggiormente dalla coor-
dinazione neuromuscolare, e ci signica
che diventerete velocemente pi forti quan-
do il vostro sistema nervoso impara lesecu-
zione del movimento. Scegliete invece un
carico che vi permetta di eseguire quindici
ripetizioni circa, stando attenti a eseguire
ogni movimento in modo corretto e comple-
tamente naturale. La maggior parte degli
esercizi durante la fase 1 eseguita alle mac-
chine, che sono pi sicure per i principianti
perch sono costruite per consentire un
movimento predeterminato e permettono di
esercitarsi nella meccanica degli esercizi.
QEseguite lallenamento per tutto il corpo
tre volte la settimana, per distanziate le
sessioni di almeno 48 ore.
QEseguite gli esercizi nellordine indica-
to, usando i numeri raccomandati di serie
e ripetizioni.
Imparate a eseguire correttamente ciascun movimento. Non pensate che le altre
persone in palestra usino sempre la forma corretta molti non lo fanno. Usare una
forma scorretta espone a rischio dinfortunio muscoli e articolazioni oltre a togliere
la tensione dal gruppo muscolare obiettivo, ed entrambe queste cose sono contro-
producenti per la crescita.
Prima di cominciare posizionatevi bene. Assicuratevi che la vostra area sia libera
da intralci e che le macchine che usate siano regolate bene per il vostro corpo.
Usate un movimento energico per fluido. Non usate ripetizioni balistiche; piut-
tosto, dovete controllare il carico sempre, sia nellascesa (la fase positiva) sia nella
discesa (la fase negativa).
Trattenete la posizione di contrazione per qualche secondo. Ripeto, non si tratta
di essere veloci, dunque concentratevi sul trattenere la posizione della contrazione
massima per un momento e poi rilasciate.
Nel punto basso della ripetizione invertite la direzione fluidamente. Non rim-
balzate il carico nella posizione di allungamento n lasciate che il pacco pesi si abbassi
completamente tra le ripetizioni, cosa che toglie tensione dal muscolo.
Allenatevi lungo un arco di movimento completo; evitate ripetizioni con arco
molto breve. Anche se dovete evitare di bloccare le articolazioni, arrivate comunque
allestensione completa e poi abbassate il carico in modo controllato per allungare il
muscolo obiettivo. Un muscolo deve essere allungato completamente perch possa
contrarsi di nuovo. Le ripetizioni con arco parziale non massimizzano la crescita
muscolare.
Espirate vicino al punto alto della ripetizione. Mentre eseguite la fase positiva
della ripetizione, trattenete il respiro, espirando solo vicino al punto alto del
sollevamento.
6 punti chiave per la forma corretta
PROGRAMMA PER PRINCIPIANTI: GLI ALLENAMENTI
TRAINING
ALLENAMENTO
FASE 2
Settimane tre e quattro
mettere alla prova i muscoli
Dopo aver imparato la forma corretta di cia-
scun esercizio e aver preso la mano con i
movimenti, il momento di cominciare ad
aggiungere carico e mettere alla prova i
muscoli. Lobiettivo durante le settimane
3-4 trovare un carico che vi permetta di
eseguire 10-12 ripetizioni con la forma cor-
retta, con le ultime ripetizioni che devono
essere piuttosto impegnative. Il volume
extra causer un picco nella produzione
ormonale naturale che accompagna lallena-
mento con i pesi, e inoltre lallenamento no
allincapacit (o abbastanza vicino allinca-
pacit) sar una parte integrante del vostro
successo denitivo nella costruzione musco-
lare. Allenarsi no allincapacit signica
semplicemente che si raggiunge un punto in
cui non si riesce a eseguire unaltra ripeti-
zione mantenendo la forma corretta; se sol-
levate un carico per un dato numero di ripe-
tizioni, non fermatevi a quel numero; se riu-
scite a sollevare il carico per unaltra ripeti-
zione, fatelo. Continuate no a che non riu-
scite a farne unaltra con la forma corretta.
Facendo riferimento alle ripetizioni, linca-
pacit deve vericarsi tra le ripetizioni 10 e
12. Correggete il carico da una serie allaltra
o da una sessione allaltra per assicurarvi di
raggiungere lincapacit muscolare in
quellintervallo di ripetizioni.
Mettendovi alla prova, comincerete a
sentire lindolenzimento muscolare del gior-
no dopo che una cosa assolutamente
naturale. Quello che importante ricordare
che in palestra si stimola la crescita
muscolare, per il processo di crescita effet-
tivo si verica fuori della palestra se ci si
riposa e si mangia in modo adeguato.
Dunque, lottimizzazione degli effetti di
costruzione muscolare non dipende solo da
quello che si fa in palestra.
Q Continuate a eseguire allenamenti per
tutto il corpo ogni due giorni.
Q La prima serie una serie di riscaldamen-
to in cui provate il modello di movimento e
riscaldate i gruppi muscolari obiettivo.
Q Eseguite gli esercizi nellordine indicato,
64 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Fase 1/settimane 1-2
QImparate a regolare
bene le macchine per il
vostro corpo.
QEsercitatevi nella forma
corretta afinch lavori
solo la parte corporea
obiettivo senza che sia
coinvolto alcuno slancio.
QProvate ripetutamente
il movimento corretto
afinch il modello di mo-
vimento diventi naturale.
QPercepite lavorare i
muscoli obiettivo.
QDeterminate quanto
carico potete usare per
quindici ripetizioni di cia-
scun movimento; annota-
te quel numero afinch
possiate ricordarlo per
lallenamento successivo.
Non usate subito carichi
pesanti.
Fase 2/settimane 3-4
Q Scegliete un carico
pi impegnativo che vi
permetta di eseguire
meno ripetizioni circa
10-12 per serie.
QAttaccate i muscoli con
una serie extra; il volume
supplementare aumenter
il rilascio ormonale natura-
le e migliorer i guadagni
di massa e forza.
QCercate di ottenere un
grado di indolenzimento
muscolare postallena-
mento che indichi che
avete spinto il muscolo
oltre la sua zona comfort.
QImparate ad allenarvi
fino allincapacit, cio
fino al punto in cui non
riuscite a eseguire altre
ripetizioni di un dato
esercizio con la forma
corretta.
Fase 3/settimane 5-8
QSuddividete lallena-
mento in due sessioni
distinte, un giorno per i
muscoli di spinta (petto,
spalle, tricipiti e addomi-
nali) e uno per i muscoli
di trazione (schiena e
bicipiti, pi le gambe).
QContinuate a incre-
mentare il volume
dellallenamento.
QIncludete serie con
numeri di ripetizioni
moderati cos da rag-
giungere lincapacit
muscolare alle ripetizioni
810.
QImparate varianti
comuni degli esercizi cos
da poter variare facilmen-
te lallenamento.
Consigli per
accelerare il successo
Potete aumentare
il rilascio ormonale
incrementando il
volume dellallena-
mento al momento
giusto.
ESERCIZI SETTIMANE 58 GIORNI 1 + 4
PETTO SERIE RIPETIZIONI
Distensione su panca con bilanciere 4 15, 810, 810, 810
Distensione su panca inclinata alla macchina 4 15, 810, 810, 810
SPALLE SERIE RIPETIZIONI
Distensione sopra la testa 4 15, 810, 810, 810
alla macchina da seduti
Sollevamento laterale alla macchina 4 15, 810, 810, 810
TRICIPITI SERIE RIPETIZIONI
Flessioni alla macchina 4 15, 810, 810, 810
Spinte in basso al cavo 4 15, 810, 810, 810
ADDOMINALI SERIE RIPETIZIONI
Sollevamento delle ginocchia da appesi 3 Allincapacit
Crunch su panca declinata 3 Allincapacit
ESERCIZI SETTIMANE 58 GIORNI 2 + 5
GAMBE SERIE RIPETIZIONI
Leg Press 4 15, 810, 810, 810
Leg Extension 4 15, 810, 810, 810
Leg curl da distesi 4 15, 810, 810, 810
Sollevamento sulle punte in piedi 4 15, 810, 810, 810
SCHENA SERIE RIPETIZIONI
Trazione alla lat machine con presa larga 4 15, 810, 810, 810
Rematore alla T bar con appoggio per il petto 4 15, 810, 810, 810
BICIPITI SERIE RIPETIZIONI
Curl al cavo con sbarra EZ in piedi 4 15, 810, 810, 810
Preacher curl alla macchina 4 15, 810, 810, 810
Riposatevi 12 minuti tra le serie
TRAINING
ALLENAMENTO
CONSIGLIO: IMPARATE AD ALLENARVI FINO ALLINCAPACIT
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 65
GLI
ESERCIZI
DISTENSIONE SU PANCA
CON BILANCIERE
O ESECUZIONE CORRETTA Assicuratevi che il vostro corpo sia posizio-
nato uniformemente sulla panca, che i piedi siano distanziati e comple-
tamente appoggiati sul pavimento e che la presa sul bilanciere sia molto
pi larga delle spalle. Abbassate il bilanciere alla parte bassa del petto
in modo controllato; poi invertite fluidamente la direzione e sollevate di
nuovo il bilanciere fino a stendere completamente le braccia.
O CONSIGLIO IMPORTANTE Quando sollevate il bilanciere dalla parte
bassa del petto, dovete muoverlo lungo un arco afinch nel punto alto si
trovi direttamente sopra il vostro viso.
O VARIANTI Manubri (distensione su panca piana con manubri); macchi-
na (distensione alla macchina da seduti).
DISTENSIONE
SU PANCA
INCLINATA ALLA
MACCHINA
OESECUZIONE CORRETTA Adattate la mac-
china al vostro corpo e sedetevi diritti sulla
panca afinch le vostre mani spingano da
una posizione accanto ai pettorali bassi. Con
un movimento energico spingete le impugna-
ture fino a stendere completamente le braccia
e poi abbassate il carico in modo controllato.
OCONSIGLIO IMPORTANTE Mentre
abbassate il carico, permettete alle scapole
di retrarsi, cos il petto si allarga e ottenete un
allungamento migliore.
O VARIANTI Bilanciere (distensione su
panca inclinata con bilanciere), manubri
(distensione su panca inclinata con manubri).
IL SOLO
PROGRAMMA
NECESSARIO
AL PRINCIPIANTE
CONSIGLIO: SUDDIVIDERE LALLENAMENTO MIGLIORA I RISULTATI
TRAINING
ALLENAMENTO
66 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
facendo due serie con un carico legger-
mente pi pesante di quello che avete
usato nelle settimane 1-2.
Q Portate ogni serie allincapacit musco-
lare e correggete il carico quanto necessa-
rio perch possiate raggiungere lincapaci-
t nellintervallo di 10-12 ripetizioni.
FASE 3
Settimane 5-8
la costruzione muscolare
comincia davvero
A questo punto dovreste aver capito bene che
sensazione d ciascun movimento incluso in
questo programma e come si esegue corretta-
mente, nonch come si sceglie un carico impe-
gnativo e si raggiunge lincapacit muscolare.
Durante le quattro settimane successive, con-
tinuerete a fare aggiustamenti nel vostro alle-
namento che focalizzano ulteriormente sullin-
cremento delleffetto di costruzione muscolare.
Tanto per cominciare, gli allenamenti per
tutto il corpo sono ottimi per i principianti e
per le fasi iniziali dellallenamento dopo una
lunga interruzione, per si possono usare solo
pochi esercizi e serie per parte corporea, es-
sendo cos estesa larea da allenare. Suddivi-
dendo lallenamento in due giorni (e in seguito
anche di pi), potete fare pi esercizi e serie
per giorno, cosa che vi permette di allenare un
dato muscolo in modo pi completo e da molte
angolazioni diverse. Dunque, suddividere lal-
lenamento in pi di un giorno il primo pas-
so verso il progresso. Tuttavia, il volume pi
grande richiede anche un riposo supplemen-
tare; adesso allenate ciascun gruppo muscola-
re solo due volte la settimana.
Unaltra cosa importante da considerare
imparare modi diversi di eseguire un dato
esercizio, che sia con bilancieri, manubri,
macchine o cavi. Per esempio, se c una la
di persone che aspetta di usare lattrezzo che
volete usare voi, ci pu rovinare il ritmo del
vostro allenamento, dunque utile conosce-
re delle alternative a quellesercizio. Sappiate
anche che ogni variante leggermente diversa
dallaltra, perci usare alternative a un eser-
cizio aiuta a costruire il muscolo obiettivo in
modo pi completo perch aggiunge variet
allallenamento. Cercate di usare nel vostro al-
lenamento tipi diversi di attrezzatura, facendo
cambiamenti regolarmente. Ecco gli attrezzi
pi comuni che si trovano nelle palestre e i
vantaggi diversi di ciascuno.
Q Macchine. Ottime per i principianti
perch consentono solo il movimento per
cui sono state progettate; dovete solo adat-
tarle al vostro corpo, posizionarvi e spinge-
re. Non c bisogno di bilanciare i carichi.
QBilancieri. Vi permettono di lavorare
con carichi pesanti, per dovete bilanciar-
DISTENSIONE SOPRA LA TESTA
ALLA MACCHINA DA SEDUTI
O ESECUZIONE CORRETTA Adattate la macchina al vostro corpo e sedetevi
con il busto eretto, aferrando le impugnature lateralmente alle spalle, con i piedi
distanziati e completamente appoggiati sul pavimento. Spingete le impugnature
con energia direttamente verso lalto fino a stendere completamente le braccia e
poi abbassate il carico in modo controllato.
O CONSIGLIO IMPORTANTE Nel punto basso i gomiti devono essere rivolti
verso il basso e ai lati del corpo.
O VARIANTI Bilanciere (distensione sopra la testa con bilanciere da seduti o in
piedi); manubri (distensione sopra la testa con manubri da seduti).
TRAINING
ALLENAMENTO
CONSIGLIO: LALLENAMENTO SPINTATRAZIONE UN SISTEMA DI ALLENAMENTO FONDAMENTALE
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 67
TRAZIONE ALLA LAT
MACHINE CON PRESA LARGA
O ESECUZIONE CORRETTA Adattate al vostro corpo limbottitura
sopra le cosce e sedetevi con il busto eretto, le cosce aderenti alle im-
bottiture e i piedi completamente appoggiati sul pavimento. Aferrate
la sbarra con una presa prona molto pi larga delle spalle. Tenendo la
schiena inarcata in modo naturale, tirate la sbarra verso la parte alta
del petto senza inclinarvi allindietro. Poi permettete al carico di tirare
in alto le braccia fino a stenderle completamente.
OCONSIGLIO IMPORTANTE Tirate i gomiti il pi possibile dietro il
piano del corpo.
OVARIANTI Peso corporeo (trazione alla sbarra); macchina (lat
machine).
REMATORE ALLA T
BAR CON APPOGGIO
PER IL PETTO
O ESECUZIONE CORRETTA Distendetevi sulla
panca afinch il petto sia appoggiato, la testa
sporga dal bordo superiore della panca e i piedi
siano piantati saldamente sul pavimento o sugli
appositi appoggi. Aferrate le impugnature con una
presa prona larga (alcune macchine permettono
posizionamenti diversi delle mani). Tirate i gomiti
pi indietro possibile, portando le piastre verso il
petto, e poi abbassate il carico in modo controllato.
OCONSIGLIO IMPORTANTE Evitate di
staccarvi dallimbottitura mentre tirate, cosa
che aggiunge slancio e impegna i muscoli della
parte bassa della schiena.
OVARIANTI Macchina (rematore alla T bar alla
macchina); manubri (rematore con manubrio a
un braccio).
SOLLEVAMENTO
LATERALE ALLA
MACCHINA
O ESECUZIONE CORRETTA Adattate la macchina al vostro
corpo, poi sedetevi con il busto eretto, aferrando le impugnature
e tenendo gli avambracci premuti saldamente contro le imbotti-
ture. Alzate il pi possibile le braccia lateralmente e poi abbassate
il carico in modo controllato.
OCONSIGLIO IMPORTANTE Non fermatevi quando i gomiti
arrivano allaltezza delle spalle; alzateli il pi possibile cos da
massimizzare la stimolazione del capo mediale dei deltoidi.
OVARIANTI Manubri (sollevamento laterale con manubri); cavi
(sollevamento laterale al cavo a un braccio).
CONSIGLIO: EVITATE DI ALLENARVI NELLA ZONA COMODA
TRAINING
ALLENAMENTO
68 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
li. Costringono entrambi i lati del corpo a
lavorare allunisono.
QManubri. Consentono la massima
libert di movimento attorno a un arti-
colazione, cosicch potete eseguire una
variet maggiore di esercizi lungo un arco
di movimento pi lungo. I manubri ri-
chiedono un numero maggiore di muscoli
stabilizzatori, dunque alla ne sacricate
un po di carico, per costruite i muscoli
ausiliari e secondari.
QCavi. Mentre con i pesi liberi lavorate
direttamente contro la gravit, con i cavi
la linea di trazione viene dai lati, dunque
potete allenare un muscolo da molte ango-
lazioni diverse.
Ecco i punti salienti delle settimane 58.
QEseguite ciascuna delle due routine due
volte la settimana; la routine uno include
i muscoli di spinta (petto, spalle, tricipiti,
pi gli addominali), mentre la routine due
include i muscoli di trazione (schiena,
bicipiti e gambe).
QFate una serie di riscaldamento di cia-
scun esercizio, poi scegliete un carico con
cui vi avvicinate allincapacit muscolare
alle ripetizioni 8-10. Deve essere un carico
pi pesante di quello che avete usato nelle
settimane 3-4.
QEseguite una serie extra di ciascun
esercizio, incrementando il volume totale
dellallenamento.
QProvate regolarmente nuove varianti
degli esercizi nella routine cos da aggiun-
gere variet al vostro allenamento.
LEG EXTENSION
O ESECUZIONE CORRETTA Adattate
la macchina al vostro corpo e sedetevi
con tutta la schiena appoggiata allo
schienale; le ginocchia devono spor-
gere appena dal bordo del sedile, con
la leva imbottita situata appena sopra
le caviglie. Aferrate limpugnatura a
ciascun lato della macchina, stendete
le gambe il pi possibile contraendo i
quadricipiti e poi abbassate il carico in
modo controllato.
O CONSIGLIO IMPORTANTE Le
ginocchia devono passare dalla posi-
zione in cui sono piegate a 90 a quella
in cui sono completamente stese; non
limitate i vostri risultati eseguendo
ripetizioni parziali.
O VARIANTI Peso corporeo (il sissy
squat lesercizio che si avvicina di
pi).
LEG PRESS
O ESECUZIONE CORRETTA Regolate lo schienale e sedetevi appoggiando
tutta la schiena, con i piedi sulla parte centrale della pedana distanziati quanto
la larghezza dei fianchi. Sbloccate la macchina e abbassate il carico in modo
controllato; le ginocchia devono muoversi verso le spalle. Fermatevi prima che la
parte bassa dei glutei si stacchi dallimbottitura. Invertite fluidamente la direzione
e spingete con i talloni fino a stendere completamente le gambe senza bloccare
larticolazione.
O CONSIGLIO IMPORTANTE Posizionare i piedi un po pi in alto sulla pedana
attacca i glutei e i posteriori delle cosce in modo pi eficace; posizionare i piedi
pi in basso pone unenfasi maggiore sui quadricipiti.
O VARIANTI Bilanciere (squat, per un esercizio che pi dificile imparare a
eseguire e che impegna molti pi muscoli stabilizzatori).
TRAINING
ALLENAMENTO
CONSIGLIO: CONTROLLATE LA FASE DI DISCESA DI OGNI RIPETIZIONE
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 69
SOLLEVAMENTO
SULLE PUNTE IN
PIEDI (non mostrato)
O ESECUZIONE CORRETTA Adattate le imbottiture
per le spalle alla vostra altezza e state eretti con gli
avampiedi sulla pedana, i piedi distanziati quanto la
larghezza dei fianchi e le punte rivolte dritte in avanti,
con le spalle completamente appoggiate. Le ginoc-
chia non devono essere bloccate. Sollevatevi sulle
punte il pi possibile e poi portate i talloni pi in basso
possibile in modo controllato.
O CONSIGLIO IMPORTANTE Evitate di trasforma-
re questo movimento in uno squat; le ginocchia
devono restare leggermente piegate durante
tutto il movimento.
O VARIANTI Manubri (sollevamento sulle punte
a una gamba con manubrio); macchina (solleva-
mento sulle punte con busto piegato a 90).
Mano a mano che migliorate, come sicuramente
farete se seguirete le nostre raccomandazioni,
importante che aumentiate il livello di dificolt del
vostro allenamento poich i muscoli diventano pi
forti. facile cadere in una zona comfort, usando lo
stesso carico per lo stesso numero di ripetizioni in
ogni sessione con il risultato che il corpo non cam-
bier mai. Ricordatevi invece che lallenamento con
i pesi si basa sul sovraccarico: i muscoli rispondono
agli oneri dellallenamento diventando pi grossi e
pi forti (ammesso che lalimentazione e il riposo
siano corretti). Per quando si adattano, dovete
alzare la posta, il che significa incrementare il carico,
un concetto chiamato sovraccarico progressivo. In
breve, continuerete a guadagnare solo se continue-
rete a mettervi alla prova in modi intelligenti.
Sovraccarico
progressivo
spingersi avanti
LEG CURL DA DISTESI
O ESECUZIONE CORRETTA Regolate la leva afinch limbot-
titura si trovi appena sopra le caviglie. Distendetevi proni sulla
macchina cosicch le ginocchia sporgano appena dal bordo della
panca, e aferrate limpugnatura a ciascun lato della macchina.
Sollevate limbottitura il pi possibile contraendo i posteriori delle
cosce e poi abbassate il carico in modo controllato.
O CONSIGLIO IMPORTANTE Tenete i piedi a martello e con le
punte dritte, n ruotate in dentro ne ruotate in fuori, cos da ottene-
re uno sviluppo pi simmetrico della parte posteriore delle cosce.
O VARIANTI Manubri (leg curl da distesi con manubrio); macchi-
na (leg curl in piedi, leg curl da seduti)
CURL AL CAVO CON
SBARRA EZ IN PIEDI
O ESECUZIONE CORRETTA State con il petto in fuori e le spalle
indietro, mantenendo la schiena inarcata naturalmente. Aferrate
la sbarra EZ, attaccata a un cavo basso, con una presa supina
larghezza spalle e tenetela con le braccia distese. Contraendo i
bicipiti sollevate la sbarra fino alle spalle e poi abbassate il carico
in modo controllato.
O CONSIGLIO IMPORTANTE Tenete i gomiti bloccati ai lati del
busto; se si spostano in avanti mentre sollevate il carico, il capo
anteriore dei deltoidi sta aiutando nel movimento.
O VARIANTI Manubri (curl con manubri in piedi); sbarra EZ,
bilanciere.
CONSIGLIO: TRATTENETE LA CONTRAZIONE MASSIMA PER UN PAIO DI SECONDI
TRAINING
ALLENAMENTO
70 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
FLESSIONI ALLE
PARALLELE ALLA
MACCHINA PER I TRICIPITI
O ESECUZIONE CORRETTA Adattate la macchina al vostro
corpo e sedetevi con il busto eretto, stringendo la cintura del
sedile, se necessario. Aferrate le impugnature accanto alle
ascelle e, mantenendo il busto eretto, spingete le impugna-
ture verso il pavimento fino a stendere completamente le
braccia, senza per bloccare i gomiti. Poi consentite al carico
di riportare le mani alla posizione iniziale.
O CONSIGLIO IMPORTANTE Tenete i gomiti pi attaccati
possibile ai lati del busto cos da mantenere massima la ten-
sione sui tricipiti; fate in modo che i gomiti non si allarghino.
O VARIANTI Peso corporeo (flessioni alle parallele).
SPINTE IN BASSO AL
CAVO CON PRESA PRONA
O ESECUZIONE CORRETTA Attaccate al cavo alto una sbarra
dritta o leggermente piegata (usatene una con manicotto
rotante per la comodit dei polsi) e state eretti. Aferrate la
sbarra con una presa prona leggermente pi stretta delle
spalle e bloccate i gomiti ai lati del busto. Nella posizione
iniziale gli avambracci sono appena al di sopra del piano
orizzontale. Contraendo i tricipiti, stendete completamente le
braccia, dopo di che consentite al carico di riportare le mani
alla posizione iniziale.
O CONSIGLIO IMPORTANTE Se lasciate che la sbarra vada
troppo in alto, i gomiti si sposteranno in avanti dalla loro
posizione ai lati del busto.
O VARIANTI Manubri (estensioni indietro).
PREACHER CURL
ALLA MACCHINA
O ESECUZIONE CORRETTA Adattate il sedile al
vostro corpo e premete il petto direttamente contro
limbottitura afinch le ascelle siano appoggiate sopra
limbottitura, con i piedi completamente appoggiati
sul pavimento. Aferrate la barra con una presa supina
larghezza spalle. Contraendo i bicipiti, sollevate la barra
il pi possibile e poi abbassatela in modo controllato
fermandovi appena prima che le braccia siano comple-
tamente stese.
O CONSIGLIO IMPORTANTE Impedite ai gomiti di al-
largarsi; devono rimanere in linea con le mani e le spalle.
O VARIANTI Manubri (preacher curl con manubri);
bilanciere (preacher curl con bilanciere).
TRAINING
ALLENAMENTO
CONSIGLIO: DURANTE I PREACHER CURL ASSICURATEVI CHE LE ASCELLE SIANO COMPLETAMENTE APPOGGIATE ALLIMBOTTITURA
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 71
CRUNCH SU PANCA
DECLINATA
O ESECUZIONE CORRETTA Regolate la declinazione
in rapporto alla vostra capacit. Agganciate i piedi
sotto limbottitura e inclinate il busto di 45. Incrociate
le braccia sopra il petto e tenete il mento staccato dal
petto. Alzate il busto contraendo gli addominali e poi
lo abbassate in modo controllato, senza per disten-
dervi completamente sulla panca.
O CONSIGLIO IMPORTANTE Per rendere il movimen-
to pi dificile, potete mettere le mani dietro la testa
oppure potete aumentare la declinazione.
O VARIANTI Cavo (crunch in ginocchio o in piedi);
macchina (qualsiasi variante della upper ab machine);
peso corporeo (movimenti di crunch di base).
SOLLEVAMENTO DELLE
GINOCCHIA DA APPESI
O ESECUZIONE CORRETTA Usando delle imbracature,
appendetevi a una sbarra per trazioni con i gomiti appog-
giati sulle imbracature. Tenete le ginocchia e le anche leg-
germente piegate. Senza usare slancio, alzate le ginocchia
il pi possibile contraendo gli addominali bassi, dopo di che
le abbassate in modo controllato.
O CONSIGLIO IMPORTANTE Non fermatevi quando
le cosce sono perpendicolari al pavimento; alzatele il
pi possibile per massimizzare la stimolazione degli
addominali bassi.
O VARIANTI Peso corporeo (crunch inverso); macchina
(lower ab machine).
CONSIGLIO: NEI CRUNCH SU PANCA DECLINATA INCURVATE LA SCHIENA PER OTTENERE UNA CONTRAZIONE PI FORTE
TRAINING
ALLENAMENTO
Per costruire
un corpo
fantastico non
bastano i pesi
JAMES
ELLIS
KENDALL
WOOD
72 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
DI JERRY
KINDELA, MA, DHS
FOTO DI
ROBERT REIFF
Lasciate perdere il nome di questallungamento. Limitatevi ad appoggiare il fondo-
schiena sui talloni, poi piegatevi in avanti lentamente fino a che il busto tocca le cosce
e le braccia stese toccano il pavimento. ALLUNGA: glutei, cosce fino alle caviglie;
tutta la schiena, soprattutto i dorsali; spalle; braccia e mani. DURATA: assicuratevi di
inspirare ed espirare profondamente, trattenendo lallungamento da un minimo di 30
secondi a un massimo di tre minuti.
Posizione
del bambino
modificata
Copyrighted 2012 by Robert Kennedy Publishing
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 73
Provate questi movimenti modicati, che derivano
prevalentemente dallo yoga e dallatletica leggera,
e osservate la parte inferiore del corpo rispondere
ai vostri sforzi nellallenamento come se foste
stati benedetti da una genetica perfetta.
Quando associate lallenamento per la forza agli esercizi per
la essibilit, le ricompense in termini di forza e guadagni muscolari sono tangibili. Secondo
uno studio piuttosto recente pubblicato sul Journal of Strength and Conditioning Research,
quando gli esercizi con i pesi erano associati allallenamento per la essibilit, i
ricercatori, misurando le prestazioni nel leg press e nella distensione su panca, hanno
osservato che i massimali per dieci ripetizioni aumentavano signicativamente.
Incorporare questi esercizi di stretching, che derivano dallo yoga e dallatletica leggera, nel
vostro regime di allenamento migliorer nettamente larco di movimento; la forza di tendini
e legamenti; lequilibrio, lagilit e altri parametri della prestazione; nonch lipertroa della
parte inferiore del corpo. Eseguiteli in sequenza. E ringraziate di non doverli fare seduti in
una stanza surriscaldata con un maestro di yoga che vi bacchetta le mani.
per la
stretching
forza
Mentre espirate,
piegatevi al punto
vita, spostando
lentamente la testa
verso il pavimento.
Quando la fronte
arriva quasi a toccare
le ginocchia, stendete
le braccia in avanti,
mantenendo i palmi
rivolti verso il basso.
Sedetevi sui
talloni.
Inspirate ed
espirate pro-
fondamente.
Tenente le ginocchia
distanziate pi o meno
quanto le anche.
Fate
Pensate a questa posizione come a una fles-
sione sulle braccia, per permettete alle anche
di abbassarsi verso il pavimento, creando un
leggero inarcamento della schiena. ALLUNGA
E COINVOLGE: braccia, spalle, colonna verte-
brale, core (addominali e vertebre lombari), co-
sce e polpacci. Questa posizione contribuisce
a raforzare la colonna vertebrale, un requisito
essenziale per aumentare i carichi di allena-
mento nel tempo. Nota: se avete problemi alla
parte inferiore della schiena, fareste meglio a
evitare questa posizione. DURATA: trattenete
la posizione per 30 secondi circa. Rilassatevi, e
poi ripetete lallungamento altre due volte.
Posizione del cane
con la testa in su
Se eseguite uno solo di questi allungamenti, scegliete questa posizione
dificile perch probabilmente uno dei migliori allungamenti per i glu-
tei in circolazione. ALLUNGA: oltre alla parte superiore della schiena,
alle spalle e alle braccia, coinvolge i glutei grande e piccolo, il piriforme,
lotturatore interno, e i gemelli inferiore e superiore una maggiore fles-
sibilit in queste aree si traduce in prestazioni migliori nello squat, negli
afondi e nel leg press. Inoltre, questa posizione allunga lo psoas, che si
irrigidisce quando passate troppo tempo seduti. DURATA: lobiettivo
trattenere questa posizione 30-60 secondi per ginocchio.
Posizione del piccione modificata
Mantenete le
anche bloccate
e non muovetele
lateralmente.
Espirate, poi
piegatevi al punto
vita e stendete il
busto e le braccia
in avanti. Inspirate
ed espirate
profondamente.
Guardate in avanti. In alterna-
tiva, per ottenere un allunga-
mento extra, potete spingere
la testa un po pi indietro
(dolcemente), e concentrare lo
sguardo sul sofitto. Inspirate
ed espirate profondamente.
Sollevate la parte
inferiore del corpo,
mantenendo cosce
e polpacci contratti.
I palmi devono stare direttamente
in linea con le articolazioni delle
spalle. Se volete iniziare con unal-
ternativa meno onerosa, piegate i
gomiti, posizionandoli direttamen-
te sotto le spalle e appoggiando gli
avambracci sul pavimento.
Per assumere questa posa, prima
assumete una posizione modificata
(sulle ginocchia) delle flessioni sulle
braccia, e poi portate la gamba
destra verso il ginocchio sinistro.
I glutei e il core
(addominali ed eret-
tori spinali) devono
essere contratti e
bloccati in posizione.
74 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
P
H
O
T
O

C
R
E
D
I
T
BY BILL GEIGER, MA | PHOTOS BY MICHAEL BUTLER
Se eseguiste la versione yoga del movimento,
chiamata janushi-rasana, dovreste toccare il gi-
nocchio con la fronte (ahi!). Ma in questa versione,
ottenete gli stessi benefici senza dover passare
mesi lavorando con uno yogi in India. ALLUNGA:
bicipite femorale e grande gluteo (posteriori delle
cosce e glutei). Questallungamento migliora le
prestazioni nella corsa e nei salti e coadiuva lo
sviluppo dei posteriori delle cosce indotto dagli
esercizi con opposizione di resistenza. DURATA:
10-15 secondi per lato (non piegate o comprimete
eccessivamente il ginocchio piegato).
Allungamento dellostacolista modificato
Questa variante dellafondo
classico non coadiuva solo
la flessibilit muscolare ma
migliora anche lequilibrio e
la stabilit, caratteristiche che
vi aiutano tutte a concentrar-
vi meglio sulla forma e sui
muscoli coinvolti quando vi
allenate con i pesi. ALLUNGA:
la parte inferiore del corpo,
dai polpacci ai posteriori delle
cosce ai quadricipiti, la parte
alta della schiena, il trapezio e
le spalle. DURATA: trattenete
1-3 minuti.
Afondo del
corridore
Piegatevi in
avanti al punto
vita, cercando di
toccare le dita
del piede della
gamba distesa.
Dopo aver disteso entrambe le gambe da
seduti, portate una gamba verso il ginoc-
chio della gamba opposta, posizionando
la pianta del piede contro di esso. Cercate
di mantenere la gamba piegata e il ginoc-
chio il pi vicino possibile al pavimento.
Cercate di
avvolgere
le dita
delle mani
intorno a
quelle dei
piedi.
Assumete la posizione
dellafondo, per stendete
la gamba dietro (il ginoc-
chio non deve toccare il
pavimento) e piegatevi in
avanti al punto vita fino a
che il petto poggia sulla
coscia della gamba avanti.
Stendete
la gamba
dietro.
Posizionate
le mani
direttamente
sotto le spalle,
permettendo
alle punte
delle dita di
appoggiarsi
sul pavimento.
Sollevate
leggermente la
testa, tenendo
lo sguardo fisso
su un punto
direttamente
davanti a voi.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 75
76 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
DI MICHAL KAPRAL |
FOTO DI ROBERT REIFF
2
Corsa di 60 metri
avanti e indietro
Correte per 5 metri e raccogliete un pezzet-
to di legno, correte indietro alla partenza
e posate il pezzo di legno sulla linea di
partenza. Ripetete per una distanza di 10
metri e poi per una distanza di 15 metri, per
un totale di 60 metri.
(vedere tabella a pagina 78)
MATT
MENDRUN
WWW. OLYMPI AN. I T
Il vecchio test militare
Army Physical Fitness Test (APFT)
Forse avete pettorali che fanno colpo sulle
ragazze, ma pensate di avere le capacit per superare il nuovo
test tness proposto per lesercito USA? Se il progetto pilota rice-
ve il benestare dalle alte sfere militari, un nuovo test con cinque
esercizi sostituir il vecchio sistema con tre esercizi, utilizzato da
oltre 30 anni. In n dei conti non penso che sia pi impegnativo,
semplicemente misura cose diverse, dice il generale Richard Lon-
go il sostituto generale in comando dellInitial Military Training,
responsabile delle prove militari. Il test vecchio non misura cose
come lagilit e la coordinazione, elementi fondamentali per i sol-
dati in situazioni di combattimento.
Il nuovo test non assolutamente gi approvato. Il generale Lon-
go e la sua squadra stanno analizzando i dati e le indicazioni che
provengono dai soldati e dagli addestratori della fase pilota condot-
ta su 10.000 atleti, poi le alte sfere dovranno approvare il passag-
gio. Ma questo aggiornamento si sta gi guadagnando i favori degli
esperti militari di tness, compreso Michael W. Nichols, istruttore
di motivazione atletica dellMDI 8, un programma tness allaperto
con base nei pressi di San Diego. Credo che sia unottima idea per-
ch se continuiamo a fare quello che abbiamo sempre fatto otterre-
mo sempre i risultati che abbiamo sempre ottenuto, dice Nicholas,
che ha 12 anni di esperienza come istruttore atletico dei Marines.
Se non cambiamo non riusciremo a sopportare gli oneri posti sul
nostro corpo. Penso che i cambiamenti siano ottimi per il futuro
dellesercito nel suo insieme.
Secondo uno studio condotto congiuntamente da molte agenzie
USA, lobiettivo futuro della preparazione militare evidente nel ti-
tolo dello studio: Costruire latleta soldato. Nellintroduzione del-
lo studio si dice: I soldati sono guerrieri. Un soldato sul campo di
battaglia simili agli atleti professionisti allapice dei loro sport. Per
ottenere successo in entrambi questi ambiti necessario ottimizza-
re la prestazione sica.
LEsercito ha pubblicato dei dati tratti dallanalisi di 8.000 atleti,
fornendo una prima valutazione di cosa potrebbe essere necessario
per superare il nuovo test. Nichols consiglia di mettersi alla prova
dando tutto nel corso del test. Chi usa lintensit massima, dice,
alla ne del test dovrebbe restare senza un briciolo di energia.
Se il nuovo test sar approvato, i parametri e i punteggi saranno
determinati entro lautunno del 2012. Nel frattempo, provate il test
pilota e vedete come ve la cavate.
Puoi superare il
nuovo test fitness
dellesercito U.S.A.,
bello?
Il nuovo test proposto per
lesercito vi far a pezzi.
Flessioni sulle braccia in due minuti 49
Sit-up in 2 minuti 62
Corsa di 3,2 km 15:09
(medie per gli uomini)
Il nuovo
test militare

Copyrighted 2012 by Robert Kennedy Publishing


Olympians News / SUPER FITNESS 77
ALLENAMENTO
78 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
CURIOSIT: LET MASSIMA PER LARRUOLAMENTO ERA 42 ANNI MA STATA ABBASSATA A 35.
1
Flessioni sulle braccia in un minuto: 36
2
Corsa di 60 m avanti e indietro: 16 secondi
3
Vogate in un minuto: 33
4
Salto in lungo da fermo: 2 metri
5
Corsa di 2,4 km: 11:02
Il nuovo test proposto
Army Physical Readiness Test (APRT)
3
1
Vogate in
un minuto
Sostituiscono i sit-up pesanti per la schiena. Per
fare le vogate, distendetevi supini con le gambe
stese, piedi uniti, punte rivolte verso lalto e braccia
stese indietro sopra la testa. Adesso sollevatevi
slanciando le braccia in avanti e piegando le ginoc-
chia a un angolo di 90, estendendo le mani oltre
le ginocchia, poi tornate nella posizione distesa.
Flessioni sulle braccia
in un minuto
Il tempo stato dimezzato a un minuto, per ai soggetti
non pi permesso di modificare la posizione delle
braccia o di fermarsi per riposare durante la prova.
LEsercito USA sta per lanciare quello che ha chiamato Army Physi-
cal Readiness Test (ARPT). Composto di cinque prove, il test or-
ganizzato per misurare il livello di fitness in base a molti parametri,
cruciali per costruire un atleta soldato forte, dicono alcuni esperti.
La tabella (adattata) stata concessa gentilmente dallesercito USA.
Valutazione
dellatleta soldato
CARATTERISTICHE VALUTATE
PROVA FORZA DURATA AGILIT
Corsa di 60 m avanti Forza muscolare della parte Potenza anaerobica Coordinazione velocit e agilit
e indietro inferiore del corpo
Vogate in un minuto Durata muscolare di tutto il corpo Durata muscolare di tutto il corpo Coordinazione di tutto il corpo
Salto in lungo da fermo Forza muscolare della parte Forza muscolare della parte Potenza della parte
inferiore del corpo inferiore del corpo inferiore del corpo
Flessioni sulle braccia Durata muscolare della parte Durata muscolare della parte Stabilit del busto
in un minuto superiore del corpo superiore del corpo
Corsa di 2,4 km Durata muscolare della parte inferiore Durata muscolare della parte Stabilit in velocit
del corpo e capacit aerobica inferiore del corpo e capacit aerobica
2
Corsa avanti e
indietro di 60 metri
Vedere la descrizione a pagina 76.
BY BILL GEIGER, MA | PHOTOS BY MICHAEL BUTLER
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 79
ALLENAMENTO
CURIOSIT: NELLESERCITO USA IL VALORE NORMALE DI GRASSO CORPOREO 24-28%.
1
Flessioni sulle braccia in un minuto: 47
2
Corsa di 60 m avanti e indietro: 15 secondi
3
Vogate in un minuto: 39
4
Salto in lungo da fermo: 2,1 metri
5
Corsa di 2,4 km: 10:59
Fate meglio di questi risultati da
soldato atleta
Non sufciente superare la prova, dovete essere tra i migliori, ecco
quindi i risultati medi di quelli che hanno preso parte alla gara Armys
Drill Sergeant of the Year (sappiate che questi atleti hanno eseguito la
prova dopo tre giorni di esercitazioni intense, senza quasi mai dormire).
4
5
Salto in lungo da fermo
Usate un metro per misurare la di-
stanza saltata da fermo. Misurate
dalla linea di partenza al punto di
atterraggio dei talloni.
Corsa di
2,4 km
Cronometrate il tem-
po di corsa facendo
circuiti di 800 m
oppure sei giri di
una pista di atletica
di 400 m.
distribuita in Italia:
OLYMPIANS S.r.l. TEL. 055/958058
FAX 055/958255
e-mail: info@ olympianstore.it
www.olympianstore.it
USE it.
FEEL it.
SEE it.
NUOVA
FORMULA
con Beta Alanina
CREATINE CLEAR
TM
integratore alimentare
di creatina, beta-alanina e vitamine C e B12, con
edulcoranti, in bustine. Creatine Clear
TM
utile nei
casi di aumentato fabbisogno di creatina.
CREATINE
CLEAR
TH
Confezione da 30 buste da 11,17 g di creatina cad.
(Pari a 90 dosi da 3,723 g di creatina in formula effervescente)
1 confezione peso netto 300 g
38,00 22,80
3 confezione peso netto 300 g
114,00 57,00
GUSTO: neutro dolcicata
con sucralosio
L
e
g
g
e
r
e

a
t
t
e
n
t
a
m
e
n
t
e

l
e

a
v
v
e
r
t
e
n
z
e

e

l
e

m
o
d
a
l
i
t

u
s
o

r
i
p
o
r
t
a
t
e

i
n

e
t
i
c
h
e
t
t
a
.
SCONTO
40%
SCONTO
50%
80 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 81
Il sangue
ACQUA
non
Quando Kyle Clarke ha sdato suo
padre, Dale, a mettersi in forma,
non solo il capofamiglia 61enne
ha accettato, ma il glio
diventato suo allenatore
inessibile, trasformando
i muscoli in un affare
di famiglia
Dale Clarke lotta per completare la 15
a

essione sulle braccia, il viso rosso per lo sforzo, le braccia tre-
manti e i pettorali gi distrutti dalle 9 serie di distensioni su panca
precedenti.
Tieni il sedere basso, gli dice sua moglie Lisa, che guarda
lallenamento.
Non ti fermare, pap, ordina suo glio Kyle.
Ma tu mi prendi in giro!, si lamenta Dale, prima di crollare sul
pavimento della sua palestra domestica di Las Vegas.
Beh, tu sai cosa devi fare per nire il lavoro, fa Kyle a suo padre
che, ora, accasciato sul tappetino guardando il glio e sperando
(sperando con tutto il suo cuore) che stia scherzando. Vedendo che
Kyle non sorride, Dale sbuffa enfaticamente e termina la sua serie di
30 essioni, eseguendo le ultime 15 carponi come fanno le donne.
Questo mi manda davvero fuori di testa, pensa fra s e s, strin-
gendo i denti, mentre Lisa e Kyle ridono e scherzano. Dopotutto,
forse farsi allenare da suo glio non stata unidea cos geniale.
DI MICHAL KAPRAL | FOTO DI TJAMESPHOTO.COM
Copyrighted 2012 by Robert Kennedy Publishing
82 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Naturalmente, il rovescio della medaglia
di quella idea che Dale Clarke non tipo
da rinunciare praticamente a nessuna sda.
Circa un mese dopo, Kyle, tornato a casa
sua a Los Angeles, ascolta in segreteria un
messaggio del padre, Kyle, voglio solo dirti
che in questa casa non si fanno pi essioni
da donnicciola. E, a questo punto, pote-
te essere certo che cos: Dale non parla a
vanvera. Di fatti, nei 4 mesi di allenamento
seguenti, via via che il suo corpo cambiava,
questo perito di macchine medicali 61enne
ed ex capitano dei Marines ha suscitato
lammirazione dei colleghi e fatto voltare
la testa alle donne per la strada (per non
parlare della moglie). Inoltre, ha imparato
qualcosa di nuovo su se stesso e su suo glio.
Non c dubbio che, davanti a Kyle Clar-
ke, molti uomini cederebbero al peccato
dellinvidia se lui non fosse cos terribil-
mente un bravo ragazzo. Affascinante, lo-
quace, divertente, intelligente, umile e forte,
Kyle vive a Hollywood con il suo lavoro di
attore di cinema e presentatore TV, oltre a
essere (tenetevi pronti!) personal trainer
certicato, esperto di equitazione, caval-
catore di tori del circuito professionistico,
esperto di skydiving, batterista, sciatore,
pilota di auto da corsa, stunt driver, pugile,
calciatore e giocatore di pallacanestro ago-
nistico, golsta, triatleta e modello di tness
(in passato apparso su Reps!).
Tuttavia, non sempre stato un superuo-
mo. Da piccolo, era uno dei bambini pi esili
della classe e per lui non stato facile avere
il padre come allenatore di baseball dallet
di 5 anni no al secondo anno della supe-
riori. Mio padre era lallenatore, quindi io
odiavo il baseball, ammette Kyle, ripensan-
doci divertito. E, siamo onesti, a nessuno
sta simpatico il glio dellallenatore. Inoltre,
ero sempre il pi piccolo. Alla ne, croll,
schiacciato da tutte quelle aspettative. Il se-
condo anno delle superiori, un giorno che
suo padre non cera, abbandon infuriato
un allenamento dopo una discussione con il
batting coach su una palla smorzata.
Da allora, non ha pi giocato a baseball
a livello agonistico. Forse, quellostinazio-
ne una caratteristica di famiglia, un trat-
to genetico nella doppia elica del DNA dei
Clarke.
INFORMAZIONE: I NUMERI DEL PADRE DALE CLARKE HA 62 ANNI, PESA 72 KG E VIVE A LAS VEGAS.
ALLENAMENTO
I rivali
Questo non vuol dire che Kyle e suo padre
non andassero daccordo. sempre stato il
mio mentore, dice Kyle del padre, ho
sempre chiesto il suo consiglio; ma per
quanto riguarda il tness, sono sicuramente
stati rivali. Clarke padre si sempre tenuto
in forma e Kyle ha seguito il suo esempio
andando in palestra regolarmente per tutta
luniversit. Dopo le superiori, Kyle costru
una quantit incredibile di muscolo e pass
un anno intero a fare il bullo con il padre.
Dale ricorda che passava un sacco di tempo
camminando per la loro casa di Las Vegas a
torso nudo. Io gli dicevo, Ehi, Kyle, mettiti
una maglietta, ricorda ridendo, e lui indi-
cava la palestra casalinga dicendo, Ma
proprio l sopra, pap.
Quando entr nellesercito con una
borsa di studio completa del Reserve
Ofcers Training Corps, Kyle non era sicu-
ro di come sarebbe andato perch, sebbene
Dale fosse stato per 6 anni capitano dei
Marines, lui non sapeva niente di quellam-
biente. Non sapeva neanche che grado
avessi o cosa fosse un capitano, dice Dale.
Io gli dicevo,
Ehi, Kyle,
mettiti una
maglietta
e lui indicava
la palestra
casalinga
dicendo, Ma
proprio l
sopra, pap.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 83
ESEMPIO DI ALLENAMENTO
Black Powder 30 minuti prima dellallenamento
Frullato proteico Pro-NOS, 42 g di proteine subito dopo lallenamento
NO2 Red, 2 la mattina, 1 il pomeriggio (a stomaco vuoto)
Integratori
GIORNO 1
ESERCIZIO SERIE RIPETIZIONI
DISTENSIONI SU PANCA ALLA MACCHINA 3 15
PEC-DECK 3 15
DISTENSIONI SU PALLA, CON MANUBRI 3 15
FLESSIONI 10 NORMALI/10 CON BRACCIA DISTANZIATE/10 CON LE MANI A DIAMANTE
SPINTE IN BASSO AL CAVO PER I TRICIPITI 4 15
ESTENSIONI PER I TRICIPITI (PIEGATO IN AVANTI) 4 15
ESTENSIONI SOPRA LA TESTA CON MANUBRI 3 15
FLESSIONI ALLE PARALLELE CON PESO CORPOREO 3 15
GIORNO 2
ESERCIZIO SERIE RIPETIZIONI
TRAZIONI ALLA LAT MACHINE 3 15
REMATORE CON BILANCIERE 3 15
REMATORE ALLA MACCHINA 3 15
STACCO DA TERRA CON GAMBE TESE 3 15
CURL CON MANUBRI 4 15
CURL ALLA MACCHINA 3 15
CURL TRASVERSALE CON PRESA A MARTELLO 4 15
PREACHER CURL A UN BRACCIO CON MANUBRIO 3 15
CURL PER I BICIPITI CON MANUBRIO (SISTEMA 21) 3 21*
GIORNO 3
ESERCIZIO SERIE RIPETIZIONI
SQUAT 4 12
AFFONDO 3 10
SOLLEVAMENTI SULLE PUNTE DEI PIEDI 4 ALLINCAPACIT
DISTENSIONI SOPRA LA TESTA SU PALLA, CON MANUBRI 3 15
SOLLEVAMENTI LATERALI, PIEGATI IN AVANTI 3 15
SOLLEVAMENTI FRONTALI IN SUPERSERIE CON SOLLEVAMENTI LATERALI 3 10
SCROLLATA CON MANUBRI 4 15
CUFFIA DEI ROTATORI (ROTAZIONE INTERNA ED ESTERNA CON ELASTICO) 3 15
ADDOMINALI
ESERCIZIO SERIE RIPETIZIONI
FESSIONI LATERALI DEL BUSTO 3 ALLINCAPACIT
SOLLEVAMENTI DELLE GAMBE 3 ALLINCAPACIT
CRUNCH CON PALLA 3 ALLINCAPACIT
ASSE 3 ALLINCAPACIT
Lallenamento di Dale Clarke
INFORMAZIONE: KYLE HA LAVORATO COME PERSONAL TRAINER, ATTORE, MODELLO, STUNT DRIVER E CAVALCATORE DI TORI PROFESSIONISTA.
3 giorni di allenamento, 1 di riposo
* Fate 21 ripetizioni totali con pesi pi leggeri, iniziando con 7 ripetizioni della met bassa
del curl e 7 ripetizioni dal punto medio a quello alto, finendo con 7 curl completi.
ALLENAMENTO
INFORMAZIONE: UN VANTAGGIO ALIMENTARE INGIUSTO? DALE CLARKE SPOSATO CON UNA CHEF.
Mio padre
era lallenatore,
quindi io odiavo
il baseball.
Siamo onesti,
a nessuno sta
simpatico il figlio
dellallenatore.
Ma dissi a mia moglie che, con il suo si-
co, sarebbe andato benissimo, e lo fece,
oltre a diventare il secondo capitano
Clarke della famiglia in due generazioni
consecutive.
Scambio di ruoli
Dopo 5 anni come Capitano dellesercito,
Kyle si trasfer a Los Angeles per costruirsi
una carriera come attore e modello. Intan-
to, dopo un infortunio al menisco (i pro-
blemi alle ginocchia possono fare questo a
un uomo) e frequenti turni di 12 ore come
responsabile delle macchine durante gli in-
terventi spinali, Dale aveva perso la sua for-
ma sica. Un giorno Kyle sugger di fare una
foto insieme per una linea di abbigliamen-
to in occasione della Festa del Pap e Dale
accett, capendo che non poteva pi usare
lincidente al menisco come scusa. La gen-
te diceva, Non puoi tornare in forma come
ai tempi delle superiori, racconta, cos
chiesi a Kyle e lui mi disse, Pap, puoi rag-
giungere la forma che desideri.
Kyle, che ormai era un personal trainer
certicato, gli prepar un programma di
alimentazione e allenamento. Dopo tutto
ci che ho imparato da lui nella mia vita,
ricorda di aver pensato, ora ho loccasione
per rendergli il favore.
Dopo 2 settimane, Kyle chiam
il padre e scopr che Dale aveva
seguito il programma senza fare
il furbo, neanche una volta. Un
tempo ero un pilota dei Marines,
spiega Dale, quindi per me tutto
bianco o nero. Kyle mi dice di fare
una cosa e io la faccio. Di solito,
Dale faceva la sua ora di allenamen-
to alle 5:00 del mattino, al buio nella
piccola palestra domestica, mentre
sua moglie dormiva nella stanza accanto.
Spesso, per aumentare lenergia mattutina,
prendeva una cucchiaiata di Black Powder,
un integratore per lossido di azoto della
MRI, e terminava la sessione con un frullato
proteico.
Il resto del programma alimentare com-
prendeva molta carne magra, insalata, ver-
dure e frutta secca, oltre agli integratori
NO2 Red che, secondo la MRI, non miglio-
rano solo lattivit vascolare, ma anche il re-
cupero dopo lallenamento.
84 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
ALLENAMENTO
WWW. OLYMPI AN. I T
INFORMAZIONE: ENTRAMBI I CLARKE SONO STATI MILITARI. KYLE NELLESERCITO E DALE NEI MARINES.
Alzati e fallo!
Ogni volta che la sua motivazione calava
(non molto spesso), Dale chiamava il glio.
Alzati e fallo!, gli ordinava quello. Dale
ricorda che, anche quando Kyle non era a
telefono o nella palestra di casa con lui, Po-
tevo sentire la sua voce nella testa che mi di-
ceva, Sono orgoglioso di te, pap. Abbiamo
tutti bisogno di qualcuno cui rendere conto
e, nel mio caso, mio glio.
Ogni 2 settimane, Kyle tornava a Las Ve-
gas per vedere la famiglia e non dimenticava
mai di allenarsi con il padre ogni giorno del
suo soggiorno. Ci allenavamo insieme, solo
padre e glio, racconta. La prima volta
che nimmo una sessione insieme, ci limi-
tammo a darci il cinque e andare via, ma poi,
separatamente, andammo entrambi da mia
madre per raccontarle tutto nei dettagli.
Nella famiglia Clarke, il sangue non acqua.
Presto, tutto il duro lavoro inizi a dare
risultati. A lavoro i colleghi di Dale comin-
ciarono a notare i suoi nuovi muscoli, fa-
cendo commenti sul suo petto massiccio e
sulle sua braccia sempre pi magre e grosse.
Quando inizi a ottenere dei risultati, faci-
le rimanere motivati, dichiara Dale.
Benefici per la salute
Quattro mesi dopo aver iniziato il program-
ma, Dale and dal medico per un secondo
controllo del grasso corporeo e di altri indi-
catori della salute. Il medico era stato sor-
preso dal 18,8% di grasso scoperto nella pri-
ma visita, ma rimase a bocca aperta davanti
al nuovo risultato: uno strabiliante 8,5%.
Mi sembrava di avere 30 anni, dice Dale.
E si montato la testa? Forse solo un
po. Qualche tempo fa andato da Kyle, ha
contratto i bicipiti e ha dichiarato, Penso
di averti battuto!. Poi, ha chiarito, Il suo
braccio era pi grosso, ma secondo me io
avevo pi denizione. Ma Kyle non ne ha
voluto sapere. Maggiore denizione? Ah!
Non pu dire di essere pi grosso di me per-
ch i numeri non mentono, quindi ci prova
con la denizione. Avrebbe dovuto provare
con la vascolarit, forse con quella potrebbe
battermi per un sofo. Ma la denizione?
Ma va! Non se ne parla neanche!.
Ad aprile, quando compir 30 anni, Kyle
avr i requisiti per entrare nel programma
di allenamento della Boston Red Sox Fan-
tasy League, in cui suo padre ha giocato
negli ultimi 20 anni. Kyle non vede lora di
migliorare le sue abilit nel baseball, una
nuova capacit (s, unaltra ancora) che lo
riporta agli anni delladolescenza e, maga-
ri, spera di imparare una o 2 cose da suo
padre. R
Olympians News / SUPER FITNESS 85
ALLENAMENTO
KEVIN
PEROD
86 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 87
Usate questo programma
ad alta intensit di
quattro settimane e
costruirete braccia che
vi faranno venir voglia di
uscire in canottiera e
non occorrono bilancieri
AGGIUNGETE
DUE
CENTIMENTRI
DI MUSCOLO
ALLE BRACCIA
DI ERIC VELAZQUEZ, NSCA-CPT | FOTO DI ALEX ARDENTI
IN 4 SETTIMANE
Siccome le braccia tendono ad ave-
re meno grasso corporeo rispetto alle altre aree,
di solito possibile conferir loro una forma ma-
scolina in molto meno tempo di quanto occorre
per le altre parti corporee, e tutto questo cer-
cando al contempo di ottenere quel punto vita
pi magro. Dunque, anche se non pensate che i
vostri addominali siano pronti per essere esibi-
ti per fortuna mancano ancora molti mesi alla
primavera e allestate , adesso il momento di
migliorare quelle braccia. Vi occorrono solo tem-
po quattro settimane e un ottimo programma.
Il programma eccolo qui!
Copyright 2012 by Robert Kennedy Publishing
88 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
CONSIGLIO: CON LE SERIE TABATA OCCORRE ALLENARSI A TUTTA.
ALLENAMENTO
QUATTRO SETTIMANE
A PARTIRE DA ADESSO
Se siete pronti a dedicarvi a un trattamento per
le braccia di quattro settimane, vi aiuteremo ad
allargare di oltre 2 cm le maniche delle vostre
camicie. Il programma progressivo qui presen-
tato trae vantaggio da alcune semplici tattiche
di allenamento che sono metodi di provata ef-
cacia per costruire i bicipiti e i tricipiti. Tuttavia
il prezzo da pagare e ce n sempre uno con-
siste nelluscire dalla zona comoda e impegnarsi
un po di pi a ogni sessione, entrando talvolta
nella zona nessun dolore, nessun guadagno.
Proprio cos, vi stiamo dicendo: uomini, datevi
da fare se volete braccia da uomo.
Anche se ogni settimana eseguirete gli stessi
esercizi tutti con i manubri , durante il mese
userete livelli diversi di difcolt per indurre
nuova crescita e denizione in quelle vostre
braccia addormentate (o pigre).
Anche se sembra gi una promessa solenne,
aggiungiamo questo: non dovrete andare mil-
le volte in palestra per ottenere quel risultato.
Questo programma richiede solo una panca
regolabile e qualche manubrio, perci potrete
costruire bicipiti e tricipiti nuovi in privato (per
esempio, nel vostro garage) prima che arrivino
le stagioni pi calde.
PERCH I MANUBRI?
Usare manubri per un mese pu non sembrare
una cosa allettante, per i manubri offrono be-
neci innegabili. Anche nei movimenti in cui si
sollevano entrambi i manubri simultaneamente,
ciascun braccio costretto a lavorare da solo.
Questo tipo di allenamento costringe ciascun
braccio a impegnare un numero totale maggio-
re di bre muscolari per completare i solleva-
menti. Ci signica che in questo modo diven-
terete pi forti e recluterete pi muscolo. La
ricerca mostra che, nella maggior parte degli
esercizi, quando latleta nella media usa i ma-
nubri riesce a usare no al 20% in pi di carico
rispetto a quando usa un bilanciere. Dunque,
se riuscite a eseguire il curl con bilanciere con
45 kg per dieci ripetizioni, potete aspettarvi di
eseguire lo stesso numero di ripetizioni di curl
con manubri da 27 kg oppure no a due ripeti-
zioni in pi con manubri da 23 kg. Inne, usare
i manubri signica cambiamenti di carico veloci
e periodi di riposo brevi, cose fondamentali per
ottenere un ottimo pompaggio continuando al
contempo a bruciare grasso.
La cosa fondamentale per unottima pre-
parazione allestate la frequenza. Invece di
allenare separatamente i muscoli delle braccia
come obiettivi secondari insieme a parti corpo-
ree pi grandi durante la settimana, metterete
insieme bicipiti e tricipiti nella stessa sessione
e li allenerete due volte la settimana. Concede-
tevi almeno 72 ore di recupero tra le sessioni.
Scegliete per esempio i giorni luned e gioved
o marted e venerd.
1
CURL ALTERNATO
CON MANUBRI IN PIEDI
O ENFASI: bicipite brachiale (entrambi i capi)
O ESECUZIONE CORRETTA: state eretti tenendo un paio di manubri ai
lati del corpo, le braccia stese e i palmi rivolti verso linterno. Tenete gli
addominali contratti, il petto in alto e la testa eretta. Tenendo i gomiti
attaccati ai lati del busto, sollevate un manubrio verso la spalla contra-
endo il bicipite, ruotando il palmo verso lalto quando superate il punto
intermedio del movimento. Spremete nel punto alto del movimento, poi
riabbassate lentamente il manubrio lungo lo stesso arco di movimento e
passate allaltro lato.
O CONSIGLIO: a differenza dei preacher curl e dei curl su panca incli-
nata, questo costruttore di massa standard eseguito sempre con le
braccia ai lati del corpo. Non permettete ai gomiti di spostarsi in avanti
nel tentativo di portare i carichi pi in alto.
Quando eseguite il
curl, supinate il polso
per ottenere una
contrazione pi forte.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 89
ESERCIZIO SERIE
1
RIPETIZIONI
2
1) Curl alternato con manubri in piedi 3 12, 10, 10
2) Estensione su panca piana con manubri 3 12, 10, 10
3) Curl con manubri su panca inclinata 3 12, 10, 10
4) Estensione indietro con manubrio 3 12, 10, 10
5) Curl di concentrazione 3 12, 10, 10
6) Estensione sopra la testa 3 12, 10, 10
con manubrio a un braccio da seduti
7) Curl alternato con presa a martello 3 12, 10, 10
8) Flessione sulle braccia con mani ravvicinate
3
3 Allincapacit
In tutti gli esercizi, non riposatevi pi di 30-45 secondi tra le serie. Non riposatevi pi di 90
secondi tra gli esercizi.
1 Non sono indicate le serie di riscaldamento; eseguitene quante vi sono necessarie per non
portate mai le serie di riscaldamento allincapacit muscolare.
2 Scegliete un carico che vi faccia raggiungere lincapacit muscolare alla ripetizione prefissata.
Ogni settimana, seguite un principio diverso di allenamento avanzato.
Settimana 1: nellultima serie di ciascun esercizio, eseguite 23 ripetizioni forzate usando un
braccio per volta o facendovi aiutare da un compagno di allenamento.
Settimana 2: nellultima serie di ciascun esercizio, dopo
aver raggiunto lincapacit, riducete del 2030% il carico
usato e continuate a macinare ripetizioni di nuovo fino
allincapacit. Eseguite 12 serie a scalare totali in
questo modo e poi passate allesercizio successivo.
Settimana 3: dopo aver completato lallenamento
come indicato, scegliete 12 esercizi rispettivamente
per i bicipiti e i tricipiti ed eseguite una serie di cento
ripetizioni.
Settimana 4: dopo aver completato lallenamento
come indicato, scegliete 12 esercizi rispettivamente
per i bicipiti e i tricipiti ed eseguite una serie
Tabata. Cominciate con un carico con cui
riuscite a eseguire a malapena 1215
ripetizioni. Annotate il numero totale
di ripetizioni eseguite negli otto
segmenti di allenamento.
3 Per questo esercizio non si
usano tecniche avanzate. Portate
semplicemente ciascuna serie
allincapacit muscolare e
a ogni sessione successiva
cercate di completare
un numero maggiore di
ripetizioni.

GUADAGNATE 2 CM IN 1 MESE
CONSIGLIO: INCREMENTATE LE RIPETIZIONI DI FLESSIONI SULLE BRACCIA A OGNI SESSIONE.
TENETE I MUSCOLI
SULLA CORDA
Per continuare a impegnare strati sempre pi
profondi di tessuto muscolare, usate le tecniche
che trovate qui per ciascuna settimana. Ricor-
datevi, vi baster allenare le braccia otto volte
per ottenere risultati, per dovrete allenarvi a
tutta.
SETTIMANA 1 | RIPETIZIONI FORZATE Questa
settimana comincia in modo abbastanza sem-
plice con serie normali di alcuni esercizi di base.
Tuttavia, fondamentale concentrarsi sullese-
guire i movimenti e scegliere i carichi in modo
corretto, perch questi esercizi rimangono per
il resto del programma. Questa settimana vi im-
pone di usare un carico progressivamente pi
pesante in ogni serie cos da costruire la forza
per il lavoro successivo. Ciascun esercizio si
conclude con una e non pi di una serie che
include 2-3 ripetizioni forzate.
Perch le ripetizioni forzate? Portare una
serie allincapacit fondamentale per indurre
la crescita muscolare, dunque se non vi allena-
te no allincapacit, gi questo un ostacolo
alla crescita muscolare. La ricerca mostra che
i soggetti che si allenano usando le ripetizioni
forzate ottengono un rilascio del 200% maggio-
re di ormone della crescita (GH) responsabile
sia della crescita sia dellossidazione di grasso
rispetto ai soggetti che non le usano. Potete
eseguire le ripetizioni forzate in due modi: fa-
cendovi assistere in palestra o usando la mano
libera per auto-assistervi, a patto che suddivi-
diate i movimenti bilaterali con manubri in due
fasi allenando i lati destro e sinistro in modo
indipendente.
Tuttavia, come tutte le tecniche avanzate
di costruzione muscolare, le ripetizioni forza-
te devono essere usate con moderazione; qui
usatele nellultima serie di ciascun esercizio.
I ricercatori dellAustralian Institute of Sport
di Canberra hanno scoperto che i soggetti che
hanno portato allincapacit molte serie di di-
stensione su panca hanno guadagnato meno
forza rispetto a quelli che hanno portato allin-
capacit solo una serie. Nelle altre serie assicu-
ratevi di usare un carico che nellintervallo di
ripetizioni pressato vi fa arrivare vicino allin-
capacit.
ESECUZIONE CORRETTA: nellultima se-
rie di ciascun esercizio, dopo aver raggiunto
lincapacit iniziale, usate la mano libera o
un compagno di allenamento per completare
2-3 ripetizioni supplementari che senza aiu-
to non sareste riusciti a eseguire.
SETTIMANA 2 SERIE A SCALARE Questa setti-
mana alzerete un po la posta usando le serie a
scalare. Includendo queste serie, innescherete
un fattore fondamentale di crescita muscolare
per le braccia durante le settimane successive
aumentando il usso sanguigno. Anche se ap-
portare quantit abbondanti di sangue ossige-
ALLENAMENTO DELLE BRACCIA

Allenate
le braccia
correttamente
e otterrete
quasi sempre
un buon
pompaggio.
ALLENAMENTO
90 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
CONSIGLIO: NELLE ESTENSIONI SU PANCA PIANA CONTRAETE I TRICIPITI NEL PUNTO ALTO.
nato ai muscoli importante qualunque sia
la parte corporea allenata, le braccia sono
particolarmente sensibili ai pompaggi enor-
mi. Laumento del usso ai bicipiti e ai tri-
cipiti sottopone ad allungamento la guaina
che li circonda (chiamata fascia muscolare),
e ci ritenuto produrre una sintesi protei-
ca, o ricostruzione muscolare, maggiore. Le
serie a scalare, che, dopo il raggiungimento
dellincapacit, vi permettono di continuare
una serie ben oltre lincapacit riducendo il
carico del 20-30%, attirano alle braccia un
volume enorme di sangue e acqua che produ-
ce un pompaggio evidente, gonamaniche e
desiderabile dal punto di vista ormonale.
In pi, le serie a scalare hanno mostrato
di favorire la crescita muscolare producendo
un rilascio di ormone della crescita tre volte
maggiore rispetto a quando ci si allena solo
no alla prima incapacit.
ESECUZIONE CORRETTA: nellulti-
ma serie di ciascun esercizio, dopo aver
raggiunto lincapacit iniziale, riducete
del 20-30% il carico usato e continuate a
macinare ripetizioni di nuovo no allin-
capacit. Eseguite 1-2 serie a scalare totali
in questo modo e poi passate allesercizio
successivo.
SETTIMANA 3 SERIE DI CENTO RIPETIZIONI
il momento di alzare un po la posta di
nuovo. Per aumentare ulteriormente il usso
sanguigno ai muscoli, reclutando anche pi
bre muscolari possibile, incrementerete il
volume considerevolmente includendo se-
rie di cento ripetizioni. Questa tecnica, che
impone di eseguire cento ripetizioni pi leg-
gere per dolorose, particolare per la sua
capacit di reclutare vari tipi di bre (invece
che solo le bre a contrazione veloce), incre-
mentando anche il glicogeno totale brucia-
to durante un allenamento. Il glicogeno, o
zucchero immagazzinato, usato in misura
maggiore durante lallenamento di grande
volume, cosa che crea una condizione pi fa-
vorevole per lossidazione del grasso.
Per eseguire una serie corretta di cen-
to ripetizioni, scegliete un carico pari al
20-30% di quello che potreste usare per die-
ci ripetizioni corrette di un dato esercizio
(dunque, se riuscite a usare 50 kg per dieci
e solo dieci ripetizioni, il vostro carico di al-
lenamento deve essere 10-15 kg; magari per
cominciare provate 12 kg). Il vostro obiettivo
completare settanta ripetizioni totali circa
prima di raggiungere lincapacit. Vi ripo-
sate solo tanti secondi quante ripetizioni vi
restano per arrivare a cento (per esempio, se
raggiungete settanta ripetizioni, vi riposate
trenta secondi) e continuate, ripeto, riposan-
do solo tanti secondi quante ripetizioni re-
stano nella serie. Una volta raggiunte cento
ripetizioni, avete nito probabilmente in
pi di un senso.
Anche se inizialmente questo tipo di alle-
namento pi leggero fa afdamento princi-
palmente sulle bre di durata a contrazione
lenta, quando lenergia viene meno entrano
in gioco anche le bre a contrazione veloce,
inclini alla crescita, per completare le ripe-
tizioni. Risultato? Un bruciore estremo che
aiuter a rimodellare i vostri bicipiti e tricipi-
ti in modo considerevole.
ESECUZIONE CORRETTA: dopo aver
completato lallenamento come indicato,
scegliete 1-2 esercizi rispettivamente per i
bicipiti e i tricipiti ed eseguite una serie di
cento ripetizioni.
ESTENSIONE SU PANCA PIANA CON MANUBRI
O ENFASI: capo interno (lungo)
O ESECUZIONE CORRETTA: distendetevi supini su
una panca piana con i piedi completamente appog-
giati sul pavimento, le braccia completamente stese
e perpendicolari al pavimento. Piegando i gomiti,
abbassate lentamente i manubri verso la parte alta
della testa. Quando le braccia sono piegate a 90,
invertite la direzione e stendete con forza le brac-
cia, riportando i manubri alla posizione iniziale.
O CONSIGLIO: nellestensione su panca piana im-
pegnate ciascun capo dei tricipiti, ponendo lenfasi
sul massiccio capo interno (lungo)
2
ALLENAMENTO
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 91
CONSIGLIO: RESISTETE ALLA GRAVIT DURANTE LA FASE ECCENTRICA.
SETTIMANA 4 LORA TABATA Se la settima-
na precedente verteva su numeri di ripetizioni
allucinanti, questa settimana verte ancora su
numeri di ripetizioni allucinanti, per eseguiti
con carichi pi pesanti. Lallenamento Tabata
prevede lesecuzione di otto segmenti di ripe-
tizioni, ciascuno di venti secondi, con dieci se-
condi di riposo tra luno e laltro. Questo stile
di allenamento ha mostrato di aumentare la ca-
pacit sia anaerobica sia aerobica in un periodo
di tempo molto breve. In altre parole, questo
tipo di allenamento pu rendervi pi forti e pi
magri.
Per eseguirlo correttamente, scegliete un
carico leggermente pi pesante uno che riu-
scite a usare per 12-15 ripetizioni controllate in
un periodo di venti secondi. Anche se non do-
vete eseguire queste ripetizioni in modo veloce,
non dovete neanche andare troppo lentamen-
te perch dovete completarne il pi possibile
nellarco breve di venti secondi (molto proba-
bilmente riuscirete a farne quindici nella prima
o nelle prime due serie, per vi renderete conto
velocemente che ogni serie successiva diventa
pi dura). Usando un orologio ben in vista, un
cronometro normale o uno ufciale per Tabata
(www.gymboss.com), eseguite ripetizioni per
venti secondi e poi vi riposate solo dieci secon-
di. Andate avanti cos no a che avete eseguito
otto segmenti da venti secondi di ripetizioni. In
ciascuna serie raggiungerete lincapacit pri-
ma, e questo va bene. Contate semplicemente il
numero totale di ripetizioni per lintera sequen-
za Tabata e alla sessione successiva cercate di
migliorarlo o di uguagliarlo con un carico pi
pesante.
ESECUZIONE CORRETTA: dopo aver
completato lallenamento come indicato,
scegliete 1-2 esercizi rispettivamente per
i bicipiti e i tricipiti ed eseguite una serie
Tabata. Cominciate con un carico moderato
(deve essere un carico che riuscite a usare
per solo 12-15 ripetizioni) ed eseguite pi ri-
petizioni possibile in venti secondi usando
la forma corretta. Annotate il totale delle
ripetizioni eseguite negli otto segmenti di
allenamento.
In circostanze normali, usare questo tipo
dintensit in un periodo di tempo cos breve
sarebbe controindicato. Per, a mali estremi
estremi rimedi, e quelle braccia vi occorrono
per avere un aspetto elegante e vigoroso per i
vostri impegni estivi. Moderando il numero
totale di serie in ogni allenamento, potete mi-
gliorare il recupero tra le sessioni, pur allenan-
do le braccia due volte la settimana. Seguite il
programma come indicato, stando attenti a non
abusare delle tecniche dintensit prescritte, e
vi garantiamo che sarete soddisfatti dei vostri
risultati. E anche se per alcune settimane potre-
ste essere pi indolenziti del solito, vi consoli
sapere che potete comprare vestiti senza mani-
che comodamente su Internet.
CURL CON MANUBRI SU PANCA INCLINATA
O ENFASI: capo lungo (esterno)
O ESECUZIONE CORRETTA: inclinate una panca a 60 circa e sedetevi
con la schiena completamente appoggiata alla panca e i piedi pian-
tati sul pavimento. Le braccia devono stare distese ai lati del corpo,
con i palmi rivolti verso lalto. Tenendo le spalle allindietro e la parte
superiore delle braccia in una posizione bloccata perpendicolare al
pavimento, sollevate i manubri avvicinandoli alle spalle. Nel punto alto
spremete con forza i bicipiti, per poi ritornare lentamente alla posizione
iniziale.
O CONSIGLIO: questo esercizio poco usato per i bicipiti attacca il ben
visibile capo esterno in quanto, con la parte superiore delle braccia
dietro il piano del corpo, allungato maggiormente.
3
Quando usate la panca inclinata,
tenete la parte superiore delle
braccia indietro per focalizzare
sul capo lungo.
ALLENAMENTO
92 Olympians News / SUPER FITNESS
4
CONSIGLIO: AUMENTATE LE PROBABILIT DI SUCCESSO GESTENDO IL CARICO DI SERIE IN SERIE.
Allenarsi con i pesi
necessario anche
se costa fatica.
ESTENSIONE INDIETRO CON
MANUBRIO
O ENFASI: capo esterno (laterale)
O ESECUZIONE CORRETTA: piegatevi in
avanti su una panca e bloccate la parte
superiore del braccio al lato del corpo,
con il gomito piegato a 90 circa. Tenendo
ferma la parte superiore del braccio, solle-
vate la parte inferiore no a stendere com-
pletamente il braccio. Riportando la parte
inferiore del braccio alla posizione iniziale,
non permettete al gomito di abbassarsi.
O CONSIGLIO: questo movimento diso-
lamento accentua ulteriormente il capo
esterno e pi visibile dei tricipiti.
CURL DI CONCENTRAZIONE
O ENFASI: capo lungo (esterno)
O ESECUZIONE CORRETTA: sedetevi sul bordo di una panca
piana e piegatevi in avanti, afferrando un manubrio con una presa
supina e appoggiando il braccio che lavora alla parte interna del-
la coscia dello stesso lato. Muovendo solo la parte inferiore del
braccio, sollevate il manubrio il pi possibile. Nel punto alto spre-
mete il bicipite e poi abbassate il manubrio in modo controllato.
O CONSIGLIO: ponendo lenfasi sul capo lungo, il curl di concen-
trazione aiuta ad aumentare il picco, o altezza, del bicipite.
REGOLA 1: per attaccare i bicipiti e i tricipiti nel
modo pi eficace possibile, meglio allenarli in
un giorno dedicato alle braccia invece che insie-
me a parti corporee pi grandi come la schiena
o il petto. Ci vi permette di usare un volume pi
grande e carichi pi pesanti, perch le braccia non
sono afaticate dallesecuzione di altri sollevamenti.
REGOLA 2: alternate i movimenti per i bicipiti e
i tricipiti per permettere un recupero migliore
allinterno dellallenamento. Ci massimizza la
quantit di carico che potete usare con la forma
corretta per ciascun esercizio e aumenta ulterior-
mente laflusso di liquidi nelle braccia.
REGOLA 3: usate angolazioni ed esercizi
diversi per ottimizzare lattacco ai muscoli delle
braccia. Pur essendo gruppi muscolari piccoli,
richiedono comunque molti stimoli diversi per la
massimizzazione della crescita.
REGOLA 4: concentratevi sullottenere una con-
trazione massima in ogni ripetizione. Ci vi aiuta
a ottimizzare i pompaggi e aumenta anche il tempo
sotto tensione muscolare, aprendo cos la strada a
guadagni a lungo termine maggiori.
REGOLA 5: scegliete un carico che provoca
lincapacit allintervallo di ripetizioni pre-
scritto. Per esempio, se vi fermate dopo dodici
ripetizioni quando avreste potuto farne 1520,
dovete incrementare il carico per la serie successi-
va. Analogamente, se non riuscite a raggiungere un
dato numero di ripetizioni, la volta successiva che
eseguite lesercizio dovete ridurre il carico.
REGOLA 6: per incrementare il pompaggio e il
bruciore muscolare usate tecniche dintensit
come ripetizioni forzate, serie a scalare, cento
ripetizioni e Tabata, per solo nel modo prescrit-
to. Abusarne non produce risultati migliori, anzi
pu provocare superallenamento e infortuni.
GUADAGNATE DUE CENTIMETRI
IN UN MESE
REGOLE DI ALLENAMENTO
5
WWW. OLYMPI AN. I T
ALLENAMENTO
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 93
6
ESTENSIONE SOPRA
LA TESTA CON
MANUBRIO A UN
BRACCIO DA SEDUTI
O ENFASI: capo interno (lungo)
O ESECUZIONE CORRETTA: sede-
tevi eretti sulla panca, con i piedi
completamente appoggiati sul pavi-
mento. Tenendo la schiena dritta e lo
sguardo rivolto in avanti, posizionate
un manubrio direttamente sopra la
testa con il braccio completamente
steso. Piegando solo il gomito e te-
nendo la parte superiore del braccio
ferma accanto allorecchio, abbas-
sate il manubrio dietro la testa no
a che il braccio forma un angolo di
90. Riportate in alto il manubrio no
a stendere completamente il braccio
e nel punto alto spremete con forza
il tricipite.
O CONSIGLIO: questo movimento
sottopone a un ottimo allungamento
il capo lungo del tricipite, quello che
determina maggiormente la massa
della parte superiore del braccio.
O ENFASI: capo
lungo e brachiale
O ESECUZIONE
CORRETTA: state
eretti tenendo un
manubrio in ciascuna
mano con una presa
neutra. Tenendo i
gomiti attaccati al
busto, sollevate un
manubrio per volta
mantenendo la presa
neutra. Nel punto
alto di ogni ripetizio-
ne spremete il bici-
pite e lavambraccio,
dopo di che abbas-
sate il carico in modo
controllato e passate
allaltro braccio.
O CONSIGLIO: il
brachiale, che con-
tribuisce a piegare
il gomito, non un
muscolo grande,
per quando ben
sviluppato pu
aumentare lassai ne-
cessaria dimensione
laterale e la massa
della parte superiore
delle braccia.
La ricerca mostra che,
nella maggior parte
degli esercizi, quando
latleta nella media usa i
manubri riesce a usare
fino al 20% in
pi di carico
rispetto a
quando usa
un bilanciere.
Il capo lungo del
tricipite attaccato
tenendo il braccio
sopra la testa.
7
C
U
R
L

A
L
T
E
R
N
A
T
O

C
O
N

P
R
E
S
A

A

M
A
R
T
E
L
L
O
ALLENAMENTO
CONSIGLIO: NELLE FLESSIONI SULLE BRACCIA RAGGIUNGETE SEMPRE LINCAPACIT.
O ENFASI: capo esterno
(laterale)
O ESECUZIONE COR-
RETTA: distendetevi
proni sul pavimento
in una posizione di
essione sulle brac-
cia, distanziando le
mani solo di qualche
centimetro. Sollevate
il corpo stendendo le
braccia e andando sulle
punte. Con lo sguardo
rivolto al pavimento
e gli addominali tirati
in dentro, abbassate il
corpo piegando i gomiti,
tenendoli stretti durante
la discesa. Interrompete
il movimento quando il
petto tocca il pavimento
e ritornate alla posizione
iniziale.
O CONSIGLIO: usate
questo movimento con
peso corporeo come
esercizio di rinitura, che
vi consente di coinvol-
gere i gruppi muscolari
ausiliari per eseguire pi
ripetizioni possibile.
F
L
E
S
S
I
O
N
E

S
U
L
L
E

B
R
A
C
C
I
A

C
O
N

M
A
N
I

R
A
V
V
I
C
I
N
A
T
E
Non c una parte corporea che non mi piace allenare,
per fra tutte preferisco le braccia per il pompag-
gio evidente che possibile ottenere quando si
allenano. Siccome i bicipiti e i tricipiti sono parti
corporee molto piccole, davvero possibile
controllare la loro contrazione.
Quando ho intrapreso lallenamento, il mio
errore pi grande stato probabilmente usare
carichi troppo pesanti. Se si usa il carico giusto,
si pu comunque raggiungere lincapacit
muscolare, che lobiettivo. Se si usa un carico
troppo pesante, si coinvolgono gruppi muscolari
ausiliari come le spalle e la parte bassa della schie-
na. Probabilmente la gente lo fa spinta soprattutto
dal proprio ego. Dovete usare i carichi pi pesanti
possibile ma che riuscite a controllare.
Sono un accanito sostenitore dellallenare i bicipiti e i
tricipiti in superserie. Ci consente, secondo me, di ottenere un allenamento eccellen-
te in poco tempo e di impegnarsi al massimo in quella sessione. Se si allenano prima i
bicipiti e poi i tricipiti, o viceversa, il gruppo che si allena per secondo sempre un po
svantaggiato perch si ha meno energia per allenarlo. Alternare i movimenti consente di
bilanciare meglio la forza durante lallenamento.
ECCO COSA FA KEVIN NEL
GIORNO DELLE BRACCIA
8
R
KEVIN
PEROD
94 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
ALLENAMENTO
Come tenere sotto
controllo limportante
ormone cortisolo per
massimizzare i guadagni
di muscolo, ridurre il
grasso e migliorare
prestazione e salute
DI STEVEN STIEFEL |
FOTO DI ALEX ARDENTI
DAVID
RYLAH
96 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Di solito, in quanto esseri umani, ten-
diamo a esagerare oppure a semplicare troppo le cose.
Quando si parla di ormoni, la tendenza quella di sem-
plicare eccessivamente, dividendoli in buoni e catti-
vi. Chi desidera costruire massa muscolare vuole livelli
alti di testosterone, mentre spesso le donne che cercano
di rimanere incinta sono ossessionate dal livello di estro-
geni. Tuttavia, sia labbondanza sia la carenza di questi or-
moni beneci possono avere effetti negativi. Come per il
cibo, parlando di livelli ormonali, lideale la moderazione.

Questo vero specialmente per il cortisolo, un ormone spesso considerato pericolo-
so che rilasciato in caso di stress (come affrontare il prepotente che tiene occupata
la lat machine e, intanto, parla a vanvera al cellulare o frenare allimprovviso per non
investire il gatto che di colpo vi trovate davanti alla macchina).
I livelli alti di cortisolo sono associati con una lunga serie di effetti negativi: lormone
riduce la massa muscolare, aumenta laccumulo di grasso e tende a farci sentire pigri ed
esausti. Inoltre, a lungo termine, leccesso di cortisolo causa problemi di salute gravi, come
diabete e malattie cardiache.
Questo, per, non vuol dire che dobbiamo eliminare questormone dalla nostra vita e dal
nostro corpo. Il cortisolo esiste per una buona ragione, spiega il dott. Luke R. Bucci, CCN,
CNS, autore di Nutrients on Ergogenic Aids for Sports and Exercise. una delle prime rispo-
ste a stress e traumi.
Quindi, come per altri cosiddetti ormoni beneci, non dovremmo averne nel corpo n trop-
po n troppo poco, ma riuscire a raggiungere una produzione e un rilascio equilibrati dellor-
mone, cos da evitare i problemi associati ai due estremi.
Conclusione: complicato, ma fattibile.
ORA DI ARRENDERSI?
Un tempo (vari millenni fa, molto prima che lallenamento con opposizione di resistenza lasciasse
langolo buio della storia dello sport per diffondersi fra le masse) il cortisolo era essenziale per sal-
vare la vita dei vostri antenati. Infatti, il principale ormone combatti o fuggi, rilasciato in caso di
crisi, quando i nostri progenitori dovevano rispondere alla domanda ben sintetizzata dai The Clash,
Devo rimanere o andarmene via?.
Davanti a questa scelta, il cortisolo ci sostiene, qualsiasi sia la nostra decisione: ci aiuta a combattere
meglio e anche a fuggire pi rapidamente perch aumenta gli zuccheri ematici e il metabolismo, ren-
dendoci per un po pi forti e pi veloci. Tuttavia, questo avviene alle spese dei nostri obiettivi a lungo
termine, come la costruzione muscolare.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 97
C
opyright
2012 by R
obert Kennedy Publishing
C
O
M
B
A
T
T
E
R
E







O

F
U
G
G
I
R
E
?
C
opyright
201
ght
2012 by R
obert Kennedy Publishing
C
O
M
B
A
T
T
E
R
E







O

F
U
G
G
I
R
E
?
costruzione muscolare.
Tuttavia, in altri momenti laumento o
lo stimolo continuo del cortisolo possono
far s che linsulina resti nel corpo troppo a
lungo e che la maggiore quantit di zucche-
ri nel sangue sia usata per la produzione di
grasso, invece che per la crescita muscola-
re, dice Bucci. Un altro problema che il
cortisolo pu indurre laccumulo di grasso
nei posti peggiori.
E ancora pi grave che gli eccessi pro-
lungati dellormone possono peggiorare
lumore, portandovi a saltare la palestra. Il
rilascio eccessivo di cortisolo tende a ren-
derci depressi e a farci mangiare troppo,
dice Bucci. Questi effetti mentali si mani-
festano prima di molti dei sintomi sici.
Questo, per, non vuol dire che dobbiate
azzerare il rilascio di cortisolo. Ogni yin ha
il suo yang. Avete bisogno di energia, ma
anche di dormire; volete ladrenalina, ma
dovete anche rilassarvi. Quindi, vi servono
i beneci ormonali degli ormoni anabolici,
come testosterone e IGF-1, ma anche gli ef-
fetti riequilibranti di insulina e corticoste-
roidi, come il cortisolo.
COME GESTIRE
IL CORTISOLO
Per le persone molto attive, uno degli stress
maggiori la sensazione di tensione indotta
dal superallenamento. Ecco qualche con-
siglio su come massimizzare i vantaggi del
cortisolo per lallenamento, mantenendo i
suoi livelli moderati.
Q Lallenamento pi leggero aiuta a ri-
durre il rilascio di cortisolo. Se vi alle-
nate intensamente ogni giorno, i vostri li-
velli di cortisolo saliranno alle stelle. Ogni
persona sportiva cammina sul lo del
rasoio: massimizzare i guadagni non vuol
dire allenarsi il pi duramente o il pi a
lungo possibile. Gli allenamenti in-
tensi con i pesi devono
essere relativamente brevi (circa unora)
e ogni settimana prendetevi almeno 2
giorni di pausa. In altre parole, mordi e
fuggi. Inoltre, qualche giorno a settimana
fate allenamenti pi leggeri, soprattutto
quando vi sentite stressati o superallenati
(s, lo sappiamo che questo va contro tutti
i vostri desideri).
Q Pensate agli altri aspetti della vita.
Chi fa una vita molto stressante otterr
meno beneci dallallenamento rispetto
a chi, invece, affronta meno stress. Stress
come mancanza di sonno, malattie o si-
tuazioni personali come un nuovo lavo-
ro, un altro glio, un divorzio o persino
dei lavori in casa, inuenzano la presta-
zione e i guadagni. Molti bodybuilder
pensano che pi duramente si allenano,
pi aumenteranno i loro guadagni, ma se,
quando vanno in palestra, il loro livello di
stress gi alto, questo non accade. Nei
periodi di maggiore stress allenatevi a
intensit pi moderata e prendetevi pi
giorni di pausa dalla palestra.
QMigliorate il recupero con lalimenta-
zione. Pu sembrare assurdo, ma, quando
ci si allena intensamente, assumere pi
calorie di quante se ne bruciano aiuta a
mantenere uno stato catabolico, ridu-
cendo limpatto negativo del cortisolo.
Userete questi nutrienti per favorire la
costruzione muscolare, quindi questo ri-
duce la probabilit che le calorie siano ac-
cumulate sotto forma di grasso corporeo;
inoltre, grazie alla riduzione dei livelli di
cortisolo, vi faranno sentire meglio e acce-
lereranno il recupero dopo lallenamento.
Q Dormite molto. Uno dei modi miglio-
ri per combattere lo stress e laumento
di cortisolo dormire molto. Cercate di
dormire 8 ore a notte, soprattutto nei pe-
riodi di stress. Inoltre, potreste provare
tecniche di rilassamento come massag-
gio, yoga, meditazione e sieste frequenti
per aiutarvi a recuperare da periodi di
forte stress e rilascio eccessivo
di cortisolo.
Come
sapete, leccesso
di una cosa buona fa male e, dato
che il cortisolo considerato negativo, non
dovrebbe scioccarvi scoprire che, beh, leccesso di una
cosa negativa fa molto male. Quindi, attenzione, amici stressati.
Ecco qualcuno dei molti efetti negativi associati a un eccesso di
cortisolo nei momenti sbagliati.
Il cortisolo indebolisce il sistema immunitario. Questo un altro
esempio del giocarsi tutto per il presente, alle spese del futuro. Quando
nel corpo c un eccesso di cortisolo, nutrienti ed energia sono bruciati
subito, invece di essere conservati per il futuro. Ecco unanalogia del
mondo della finanza: un rilascio eccessivo di cortisolo quando non ne-
cessario come comprare biglietti della lotteria invece di investire nella
casa o in un fondo pensionistico. Probabilmente, sapete gi che allenarsi
eccessivamente pu danneggiare il sistema immunitario e, magari,
anche rendervi pi soggetti a influenza e rafreddore.
Laumento di cortisolo fa venire voglia di carboidrati. Laumento del-
lo stress (e, quindi, del rilascio di cortisolo) accresce la voglia di carboi-
drati, forse a causa dellaumento di serotonina e altre sostanze chimiche
cerebrali che ci fanno desiderare questi nutrienti. In s i carboidrati non
sono negativi, ma
facendo una vita sedentaria
assumerne troppi provoca laccumulo di
grasso corporeo.
Il cortisolo aumenta il pericoloso grasso viscerale. Oltre a farci
mangiare di pi, leccesso di cortisolo aumenta laccumulo di grasso, una
doppia spinta verso lobesit. La cosa ancora peggiore che leccesso
di cortisolo favorisce laumento del grasso viscerale, quello accumulato
nella cavit addominale che circonda gli organi. Anche aumenti lievi di
questo tipo di grasso possono esercitare un efetto negativo potente
sulla salute.
I livelli alti di cortisolo hanno molti altri efetti negativi, fra cui ridu-
zione del testosterone, aumento della secrezione di insulina, infiamma-
zione, minore vasodilatazione dei vasi sanguigni (che causa un aumento
della pressione ematica) e maggior rischio di placche nelle arterie.
INFORMAZIONE:LECCESSO CRONICO DI CORTISOLO AUMENTA IL SEDERE E LA PANCIA.
INTEGRAZIONE
In pratica, con il rilascio di quantit ecces-
sive di cortisolo, compromettiamo i livelli
energetici futuri per soddisfare le richieste
immediate del corpo. Troppo poco cortiso-
lo e sopraggiungono fatica, inammazione
eccessiva, peggioramento delle allergie e
indolenzimento muscolare. Dopo lallena-
mento duro, il cortisolo fa parte della tem-
pesta ormonale prodotta per favorire lav-
vio del recupero, e tutti sappiamo quanto
sia importante.
Oggi, conosciamo molto meglio le nostre
esigenze chimiche biologiche.
Uno dei maggiori ricercatori sulla rispo-
sta umana allo stress e, quindi, sul rilascio
di cortisolo, era Hans Selye, un pioniere
dellendocrinologia che ha denito lo stress,
la risposta non specica del corpo a qual-
siasi richiesta di adattamento, che questa
induca piacere o dolore. Selye non si oc-
cupato specicatamente del cortisolo, ma
stato un pioniere che ha gettato le basi per
quelli che hanno studiato gli effetti dellor-
mone dopo di lui.
UNO STEROIDE
Il cortisolo un ormone steroideo glucocor-
ticoide. Non uno di quegli steroidi che vi
aiutano a costruire muscolo, a scagliare la
palla da baseball no alle gradinate pi alte
dello stadio o ad allargare le vostre arterie
pulsanti. Questo tipo di steroidi rilasciato
in situazioni di stress. Il cortisolo aumenta
gli zuccheri ematici, accelerando il ritmo
con cui il corpo metabolizza il cibo assunto.
In certi momenti, ad esempio dopo lallena-
mento, questo pu aiutare a potenziare il
processo di costruzione muscolare perch
aumenta anche il rilascio di insulina.
Inoltre, dopo lallenamento un
metabolismo pi rapido
stimola la
98 Olympians News / SUPER FITNESS
persona sportiva cammina sul lo del
rasoio: massimizzare i guadagni non vuol
dire allenarsi il pi duramente o il pi a
lungo possibile. Gli allenamenti in-
tensi con i pesi devono
ri per combattere lo stress e laumento
di cortisolo dormire molto. Cercate di
dormire 8 ore a notte, soprattutto nei pe-
riodi di stress. Inoltre, potreste provare
tecniche di rilassamento come massag-
gio, yoga, meditazione e sieste frequenti
per aiutarvi a recuperare da periodi di
forte stress e rilascio eccessivo
di cortisolo.
Come
sapete, leccesso
di una cosa buona fa male e, dato
che il cortisolo considerato negativo, non
dovrebbe scioccarvi scoprire che, beh, leccesso di una
cosa negativa fa molto male. Quindi, attenzione, amici stressati.
Ecco qualcuno dei molti efetti negativi associati a un eccesso di
cortisolo nei momenti sbagliati.
Il cortisolo indebolisce il sistema immunitario. Questo un altro
esempio del giocarsi tutto per il presente, alle spese del futuro. Quando
sono negativi, ma
facendo una vita sedentaria
assumerne troppi provoca laccumulo di
grasso corporeo.
, p
metabolismo pi rapido
stimola la
P
E
R
C
H


I
L

C
O
R
T
I
S
O
L
O


C
O
S


P
E
R
I
C
O
L
O
S
O
?
LULTIMA PAROLA
SUL CORTISOLO
La conclusione che non dovete eliminare lo
stress dalla vostra vita, ma imparare a gestirlo.
E, per riuscirci, imparare a tenere sotto control-
lo il cortisolo essenziale, soprattutto se lalle-
namento una parte importante della vostra
vita. Laumento del cortisolo una risposta
importante agli stimoli della vita, solo che dove-
te fare in modo che questa risposta duri solo
nch necessaria. qui che entrano in
gioco attivit antistress come sonno,
relax, riduzione dellintensit
dellallenamento, e dieta e inte-
grazione adeguate. Prima il
corpo ha bisogno di quel
rilascio di cortisolo e, poi,
non ne ha pi bisogno
Come abbiamo detto,
complicato.
Un
altro
problema che il
cortisolo pu indurre
laccumulo di grasso nei posti
peggiori: il sedere e la pancia.
Ridurre il cortisolo, soprattutto in periodi di stress forte,
migliora la salute e la prestazione. Provate a ridurre lo
stress e il cortisolo con gli integratori seguenti.
* Assumete le vitamine B: le vitamine del
gruppo B non sono solo essenziali per la salute, ma
aiutano anche a contrastare lo stress. Cercate un
complesso di vitamine B con una dose bilanciata di
B6 (50-100 mg), B3 (75-125 mg), acido pantotenico
(50-100 mg) e B12 (200-400 g), e assumetelo con
la colazione.
* Non dimenticate la C: la vitamina C un
antiossidante che distrugge i radicali liberi, che
sono associati al rilascio di cortisolo. Assumetene
500-1.000 mg 1-3 volte al giorno, aumentando
lentamente la dose per permettere ladattamento
del sistema digestivo. La distruzione dei radicali
liberi con la vitamina C migliora il recupero e la
crescita, oltre a proteggere contro indisposizioni
e malattie.
* Aumentate i minerali: lintegrazione
con minerali come il magnesio e lo zinco pu
ridurre i livelli di cortisolo. Spesso, chi si allena
intensamente e suda molto ha una carenza di
questi minerali che aiutano ad alleviare il danno
del cortisolo. Assumete un multivitaminico/mul-
timinerale come lo ZMA o integratori separati
di zinco (15-30 mg per gli uomini e 15 mg per le
donne) e di magnesio (400-600 mg in pi dosi,
assunte insieme ai pasti; una dose maggiore
pu avere un efetto lassativo).
* Pi aminoacidi: forse assumete molte
proteine per favorire la costruzione muscolare,
ma alcuni aminoacidi sono particolarmente
utili per minimizzare limpatto del cortisolo
nel corpo. Provate ad assumere la glutamina
per raforzare il sistema immunitario, che pu
essere indebolito da un eccesso di cortisolo.
Assumete anche i BCAA per ridurre ancora di
pi i livelli di cortisolo dopo lallenamento con
i pesi. Per ridurre il cortisolo, assumete 5-10
g di glutamina prima e dopo lallenamento,
e 5 g di BCAA dopo la sessione. Negli esseri
umani, 50-200 mg di L-teanina (un derivato
della glutamina) riducono lansia e, in studi
sullo stress compiuti su animali, dosi pi alte
hanno ridotto lattivit dellormone.
* Assumete prodotti erboristici:
lestratto di Epimedium e della corteccia di
magnolia, il beta-sitosterolo e i polimetos-
siflavoni (flavonoidi contenuti nella scorza
degli agrumi) hanno ridotto lattivit del
cortisolo sia in studi su animali sia in
alcuni studi su esseri umani, soprattut-
to se combinati con vitamine B e C, e
aminoacidi.
* Provate i metaboliti: la fosfatidil-
serina ha goduto di un breve momento
di gloria nel bodybuilding perch riduce
laumento di cortisolo dopo lallenamento,
ma le dosi eficaci (800 mg) sono costose.
Nel corpo il DHEA lantagonista del
cortisolo; 25-50 mg mantengono normale
e sano il livello di DHEA nel sangue.
TENETE SOTTO CONTROLLO
IL CORTISOLO
R
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 99
C
A
B
100 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 101
Se volete costruire una schiena massiccia, larga in alto,
stretta al punto vita e piena di muscoli ben distribuiti,
dovete capire come la presa e la posizione dei gomiti
inuenzano il reclutamento muscolare. Qui c tutto
quello che dovete sapere. IN PI: due esempi di
allenamento per la schiena.
Risposta: Un po per volta. Domanda: Come si mangia un elefante?. La morale di questa
vecchia storiella che qualunque sia la dimensione del compito da svolgere, si deve affrontare un giorno, un passo
o un pezzo per volta, no al suo completamento. Per il gruppo muscolare grande della parte superiore del corpo,
la schiena, questa storiella (per quanto possa sembrare scontata) perfettamente attuale.
Dopotutto, nella schiena ci sono i grandi muscoli a V, noti come dorsali. Spostando lattenzione verso il centro
della schiena, si trova il trapezio, grosso e carnoso, a forma di diamante con il vertice in alto. Altri muscoli pro-
minenti sono i grandi rotondi, soprannominati piccoli dorsali a causa della loro prossimit ai grandi dorsali, e i
romboidi, che si trovano appena sotto il trapezio e coadiuvano nellarretramento delle scapole.
DI JIMMY PENA, MS, CSCS | FOTO DI MICHAEL BUTLER
~
ABC
della costruzione
della schiena ideale.
sta tutto nella presa!
B
Copyright 2012 by Robert Kennedy Publishing
102 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Ovviamente ci sono altri muscoli pi
piccoli nel resto di questa porzione gigante
di tessuto muscolare. Ognuno ricopre un
suo ruolo, per quando si tratta di creare
una schiena muscolosa e ben bilanciata, le
parti da curare sistematicamente nellalle-
namento sono i muscoli pi prominenti.
NEL DETTAGLIO
Se voleste suddividere i muscoli della
schiena pi importanti (come dovreste fare
quando organizzate il programma di alle-
namento), avreste: 1) dorsali alti, 2) dorsali
bassi, 3) parte centrale della schiena. Se vi
state chiedendo che ne ha fatto la par-
te alta della schiena, probabilmente state
pensando alla parte alta del trapezio, che
per non sar argomento di discussione
qui, perch allenata meglio nel corso del
lavoro per le spalle, usando vari movimenti
di scrollata.
Q Dorsali alti. Come si possono at-
taccare queste aree importantissime
con concentrazione assoluta per co-
struire una schiena larga e massiccia?
Cominciamo dai dorsali alti. Con un
piccolo aiuto dai grandi rotondi, i
dorsali alti sono i muscoli della schie-
na che danno lampiezza e la forma a
V tanto desiderata. Ogniqualvolta
assumete una presa larga prona sulla
sbarra per la trazione alla lat machi-
ne, allenate la parte alta dei dorsali.
Tuttavia, poche persone capiscono
che possibile allenare i dorsali alti
anche piegandosi in avanti, come nel
caso del rematore con bilanciere, a
patto che si usi una presa prona larga.
Q Dorsali bassi. Questa porzione d
spessore alla schiena n dove i dorsali
si inseriscono nel punto vita. Anche se
poche persone lo sanno, i dorsali bassi
non sono coinvolti quando si allenano i
dorsali alti, perch necessario utiliz-
zare un angolo diverso. In altre parole,
ogniqualvolta si usa una presa stretta o
supina per la trazione alla lat machine
o il rematore, i gomiti si avvicinano au-
tomaticamente al corpo. Questa varia-
zione dellangolo (posizione dei gomiti
relativamente al busto) recluta le bre
testarde dei dorsali bassi meglio dei
movimenti con presa larga.
Q Parte centrale della schiena: In-
ne, se desiderate spessore nella parte
centrale della schiena, dovete con-
centrarvi sulla parte centrale e bassa
del trapezio, oltre che sui romboidi.
Anche in questo caso, molte persone
pensano erroneamente di attaccare la
parte centrale della schiena con i mo-
vimenti di rematore con presa stretta
ma si sbagliano. Vi ricordate la regola
dellangolo dei gomiti? Dunque, nei
movimenti con presa stretta, i gomiti
sono vicini al busto, cosa che coin-
volge i dorsali bassi, mentre la parte
centrale della schiena non attivata in
modo signicativo. Allenate meglio la
parte centrale della schiena utilizzan-
do una presa larga per i rematori (con
bilanciere o al cavo) in cui la sbarra
tocca la parte alta degli addominali.
UNA COPPIA DI
ALLENAMENTI
Adesso che sapete come attaccare le varie
parti della schiena, dovete organizzare tut-
to in una routine. Si tratta in realt di due
routine. Questi allenamenti di esempio si
concentrano su aree distinte della schiena,
afnch possiate usare maggiore intensi-
t in ognuno di essi e costruire maggiore
massa e spessore da cima a fondo. Note-
rete che non necessaria una miriade di
movimenti per riuscire in ci. Infatti, mo-
dicando anche solo leggermente la presa
per gli esercizi comuni, potete attaccare
i muscoli della schiena in modo diverso,
dando maggiore dimensione e profondit
ai muscoli che esigono nuove sde. Ecco
perch imparare a inserirli nelle routine
pu aiutarvi ad aggiungere forza e massa al
sico, soprattutto se vi sembra di trovarvi
in un plateau.
INFORMAZIONE: LA PARTE CENTRALE DELLA SCHIENA NON ATTIVATA GRANCH DAI MOVIMENTI CON PRESA STRETTA.
ALLENAMENTO
ALLENAMENTO 1 PRIORIT: DORSALI
ALTI, PARTE CENTRALE DELLA SCHIENA
(ROMBOIDI, PARTE CENTRALE DEL TRAPEZIO)
ESERCIZI SERIE RIPETIZIONI
1) Rematore con bilanciere (presa larga) 4 6*
2) Rematore al cavo da seduto (presa larga) 4 10**
3) Trazione alla lat machine (presa larga) 4 12**
4) Trazione alla sbarra (presa larga) 4 Allincapacit
ALLENAMENTO 2 PRIORIT: DORSALI BASSI
ESERCIZI SERIE RIPETIZIONI
1) Rematore con bilanciere (presa supina) 4 6*
2) Rematore al cavo da seduto (presa stretta) 4 8**
3) Trazione alla lat machine (presa supina) 4 10**
4) Trazione alla sbarra (presa supina) 4 Allincapacit
Non sono indicate le serie di riscaldamento, quindi accertatevi di fare molte serie con carico moderato
e alto numero di ripetizioni prima di afrontare la routine. Non portate mai le serie di riscaldamento
allincapacit muscolare.
* Rest-pause. Fate un riposo molto breve nel corso di una serie dellesercizio. Per esempio, selezionate un
carico che vi fa raggiungere lincapacit dopo 5-6 ripetizioni, per fate solo tre ripetizioni. Riposate 15-20
secondi e poi fate altre 2-3 ripetizioni. Continuate a fare 2-3 ripetizioni seguite da 15-20 secondi di riposo pi
volte che potete. Tutti questi segmenti costituiscono una serie. Fate cos nelle ultime due serie dellesercizio.
** Serie a scalare. Dopo aver completato il numero obiettivo di ripetizioni con un carico pesante,
riducete il carico del 20-30% e continuate a eseguire ripetizioni fino a raggiungere di nuovo lincapacit.
Usate questa tecnica nelle ultime due serie dellesercizio indicato.
Nota: se allenate le parti corporee una volta la settimana, alternate semplice-
mente fra gli allenamenti 1 e 2 ogni volta che vi allenate. Gli atleti pi avanzati
che sentono il bisogno di allenare la schiena due volte la settimana devono
alternare gli allenamenti, accertandosi di eseguire ogni allenamento due volte
la settimana.
STRATEGIE CON ALLENAMENTI
GEMELLI PER COSTRUIRE UNA
GRANDE SCHIENA
WWW. OLYMPI AN. I T
Attaccate la schiena da tutti gli angoli
INFORMAZIONE: IL MODO IN CUI MUOVETE IL BILANCIERE LUNGO IL CORPO DETERMINA I RISULTATI.
1
REMATORE CON
BILANCIERE
O OBIETTIVO: allenamento 1
dorsali alti. Usando una presa larga
prona, durante la trazione i gomiti
restano distanti dai fianchi, cosa
ideale per coinvolgere le fibre dei
dorsali alti.
O PREPARAZIONE: Posizionatevi
con i piedi distanziati quanto la
larghezza delle spalle e aferrate il
bilanciere con una presa larga, prona.
Tenendo le ginocchia leggermen-
te piegate, piegatevi in avanti al
punto vita fino a che il busto quasi
parallelo al pavimento. Il bilanciere
deve penzolare dritto gi, davanti
agli stinchi.
O ESECUZIONE: Senza sollevare
la parte superiore del corpo, tirate
il bilanciere alladdome, portando
i gomiti in alto, oltre il livello della
schiena. Trattenete il bilanciere nella
posizione di contrazione massima
per un secondo, poi abbassate lenta-
mente lungo lo stesso percorso.
O OBIETTIVO ALTERNATIVO:
allenamento 2 dorsali bassi.
Usate una presa supina. Sollevate
il bilanciere sfiorando i quadricipiti
fino a portarlo agli addominali
bassi. Ci pone lenfasi sui dorsali
bassi, costringendovi a tenere i
gomiti stretti.
Avrete notato che in questo articolo sullallenamento suggeriamo scelte di esercizi valide per en-
trambi gli allenamenti di esempio. Lo facciamo per comodit. Una volta appresi questi esercizi e le
loro varianti, potete usare le sette regole presentate in Come organizzare un grande allenamento
per la schiena a pagina 104 per continuare ad affinare quella V densa e muscolosa.
PPP
R
E
S
AA

S
U
P
I
NNN
AAA
Olympians News / SUPER FITNESS 103
ALLENAMENTO
WWW. OLYMPI AN. I T
C
O
M
E

O
R
G
A
N
I
Z
Z
A
R
E

U
N

G
R
A
N
D
E

A
L
L
E
N
A
M
E
N
T
O

P
E
R

L
A

S
C
H
I
E
N
A
2
REMATORE
DA SEDUTO
O OBIETTIVO: allenamento
1 dorsali bassi. Con le mani rav-
vicinate, questa variante avvicina
automaticamente i gomiti al corpo,
permettendo un grande coinvolgi-
mento dei dorsali bassi lungo tutto
larco di movimento.
O PREPARAZIONE. Attaccate una
maniglia da presa stretta al cavo
e sedete con il busto eretto, rivolti
O OBIETTIVO ALTERNATIVO:
allenamento 2 dorsali. Attacca-
te una sbarra per trazioni e usate
una presa larga prona. Durante la
trazione, i gomiti non si troveran-
no pi vicini ai fianchi bens larghi
e lontani dal corpo, impegnando
quindi la parte alta dei dorsali.
verso il pacco pesi. Appoggiate
i piedi sulla pedana, tenendo le
gambe leggermente piegate.
Piegatevi in avanti per aferrare la
maniglia, tenendo la schiena dritta
e il petto alto. Tiratevi indietro fino
a che il busto eretto e le braccia
sono completamente stese.
O ESECUZIONE. Tirate la maniglia
verso laddome. Tenete i gomiti
vicini al corpo. Tenete il busto
eretto e la testa in posizione neutra
mentre spremete i muscoli della
schiena. Trattenete la contrazione
massima per un secondo e poi
abbassate lentamente il carico
allestensione completa delle brac-
cia, senza piegarvi molto in avanti.
O OBIETTIVO ALTERNATI-
VO: allenamento 1 dorsali
bassi. Rovesciando la presa sulla
sbarra per le trazioni, coinvolgete
maggiormente i bicipiti insieme
ai dorsali bassi, ecco perch siete
molto pi forti nella versione con
presa supina.
PPPPPPPPPPPPP
RRRR
E
S
A

S
U
PP
II
NNNNN
AAAA
PPPPPPPPP
R
EEE
SSS
AAAAA

LLL
AAAAAAAA
RRRRRRRRR
GGGGGG
AAAA
104 Olympians News / SUPER FITNESS
Per massimizzare lo spessore e la struttura di
tutta la schiena, essenziale combinare eserci-
zi, prese e movimenti fondamentali e organiz-
zarli nellallenamento nellordine giusto. Ecco
le sette considerazioni pi importanti quando
lobiettivo una schiena pi sviluppata.
1. Allenate solo la schiena. La schiena consiste
di molti gruppi muscolari grandi, secondi per
grandezza solo alle gambe, perci per allenare
tutte le parti non bastano un esercizio o due. Do-
vete dedicare un giorno alla schiena, specialmen-
te se volete far crescere questarea rapidamente
ed eficientemente.
2. Allenate la schiena per ultima. Allenate la
schiena alla fine della settimana per 4-6 settima-
ne. La ricerca mostra che un allenamento intenso
per la schiena potrebbe compromettere gli alle-
namenti immediatamente successivi. Invece, se
preceduta da altre parti corporee (lasciandola per
la fine della settimana), la schiena non risentir
minimamente dellindolenzimento o dellafatica-
mento degli altri gruppi muscolari.
3. Usate sempre le cinghie. Non lasciate mai la
schiena in balia della forza della presa. Per esem-
pio, se lobiettivo di ripetizioni per una certa serie
10, la ricerca ha mostrato che usare le cinghie
(con carichi leggeri, tipo 10RM) permette di com-
pletare 1-2 ripetizioni in pi di quanto possibile
altrimenti.
4. Cominciate lallenamento della schiena
con movimenti grandi, composti (multiarti-
colari). Dovete attaccare la schiena con il carico
massimo possibile ma, se possibile, dovete farlo
quando i muscoli sono freschi (allinizio della
sessione). Ci particolarmente vero quando
nellesercizio sono coinvolti molti muscoli.
5. Mettetevi nella posizione pi forte possi-
bile. Qualunque essi siano, quelli descritti qui o
altri, in tutti gli esercizi per la schiena (eccetto lo
stacco da terra a gambe tese per la parte bassa
della schiena) dovete tenere il petto in alto, la
schiena inarcata e i glutei infuori. Mettere il corpo
in questa posizione vi rende pi forti dalla prima
allultima ripetizione. Se abbassate il petto vi
esponete agli infortuni e i muscoli perdono il loro
vantaggio meccanico.
6. Dovete usare le tecniche di intensit in tutti
gli esercizi. Per stimolare la crescita muscolare,
necessario andare oltre lincapacit. Fatene una-
bitudine (nelle ultime due serie di tutti gli esercizi
presentati in questo articolo, usate la tecnica di
intensit suggerita sotto la descrizione di ogni
esercizio e spingete oltre lincapacit iniziale).
7. Cambiate regolarmente lallenamento
della schiena provando nuovi esercizi,
riorganizzando la routine, alternando giorni
o settimane pesanti e leggeri e usando molte
tecniche di allenamento avanzate, simili a quelle
descritte qui, per spingere i dorsali e altri muscoli
della schiena in molti modi diversi.
WWW. OLYMPI AN. I T
INFORMAZIONE: PER I MOVIMENTI CON PRESA SUPINA POTETE USARE LE CINGHIE PER I POLSI.
3
TRAZIONE ALLA
LAT MACHINE
O OBIETTIVO: allenamento 1 dorsali
alti. Con una presa larga prona, lobiet-
tivo principale sono i dorsali alti. Se non
avete infortuni preesistenti alle spalle e al
collo, potete provare la variante dietro il
collo, per usate una forma di esecuzione
perfetta.
O PREPARAZIONE. Sedete con il busto
eretto afinch la sbarra si trovi esatta-
mente sopra la testa o appena davanti al
corpo. Sistemate le imbottiture afinch
i quadricipiti siano bloccati. Aferrate le
estremit piegate della sbarra con una
presa larga prona. Tenete gli addominali
contratti e la schiena leggermente inarca-
ta con i piedi completamente appoggiati
sul pavimento.
O ESECUZIONE. Cercate di non inclinarvi
indietro, avvicinate le scapole e abbassate
la sbarra alla parte alta del petto, tenendo
i gomiti indietro. Spremete e trattenete
per un secondo prima di permettere che il
bilanciere riporti le braccia allestensione
completa.
O OBIETTIVO ALTERNATIVO:
allenamento 2 dorsali bassi. Sia la
presa supina (larga pi o meno quanto le
spalle) sia la presa stretta (presa neutra,
palmi rivolti uno verso laltro) allenano
maggiormente i dorsali bassi. Con la
presa supina c un maggiore coinvolgi-
mento dei bicipiti.
PPPPPPPPP
RRRRRRRR
EEEE
SSS
AA

SS
UU
P
I
N
A
P
R
EE
SS
AAAA

N
EEEE
UUUUUUUU
TTTTTTTT
RRRRRRRRRR
AAAAAAAAAAA
Olympians News / SUPER FITNESS 105
ALLENAMENTO
106 Olympians News / SUPER FITNESS
INFORMAZIONE: TERMINATE LALLENAMENTO DELLA SCHIENA CON UN MOVIMENTO CHE INONDA I MUSCOLI DI SANGUE.
4
TRAZIONE
ALLA SBARRA
O OBIETTIVO: allenamento 1 dorsali
alti. Esistono molte varianti di questo
esercizio, per lesecuzione comune con
presa larga la migliore per i dorsali
alti.
O PREPARAZIONE. Aferrate una sbarra
alta con una presa larga prona e chiusa
(il pollice avvolge la barra). State appesi
alla sbarra, con le braccia completamen-
te stese e i piedi incrociati dietro di voi.
O ESECUZIONE. Contraete i dorsali per
portare il mento sopra la sbarra. Concen-
tratevi sul tenere i gomiti larghi per poi
tirarli gi per sollevarvi. Trattenete per
un secondo nella posizione di contra-
zione massima per poi abbassarvi sotto
controllo.
O OBIETTIVO ALTERNATIVO:
allenamento 2 dorsali bassi. Usate
una presa stretta, o neutra o supina.
Con la presa supina coinvolgete mag-
giormente i bicipiti. Ecco probabilmen-
te perch con questo esercizio potete
fare pi ripetizioni che con qualsiasi
altra variante di questo esercizio.
Il mio nuovo costruttore di massa preferito per la schiena il rematore
alla Smith machine con presa supina. Nellultimo anno ho scoperto che
eseguire questo esercizio isola benissimo i dorsali, attaccandoli forte in basso.
Allena anche la parte centrale della schiena, che unarea problematica per
gran parte degli atleti. Ho cominciato a usarlo perch anche Dorian Yates
faceva i rematori con presa supina e la sua schiena era mitica.
Mi piacciono anche i rematori pesanti con bilanciere e manubri ma
ogni buon allenamento per la schiena ha bisogno di un buon esercizio
di rifinitura per inondare i muscoli di sangue e aumentare la definizione.
Preferisco i pullover perch isolano totalmente i dorsali, per con la
macchina si gode di maggiore forza ed equilibrio.
Allenare la schiena pu essere dificile perch non si riescono a vedere i
muscoli, perci dificile concentrarsi e isolarli. Gran parte degli atleti tende
a usare troppo gli avambracci e i bicipiti. Penso che sia meglio tenere il petto
alto e le spalle indietro nel corso dellesecuzione di tutti gli esercizi per la
schiena.
R
tore
e
basso.
per
s
dere i
tende
petto
la
ROB
KREIDER
PPPPPPPPPPRRRRRRRESSSSSAAAAAAA SSUUUPPPPIIIIIIIIIINNNNNNNNNNNNNNNNNNAAAAAAAAAAAAAAAAAAAA
P
R
EEE
SS
A

N
E
UUUUUUU
TTTTTT
R
AAAAAAAAAA
WWW. OLYMPI AN. I T
ALLENAMENTO
Ecco cosa funziona per Rob
Powertec

PROFESSIONAL
WWW. O L Y MP I A N S T O R E . I T

Prodotti distribuiti in italia da OLYMPIANS S.r.l.


Figline Valdarno (FI) tel 055 958058 www.olympianstore.it 800-776-999
Se doveste portare il peso del mondo sulle spalle,
come faceva Atlas nella mitologia della Grecia antica come punizio-
ne per una tentata ribellione contro Zeus, probabilmente costruire-
ste deltoidi di proporzioni mitologiche. Forse non siete in grado di
fare una cosa del genere, per costruire spalle massicce degne di un
feroce guerriero greco, che vigila dalla sommit del Monte Olimpo,
non deve essere necessariamente unimpresa erculea. Tuttavia,
necessario un approccio illuminato basato sulla saggezza dettata dai
loso dellet doro. Se volete costruire spalle larghe che vi distin-
guono dai semplici mortali, ascoltate questi sette comandamenti per
sviluppare deltoidi mondiali.
DI BILL GEIGER, MA | FOTO DI ALEX ARDENTI
REGOLE
SEMPLICI
PER COSTRUIRE
SPALLE DAUOMO

Seguite questi sette comandamenti
dimostrati oltre a provare il nostro
allenamento desempio per avere
delle spalle di proporzioni epiche
Copyright 2012 by Robert Kennedy Publishing
108 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
KELECHI
OPARA
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 109
Roba da eroi
Per organizzare una routine degna degli dei
necessario scegliere gli esercizi migliori e
anche organizzarli nellordine giusto, oltre
a scegliere carichi con cui raggiungete lin-
capacit in un certo intervallo di ripetizio-
ni. Aggiungeteci i fattori che incrementano
lintensit, il bisogno di variet e la sda di
creare una split di allenamento che riduce
il rischio di superallenamento si tratta di
unimpresa eroica. Forse nemmeno un gran-
de come Aristotele sarebbe in grado di aiu-
tarvi in questo caso, noi invece s.
COMANDAMENTO 1:
Eseguite prima i
movimenti composti.
Per tutte le parti corporee, eseguite prima i
movimenti multiarticolari (composti) gli
esercizi che coinvolgono pi di una coppia
di articolazioni perch reclutano la quan-
tit massima di massa muscolare, permet-
tendo quindi di usare i carichi pi pesanti.
Dopo il riscaldamento, i livelli energetici
sono al massimo, perci potete usare i ca-
richi pi pesanti. I movimenti composti per
le spalle comprendono la famiglia delle di-
stensioni sopra la testa (partecipano tutti i
tre capi dei deltoidi, principalmente quello
frontale e quello mediale, oltre che i trici-
piti). Anche le tirate al mento sono eserci-
zi composti che allenano particolarmente
bene i capi frontali e mediali dei deltoidi.
NOTA 1:
spingete fino
allestensione
completa delle
braccia ma
non bloccate i
gomiti per sal-
vaguardare la
sicurezza delle
articolazioni.
NOTA 2: aferrate il bilan-
ciere con una presa larga, gli
avambracci devono essere
perpendicolari al pavimento
quando il bilanciere nel
punto basso del movimento.
DISTENSIONE SOPRA LA TESTA ALLA SMITH MACHINE
OBIETTIVO: capi frontali e mediali, tricipiti secondariamente
PREPARAZIONE. Sistemate una panca con schienale basso fra i due
montanti della macchina. Sedetevi, spostando la panca avanti o indietro,
afinch il bilanciere si trovi proprio davanti al vostro naso nella posizio-
ne bassa. Sedete con il busto eretto, distanziando i piedi per aumentare la
stabilit, tenendo il petto alto e guardando dritto avanti.
ESECUZIONE CORRETTA. Abbassate il bilanciere sotto controllo fino
a portarlo allaltezza del naso. I gomiti devono puntare verso il basso e
lesterno. Invertite fluidamente la direzione e spingete con forza verso
lalto fino allestensione completa delle braccia.
CONSIGLIO. Con i pesi liberi dovete equilibrare il carico ma in questo
caso no, perci potete usare carichi pi pesanti ed essere comunque al
sicuro.
INFORMAZIONE: I MOVIMENTI COMPOSTI PERMETTONO DI USARE CARICHI PI PESANTI.
110 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
ALLENAMENTO
INFORMAZIONE: LE TIRATE AL MENTO CON PRESA LARGA RIDUCONO IL RISCHIO DI INFORTUNIO ALLE SPALLE.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 111
ALLENAMENTO
NOTA 1:
non usate una presa
stretta perch causa
rotazione interna
delle spalle e accor-
cia larco di movi-
mento. Reclutate
meglio il capo me-
diale distanziando le
mani circa 25 cm.
NOTA 2:
nel punto alto i
gomiti devono pun-
tare verso lalto
e lesterno.
OBIETTIVO: capi frontali e mediali, parte alta del trapezio
PREPARAZIONE. Assumete una presa prona media sul bilanciere, sorreggendolo
davanti a voi con le braccia stese. Tenete il petto in fuori, le spalle indietro e la
schiena leggermente inarcata, con i piedi distanziati quanto la larghezza delle
spalle.
ESECUZIONE CORRETTA. Tirare il bilanciere verso lalto piegando i gomiti e
allargandoli lateralmente, tenendo sempre il bilanciere vicino al busto. Sollevate
il bilanciere allaltezza del mento, poi abbassatelo sotto controllo estendendo
completamente le braccia.
CONSIGLIO. Tenete il bilanciere vicino al corpo per tutta la durata del movimento.
TIRATA AL MENTO CON EZ BAR
COMANDAMENTO 2:
Usate i carichi pi pesanti allinizio
dellallenamento, quando i livelli di
forza sono alti.
Oltre alla scelta del movimento giusto che coinvolge la massa muscolare
massima, anche il carico molto importante. Scegliere un carico che cau-
sa incapacit muscolare dopo circa 6-8 ripetizioni (senza contare i riscal-
damenti), vuol dire concentrarsi sui guadagni di forza e di massa. Nel cor-
so dellallenamento, con il montare della fatica, ci si concentra meno sulla
forza e di pi sulla costruzione muscolare, ottenuta allenandosi con un
intervallo di ripetizioni leggermente maggiore, solitamente 8-12. Combi-
nare movimenti che usano intervalli di ripetizioni diversi (6-8 e 8-12) fa s
che i muscoli obiettivo lavorino in modo leggermente diverso a causa del-
le intensit relative diverse, per uno sviluppo complessivo pi ottimale.
112 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
COMANDAMENTO 3
Fate i movimenti
monoarticolari dopo i
movimenti composti.
Gli esercizi monoarticolari escludono ef-
cacemente i gruppi muscolari coadiuvanti
perch, come implica il nome, si muove solo
unarticolazione, perci solo il muscolo che si
attacca a quellarticolazione in grado di con-
trarsi ed estendersi. A questo punto dellalle-
namento, potete fare un movimento per con-
centrarvi su ognuno dei tre capi dei deltoidi.
Per attaccare efcacemente un solo capo, do-
vete allenarvi nel piano particolare in cui quel
capo lavora pi attivamente.
Q Stando in piedi e sollevando le braccia
stese davanti al corpo, vi concentrate sui
capi anteriori (frontali) del deltoidi.
Q Stando in piedi e sollevando lateral-
mente le braccia stese, vi concentrate sui
capi mediali dei deltoidi.
Q Stando piegati in avanti e portando le
braccia stese da una posizione verso il
basso a una ai lati del corpo, ponete len-
fasi sui capi posteriori dei deltoidi.
Quello che rende unici i movimenti scelti
per questo allenamento lesecuzione uni-
laterale (un braccio per volta), che permette
di concentrarsi maggiormente su ogni arto,
cosa particolarmente utile se state cercando
di rimettere in pari un arto pi debole o pi
piccolo.
NOTA 1: tenete il
corpo ad angolo
retto, perpendico-
lare al percorso del
movimento. Non
ruotate il busto
quando portate la
mano in alto.
NOTA 2:
bloccate in
un leggero
piegamento
il gomito e
mantene-
te questo
piegamento
del gomito per
tutta la serie.
OBIETTIVO: capo posteriore
PREPARAZIONE. Mettetevi accanto a un cavo basso (senza maniglia
attaccata, oppure potete usare una maniglia a D, se preferite). Piegatevi
in avanti al punto vita, tenendo le ginocchia piegate, per favorire lequi-
librio, e la schiena piatta. Il cavo deve trovarsi proprio davanti e accanto
alla spalla. Aferrate la pallina di gomma con la mano pi lontana, usando
una presa neutra. Potete mettere la mano libera sulla coscia.
ESECUZIONE CORRETTA. Contraete il capo posteriore per passare con la
mano davanti al corpo, disegnando larco pi alto che potete e tenendo il
gomito leggermente piegato. Abbassate sotto controllo ed eseguite alcu-
ne ripetizioni. Il pacco pesi non deve toccare il pavimento fra le ripetizioni.
CONSIGLIO. Per isolare meglio il capo posteriore, cercate di non sollevar-
vi al completamento del movimento.
SOLLEVAMENTO LATERALE PIEGATO
IN AVANTI A UN BRACCIO AL CAVO
INFORMAZIONE: NEI SOLLEVAMENTI LATERALI, TENETE IL GOMITO PIEGATO PER ESCLUDERE I TRICIPITI.
ESERCIZIO SERIE
1
RIPETIZIONI
2
Distensione sopra la testa alla Smith machine 3 6-8
Tirata al mento con EZ Bar 3 8-10
Sollevamento laterale a un braccio con manubrio
3
3 10-12
Sollevamento laterale piegato in avanti a un braccio al cavo
3
3 10-12
Sollevamento frontale a un braccio al cavo
3
3 10-12
Scrollata alla Smith machine 4 6-8, 6-8, 10-12, 10-12
1 Non comprende le serie di riscaldamento, fate quante ripetizioni necessario ma non portate mai le
serie di riscaldamento allincapacit
2 Scegliete un carico con cui potete raggiungere lincapacit muscolare al numero di ripetizioni
prefissato. Se potete fare pi ripetizioni di quelle indicate, per la serie successiva aumentate il carico.
3 A ogni allenamento ruotate lordine di questi tre movimenti per evitare di fare sempre lo stesso
esercizio per primo, o per ultimo.
PER SPALLE DEFINITIVE
ALLENAMENTO PER I DELTOIDI
ALLENAMENTO
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 113
OBIETTIVO: capo mediale
PREPARAZIONE. State con il petto in fuori
e le spalle indietro, con la mano non alle-
nata che si tiene alla sommit di una panca
inclinata o di un altro oggetto immobile.
Aferrate il manubrio tenendo il gomito
leggermente piegato, sorreggendo il peso
accanto alla coscia, con una presa prona.
ESECUZIONE CORRETTA. Sollevate il braccio
lateralmente lungo un arco ampio fino allal-
tezza della spalla, tenendo il gomito in alto e
mantenendo sempre lo stesso piegamento
nel gomito. Abbassate sotto controllo, per
fermatevi prima della posizione in cui il
braccio perpendicolare al pavimento, per
mantenere la tensione sul muscolo.
CONSIGLIO. Il movimento non perfetta-
mente laterale. Sollevate il carico lateral-
mente e un po in avanti.
SOLLE-
VAMENTO
LATERALE
CON MANUBRIO
A UN BRACCIO
INFORMAZIONE: PER AVERE SPALLE SANE NON DOVETE IGNORARE IL CAPO POSTERIORE DEI DELTOIDI.
NOTA 1: non fermatevi allal-
tezza della spalla. Portate il
peso ben al di sopra del piano
orizzontale perch il capo me-
diale ancora ben impegnato.
Per attaccare
efficacemente
un solo capo,
dovete allenarvi
nel piano
particolare
in cui quel
capo lavora pi
attivamente.
Guardandolo, pensereste che Kelechi ha vinto alla lotteria della gene-
tica, per questo ex sergente dei Marines aveva spalle che crescevano
lentamente, cosa che lo ha indotto ad adottare un allenamento su due
giorni la settimana composto principalmente di lento avanti, tirata al
mento e sollevamenti laterali, tutti eseguiti in piedi e con carichi pe-
santi. Kelechi dice di non aver mai spinto ai limiti del superallenamento
perch raramente arriva allincapacit muscolare assoluta, cosa che gli
permette anche di accelerare il processo di recupero.
Avendo combattuto in Afghanistan, Kelechi ricorda che la palestra
che condividevano con i Navy SEALs era equipaggiata solo con un
pulley arrugginito e una coppia di parallele per le flessioni, cos improv-
visavano usando i sacchi di sabbia, facendo curl e torsioni. Non cerano
pasti preparati a casa. Per i fabbisogni proteici si afidavano ai pasti
pronti dellesercito.
Da quando tornato negli USA, Kelechi si dedicato alla sua
carriera nel fitness, che comprende anche la cura di una rubrica per
bodybuilding.com.
KELECHI OPARA
ALLENAMENTO
114 Olympians News / SUPER FITNESS
OBIETTIVO: capo frontale
PREPARAZIONE. Attaccate una
maniglia a D a un cavo basso.
Mettetevi accanto al pulley,
dandogli le spalle (deve essere
allineato alla spalla allenata),
con il petto infuori e le spalle
indietro, conservando la cur-
vatura naturale della schiena.
Aferrate la maniglia con una
presa prona, tenendo il braccio
steso a lato della coscia.
ESECUZIONE CORRETTA. Con un
movimento fluido e controllato,
sollevate il braccio steso verso
lalto davanti a voi, fino allal-
tezza del mento, poi abbassate
sotto controllo. Fermatevi ap-
pena prima che il braccio torni a
fianco del corpo. Eseguite tutte
le ripetizioni per un lato e poi
cambiate braccio.
CONSIGLIO. Per una linea
di trazione leggermente
diversa, non portate la
maniglia esattamente
davanti alla spalla, ben-
s un po verso il centro.
SOLLEVAMENTO
FRONTALE A UN
BRACCIO AL CAVO
COMANDAMENTO 4:
Eseguite gli esercizi
monoarticolari
usando un intervallo di
ripetizioni pi alto.
Per i movimenti monoarticolari, scegliete un
carico che vi permette di lavorare nei pressi
del limite superiore dellintervallo di ripeti-
zioni di costruzione muscolare, raggiungendo
cio lincapacit muscolare alle ripetizioni
10-12. Solitamente, quelli monoarticolari non
sono esercizi in cui si usano carichi molto
pesanti perch la posizione con braccio ste-
so pone grande pressione sullarticolazione
del gomito. Quindi, in questo caso dovreste
scegliere un carico moderato nel tentativo di
affaticare completamente il muscolo e creare
un pompaggio signicativo.
COMANDAMENTO 5:
Aggiungete le tecniche
di intensit.
Allenarsi allincapacit muscolare fonda-
mentale per aumentare la massa muscolare
e ci signica fare pi ripetizioni possibile
con la forma di esecuzione corretta. In alcune
serie potete andare oltre lincapacit musco-
lare e incrementare leffetto di costruzione
muscolare, scioccare i muscoli e intensicare
il bruciore usando svariate tecniche di allena-
mento avanzate. Anche se in questo articolo
non ne suggeriamo nessuna in particolare, fra
le preferite nel giorno delle spalle ci sono le ri-
petizioni forzate, le serie a scalare, le negative
e il rest-pause. Per alcune necessario laiuto
di un compagno di allenamento, per altre in-
vece potete fare da soli.
COMANDAMENTO 6:
Accertatevi che tutti i capi
dei deltoidi ricevano
uguale trattamento.
molto facile utilizzare una routine che pre-
vede di allenare i capi frontali, mediali e poste-
riori sempre nello stesso ordine. Il problema
che se seguite questa ricetta troppo a lungo
svilupperete spalle asimmetriche perch
probabile che i livelli energetici siano scarsi
verso la ne della sessione di allenamento e se
ci succede quando attaccate nalmente i capi
posteriori, non avete pi forze da spendere.
Ci particolarmente vero se usate carichi
pesanti nella distensione su panca, cosa
che pu sovrasviluppare i capi anteriori
(che partecipano a tutti i movimenti di
distensione per il petto). La soluzione?
Variate lordine degli esercizi mono-
articolari a ogni allenamento, afnch
nessuna area riceva maggiore attenzione
e possiate ottenere uno sviluppo bilan-
ciato. Quindi, dopo gli esercizi multiarti-
NOTA 1: se il
pacco pesi tocca
il pavimento nel
punto basso della
ripetizione, la ten-
sione sul muscolo
si perde, quindi
allontanatevi dal
pacco pesi.
NOTA 2: non dovete tenere il gomito
steso bloccato, perch ci stressa lar-
ticolazione. Per non dovete nemmeno
piegare molto il gomito, perch accorcia
la leva e rende il movimento pi facile.
ALLENAMENTO
WWW. OLYMPI AN. I T
WWW. OLYMPI AN. I T
P
H
O
T
O

C
R
E
D
I
T
NOTA 2: viene naturale piegare le
braccia per assistere il movimento, per
cercate di tenerle pi stese possibile.
OBIETTIVO: parte alta del trapezio
PREPARAZIONE. Sistemate il bilanciere allaltezza dei fianchi. State eretti
con i piedi distanziati quando la larghezza delle spalle, ginocchia sbloc-
cate. Assumete una presa prona larga quanto la larghezza delle spalle,
appena pi larga delle cosce, percependo un allungamento profondo.
ESECUZIONE CORRETTA. Senza piegare le braccia, scrollate le spalle verso
gli orecchi, trattenendo la contrazione massima per un secondo, poi ab-
bassate lentamente al punto di partenza.
CONSIGLIO. Quando le ripetizioni si fanno dificili, potete accelerare il
movimento e generare un po di slancio attraverso le anche e le ginocchia,
per andare oltre lincapacit muscolare.
SCROLLATA ALLA SMITH MACHINE
Allenarsi
allincapacit
muscolare
fondamentale
per aumentare la
massa muscolare.
colari, in ogni allenamento seguite uno schema
leggermente diverso che alterna lordine dei
movimenti monoarticolari.
Se uno dei capi rimasto indietro (e non
raro vedere atleti con capi frontali ben svi-
luppati e capi posteriori minuscoli per le ra-
gioni suddette) allora date la priorit allarea
debole mettendola per prima nella rotazione
dei movimenti monoarticolari. Per aumen-
tare limpegno per la parte rimasta indietro
potreste anche fare un secondo esercizio di
isolamento (leggermente diverso) nello stes-
so allenamento.
COMANDAMENTO 7:
Non cadete preda
delle abitudini, inserite
variet nella routine.
La costruzione muscolare si basa su: 1)
sovraccaricare il muscolo obiettivo per ren-
derlo pi grosso e pi forte, 2) aumentare
progressivamente il sovraccarico alladattar-
si dei muscoli. Pur avendo organizzato unot-
tima routine di allenamento per le spalle,
ultimamente sta diventando meno efcace
(legge della riduzione dei guadagni) perch
il corpo si adatto. Per accertarvi che il cor-
po non si adatti mai e continui a progredire,
dovete cambiare a intervalli regolari gli al-
lenamenti, gli esercizi, gli schemi di serie e
ripetizioni e la split di allenamento.
Uno dei modi pi semplici per apportare
dei piccoli cambiamenti fare sostituzioni
con varianti simili. Per esempio, invece di
fare sollevamenti laterali al cavo un braccio
alla volta, potete farli da seduti con manubri,
in piedi con manubri, alla macchina, inclinati
lateralmente, facendo passare il cavo dietro
la schiena, portando il carico ben al di sopra
della testa oppure con un manubrio unilate-
ralmente. Ogni movimento leggermente di-
verso dal suo simile. Quindi, oltre a allenare
le spalle in modo leggermente diverso ogni
volta, che signica che le allenate da angoli
leggermente diversi per uno sviluppo otti-
male, correte meno rischi di andare in stallo
seguendo la stessa routine.
Gli dei dellallenamento hanno parlato.
Forse non dovete portare il peso del mondo
sulle spalle, per avete qualche sollevamento
pesante da fare.
NOTA 1: la parte
alta del trapezio
allenata lungo
il piano verticale,
perci non ne-
cessario ruotare
le spalle, cosa
che pu anche
porre stress
sulle vertebre
cervicali.
R
INFORMAZIONE: NON RUOTATE MAI LE SPALLE DURANTE UNA SCROLLATA.
ALLENAMENTO
Olympians News / SUPER FITNESS 115
116 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Copyright 2012 by Robert Kennedy Publishing
L
E
O

A
.

S
A
L
I
N
A
S
DI MICHAL KAPRAL
Brian Stann
PROFILI
REPS! UOMO
Lallenamento per la potenza di Stann
Gli allenamenti pre-combattimento di Stann sono una combinazione di potenza, durata ed esercizi isometrici.
ET: 31
ALTEZZA: 185 cm
PESO DI COMBATTIMENTO: 84 kg
NATO A: base aerea Yakota, Giappone
CRESCIUTO A: Scranton, Pennsylvania
CREDENZIALI: combattente UFC,
ha ricevuto la stella dargento come
Capitano nella guerra in Iraq.
SOPRANNOME: All-American
All-American Brian Stann
nato per combattere
Linfanzia passata in Pennsylvania gli ha anche
insegnato a utilizzare le avversit come stimolo per i
successi futuri, dice Stann. Arrivato al college si im-
maginava gi come il quarterback di punta della squa-
dra di football, e la delusione quando seppe che non
sarebbe successo fu devastante. Dovevo riprendermi
da quel colpo, dice Stann. Dovevo trovare un modo
per diventare un condottiero e dare un contributo
determinante alla squadra. Da quarterback pass al
ruolo di safety e n per dare il suo contributo migliore
come linebacker. Ci sono lezioni da trarre da qualsi-
asi situazione avversa, ci rivela Stann, un mantra uti-
lissimo per destreggiarsi nella vita. Potete scegliere
di lasciarvi abbattere dalle avversit oppure utilizzarle
come lezioni per ottenere successi futuri.
Negli allenamenti e nei combattimenti, Stann
utilizza tanto il cervello quanto i muscoli. Un lau-
reato in economia che ha fondato Hire Heroes USA,
unorganizzazione che aiuta ex soldati a trovare un
impiego, Stann sa come trarre il massimo da qualsi-
asi situazione. I suoi allenamenti e circuiti intensi
per la potenza farebbero implorare piet alla mag-
gior parte degli atleti. Perci non sorprende che
questatleta sponsorizzato dalla Gaspari Nutrition
e da Bodybuilding.com riporti spesso la vittoria
nellottagono. I combattenti combattono perch
combattere nel loro DNA, dice Stann. Io sono un
combattente nato.
RISCALDAMENTO
Salti e altri esercizi pliometrici come riscaldamento
SUPERSERIE 1
RIPETERE CONSECUTIVAMENTE PER 4 SERIE
ESERCIZIO RIPETIZIONI CARICO
Girata a partire dalle 5 85 kg
ginocchia
Lavoro per il collo 20 in ciascuna direzione 10-15 kg
Lavoro per il core Distensioni in avanti allincapacit
con le fasce elastiche TRX
SUPERSERIE 2
RIPETERE CONSECUTIVAMENTE PER 3 SERIE
ESERCIZIO RIPETIZIONI CARICO
Squat frontale a una gamba 5 10 kg per lato
Trazioni alla sbarra 6 25 kg
con sovraccarico
Distensioni isometriche 5 Variabile (trattenete
con manubri nel punto intermedio
per 20 secondi)
SUPERSERIE 3
RIPETERE CONSECUTIVAMENTE PER 3 SERIE
Sollevamenti laterali con sovraccarico su panca
con il sistema TRX. Cominciate con una trattenuta
isometrica di 15 secondi, seguita da 8 ripetizioni,
spremendo nel punto alto di ciascuna ripetizione.
Leg Curl in piedi. Cominciate con una trattenuta
isometrica di 15 secondi, seguita da 8 ripetizioni,
tirando il pi possibile verso i glutei.
Squat a una gamba con il dorso del piede dietro
appoggiato su una panca. Concentratevi sul tallone
della gamba avanti per 8 ripetizioni per ciascuna
gamba.
SERIE DI SCATTI RIPETERE PER 6 SERIE
Utilizzando una slitta caricata con 100 kg, fate due
scatti a tutta per 20 metri.
Passate immediatamente a 25 secondi di pugni al
sacco pesante.
Fate subito dopo altri due scatti con la slitta
AEROBICA CONCLUSIVA
Scatti su tapis roulant no allincapacit. 10 secondi
di scatti, 10 secondi di riposo con inclinazione 10 e
velocit 11.
Il programma
alimentare di
Brian Stann
Per scendere a 84 kg
prima di un combat-
timento, Brian Stann
segue un programma
alimentare rigido.
MATTINA PRESTO:
Mirtilli e lamponi
con yogurt greco
45 MINUTI DOPO:
Frullato proteico
con olio di semi
di lino
PREALLENAMENTO:
1,5 cucchiaini di
miele puro
POST-ALLENAMENTO:
frullato per il re-
cupero MyoFusion
Probiotic Series
con verdure in
polvere
PRANZO: verdure mi-
ste e pollo grigliato
PREALLENAMENTO:
1,5 cucchiaini di
miele puro
POST-ALLENAMENTO:
frullato per
il recupero
CENA: salmone
grigliato e verdure
miste
PRIMA DI CORICARSI:
frullato proteico
con una tazza di
ker
SPUNTINI: mandorle
al naturale o petto
di tacchino magro
(secondo quanto
necessario durante
la giornata)
Con uninfanzia turbolenta passata nella rissosa cittadina di
Scranton, probabilmente la pi grande comunit di minatori di antracite della
Pennsylvania, Brian Stann ha imparato presto a difendersi e nelle risse fra gang
locali era sempre lultimo ad arrendersi. Non ho mai avuto paura di esprimere le
mie opinioni e riuscivo sempre a difendermi, dice. Da piccolo, ero preso di mira
dai ragazzi pi grandi. Cerano due opzioni: imparare a difendersi o scappare. Oggi
che un veterano decorato della Guerra in Iraq e uno dei combattenti migliori della
categoria pesi medi dellUFC, non difcile capire quale opzione ha scelto Stann.
I combattenti combattono
perch nel loro DNA. Io sono
un combattente nato.
L'Appuntamento N1 per il mondo del
Bodybuilding e Sport di Potenza
dal 19 al 22 Aprile 2012
19-20 Aprile per Operatori Professionali 21-22 Aprile per Operatori e Pubblico
Quartiere Fieristico di Essen, Germania Padiglione 8, 9, 10/11 & 12
Siamo interessati ad avere informazioni in qualit di Visitatori su FIBO POWER 2012
Siamo interessati ad avere informazioni in qualit di Espositori su FIBO POWER 2012
Azienda
Contatto
Via/ Cp
Citt
Telefono Fax
E-Mail
CONTATTO: FAX 02.33402130 Oppure telefonate allo O2.33402131
CF
FIBO POWER Night Session
Arm Wars Ferocity
MFN Newcomer Gala
Grappling Cup
FIBO Strongman ClassX
Miss FIBO POWER Beauty
FIBO POWER Strongest Benchpresser
Stars on Stage
Dr. Beins POWERLifting Challenge
Delegazione FIBO POWER in Italia: PROMOEVENTS srl Via Privata Pomezia 10/A 20127 Milano
Tel: 02/33402131 Fax: 02/33402130 Email: italia@fibo.de

www.fibo-power.de
ON
Copyright 2012 by Robert Kennedy Publishing
I
A
N

T
R
A
V
I
S

B
A
R
N
A
R
D
DI MICHAL KAPRAL
Jim Vaglica
PROFILI
ET: 49 anni
ALTEZZA: 173 cm
PESO: 75 kg
ABITA A: Billerica, MA
LAVORA A: Waltham, MA
PROFESSIONE: Capo pattuglia della polizia
stradale; membro di una divisione SWAT
regionale nel Massachusetts del nord est.
CREDENZIALI PER LA FAMA: Vive per servire
e proteggere; concorrente di Expedition
Impossible.
Allinizio della sda di 10 tappe cerano 13
squadre di 3 persone, con un montepremi totale
di 150.000 $. Vaglica, la cui squadra era chiamata
Team Cops, dice che le giornate erano molto pi
dure di come appaia in TV, con riprese che durava-
no no a 14 ore. Le uniche fonti di sostentamento
erano lacqua e il cibo che riuscivi a trasportare,
dice. Arrivavi allaccampamento, bevevi, mangia-
vi e poi collassavi, sapendo che ti avrebbero sve-
gliato la mattina per rifare tutto daccapo.
Per prepararsi ad affrontare la prova, Vaglica ha
ritoccato la sua routine abituale per la costruzio-
ne muscolare per concentrarsi di pi sulla durata
e altre capacit atletiche. Ha anche macinato cir-
cuiti allaperto stile SWAT che includevano: ribal-
tamento di pneumatici, trasporto di tronchi, tirata
della slitta, arrampicata su cor-
da e camminate veloci standard
di 8-10 km con uno zaino di 15
kg sulle spalle. Per partecipare
Lallenamento Expedition Impossible
Per mettersi in forma per il reality show della ABC, Jim Vaglica ha cambiato la
sua routine di allenamento standard per la forza e ha migliorato la forma sica
complessiva seguendo un programma a circuito. Oltre a seguire un programma
di allenamento con i pesi tradizionale, Jim ha seguito anche il programma
seguente a base di trazioni alla sbarra e squat con peso corporeo.
Vaglica ha ideato un allenamento a base di trazioni alla sbarra (eseguendo
ripetizioni no allincapacit e utilizzando la sua versione dellesercizio) e
squat con peso corporeo (20 ripetizioni) eseguiti in superserie. Iniziando con
le trazioni alla sbarra e poi passando subito agli squat, Jim si preggeva un
obiettivo di trazioni totali ed eseguiva quante superserie di trazioni/squat
necessarie per raggiungere il numero totale di trazioni previsto. Ad esempio,
se lobiettivo erano 75 trazioni alla sbarra, ma nella prima serie aveva raggiunto
lincapacit a 20, eseguiva subito 20 ripetizioni di squat. Poi, cominciava
immediatamente a eseguire trazioni alla sbarra per il maggior numero di
ripetizioni possibile, e, raggiunta lincapacit muscolare, eseguiva 20 squat.
Continuava cos no a portare a termine le 75 trazioni pressate. Mantenevo un
ritmo elevato che mi faceva avere il atone per tutto il tempo, dice Vaglica.
alla trasmissione, tutti i concorrenti hanno dovuto
prendere lezioni avanzate di discesa a corda dop-
pia, equitazione e nuoto.
Inizialmente, Vaglica aveva chiesto di poter
partecipare a Survivor ma poi ricevette una
telefonata e si ritrov a dover mettere insieme la
sua squadra Team Cops per partecipare a Expe-
dition Impossible. Vaglica dice che la sua squa-
dra dove lo afancavano un uomo e una donna
anchessi della SWAT era ben preparata per le
sde siche e mentali della trasmissione, grazie
soprattutto ai 13 anni di Vaglica come membro
della squadra dlite della SWAT. Per noi, la mis-
sione viene prima di tutto il resto, dice. Non ci
diamo per vinti; non ci arrendiamo; non abbiamo
paura. Mai. per questo che la trasmissione ci ha
dato meno spazio rispetto agli altri con-
correnti. Volevano comportamenti me-
lodrammatici, paura, ma non li abbiamo
accontentati.
Da ultimo, Team Cops nita al quin-
to posto, ma Vaglica dice che rimon-
terebbe volentieri in sella per unaltra
sda: Coglierei qualsiasi opportunit
per rifare una cosa del genere.
Trazioni alla
sbarra, stile
Jim V.
Per stimolare ulteriormente
i muscoli della schiena,
Vaglica cominciava
ciascuna ripetizione
di trazioni alla sbarra
eseguendo una retrazione
scapolare nella posizione
da appeso, spremendo e
poi rilasciando le scapole
prima di spingersi verso
lalto il pi velocemente
possibile no a toccare
la sbarra con il mento.
Poi si riabbassava
lentamente distendendo
completamente il corpo.
Questa era la prima
ripetizione. Iniziava la
successiva eseguendo
unaltra retrazione
scapolare. Come sda
aggiuntiva, Vaglica
cambiava la presa ogni
tre ripetizioni, passando
dalla pi facile alla pi
difcile. Partiva da una
presa larga, passava a una
presa media prona, poi a
una presa neutra e inne
a una presa stretta supina.
Ripeteva la sequenza no
allincapacit, dopodich
eseguiva gli squat.
Squat con peso
corporeo: Vaglica
eseguiva gli squat in
modo molto controllato,
abbassandosi sotto
la parallela ma senza
rimbalzare nel punto
basso.
Pensava di essere pronto a tutto, ma Jim Vaglica non aveva
messo in conto i cammelli. Dopo due mesi passati ad allenarsi intensamente per par-
tecipare al reality show avventuroso Expedition Impossible, prodotto da Mark
Burnett e trasmesso dalla ABC, il 49-enne sergente di polizia di Boston e membro
di una divisione regionale dei reparti scelti statunitensi (SWAT) si ritrovato im-
provvisamente a battersi con bestie selvagge nel deserto marocchino. Quei diavoli
di cammelli la spuntavano sempre! Sono enormi alti due metri e mezzo e cattivi,
dice Vaglica. Io sono stato buttato a terra pi di una volta e altri sono stati addirittu-
ra presi a calci. E gli stalloni arabi erano altrettanto indisciplinati. A un certo punto
il cavallo di Vaglica si tuffato nel vuoto, costringendolo a saltare gi dalla sella.
Volevano
comportamenti
melodrammatici,
paura, ma Team
Cops non li ha
accontentati.
Muscolo SWAT
REPS! UOMO
118 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Olympians
S.r.l.
055/958058 Fax 055/958255
info@olympianstore.it www.olympianstore.it
KETTLEBELL

VISITA IL SITO WWW.OLYMPIANSTORE.IT
(solo customer care e ordini)
Numero verde
800-776999
(solo customer care e ordini)
Per ordini chiam
a
:
GRIGIO BASE IN GOMMA
OK
BASE IN GOMMA
colore: GRIGIO
In ghisa meccanica con base
gommata. il pi piccolo dei nostri
kettlebell pesa 4 kg, il peso ideale
per principiante, donna o uomo a
qualunque livello di capacit fisica.
In pezzature da KG: 4, 8, 12, 16,
20, 24, 28, 32, 36, 40, 44, 48
Kettlebell da competizione con maniglia e
corpo interno in acciaio, rivestimento in
gomma. Stesse dimensioni anche per pesi
progressivamente differenti.
In pezzature da KG: 12, 16, 20, 24, 28
RUBBER COMPETITION
OKRC
Kettlebell classici, nero lucidato, in fusione
di ghisa. In pezzature da KG: 4, 8, 12, 16,
20, 24, 28, 32, 36, 40, 44, 48
NERO POLISHED
OKP
I classici Kettlebell per gli allenamenti pi attuali
Il Kettlebell Hollow da
competizione della Olympians
Gym si differenzia dagli altri
kettlebells perch ha le stesse
dimensioni anche per pesi
progressivamente differenti.
In pezzature da KG: 8, 12,
16, 20, 24, 28, 32
HOLLOW - DA COMPETIZIONE
OKR
N
O
V
I
T

WWW. OLYMPI AN. I T


Quando avevo 18 anni, mi trovavo
nellappartamento di una mia amica
quando udii un gmito provenire
dal cassonetto delle immondizie. Mi
avvicinai e vidi che qualcuno aveva
bloccato il coperchio con una traversa,
la rimossi, sollevai il coperchio e, con
mia gran sorpresa,
trovai un cucciolo
allinterno del
cassonetto.
Adottai il
piccolo cucciolo
di pitbull, lo
battezzai Tank,
e da allora il mio
migliore amico.
I
A
N

L
O
G
A
N
Brandon Myles White
Supereroe Fondamentale
Da piccolo, il ragazzo di copertina di Reps! Brandon Myles
White sognava di avere un giorno laspetto di un supereroe dei
lm. Nel giro di pochi anni tdan! sogno realizzato.
Ero un ammiratore
dei bodybuilder
della vecchia scuola
come Steve Reeves, Arnold e Larry Scott.
Leggendo i libri che mio padre teneva
in garage, cominciai a pensare a quanto
sarebbe stato fantastico avere un aspetto
davvero potente come un eroe dei fumetti o
dei lm dazione.
A 17 anni, dopo aver visto lm come
Predator e Rocky decisi che volevo guada-
gnare un po di massa muscolare. Tutta-
via, scelsi la strategia peggiore pos-
sibile, ingozzandomi di calorie a pi
non posso (tanto che mangiavo barrette
di cioccolato pure la notte), convinto di
aver trovato il modo migliore per costruire
muscolo. Mi sbagliavo di grosso!.
Ho cominciato a praticare
larrampicata su roccia, come
parte di un corso speciale offerto dal liceo e da allora ne sono
un appassionato. Lanno scorso ho
ottenuto anche la certicazione di
immersione subacquea e mi sono
immerso nelle Hawaii e a Saint-
Barthlemy nelle Antille.
Quando avevo
nellappartamento
quando udii un gm
dal cassonetto dell
avvicinai e vidi che
bloccato il coperch
la rimossi, sollevai
mia gran sorpre
trovai un cuccio
allinterno del
cassonetto.
Adottai il
piccolo cucciolo
di pitbull, lo
battezzai Tank,
e da allora il mio
migliore amico.
Superero
Da piccolo, il r
White sognava
lm. Nel giro di
H
larr
parte di u
un appas
ottenuto
immersio
immerso
Barthlem Non appena ho
cominciato ad allenarmi
correttamente, ho
cominciato a ottenere
risultati molto
rapidamente.
ET: 27 anni
ALTEZZA: 188 cm
PESO: 104 kg
RESIDENZA: Los Angeles
SUL WEB:
brandonmyleswhite.com
TWITTER: @brandon_myles
PROFILO DI
COPERTINA
5
il numero di giorni
consecutivi la
settimana in cui
Brandon Myles
White si allena in
palestra. Si concede
uno stacco il fine
settimana.
REPS! UOMO
Copyright 2012 by Robert Kennedy Publishing
Siate costanti.
Solo perch
non state
vedendo risultati
immediati non
vuol dire che
lallenamento
non stia dando i
suoi frutti.
120 Olympians News / SUPER FITNESS
Per ulteriori informazioni visitate il sito internet www.healthynfit.it
oppure contattate direttamente Olympians S.r.l. al numero verde da telefono fisso 800-776-999
L
e
g
g
e
r
e

a
t
t
e
n
t
a
m
e
n
t
e

l
e

a
v
v
e
r
t
e
n
z
e

e

l
e

m
o
d
a
l
i
t

u
s
o

r
i
p
o
r
t
a
t
e

i
n

e
t
i
c
h
e
t
t
a
.

Proteine derivate
dallalbume delluovo.
Peptidi e proteine delluovo 100%
puri, con il tasso di efcienza
proteica pi alto possibile. Molti
considerano le proteine delluovo la
forma proteiche di qualit pi alta
per il corpo umano. Sono ricche
di tutti gli amminoacidi essenziali,
compresi gli amminoacidi
ramicati. Inoltre, questo prodotto
completamente naturale e senza
aromi, dolcicanti o coloranti
articiali.
N.P.U. 95%
il pi alto N.P.U.
(Net Protein Utilization)
P.E.R. 3,9
il pi alto P.E.R.
(Protein Efficiency
Ration)
senza dolcificanti!
deri ate Proteine d i P
FACILMENTE
SOLUBILE
ASSOLUTAMENTE
DELIZIOSO!
GUSTI: CACAO / VANIGLIA
BARATTOLO da 908 g
Complesso di proteine [albume duovo, idrolizzato
di proteine delluovo], papaina (da Carica papaya),
bromelaina (da Ananas comosus).
Informazioni nutrizionali per porzione 28 g (gusto cacao)
Proteine 22 g
Carboidrati 2 g
di cui zuccheri 0 g
Grassi 0 g
Proteine 78,6 g
Carboidrati 7,14 g
Grassi 0 g
Informazioni nutrizionali per 100 g (gusto cacao)
GUSTI: CACAO / VANIGLIA
BARATTOLO da 908 g
Complesso di proteine [concentrato di proteine
del siero di latte, proteine del siero di latte
ottenute con scambio ionico, proteine del siero
di latte idrolizzate, isolato di proteine del siero di
latte], glutammina.
Informazioni nutrizionali per porzione 56 g (gusto vaniglia)
Proteine 43,68 g
Carboidrati 4,48 g
di cui zuccheri 3 g
Grassi 1,12 g
Proteine 80,35 g
Carboidrati 5,35 g
Grassi 1,78 g
Informazioni nutrizionali per 100 g (gusto vaniglia)
Ogni porzione di questo prodotto
contiene 45 g di proteine del siero,
peptidi del siero e amminoacidi
della qualit pi alta. Non ci sono
dolcicanti, coloranti o aromi
articiali aggiunti e neanche grassi
aggiunti. 100% Whey Pro-Amino
contiene le frazioni proteiche beta-
lattoglobulina, alfa-lattoalbumina,
glicomacropeptidi, albumina e
lattoferrina.
Tecnologia hi-tech ad
alto assorbimento.
FACILMENTE
SOLUBILE
ASSOLUTAMENTE
DELIZIOSO!
OLTRE 40 GRAMMI
DI PROTEINE
DELLA PI ALTA
QUALIT
PER PORZIONE
Whey protein
Peptidi
Aminoacidi
senza dolcificanti!
Foto: Eric Jacobson - (www.impact-photography.com)
52,00
42,00
122 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Chris Harnell
Allenatevi Zavorrati
Prediligo un approccio semplice al sollevamento pesi e seguo un
programma di allenamento tradizionale. Attenermi ai fondamentali
mi ripaga con i risultati di cui ho bisogno per essere sempre al mas-
simo della forma, quindi non ricorro a attrezzi strani o particolari.
Tuttavia, ogniqualvolta adotto una mentalit competitiva, adoro
utilizzare un giubbotto zavorrato per definirmi durante le mie
sessioni di aerobica. Il giubbotto in questione pesa circa 15 kg
e lo indosso e faccio power walking allaperto per circa unora.
Cos facendo, accelero il battito cardiaco molto di pi rispetto
alle camminate senza giubbotto, e a volte incorporo scali-
nate o colline nellallenamento per bruciare
pi calorie. Di tanto in tanto, faccio qualche
scatto su una superficie piana con
indosso il giubbotto, ma senza esage-
rare perch non voglio sottoporre le
ginocchia a una pressione eccessiva.
Il carico aggiuntivo aiuta a bruciare
grasso corporeo e a scolpirmi, oltre
a fornire lavoro in pi per i polpacci,
qualcosa di cui abbiamo quasi tutti
bisogno!
Attrezzi
insoliti
DI LARA McGLASHAN-VOLZ, MFA, CPT
Sean Lowe
Scegliete le catene!
Ho giocato a football per anni, ma nessun allenamento di football potr mai eguagliare i
guadagni di forza che ho ottenuto utilizzando le catene. Prendete due catene massicce e
avvolgetele intorno alle estremit di un bilanciere quando eseguite gli squat o le distensioni su
panca piana, ad esempio. Quando abbassate il bilanciere, le catene si accatastano sul pavimento
e il carico si alleggerisce come se lo riduceste. Poi quando ritornate eretti o distendete il carico
verso lalto, le catene si sollevano e il carico aumenta con il progredire della fase concentrica.
Grazie alle catene, ho ottenuto miglioramenti fantastici in termini di forza ed esplosivit mu-
scolare e le considero un elemento fondamentale della mia strategia per guadagnare massa.
Per quanto riguarda laerobica, la mia nuova macchina preferita un tapis roulant della
palestra dove mi alleno che sinclina fino al 25%! Lo regolo a 5,5 km lora e minerpico su per
quella salita. Cos facendo, accelero il battito cardiaco e brucio grasso corporeo pi veloce-
mente! E la parte inferiore del corpo prende letteralmente fuoco!
Ammettetelo: a volte i vostri
allenamenti con i pesi vi annoiano. Non
preoccupatevi, ogni tanto la noia colpi-
sce persino gli atleti pi dediti. Invece
di macinare lennesima (sbadiglio) serie
per il petto, perch non provate a utiliz-
zare alcuni attrezzi particolari usati da
chi ha imparato come fare a mantene-
re i propri allenamenti sempre freschi?
Basta che incorporiate una qualsiasi di
queste tecniche o attrezzi e darete una
scossa al corpo e alla mente.
Scoprite come aggiungere
variet allallenamento
(e prevenire la noia)
per alimentare i progressi.
Nota del redattore: il giubbotto
zavorrato Olympians regola-
bile aggiunger 15 kg ai vostri
sforzi aerobici per 100,83
il giubbotto dotato di 30 pesi
in ghisa da 0,5 kg cadauno.
www.olympianstore.it
I CONSIGLI DEGLI ESPERTI
F
O
T
O

D
I

A
L
E
X

A
R
D
E
N
T
I

E

P
A
U
L

B
U
C
E
T
A
Nota del redattore: Catene da palestra
Olympians, da applicare ai bilancieri per
appesantire progressivamente il carico,
lunghe 150 cm cadauna da 6, 8 o 12 kg.
www.olympianstore.it
Copyright 2012 by Robert Kennedy Publishing
Sebastian Siegel
Seguite i vostri istinti
fondamentali
Un tempo seguivo una routine di
allenamento con i pesi standard
con serie normali, split delle parti
corporee e via dicendo. Adesso, mi
alleno ad alta intensit e non conto
mai le serie, eseguendo 12-100
ripetizioni (fidatevi, raggiungere il
traguardo dei 100 vi esaurir come
mai prima); poi mi riposo un po e, a
seconda di come mi sento, rifaccio
tutto daccapo. Per quanto riguarda
laerobica, poich adoro correre su
per una scalinata, percorro qualche
rampa in su e in gi per riscaldarmi
poi salto qualche scalino, carico
una persona o due! sulle spalle
e la trasporto in su e in gi un paio
di volte.
Anche il sacco pesante un
attrezzo fantastico per laerobica.
Allenatevi con un compagno e fate
a turno a sferrare calci e pugni al
sacco, per 30 secondi ciascuno. Per
accelerare il battito cardiaco, ese-
guite combinazioni, calci continui
e roba del genere. Allenandomi in
questo modo, ottengo una risposta
ormonale naturale una cosa incre-
dibile! Favorisce anche lo sviluppo
di muscoli magri, lossidazione del
grasso, e vi fornisce una sfida emo-
tiva che pu essere illuminante.
Nota del redattore: Scegliete
il sacco di potenza dellOlym-
pians 15lb a carico progressi-
vo con impugnature laterali
per 75,63.
DI STEVEN STIEFEL
Accelerate la
perdita di grasso
senza perdere
muscolo
Una nuova ricerca avvincente
sulla leucina, uno degli amminoacidi ramicati
(BCAA), dimostra che assumere o integrare con
questo amminoacido pu aiutarvi a bruciare pi
grasso corporeo conservando per tessuto muscola-
re prezioso. Lo studio, che ha coinvolto 10 scalatori
mentre scalavano la montagna pi alta del mondo,
il Monte Everest, ha valutato gli effetti dellintegra-
zione con leucina sulla perdita di muscolo e grasso
alle altitudini elevate (consi-
derando che lEverest alto
8.848 m stiamo parlando
di unaltitudine che mette
paura).
Nuove scoperte interessanti confermano
che un amminoacido ottimizza il potenziale
brucia grassi senza cannibalizzare tessuto
muscolare, anche se siete gi magri
Science Daily scrive che, sebbene i ri-
cercatori Wayne Askew e Stacie Wing-
Gaia stiano ancora analizzando i dati,
sembra che la leucina possa aiutare a
preservare il tessuto muscolare durante
lossidazione di grasso corporeo, anche in
condizioni difcili come altitudine eleva-
ta, dieta con calorie ridotte e svolgimento
di attivit vigorosa o nel corso di periodi
di assunzione di ossigeno limitata.
Gli scalatori hanno assunto ogni giorno
tre barrette alimentari che contenevano
dosi elevate di leucina e i ricercatori han-
no raccolto dati metabolici usando stru-
menti a ultrasuoni. Solitamente, quando
soggetto a condizioni cos ardue, il corpo,
nel tentativo di trovare risorse energeti-
che, brucia sia muscolo sia grasso corpo-
reo, per i ricercatori hanno scoperto che
la leucina aiuta il corpo a salvaguardare il
tessuto muscolare necessario per lattivit
sica, concentrandosi invece sulluso del
grasso corporeo per produrre energia.
Daccordo, forse non vi state allenando
a 8.000 m come quegli scalatori, per i
beneci da loro sperimentati si applicano
anche a noi quaggi a valle. Quando inte-
grate con leucina o BCAA riducete i livelli
di grasso corporeo e ottenete anche pre-
stazioni migliori durante lattivit sica
intensa. Una cosa importantissima per gli
atleti di qualsiasi tipo: culturisti, atleti di
durata e atleti di forza.
Leucina e BCAA
I BCAA sono un gruppo di tre ammino-
acidi leucina, isoleucina e valina con
struttura chimica simile, che li contraddi-
stingue dagli altri amminoacidi. Questi tre
BCAA sono essenziali, che signica che il
corpo non pu sintetizzarli internamente,
perci necessario trarli attraverso la dieta
e lintegrazione.
Anche se i tre BCAA lavorano congiun-
tamente per stimolare gli stessi beneci, la
leucina considerata la pi importante del
trio per promuovere i beneci per il sico e
la prestazione. Ecco alcuni dei vantaggi spe-
cici della leucina e degli altri BCAA.
QLa leucina aiuta a bruciare grasso
corporeo. Dei tre BCAA, la leucina
lamminoacido chiave per promuo-
vere lossidazione del grasso. Questo
perch aumenta il ritmo metabolico e
il dispendio calorico. La leucina riduce
anche lappetito. Alla presenza della
leucina, il corpo attinge soprattutto
alle riserve di grasso corporeo per ot-
tenere energia, aiutandovi a dimagrire
conservando tessuto muscolare.
Un modello della molecola dellamminoacido
leucina. Gli amminoacidi sono gli elementi
costitutivi delle proteine e aumentano
il potenziale brucia grassi del sistema metabolico.
MACCHINA MAGRA
124 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Copyright 2012 by Robert Kennedy Publishing
CURIOSIT: NON DOVETE NECESSARIAMENTE PERDERE MUSCOLO QUANDO VI DEFINITE.
INTEGRATORI
Q La leucina aumenta il rilascio di
insulina. Dopo gli allenamenti, un
forte rilascio di insulina facilita il tra-
sporto dei nutrienti, come la creatina
e il glucosio, al tessuto muscolare, per
la crescita e il recupero. Il glucosio
fondamentale per riempire le riserve
di glicogeno esaurite dallallenamen-
to intenso. Ricordatevi, tuttavia, che
in altri momenti della giornata non
dovete aumentare troppo il rilascio
di insulina. meglio integrare con la
leucina (o i BCAA) prima e dopo gli
allenamenti.
Q I BCAA prevengono la disgrega-
zione muscolare. Quando il corpo
ha bisogno di pi energia di quella
apportata con il cibo, attinge dal tessu-
to muscolare e dalle riserve di grasso
corporeo. In questo caso, il ruolo della
leucina duplice: incoraggia il corpo
ad attingere dalle riserve di grasso e
scoraggia il corpo a disgregare il tes-
suto muscolare, la fonte energetica pi
facile a cui attingere. La ricerca pre-
sentata a un meeting annuale della In-
ternational Society of Sports Nutrition
ha dimostrato che i BCAA riducono
anche i livelli di cortisolo quando as-
sunti dopo lallenamento. Il cortisolo
un ormone catabolico rilasciato nei
momenti di stress, come durante latti-
vit sica intensa. Fra gli svantaggi del
cortisolo ci sono il blocco degli effetti
di costruzione muscolare del testoste-
rone e la spinta verso la disgregazione
muscolare. Il cortisolo favorisce anche
il deposito di grasso corporeo, spe-
cialmente di quello viscerale. I BCAA
intervengono riducendo il cortisolo e
salvando il tessuto muscolare.
Q La leucina stimola la sintesi pro-
teica. La sintesi proteica il processo
attraverso il quale le cellule muscolari
aumentano le proteine muscolari, au-
mentando il tessuto muscolare. Anche
lisoleucina e la valina inuenzano
positivamente la sintesi muscolare ed
possibile ottenere beneci aggiunti
assumendo tutti i tre amminoacidi sot-
to forma di integratori. Il momento pi
cruciale per la sintesi proteica subito
dopo la ne di sessioni di allenamento
intense.
Q I BCAA aumentano lenergia du-
rante gli allenamenti. I BCAA sono
metabolizzati in modo diverso rispetto
agli altri amminoacidi. La gran parte
degli amminoacidi raggiunge diretta-
mente il fegato per essere disgregata
immediatamente e poi distribuita in
tutto il corpo. Invece, i BCAA van-
no direttamente dove sono necessari
come carburante immediato. Per-
ci, durante lallenamento con i pesi
i BCAA sono trasportati ai muscoli
allenati, aiutandovi ad allenarvi pi
intensamente e ad aumentare i livelli
energetici.
La scommessa migliore
Potete integrare solo con leucina, con tutti
i BCAA o con una qualche combinazione
di essi. Ricordatevi che gli altri due BCAA,
isoleucina e valina, bench non potenti
quanto la leucina, possono apportare bene-
ci complementari. Per ottenere i risultati
migliori dallallenamento con i pesi, assu-
mete 3-5 g di BCAA prima e dopo gli alle-
namenti, per un totale pari a no 10 g al
giorno. Assumete i BCAA preallenamento
30 minuti circa prima dellallenamento
insieme a un frullato proteico e assume-
te i BCAA postallenamento subito dopo
la ne della sessione [nota del redattore:
dovete comunque fare un pasto con pro-
teine e carboidrati complessi entro i 90
minuti successivi lallenamento].
Cercate prodotti con BCAA che con-
tengono leucina, isoleucina e valina in
rapporto 2:1:1. In altre parole, una dose
ideale di 5 g di BCAA contiene 2,5 g di
leucina, 1,25 g di isoleucina e 1,25 g di
valina. R
J
A
M
E
S

E
L
L
I
S

D
I

A
L
E
X

A
R
D
E
N
T
I
Quando integrate
con leucina o BCAA
riducete i livelli
di grasso corporeo
e ottenete anche
prestazioni
migliori
durante
lattivit
fisica
intensa.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 125
Acceleratori
metabolici
Sapete che un elemento essenziale per mas-
simizzare i risultati dentro e fuori la palestra, molti per non sanno cosa
sia davvero il metabolismo, tanto meno perch cos importante. Capire i
fondamentali di come funziona il metabolismo e di quali sono gli alimenti
che coadiuvano il miglioramento del suo funzionamento fondamentale
per progredire e raggiungere i propri obiettivi, sia per i principianti sia per
chi si trova in un plateau dellallenamento.
Con Boost Your Metabolism Cookbook, la cuoca Susan Irby e la dotto-
ressa Rachel Laferriere, suddividono i fondamentali del metabolismo in
tre fattori principali:
Essenzialmente, il metabolismo la velo-
cit e il modo in cui il corpo converte il cibo
in energia. Oltre allattivit sica, il fattore
pi cruciale che inuenza il ritmo metaboli-
co il cibo assunto. Ecco alcuni dei migliori
acceleratori del metabolismo in circolazio-
ne, con delle combinazioni che rivitalizze-
ranno il metabolismo ancora di pi.
Sciogliete pi grasso, bruciate pi calorie
e aumentate lenergia per allenamenti
pi intensi con questi sei potenti alimenti
funzionali

Acceleratore: yogurt
greco
Adesso ha un suo posto sso fra gli altri lat-
ticini sugli scaffali del supermercato ma in
passato lo yogurt greco era difcile da tro-
vare e relativamente sconosciuto al grande
pubblico. riuscito a salire alla ribalta per-
ch apporta un bel po di proteine (18 g con
una porzione di di tazza) e anche perch
lunico latticino con una versione magra
che conserva la consistenza e il sapore ric-
chi dello yogurt intero.
Q Accelerate lacceleratore: mi-
schiate dellavena integrale spezzata
con dello yogurt greco aromatizzato
alla vaniglia e una tazza di mirtilli (ric-
chi di antiossidanti e bre), creando
cos una leccornia tripla per iniziare la
giornata alla grande.
Acceleratore: broccoli
Se riuscite ad andare oltre i brutti ricor-
di dellinfanzia quando vi costringevano
a mangiare questo ortaggio della famiglia
delle crocifere, reintrodurre i broccoli nella
vostra dieta un ottimo modo per accelera-
re il metabolismo. Questo ortaggio potente
aumenta davvero, anche del 30%, la capa-
cit del corpo di bruciare il grasso. Lalto
contenuto di acqua e di bre vi far sentire
pi sazi, pi a lungo. Se il vostro sistema di-
gestivo sensibile agli effetti gassosi dei
broccoli crudi, provate a cuocerli cos da
digerirli pi facilmente. Per non esagerate
con la cottura.
Q Accelerate lacceleratore: La
frutta secca una fonte ottima di
proteine; il tipo migliore sono
le mandorle. Uno studio re-
Volete accelerare il metabolismo?
Non potete sbagliarvi scegliendo
alimenti energetici sani come
salmone, broccoli e pomodori.
ALIMENTA LA BESTIA
DI ALLISON McDONALD
2. Livello di attivi-
t sica: il livello a
cui operate e brucia-
te calorie quando
attivi.
3. Effetto termi-
co del cibo: le-
nergia necessaria
afnch il corpo
digerisca il cibo.
1. Ritmo meta-
bolico di base: la
velocit a cui il cor-
po brucia le calorie
quando siete inattivi.
Copyright 2012 by Robert Kennedy Publishing
126 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 127
CURIOSIT: PEPE DI CAYENNA, CUMINO E POLVERE CHILI RAPPRESENTANO UNOTTIMA MISCELA BRUCIA GRASSI.
CIBI BRUCIA GRASSI
cente condotto alla Purdue University
(West Lafayette), ha rivelato che man-
giare mandorle accelera il metaboli-
smo senza causare guadagno di peso,
quando assunte in quantit moderate.
Combinate le mandorle tostate con i
broccoli per creare un contorno sa-
ziante e povero di calorie.
Per minimizzare la perdita di sul-
forafano, un antiossidante potente
distrutto dalla cottura eccessiva dei
broccoli, aggiungete delle cime fre-
sche. Secondo uno studio recente, ag-
giungere cime fresche quasi raddoppia
la quantit di sulforafano.
Acceleratore: salmone
selvaggio
Avete ormai imparato a memoria che le
proteine magre, come pollo, tacchino e ton-
no, sono quelle da preferire, giusto. Per
quando si vuole un acceleratore metabolico
proteico che apporta alla dieta anche gras-
si salubri, il salmone la scelta migliore. I
due tipi di acidi grassi omega-3 (DHA e
EPA) presenti nel salmone sono molto uti-
li al metabolismo e aiutano a combattere
le inammazioni. Il salmone ricco anche
di selenio, un minerale fondamentale per
la salute della tiroide. Se i tranci o i letti
di salmone selvaggio vanno oltre il vostro
budget, unalternativa abbordabile il sal-
mone selvaggio in scatola, mezza scato-
letta apporta 17 g di proteine.
Q Accelerate lacceleratore: la
capsaicina, lelemento piccante
nelle spezie come il pepe di Ca-
yenna, la polvere chili e il cu-
mino, ravviva il metabolismo
stimolando gli enzimi bru-
cia grassi nel corpo. Usate
una di queste spezie (o
una miscela delle tre per
ottenere il mix metabo-
lico denitivo) per con-
dire il vostro salmone
e godere dei beneci e
del gusto migliori.
Acceleratore:
Spinaci
Gli spinaci sono gli ortaggi a
foglia verde pi importanti. Una
sola tazza di spinaci apporta oltre la
met dei fabbisogni giornalieri di vitamine
B e C, calcio, potassio, magnesio ecc. Le vi-
tamine B e il calcio sono regolatori metabo-
lici noti, il potassio migliora il metabolismo
mantenendo le cellule idratate e il magnesio
accelera lossidazione dei grassi. Gli spinaci
baby sono ottimi per le insalate e i panini e si
conservano pi a lungo della lattuga.
QAccelerate lacceleratore: le uova,
considerate essere un alimento quasi
perfetto, contengono quasi tutti i nu-
trienti conosciuti alluomo e sono ric-
che di proteine di alta qualit. Unite
le uova e gli spinaci in una frittata per
creare un pasto metabolico miracolo-
so che va bene per colazione, pranzo
e cena. Se volete mantenere elastiche
le arterie (cosa fondamentale per gli
allenamenti intensi), scegliete uova
arricchite con DHA (alcune uova ar-
ricchite con DHA contengono tanto
DHA quanto il salmone).
Acceleratore:
pomodoro
Ricchi dellanticancro licopene
(un antiossidante potente), i po-
modori sono ricchi anche di cro-
mo, un minerale che aumenta la
velocit a cui il corpo brucia le
cellule grasse. I pomodori sono
ricchi anche degli acidi citrico,
malico e ossalico, che accelerano
il metabolismo e aiutano i reni a
funzionare pi efcacemente per
I broccoli
possono
aumentare
anche del 30%,
la capacit del
corpo di bruciare
il grasso.
S
T
E
V
E

C
O
O
K

D
I

M
I
C
H
A
E
L

B
U
T
L
E
R
128 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
A
S
S
O
C
I
A
T
E
D

P
R
E
S
S
,

L
A
U
R
A
G
R
A
C
E
P
H
O
T
O
G
R
A
P
H
Y
.
C
O
M
CURIOSIT: SARAH BURKE STATA LA PRIMA DONNA A ESEGUIRE CON SUCCESSO IN GARA UN AVVITAMENTO DI 1.080.
ALIMENTATE LA BESTIA
Una mela con burro di arachidi. Il burro
di arachidi ricco di grassi salubri e la mela
apporta tanta energia. Quando non sono in viaggio
(cio di rado), preferisco il burro di arachidi natura-
le. Quando sono in viaggio (vi ho detto che viaggio
tantissimo?), di solito porto con me pacchetti di
burro darachidi formato viaggio e aferro una
mela al volo.
Una fetta di formaggio e una mancia-
ta di mandorle. Ricche di tantissimi fito-
nutrienti diversi, le mandorle contengono anche
grassi salubri, calcio e magnesio, che contribuisco-
no alla salute delle ossa, oltre che vitamina E. uno
spuntino facile da preparare e carico di energia.
Frullato altamente energetico. Non mi
piace mangiare troppo prima dellallenamen-
to mattutino. Per ho bisogno di qualcosa
che mi sostenga nel corso della sessione, cos
di solito preparo un frullato ricco di proteine.
suficiente per mettermi in moto la
mattina ed anche buonissimo. La
ricetta seguente suficiente per due
porzioni. Cos pu berne uno anche il
mio uomo (lo sciatore professionista
Rory Bushfield) quando si sveglia.
1 tazza di cubetti di ghiaccio
200-250 ml di latte scremato
1 banana congelata
1 cucchiaio grande di polvere
proteica alla vaniglia
1/3 di tazza di farina davena
1 cucchiaio di burro di mandorle
naturale
Mischiate tutti gli ingredienti usando
un frullatore fino a uniformare, beve-
te e poi andate ad allenarvi.
Gli spuntini energetici di Sarah
arah Burke pu sembrare una bellezza da spiaggia di Malibu ma in questo caso
lapparenza inganna. Se pensate di essere dei bravi sciatori, di quelli che non hanno
problemi a fare salti ed eccellono nellhalf-pipe (quando non siete in palestra ad allenarvi),
allora avete trovato pane per i vostri denti con la sciatrice 29enne Sarah Burke.
Leggete e ridimensionatevi. Attualmente Sarah doppia campionessa X Games
di half-pipe (con sei medaglie, ha vinto pi ori nellhalf-pipe di chiunque altro,
uomo o donna), stata nominata per un Oscar ESPY (gli oscar sportivi creati dal
network televisivo ESPN) molte volte ed diventata il primo sciatore a vincere un
ESPY (nel 2010 stata anche nominata Female Action Athlete of the Year). Prima
di diventare latleta migliore al mondo nellhalf-pipe, Sarah era la donna agonista
di sci freestyle migliore al mondo, disciplina in cui ha gareggiato regolarmente
contro gli uomini, vincendo anche. Come dice Sarah: Volevo semplicemente ave-
re le stesse opportunit degli uomini, cos li ho sfidati ogniqualvolta possibile.
Anche se avremmo potuto continuare a elencare la lunga lista dei suoi successi, ab-
biamo deciso invece di chiedere a Sarah di ofrire ai nostri lettori i suoi suggerimenti
per degli spuntini energetici. Abbiamo pensato che una persona cos competitiva e
che si allena cos duramente avesse qualcosa da condividere con i lettori pi hardco-
re di Reps!. Sarah ha accettato e ci ha oferto quanto segue. Jerry Kindela
sbarazzarsi dei depositi dei grassi. uno
degli alimenti che meglio mangiare cru-
do per godere al massimo dei suoi beneci
alimentari.
Q Accelerate lacceleratore: il basi-
lico fresco una pianta antiossidante
(il gusto iniziale ricorda vagamente
il pepe, poi diventa pi dolce con la
masticazione) che accelera il meta-
bolismo. Combinate il basilico fresco
spezzettato con i pomodori e la cipol-
la a dadini e laceto per creare unin-
salata rapida ricca di vitamine, mine-
rali, grassi salubri e bre.
Acceleratore: t oolong
Il t oolong ottenuto dalla pianta Camelia
sinensis, le stesse foglie da cui ottenuto il
t verde. Questo tipo di t contiene grandi
quantit di polifenoli, antiossidanti che ac-
celerano il metabolismo, aiutando a brucia-
re i grassi e a bloccare gli enzimi lipogeni.
La ricerca condotta da William Rumpler,
siologo del Beltsville Human Nutrition Re-
search Center, ha mostrato che bere t oo-
long aumenta le calorie totali bruciate in 24
ore. In un altro studio, gli scienziati dellu-
niversit di Tokushima (Giappone) hanno
scoperto che gli uomini che hanno assunto
t oolong hanno sperimentato un aumento
del 12% dellossidazione dei grassi e un in-
cremento del 10% del dispendio energetico.
Q Accelerate lacceleratore: non
vi piace bere il t da solo? Provate un
frullato proteico con t, mischiando
t oolong (freddo), polvere proteica,
yogurt magro e miele. Oppure, per
un frullato pi esotico, mischiate il t
freddo con avocado, ginseng e polve-
re proteica. Prendete in considerazio-
ne anche il t verde, che ha dimostra-
to di dilatare i vasi ematici 30 minuti
dopo averlo assunto. La ricerca ha
mostrato che il t verde pu essere il
liquido ideale da usare in un frullato
proteico dopo un allenamento: apre i
vasi ematici per un migliore trasporto
delle proteine.
Gli uomini che
hanno assunto
t oolong hanno
sperimentato un
aumento del 12%
dellossidazione
dei grassi.
1
2
3
S
Calorie: 239; Proteine: 20 g; Carboidrati:
29 g; Grassi totali: 6 g; Grassi saturi: 1 g;
Grassi monoinsaturi: 1 g; Grassi polin-
saturi: 0.4 g; Fibre: 4 g; Zuccheri: 12 g;
Sodio: 72 mg; Colesterolo: 8 mg.
I salti Burke sono
tutta unaltra cosa.
R
WORKBENCH
POWER RACK
+UTILITY BENCH
+135 KG DI PESI
1.829,12
1.097,47
40%
SCONTO
OBSG04
WB-PR11
WB-UB11

POWERTEC
F
i
t
n
e
s
s
Importatore esclusivo per litalia: OLYMPIANS Srl tel. 055/958058-959266 fax 055/958255 www.olympianstore.it e-mail: info@olympianstore.it
WB-LS11
1.802,90
1.262,03
30%
SCONTO
WORKBENCH
LEVERAGE GYM
+117,5 KG DI PESI
OBSG04
COD: WB-PR11
POWER RACK
Garantisce sollevamenti pesanti per chi
vuole risultati! Costruito per durare questo
power rack di per se una palestra. Il
power rack di base costruito con tubi di
65 mm e solidi appoggi e sbarre regolabili
in altezza. I tanti fori per la regolazione
dellaltezza sono numerati per cambi di
altezza rapidi e semplici. Contrariamente ad
altri rack sul mercato questo Power Rack
ha anche delle sbarre heavy duty regolabili
per lesecuzione delle flessioni alle parallele
e due maniglie per la trazione alla sbarra.
Lun: 129 Lar: 126
h: 213 Peso: 95 kg
COD: WB-UB11
UTILITY BENCH
Regolabile in posizione inclinata,
declinata e piana. Aggancio
per posizionare la panca
al centro del rack e
alloggio per accessori
optional
Lun: 142 Lar: 68
h: 46 Peso: 32 kg
COD: WB-LS11
WORKBENCH
LEVERAGE GYM
La serie Workbench include numerose caratteristiche
brevettate uniche, introvabili in altre macchine. Una
postazione completa di lavoro, permette oltre 20 dei
principali esercizi, per un allenamento che scolpisca
il vostro corpo. Preparatevi a lavorare duro con
Workbench!
Lun: 256 Lar: 141
h: 208 Peso: 132 kg
COD: OBSG04
SET PESI MODELLO OLYMPIC GRIP
Set di pesi 50mm, modello con tre prese grip, color grigio
martellato, rifiniti a macchina. Rivestiti con anello gommato,
diametro delle piastre da kg 20,15,10 = 35 cm.
Nelle seguenti pezzature:
2 pz.da 20 kg anello gommato col. blu, 2 pz.da 15 kg anello
gommato col. rosso, 2 pz da 10 kg anello gommato giallo, 2 pz
da 5 kg anello gommato arancione, 2 da 2,5 kg anello gommato
verde, 2 pz.da 1,25 kg anello gommato nero.
COD: OBSG04
SET OLYMPIC
GRIP 127,5 KG
Il set composto da:
1 bilanciere OB24 220 cm, portata 450
kg, cromato
coppia di molle fermapesi
107,5 kg di pesi in pezzature:
2 pz. da 20 kg col. blu,
2 pz. da 15 kg col. rosso,
2 pz. da 10 kg col. giallo,
2 pz. da 5 kg col. rosso,
2 pz. da 2,5 kg col. verde,
2 pz. da 1,250 kg col. nero
WB-PR11
+ WB-UB11
+ OBSG04
WB-LS11
+ OBSG04
GUARDA
IL CATALOGO
DIGITALE
POWERTEC
FITNESS!
130 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
Stress
menagement
e sovrappeso
Lo stress protratto senzaltro il fattore
pi importante nello sbilanciamento che si crea negli anni a livello
metabolico ed ormonale e che favorisce il processo di invecchia-
mento e di modicazioni della composizione corporea (cio meno
muscoli pi grasso) che, quasi sempre, si accompagnano col pas-
sare degli anni. stato stimato, con approssimazione per difetto,
che circa il 50-70% delle malattie sono collegate allo stress.
I ricercatori ritengono che lo stress rivesta un ruolo principale nel manife-
starsi della malattia. Le normali cause di malattie, come i microrganismi, i veleni,
i disordini metabolici, etc sono necessari ma non sufcienti. Per esempio, per
contrarre un raffreddore il virus che causa il raffreddore deve essere presente
nellambiente ed essere inalato nel tratto respiratorio ma non tutte le persone che
lo inalano sviluppano il raffreddore. La possibilit che il virus possa attecchire e
mettere radici nei tessuti dipende dallo stato del terreno cio del sistema immu-
nitario che strettamente collegato allo stress. Numerose ricerche e studi hanno
supportato lidea che uno stress eccessivo possa portare ad un malfunzionamento
del sistema immunitario rendendo le persone pi sensibili a sviluppare malattie a
causa di fattori ambientali ai quali si normalmente esposti e che, in situazioni di
buona funzionalit del sistema immunitario, non sfociano in malattie.
Il termine stress si riferisce alla risposta del corpo al fattore stressante che
lo stressor. Lo stressor levento che provoca lo stress che una reazione dellor-
ganismo a qualcosa che altera il suo equilibrio. Ogni cosa che stimola un cam-
biamento o un adattamento pu essere uno stressor. Lo stressor pu essere un
fattore esterno reale o semplicemente percepito tale, o interno, come eccessivo
perfezionismo, senso di colpa, aspettative irrealistiche, paure, gelosie, desideri
inappagabili etc Fondamentale , appunto, la percezione che si ha dello stress
non tanto lo stress in s, infatti lo stesso fattore stressante pu generare diversi
livelli di stress a seconda delle persone che lo vivono.
La risposta allo stress mediata dal sistema nervoso ed endocrino. Le ghian-
dole surrenali rilasciano gli ormoni noradrenalina e cortisolo. C anche unat-
tivazione del sistema nervoso che, insieme agli effetti degli ormoni dello stress,
predispone lorganismo alla reazione. Inizialmente la risposta allo stress era
stata chiamata combatti o fuggi perch, appunto, una risposta nalizzata a
predisporre lorganismo ad attingere alle proprie risorse per affrontare o scap-
pare via da uno stressor che rappresenta una minaccia per la vita. In teoria, una
volta che lo stressor stato scontto o dominato, si attraversa una fase di pro-
ANTI-AGING
DEL DOTT. MASSIMO SPATTINI E
CLAUDIO LOMBARDO
Copyrighted 2012 by Sandro Ciccarelli Editore
MEDICINA ANTI-AGING
E RIGENERATIVA
Numerose ricerche e
studi hanno supportato
lidea che uno stress
eccessivo possa portare ad
un malfunzionamento del
sistema immunitario
rendendo le persone pi
sensibili a sviluppare
malattie a causa di fattori
ambientali ai quali si
normalmente esposti e
che, in situazioni di buona
funzionalit del sistema
immunitario, non sfociano
in malattie.
WWW. OLYMPI AN. I T
Olympians News / SUPER FITNESS 131
CURIOSIT: IL CORTISOLO IL PRINCIPALE ORMONE DELLO STRESS ATTIVATO IN SITUAZIONI DI EMERGENZA.
CORTISOLO
fondo rilassamento e, per questo, la giusta
alternanza tra determinati stress stimolanti
e i successivi periodi di rilassamento, ha un
effetto positivo sullorganismo. Un po come
una macchina in rodaggio che ogni tanto va
portata al massimo dei giri ma poi bisogna
tornare a regimi bassi per fare in modo che
essa duri nel tempo con ottime prestazioni.
Se invece si tirassero sempre tutte le marce,
in breve tempo, si vericherebbero problemi
cos come se, viceversa, si andasse costan-
temente piano poich poi, alloccorrenza, la
macchina non sarebbe in grado di effettuare
prestazioni ottimali. pur vero per che nel-
la societ moderna gli stressor sono cos tanti
(ed alcuni anche al di sotto del nostro livello
di consapevolezza) che non ci si rende con-
to della loro presenza la quale, comunque,
porta ad un sovraccarico di stress nel tempo.
Praticamente ci si ritroverebbe nella condi-
zione di non essere mai in grado di bloccare
le risposte allo stress ed entrare nella fase di
rilassamento.
Gli effetti psicologici e sici provocati
dallo stress sono concepiti per la reazione
combatti o fuggi. Questi cambiamenti in-
cludono un innalzamento del battito cardia-
co, unaccelerazione del ritmo respiratorio,
una contrazione dellapparato gastrointesti-
nale ed urinario, aumento della glicemia, un
aumentato afusso di sangue verso i muscoli
e un aumento della pressione sanguigna. Se
questi effetti, che sono beneci a breve ter-
mine, diventano invece cronici (come nel
caso di stress cronico) cessano di essere utili
e si trasformano invece in dannosi per lor-
ganismo. Per esempio, momentanei innalza-
menti della pressione sfociano nelliperten-
sione, ripetuti innalzamenti della glicemia
portano al diabete, alterazioni del ritmo car-
diaco portano a cardiopatie e cos via; tutte
queste malattie sono le prime cause di morte
nella nostra societ. Ma anche lobesit le-
gata allo stress.
Al giorno doggi, il livello
di stress delle societ
occidentali, ha raggiunto
livelli dallarme.
La moderna tecnologia, anzich ren-
dere la vita pi semplice lha resa pi fre-
netica, immergendoci in un net-work con-
tinuo di stimolazioni; telefoni cellulari,
internet, televisioni in ogni camera, auto-
mobili parlanti non ci lasciano in pace.
Svariati studi clinici hanno dimostrato
che abbassando i livelli di stress e riportan-
do i livelli di cortisolo (il principale ormone
dello stress) a valori normali, si pu ridurre
il peso corporeo, la pressione sanguigna,
migliorare la sensibilit allinsulina, riequi-
librare la glicemia e controllare lappetito.
La buona notizia che numerosi studi
hanno dimostrato che lo yoga, i massaggi,
lesercizio fisico, la corretta alimentazione
e luso di determinati integratori, possono
funzionare da anti-stress e diminuire i
livelli di cortisolo. Il cortisolo appunto il
principale ormone dello stress che viene
attivato in situazioni di emergenza; quan-
do questo stress diventa cronico, i livelli
di cortisolo nel sangue sono sistematica-
mente alti. Il cortisolo manda dei segnali
al cervello per aumentare lappetito e
soprattutto verso i carboidrati ed i grassi,
cio verso i cibi particolarmente ricchi di
calorie, proprio per fornire allorganismo
le maggiori energie possibili per contra-
stare la situazione di stress.
Nelluomo primitivo, la situazione di
stress era per lo pi legata a situazioni di
carattere fisico: aggressioni, eventi clima-
tici sfavorevoli, intensa attivit di caccia
ecc
Al giorno doggi lo stress prevalente-
mente di carattere psichico: il lavoro, la
famiglia, il coniuge, i problemi economici,
la mancanza di tempo, ecc
Di conseguenza la risposta allo stress
con una super alimentazione, in realt
non funzionale alla causa scatenante.
Inoltre il cortisolo, per gli stessi motivi,
tende a ridurre la mobilizzazione dei gras-
si di deposito per conservarli per situazio-
ni di emergenza e questo lo fa, oltre che
tramite un segnale diretto alle cellule adi-
pose, anche bloccando lazione dei pi
importanti ormoni del nostro corpo: peg-
giorando lefficienza dellinsulina si hanno
pi facilmente sbalzi glicemici e crisi di
fame per i carboidrati, diminuendo la
serotonina pi facilmente ci sentiremo
depressi, diminuendo lormone della cre-
scita calano i muscoli ed aumenter il
grasso e riducendo gli ormoni sessuali
(testosterone ed estrogeni) diminuir la
libidine e la performance sessuale.
La moderna tecnologia,
anzich rendere la vita
pi semplice lha resa
pi frenetica, immergendoci
in un net-work continuo
di stimolazioni;
telefoni cellulari,
internet, televisioni
in ogni camera,
automobili parlanti
non ci lasciano
in pace.
... numerosi studi hanno dimostrato che lo yoga, i massaggi, lesercizio
fisico, la corretta alimentazione e luso di determinati integratori,
possono funzionare da anti-stress e diminuire i livelli di cortisolo.
F
o
t
o
:


j
u
l
i
e
n

t
r
o
m
e
u
r

-

F
o
t
o
l
i
a
.
c
o
m
132 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
BADATE BENE: DIETE TROPPO RESTRITTIVE SCATENANO STRESS PORTANDO A PERDERE MUSCOLO E NON GRASSO.
ANTI-AGING
Quindi alla fine ci ritroveremo affa-
mati, depressi, deboli, grassi e quasi impo-
tenti. Non una bella prospettiva! Ma
badate bene, anche una dieta eccessiva-
mente restrittiva fonte di stress e scate-
nando questi meccanismi, non porter ad
una corretta perdita di peso, ma se mai a
perdere piuttosto i muscoli invece del
grasso.
poi classica la situazione di diete
troppo restrittive che innalzando in
maniera notevole il cortisolo, causano un
impellente desiderio di sovralimentarsi,
che porta allabbandono della dieta e ad
uno smodato consumo di cibo.
Anche lallenamento eccessivo fonte
di stress, ed una ricerca effettuata presso
lUniversit del Colorado, ha dimostrato
che gli atleti in condizioni di super-allena-
mento presentavano difese immunitarie
pi basse, disturbi dellumore e maggiori
livelli di grasso corporeo.
Al
giorno doggi sono tantissimi gli stimoli
esterni che il nostro cervello deve pro-
cessare rispetto al passato e spesso ci si trova a
dover consumare il proprio pasto di fretta (i fast-
food ne sono un esempio, ma non solo..), man-
giando quello che capita o, peggio ancora, ci tro-
viamo durante il pasto a rimuginare pensieri
depotenzianti (impegni, imprevisti, problemati-
che lavorative e via dicendo), che alterano i pro-
cessi del sistema enterico (il nostro secondo cer-
vello) e quindi la corretta funzione dellapparato
digerente.
Uno dei caposaldi della psico-cibernetica
afferma che la mente umana non pu distin-
guere un evento reale da uno vividamente
immaginato perch in entrambi i casi si attiva-
no le stesse reti neurali.
Facendo fede a questo principio possiamo
dire che se consumiamo un cibo distraendoci
(guardando la televisione o seduti davanti al pc)
dalla nostra azione alimentare, per la nostra
mente non stiamo consumando quel cibo.
VERSO UNA
NUTRIZIONE
CONSAPEVOLE
M
a
s
s
i
m
o

o

S
p
a
t
S
p
a
t
i
n
ii

F
o
t
o
r
p
e
r
g
e
n
g
e
n
g
t
i
l
e
t
i
l
e
c
o
n
c
o
n
c
e
s
s
i
o
n
e
d
e
l
e
u
l

a
u
t
o
r
e
t
o
r
e

F
o
t
o
:


M
i
c
h
a
e
l

N
e
v
e
u
x
Anche lallenamento
eccessivo
fonte di stress

F
o
t
o
:


M
i
c
h
a
e
l

N
e
v
e
u
x
CURIOSIT: LO STIMOLO DELLA SAZIET RAGGIUNGE IL CERVELLO IN CIRCA 20 MINUTI DALLINIZIO DEL PASTO
SAZIET
Questultimo viene consumato in
modo pi veloce e la quantit di cibo inge-
rito risulta maggiore in quel lasso di
tempo necessario affinch lo stimolo della
saziet raggiunga i centri cerebrali (circa
20 minuti). La quantit calorica ingerita
alla fine del pasto risulter maggiore di
quella ingerita se attuassimo una pratica
alimentare consapevole.
Inoltre la distrazione determina una
parziale insensibilit al gusto dellali-
mento consumato, che interferisce con le
sostanze ormonali gratificanti (endorfine)
prodotte durante e dopo la consumazione.
Il nostro organismo, per ovviare a
questa parziale soddisfazione, ci richiede
di consumare altro cibo.
Se consumiamo
un cibo distraedoci,
per la nostra
mente non stiamo
consumando
quel cibo.
PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT
PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT | PUBBLICIT
La gratificazione quella piacevole
sensazione data:
Q dallappagamento dellaver
soddisfatto un nostro bisogno
primario (fame);
Q dagli stimoli sensoriali (vede-
re e gustare un alimento);
Q dai pensieri (quello che visua-
lizziamo, che ci diciamo e
sensazioni che proviamo) che
generiamo durante la consu-
mazione degli alimenti.
Questi ultimi punti influenzano in
modo determinante il senso di
saziet (ipotalamo), oltre ad incide-
re in maniera determinante sulla
motivazione circa il perseguimento
del regime alimentare adottato (se il
regime alimentare basato su
rinunce e sacrifici, e quindi su poca
gratificazione, sar difficile che
diventi unabitudine alimentare a
lungo termine).
F
o
t
o
F
o
t
o
:

p
z
A
x
p
z
A
x
p
z
A
x
p
z
A
x
e
-
e
-
e

-

e
-
F
o
t
o
F
o
t
o
F
o
t
o
F
o
t
o
l
i
a
.
l
i
a
.
l
i
a
l
c
o
m
c
o
m
134 Olympians News / SUPER FITNESS
WWW. OLYMPI AN. I T
IL METODO
Il seguente metodo sul consumo dei
cibi affonda le sue radici nella PNL.
Si tratta, in sintesi, di accorgimenti
comportamentali di semplice adozi-
one da dover inizialmente consape-
volizzare in modo da farli diventare
successivamente delle abitudini au-
tomatiche, inconsce.
I punti da seguire sono i seguenti:
1) Mangia appena senti
fame Luomo primitivo mangiava per
nutrirsi e per gusto e non, come spesso
accade oggi, per soddisfare bisogni emoti-
vi. Per seguire questa linea guida neces-
sario mettere in atto un ascolto attivo
del proprio organismo, discernendo i biso-
gni primari (fame, sete, ecc.) da quelli
emotivi (ansia, insoddisfazione, ecc.).
2) Mangia ci che vuoi
spesso in dosi moderate.
Luomo primitivo mangiava spesso perch
si nutriva di ci che trovava durante lap-
provvigionamento del cibo, vista limpos-
sibilit di conservarlo per tempi molto lun-
ghi come accade oggi. Non si ha quindi la
necessit di fare magazzino, possiamo
permetterci di velocizzare e alimentare
spesso il nostro metabolismo facendogli
sapere che, in caso di necessit, c dispo-
nibilit di cibo.
3) Fate avanzare sempre
qualcosa nel piatto. Per con-
trastare la credenza potenziante pi diffusa
(buttare il cibo uno spreco o peggio anco-
ra un peccato!) e per esorcizzare la perso-
na dal senso di colpa derivante, che contra-
sta la piena consapevolezza dello stimolo
della saziet, estranea alluomo ancestrale.
4) Posa la forchetta dopo
ogni boccone. Lo stimolo della
saziet, che parte dai centri cerebrali non
tanto strettamente correlato alla quanti-
t di cibo che ingeriamo bens diretta-
mente proporzionale alla lentezza con
cui si consumano i cibi e, quindi, al loro
tempo di assunzione. Luomo primitivo
non aveva fretta di consumare il pasto, a
differenza di quanto portato a fare luo-
mo moderno per radicati cambiamenti del
proprio stile di vita. Inoltre alcune tipolo-
gie di ristorazioni (come i fast food) inten-
sificano ulteriormente questa problemati-
ca. Gustare lentamente il cibo importan-
te perch lo stomaco invia il segnale di
saziet al cervello con un ritardo di circa
20 minuti dallinizio della consumazione
del pasto. Inoltre stato dimostrato che se
il cibo viene triturato bene migliora lazio-
ne enzimatica nello stomaco.
5) Ascolta il tuo corpo
ogni giorno di pi. Luomo pri-
mitivo possedeva unassoluta consapevo-
lezza dello stimolo della fame ma anche di
quello della saziet. Lalterazione di questi
ultimi stata causata da una progressione
del sovraccarico sensoriale durante il con-
sumo degli alimenti nonch da un ritmo di
vita pi frenetico rispetto al passato. Il
nostro corpo ci dice di cosa ha bisogno e,
soprattutto, lappetito specifico per
determinati macronutrienti (carboidrati,
proteine, grassi).
6) Apprezza ogni bocco-
ne al 100% Questo espediente
viene utilizzato al fine di produrre una sen-
sazione benefica a livello emotivo. Il piace-
re associato a questa sensazione permette
un equilibrio dellassetto neuro-trasmettito-
riale del cervello che, tramite uno stimolo
del sistema endorfinergico, genera la pro-
duzione di sostanze gratificanti. Queste
sostanze hanno capacit analgesiche, cal-
manti e appaganti, aumentando il senso di
controllo della persona durante il persegui-
mento della dieta, tramite la stabilizzazione
e lanticipazione dello stimolo di saziet.
7) Se hai il dubbio di esse-
re sazio, fermati! Per prendere
consapevolezza del senso di saziet e non
eccedere nella quantit di cibo ingerita, o
meglio, introdurre quella corretta, risulta
indispensabile decidere di fermarsi tra i
punti 5 e 6 della seguente scala:
1 > Molta fame
2
3
4 >> Famelico
5
6
7 >>> Sazio
8
9
10 >>>> Molto sazio
Bibliografia
Stress and Aging, Errol R. Korm M.D., Rod Comumale M.D.
Anxiety, in D. Meichenbaum, M.E. Jaremko (eds.), Stress
Reduction and Prevention, Plenum, New York, Maxwell Malz,
Psicocibernetica, Astrolabio, 1965, Roma.
Selye, Hans, The Stress of life; McGraw-Hill (Paperback)
Paul Mckenna, Posso farti dimagrire, 2010, Tea edizioni
Debora Conti, EFT & PNL insieme per dimagrire, Editore My Life
MASTICATE, MASTICATE, MASTICATE!!!
ANTI-AGING
Dott. Massimo Spattini
Medico Chirurgo
Specialista in Scienza dellAlimentazione
Specialista in Medicina dello Sport
Board Certified in Anti-Aging & Regenerative Medicine
(ABAARM-USA)
Presidente dellAccademia del Fitness
Dott. Claudio Lombardo
Laurea di primo livello in
Scienze organizzative e gestionali
Sport Coach (specializzato in PNL)
Diet Coach - Coaching Consultant.
www.claudiolombardo-pnlesport.com
F
o
t
o
:


L
a
n
a
K

-

F
o
t
o
l
i
a
.
c
o
m
F
o
t
o
:


E
r
i
c

I
s
s
e
l

e

-

F
o
t
o
l
i
a
.
c
o
m
F
o
t
o
:


l
a
u
r
e
n
t

h
a
m
e
l
s

-

F
o
t
o
l
i
a
.
c
o
m
Presidente
Dott. MASSIMO SPATTINI
info@massimospattini.it
www.massimospattini.it
DATE
25-26 febbraio / 10-11 marzo


DURATA: 4 giornate
SEDE: PARMA
DOCENTI: Davide Antoniella - Giovanni Montagna
Massimo Spattini

PROGRAMMA:
Fisiopatologia della Sindrome Metabolica
Eziopatogenesi della sindrome metabolica
La dieta per la Sindrome Metabolica
Lintegrazione per la Sindrome Metabolica
Disturbi del sonno e gestione dello stress
Test di valutazione
Metodologie di allenamento per il Fitness Metabolico



QUOTA: 500,00
(comprensiva della quota associativa)
L'importo pu essere pagato, con una maggiora-
zione, in due rate :
- 1
a
rata entro il 10-02-2012 : 270,00
- 2
a
rata entro il 28-02-2012 : 270,00


REQUISITI : Per partecipare al Corso di
Fitness Metabolico necessario essere
d i p l o ma t i P e r s o n a l T r a i n e r
o Fisioterapisti o Laureati in Scienze Mo-
torie o ISEF. Per ottenere il diploma di
Istruttore di Fitness Metabolico occorre
essere in possesso della Certificazione
BLSD (il corso BLSD sar in programma
anche presso l'Accademia del Fitness nei
primi mesi del 2012)


ACCADEMIA DEL FITNESS
Galleria Crocetta 10/A - 43126 PARMA
Tel. 0521-1682083 / 0521-941319
Fax +39 0521.294971
info@accademiadelfitness.com
Ultimamente ai convegni di Medicina dello Sport non si parla altro che di Sin-
drome Metabolica che fondamentalmente consiste in un sovrappeso soprattutto
a livello addominale, ipertensione, dislipidemia borderline e ridotta tolleran-
za ai carboidrati. Questa patologia pu essere curata soprattutto con una
correzione dello stile di vita, cio alimentazione corretta, adeguato esercizio
fisico, adeguato sonno fisiologico e gestione dello stress. Il fitness metabolico
riguarda lattivit fisica idonea per tutte quelle persone generalmente adulte,
non perfettamente sane, affette da tutte quelle patologie tipiche della societ
occidentale caratterizzate da malnutrizione e sedentarismo, comprendendo
nuove categorie sociali, rispetto al fitness tradizionale, con un potenziale di
circa 35 milioni di persone rispetto al potenziale di circa 20 milioni del fitness
tradizionale. Lesercizio fisico a questo punto pu essere considerato una vera
e propria terapia, sia preventiva che curativa e come tale deve essere pre-
scritta con specificit di tipologia e di dose proprio come un farmaco, cio ad
una determinata frequenza ed intensit. Al medico specialista in Medicina
dello Sport spetta questa competenza ma deve esistere una figura professio-
nale operatore nel settore del fitness in grado di tradurre nella pratica le
indicazioni del medico. Questa nuova figura professionale si identifica nell
ISTRUTTORE DI FITNESS METABOLICO
P
H
O
T
O

C
R
E
D
I
T
WWW. OLYMPI AN. I T
136 Olympians News / SUPER FITNESS
I
M
M
A
G
I
N
I

G
E
N
T
I
L
M
E
N
T
E

C
O
N
C
E
S
S
E

D
A

T
O
U
G
H
M
U
D
D
E
R
.
C
O
M
Va bene,
tipo
tosto!
DI MICHAL KAPRAL
Affrontiamo
gli ostacoli
del Tough Mudder
Will Dean pensava di
aver avuto unidea brillante. Come
parte del suo dottorato alla Har-
vard Business School, il 29enne ex
ufciale del controterrorismo bri-
tannico ha prodotto il piano di inve-
stimento di una serie di eventi con
prove a ostacoli ispirate ai campi di
addestramento della britannica SAS
(Special Air Service). Dean intrave-
deva un mercato per qualcosa di pi
divertente della solita maratona o
prova di triathlon e lha sottoposto
entusiasticamente ai suoi professori.
Quasi tutti i professori della Harvard mi
dissero che era unidea pessima, dice alle-
gro Dean in unintervista telefonica dal suo
ufcio a New York. Io per sono un inglese
testardo, cos sono andato avanti lo stesso.
In breve Dean ha sbugiardato i suoi profes-
sori dalto rango. Con laiuto di soli 8.300
$ in pubblicit Facebook, il primo Tough
Mudder allimpianto vicino ad Allentown
del 2 maggio 2010, ha esaurito i 4.500 po-
sti disponibili in cinque settimane. Lanno
scorso, 150.000 persone hanno versato la
quota di partecipazione di circa 100 $ per
partecipare a 14 Tough Mudders negli Stati
Uniti. Nel 2012, Dean si aspetta che la cifra
arrivi a mezzo milione di partecipanti nei 31
eventi programmati in Stati Uniti, Canada,
Regno Unito, Giappone e Australia.
Chi vuole prendere parte a un Tough
Mudder, deve essere un atleta davvero for-
te, muscoloso e impavido. I partecipanti al
Tough Mudder affrontano no a 20 ostacoli
di tipo militare lungo un percorso di 11-19
km, spesso pieno di fango. Fra gli ostacoli
classici del Mudder ci sono larrampicata
della corda sopra a barriere alte, il passag-
gio aereo sopra a uno stagno dacqua gelata,
il trascinamento nel fango, il passaggio in
tunnel pieni dacqua e la terapia elettro-
shock (ancora non c il waterboarding).
Le prove non sono cronometrate e prima di
cominciare i partecipanti devono dichiarare
di capire che si tratta di una sda e non di
una gara.
Il fascino, dice Dean, il senso di came-
ratismo. Quando nisci un Tough Mudder
ricevi una birra gratis, non una banana iso-
tonica. E probabilmente sarai battuto da un
tale che indossa un Borat mankini. Nono-
stante la natura non competitiva degli even-
ti, sono comunque molto impegnativi. Ho
visto ragazzi grossi e forti tremare sul bordo
dellostacolo Walk the Plank, incapaci di
decidersi a saltare nellacqua gelida sotto-
stante, dice Dean.
Carlos Almendrez, un dirigente dazien-
da di San Francisco, ha completato il Tough
Mudder 2011 di Squaw Valley, descrivendo-
lo nel suo blog una specie di esperimento
psicologico malato. Come il tizio del lm
Saw che ti tormenta e ti d una speranza di
sopravvivenza per poi farti a pezzi.
Dean dice che c sempre qualcuno che
afferma che non difcile. A queste per-
sone puoi sparare sulla linea darrivo e ti
direbbero comunque che non poi cos
difcile.
Per quelli per cui il fango e le sfide
non sono mai abbastanza e sono
disposti a pagare 450 $ di iscrizione
pi unassicurazione di 45 $, il diret-
tore di Tough Mudder Will Dean ha
creato un evento speciale dedicato
a loro: il Worlds Toughest Mud-
der, un evento non-stop di 24 ore
programmato per met dicembre
al Raceway Park di Englishtown, nel
New Jersey.
Per qualificarsi per uno dei 1.000
posti disponibili, era necessario
piazzarsi nel migliore 5% di quelli
che hanno completato uno degli
eventi Tough Mudder fra il 1 mag-
gio e il 1 dicembre.
Il percorso di 16 kg presentava osta-
coli come il Mudder classico, per
pi grandi, dice Dean.
Il riconoscimento Worlds Tou-
ghest Mudder va alla persona che
completa pi giri nelle 24 ore.
Il Mudder
pi duro
al mondo
REPS! ESTREMO
R
Copyright 2012 by Robert Kennedy Publishing
LEONARDO
CASAGRANDE
WORLD 2011
CUCINA
BLINDATA
CONTRO
IL DOPING
SPIEGHIAMO
IL NATURAL
BODYBUILDING
I FANTASTICI 4
ALLA CONQUISTA
DI NEW YORK
TERZO
CAMPIONATO
ITALIANO
NBFI
REPORT
COMPLETO!
DEDICATA ALLO STILE
DI VITA DRUG-FREE
INTEGRATORI PER LO SPO RT
pppoosstt--wwoorkkouut
Perfetto anabolismo muscolare
e recupero rapido ed ottimale.
BBAARA RATTTOOLLO DAA 5100 gr
gus gustoo: agrumi
SSSSSSSSSSSSSSSSSSSSSSSSSSSHHHHHHHHHHHHHHHHHHHHAAAAAAAAAAAAKKKKKKEEE UUP
kk
SSSHHHAAAKKKEEE UU E
RRREEEAAAALLL FFUEEL
pppppree---wwwoorkkouut
Massimizza lenergia e
lespolsivit muscolare
BBBBARA ARATTTOOOLOOO D DA 510 ggr
guustto oo: mmmirrtillo
I
.
P
.
w
w
w
.r
e
p
o
r
t
i
t
a
l
i
a
.
it
WWW. NBFI . I T
NATURAL BODYBUILDING 139
ALLENATORI NBFI
2 LIVELLO
Il 12 giugno 2011 si tenuto l'esa-
me di certificazione 2 Livello NBFI,
presso la palestra Olympian's Gym
A.s.d., a Figline Valdarno (Fi). I diplo-
mati, che ricordiamo possono svolgere
autonomamente l'attivit di istruttori,
sono stati: Elia Mazzucchi, Kristian
Montevecchi, Annalisa Ghirotti,
Christian Savatteri, Franco Monti. A
tutti i migliori auguri per un proficuo
sviluppo della loro attivit.
Insieme ai candidati di 2 livello
hanno sostenuto la prova d'esame anche
2 allievi del 1 livello, che avendo perso
alcune ore di corso hanno dovuto posti-
cipare la data del loro esame, e avendolo
superato, hanno ottenuto il diploma di
aiuto allenatore: Giovanni Signorini e
Giacomo Longaretti. A quest'ultimo
stata posta la "limitazione d'uso" del
diploma, finalizzato allo spinning e
all'allenamento aerobico, cardine della
sua attivit.
4 CAMPIONATO ITALIANO
DI NATURAL BODYBUILDING
MASCHILE NBFI,
3 CAMPIONATO MS. BODY
FIT FEMMINILE 2012
Dopo l'eccezionale riuscita avuta col 3
campionato, con la massiccia affluenza di
atleti e con i grandiosi risultati dei nostri
atleti al Campionato WNBF di New
York, Casagrande Campione del Mondo
Categoria leggeri e Nardino 3, di cui
trovate il resoconto nelle prossime pagine,
iniziamo gi a promuovere il 4
Campionato Italiano. La gara si terr
sabato 13 Ottobre 2012, sempre a
Figline Valdarno (FI), vi aspettiamo
numerosi!
Ancora una volta, un invito particola-
re alle atlete che vorrebbero gareggiare:
forza ragazze, dimostrate la vostra prepa-
razione e la vostra grinta!
Come nella precedente edizione, sar
effettuato il test anti-doping con
Poligrafo (macchina della verit) e test
delle urine a tutti. Per ulteriori informa-
zioni visitate il sito NBFI.IT oppure
scrivete a info@nbfi.it.
CORSI DI
SPECIALIZZAZIONE
NBFI & FIKDA 2012
KETTLEBELL TRAINING
La F.I.K.D.A. Federazione Italiana
Kettlebell e Discipline Affini, ha rin-
novato la sua collaborazione con la
NBFI per la
preparazione
degli allena-
tori specia-
lizzati in
insegnamen-
to di kettle-
bell training,
cos da otte-
nere un tito-
lo valido per
poter instau-
rare un rap-
porto di
lavoro, in
quanto que-
sta certifica-
zione conforme ai principi generali
dattati dal CONI, con il nuovo
Sistema Nazionale di Qualifiche dei
Tecnici Sportivi (SNaQ).
Ulteriori informazioni e dettagli sul
sito NBFI.IT
IL VIDEO DELLA GARA
DISPONIBILE
GRATUITAMENTE
SU INTERNET
Potete visionare gratuita-
mente la terza edizione
del Campionato Italiano
NBFI collegandovi sul
sito www.tv1.it,
in basso a destra
troverete l'icona
blu. Cliccateci
sopra e godetevi
lo spettacolo!

NBFI
NEWS
di Isabella Desci, Segretaria nazionale NBFI WWW.NBFI.IT
CONVENZIONATA
Ente nazionale di
promozione sportiva
(riconosciuto dal
Coni ai sensi del D.
LGS. n.242/1999)
CONVENZIONATA
Ente di Promozione Sportiva
(riconosciuto dal CONI ai sensi
del D. Lgs. 242/1999)
Rilasciato a
Sandro Ciccarelli
Presidente
NBFI
Dott. Antonino Viti
Presidente Nazionale
ACSI
Allenatore/Personal Trainer
di Bodybuilding e Fitness
1 livello
Titolo conforme ai principi generali dettati dal CONI,
con il nuovo Sistema Nazionale di Quali che dei Tecnici Sportivi (SNaQ).
Diplom
a
Luogo di nascita
www.nb .it
www.acsi.it
AFFILIATA AFF AFF FFILI IL ILI ILIATA ATA ATA
AFFILIATA
il - -/- -/- - - -
Figline Valdarno (Fi) 6 Maggio 2012
n - - - registro diplomi
I diplomati del 2 livello NBFI 2011 con alcuni docenti
e il presidente Sandro Ciccarelli
CORSI 2012
CONVENZIONATA
ENTE NAZIONALE DI PROMOZIONE
SPORTIVA (RICONOSCIUTO DAL
CONI AI SENSI DEL D. LGS.
N.242/1999)
NATURAL
BODYBUILDING
& FITNESS ITALY
Vedi le info dettagliate dei CORSI NBFI:
Per info e prenotazioni: N.B.F.I.
Tel 055 0513600 Fax 178 2208485 info@nb.it
Via Brodolini, 35/b 50063 Figline Valdarno (FI)
CERTIFICAZIONE NBFI - ACSI/CONI PRIMO LIVELLO
ALLENATORE BODYBUILDING & FITNESS E PERSONAL TRAINER
Il corso Allenatore NBFI, Federazione di Natural Bodybuilding afliata alla ACSI, d diritto, a chi supera lesame, di
afancare gli allenatori di 2 livello come tecnico abilitato nelle associazioni sportive dilettantistiche italiane afliate al CONI.
Il corso comprende argomenti di: Allenamento; Essenziali del Weightlifting; Tecnica di esecuzione degli esercizi; Fisiologia di base; Cardio per aumento della
performance e per dimagrimento; Preparazione alle gare (allenamento, integrazione, alimentazione) e posing (corso di pose); Stretching; Pesi e preparazione in
palestra per altri sport; Alimentazione e integrazione; Riabilitazione e prevenzione dei traumi; Diritto dello sport afferente i tecnici dello sport.
Docenti: Dott.Gabriello Castellacci, Laureato in economia e management dello sport, Maestro CONI 4 Livello europeo, Prof.
Pasquale Cozza, Diplomato ISEF e Allenatore CONI Terzo Livello, Dott.Gabriele Tampellini, Laureato in Scienze Motorie, Maestro
CONI 3 Livello, Roberto Del Gaudio, Maestro CONI 3 Livello, Matteo Guida, Allenatore e Personal Trainer ISSA e personal
Trainer NBFI/IART ACSI/CONI, Dott. Kristian Montevecchi, laureato in Economia, specializzato in marketing e comunicazione,
personal Trainer NBFI/IART ACSI/CONI, Dott. Andrea Rizzo, Laureato in Scienze Motorie, personal Trainer NBFI/IART ACSI/CONI,
Armando Vinci, Fisioterapista e posturologo, Dott. Anthony McDougall, Chiropratico, Carlo Buzzichelli, Personal Trainer NSCA e
presidente del Tudor Bompa Institute Italia, Ing. Paolo Evangelista, esperto in Powerlifting e biomeccanica, autore del libro DCSS.
CERTIFICAZIONE NBFI - ACSI/CONI FIKDA PRIMO LIVELLO
ALLENATORE KETTLEBELL E PERSONAL TRAINER
Il corso Allenatore NBFI afliata alla ACSI, specializzazione kettlebell training FIKDA, d diritto, a chi supera lesame, di
afancare gli allenatori di 2 livello come tecnico abilitato nelle associazioni sportive dilettantistiche italiane afliate al CONI.
Il corso comprende argomenti di: Allenamento con il kettlebell; Tecnica di esecuzione degli esercizi e metodologia specica; Fisiologia di base; Kettlebell
Cardio per aumento della performance e per dimagrimento; Kettlebell e preparazione in palestra per altri sport; Alimentazione e integrazione; Riabilitazione
e prevenzione dei traumi; Diritto dello sport afferente i tecnici dello sport.
Docenti: Mario Civalleri, Kettlebell Trainer RKC e autore del libro Kettlebell Heavyrobics, Alberto Oddone, Presidente FIKDA,
Dott. Gabriello Castellacci, Laureato in economia e management dello sport, Maestro CONI 4 Livello europeo, Prof.Pasquale
Cozza, Diplomato ISEF e Allenatore CONI Terzo Livello, Dott. Gabriele Tampellini, Laureato in Scienze Motorie, Maestro CONI 3
Livello, Matteo Guida, Allenatore e Personal Trainer ISSA e personal Trainer NBFI/IART ACSI/CONI, Dott. Kristian Montevecchi,
laureato in Economia, specializzato in marketing e comunicazione, personal Trainer NBFI/IART ACSI/CONI, Dott. Andrea Rizzo,
Laureato in Scienze Motorie, personal Trainer NBFI/IART ACSI/CONI, Armando Vinci, Fisioterapista e posturologo, Dott. Anthony
McDougall, Chiropratico, Carlo Buzzichelli, Personal Trainer NSCA e presidente del Tudor Bompa Institute Italia,
FEDERAZIONE NATURAL BODYBUILDING & FITNESS OF ITALY
AFFLIATA WNBF - WORLD NATURAL BODYBUILDING FEDERATION
CONVENZIONATA ACSI: ENTE NAZIONALE DI PROMOZIONE SPORTIVA (RICONOSCIUTO DAL CONI AI SENSI DEL D. LGS. N.242/1999)
WWW.NBFI.IT
NBFI sempre attenta ad organizzare eventi invitando relatori nazionali ed internazionali di indiscutibile autorevolezza
per offrire ai propri iscritti quanto di meglio si possa trovare in materia di allenamento ed alimentazione per lo sport.
Di seguito sono riportati gli eventi pianif icati no ad adesso.
Corsi aperti a tutti i cittadini italiani, Titolo di studio richiesto: Licenza Media, (QUOTA ASSOCIATIVA NBFI/ACSI/CONI + LIBRI +
LEZIONI TEORICHE + LEZIONI PRATICHE + ESAME FINALE + RILASCIO DIPLOMA A SUPERAMENTO ESAME FINALE + RILASCIO
CERTIFICAZIONE DI RICONOSCIMENTO A SUPERAMENTO ESAME FINALE).
INIZIO CORSI MARZO 2012, FIGLINE VALDARNO (FIRENZE) 4 WEEK END (60 ORE)
I corsi sono vincolati ad un numero minimo di iscritti di 10 allievi.
Titoli NBFI/ACSI conformi ai principi generali dettati dal CONI, con il nuovo Sistema Nazionale
di Qualiche dei Tecnici Sportivi (SnaQ).
Questa certi cazione costituisce titolo valido per poter
instaurare un rapporto di lavoro, in quanto conforme ai
principi generali dettati dal CONI, con il nuovo Sistema
Nazionale di Quali che dei Tecnici Sportivi (SNaQ).
Questa certi cazione costituisce titolo valido per poter
instaurare un rapporto di lavoro, in quanto conforme ai
principi generali dettati dal CONI, con il nuovo Sistema
Nazionale di Quali che dei Tecnici Sportivi (SNaQ).
1
2
3
4
1
2
3
4
ALLENATORE DI BODYBUILDING E PERSONAL TRAINER NBFI
calendario orari argomento docenti ore
Sabato 3 Marzo
10:00 - 13:00 Elementi di diritto afferente lo sport Castellacci 3
14.00 - 16.00 Teoria e principi dellattivit sica Cozza 2
16:00 - 20:00 Fisiologia di base Tampellini 4
Domenica 4 Marzo
9:00 - 11:00 Cenni di anatomia e sistema cardiocircolatorio Tampellini 2
11:00 - 13:00
Teoria, principi e metodiche dell'allenamento "Natural" Cozza 4
14:00 - 16.00
16:00 - 18:00 Allenamento funzionale: abilit siche e capacit condizionali Montevecchi 2
Sabato 24 Marzo
10:00 - 12:30 I principi base dellintegrazione Rizzo 2,5
13:30 - 15:30 Gli integratori di base e fondamentali Rizzo 2
15:30 - 18:00 I principi base dellalimentazione Guida 2,5
18:00 - 20:00 Dieta metabolica, low carb e slow carb Guida 2
Domenica 25 Marzo
9:00 - 13:00 La periodizzazione nel Natural Body building. BIIO. EDT Guida 4
14:00 - 18:00 Sistemi abbreviati per hardgainer: il programma di McRobert Del Gaudio 4
Sabato 14 Aprile
10:00 - 14:00 La periodizzazione della forza Buzzichelli 4
15:00 - 16:00 Plicometria ed analisi della composizione corporea Buzzichelli 1
16:00 - 18:00 Valutazione Posturale Vinci 2
18:00 - 20:00 Le basi della traumatologia sportiva Mc Dougall 2
Domenica 15 Aprile
10:00 - 13:00 Leve e biomeccanica del powerlifting Evangelista 3
14:00 - 17:00 Il metodo DCSS Evangelista 3
17:00 - 19:00 Esercitazioni pratiche in palestra Evangelista 2
Sabato 5 Maggio
10:00 - 13:00 Le basi della comunicazione efcace per istruttori e PT Montevecchi 3
14:00 - 17:00 Fisiologia dellallenamento Tampellini 3
17:00 - 20:00 La programmazione di un allenamento Cozza 3
Domenica 6 Maggio 9:00 - 13:00 Esami
ORE TOTALI 60
ALLENATORE DI KETTLEBELL E PERSONAL TRAINER NBFI/FIKDA
calendario orari argomento docenti ore
Sabato 3 Marzo
10:00 - 13:00 Elementi di diritto afferente lo sport Castellacci 3
14.00 - 16.00 Teoria e principi dellattivit sica Cozza 2
16:00 - 20:00 Fisiologia di base Tampellini 4
Domenica 4 Marzo
10:00 - 14:00 Kettlebell training: propedeutica Civalleri 4
15:00 - 19:00 Kettlebell training: esercizi e metodologie di base Civalleri 4
Sabato 24 Marzo
10:00 - 12:30 I principi base dellintegrazione Rizzo 2,5
13:30 - 15:30 Gli integratori di base e fondamentali Rizzo 2
15:30 - 18:00 I principi base dellalimentazione Guida 2,5
18:00 - 20:00 Dieta metabolica, low carb e slow carb Guida 2
Domenica 25 Marzo
10:00 - 14:00 Kettlebell training: verica tecniche acquisite ed introduzione tecniche avanzate Civalleri 4
15:00 - 19:00 Kettlebell training: sviluppo ed applicazione tecniche avanzate Civalleri 4
Sabato 14 Aprile
10:00 - 14:00 La periodizzazione della forza Buzzichelli 4
15:00 - 16:00 Plicometria ed analisi della composizione corporea Buzzichelli 1
16:00 - 18:00 Valutazione Posturale Vinci 2
18:00 - 20:00 Le basi della traumatologia sportiva Mc Dougall 2
Domenica 15 Aprile
10:00 - 13:00 Kettlebell training: verica tecniche acquisite Civalleri 3
14:00 - 17:00 Ketlebell training: il metodo didattico FIKDA Civalleri 3
17:00 - 19:00 Kettlebell training: Esame pratico e discussione tesi Civalleri 2
Sabato 5 Maggio
10:00 - 13:00 Le basi della comunicazione efcace per istruttori e PT Montevecchi 3
14:00 - 17:00 Fisiologia dellallenamento Tampellini 3
17:00 - 20:00 La programmazione di un allenamento Cozza 3
Domenica 6 Maggio 9:00 - 13:00 Esami
ORE TOTALI 60
NBFI
ORE TOTALI 60
F
o
t
o
:


m
e
n
t
a
l
r
a
i

-

F
o
t
o
l
i
a
.
c
o
m
del Dott. Marco Ceriani
Copyrighted 2012 by Sandro Ciccarelli Editore
C
U
C
IN
A
B
L
IN
D
A
T
A
C
O
N
T
R
O
IL
D
O
P
IN
G
Le
derrate alimentari degli atleti vengono
blindate per motivi di sicurezza alimentare
contro il dilagare del fenomeno del doping
involontario. Due grandi avvenimenti spor-
tivi recenti, il Tour DE France e i mondiali di nuoto, hanno
visto la fgura del nutrizionista e dello chef af ancare, per im-
portanza quella del preparatore atletico e del coach.
Il controllo del cibo ha raggiunto livelli impensabili ed
ha obbligato i team ad approvvigionamenti di alimenti ga-
rantiti sotto il proflo della contaminazione chimica.
Del resto, anche a livello comunitario stata amplia-
ta la trasparenza sulle etichette estendendo a carni suine,
ovine e caprine lobbligo del certifcato di provenienza sui
prodotti carnei (fno ad ora questo obbligo riguardava le
carni bovine, il pesce, frutta e verdura fresca, miele, uova
e olio di oliva mentre in un prossimo futuro lobbligo in
etichetta riguarder anche il latte e i suoi derivati. E sulla
provenienza del latte e
yogurt dei prodotti ita-
liani se ne scopriranno
delle belle...).
Il luogo di origine
quindi di fondamentale
importanza per evitare
e combattere sofstica-
zioni o epidemie alimen-
tari, quindi in etichetta
sar un obbligo trovare,
ad esempio, la seguente
denominazione: pro-
sciutto confezionato in
Italia con carne di maiale
tedesca.
Ritornando allo sport, i Mondiali di nuoto di questa esta-
te a Shanghai, che hanno visto la partecipazione di 2.200 at-
leti provenienti da 181 paesi, si sono disputati allinsegna del
doping indotto dalluso di carne contaminata.
Sul banco degli imputati cera il Clenbuterolo (farmaco
inserito nella categoria dei dopanti, assunzione punita dalla
WADA con due anni di sospensione) che ha tra i suoi potenti
efetti oltre alla funzione broncodilatatoria, anche lefetto di
aumentare la massa muscolare e bruciare i grassi corporei).
Durante le Olimpiadi di Pechino sono state consumate
dagli atleti ben 131 tonnellate di carne e secondo un accu-
rato studio della WADA ben 22 atleti (su un campione di 28)
tornando dalla Cina risultarono avere tracce di Clenbuterolo
nel sangue. Gli atleti pi famosi a essere risultati positivi a
questa sostanza, ma anche a giurare sulla propria innocenza
sono fno ad ora Alberto Contador (ciclista trovato positivo
al Tour nel 2010), Adam Seroczynski (canoista, positivo a
Pechino 2008 e squalifcato per 2 anni) e Dimitrij Ovtcharov
(tennis tavolo, positivo nel 2010).
Per evitare ogni alibi di assunzione involontaria di
Clenbuterolo tramite il consumo di carne, e dichiarare una
guerra sempre pi totale al doping (di recente alcune azien-
de farmaceutiche hanno siglato protocolli di lavoro con le
agenzie mondiali che lottano contro il doping per la trac-
ciabilit di alcuni farmaci anabolici) le nazionali hanno va-
rato un vero e proprio codice comportamentale in fatto di
alimenti. Nessuno pu mangiare fuori dagli alberghi scelti
per il ritiro. Niente spuntini locali, nessuna sosta ai fast food
e ai locali alla moda. Gli atleti mangiano solo quanto portato
da casa e approvato dal responsabile per la nutrizione (spes-
so confuso con il nutrizionista che un medico, mentre altri
professioni si occupano di cibo e salute come i biologi, i tec-
nologi alimentari e i dietisti) degli atleti. Una bella occasione
142 NATURAL BODYBUILDING
WWW. NBFI . I T
F
o
t
o
:


G
i
l
l
e
s

P
a
i
r
e

-

F
o
t
o
l
i
a
.
c
o
m
MMarco Ceriani un espertto di nutrizione e benessere ((laureato in scienze delle preparazioni alimentari). Ha direetto
centri di medicina e di nutrizione applicata allo sport. consulente di numerosi atleti e team professionistici. Ha al suo
atttivo centinaia di formulazi ioni di supplementi per la perrformance e il benessere. Responsabile per la nutrizione del
seettore Muay Thai e Vice Pr residente NBFI., ideatore del metodo Bella Forza e dellinsserto RINGNESS del magazine
FFIGHT! di OLYMPIANS MEDIA GROUP.
AAutore di centianaia di artic coli divulgativi e libri. www.bellaforza.it Facebo book: marco ceriani
F
o
t
o
:


J
o
s
e

M
a
n
u
e
l

G
e
l
p
i

-

F
o
t
o
l
i
a
.
c
o
m
per dare la giusta considerazione anche questa professione
che, sotto laspetto pratico, un mix vincente tra uno chef,
un farmacista e un medico.
I vari paesi presenti a Shanghai per il mondiale di nuoto
si sono date regole diverse, ma tutte volte alla stretta sorve-
glianza e alla tutela del cibo per i propri atleti.
LItalia ha posto il divieto assoluto di acquistare e consu-
mare cibo fuori dallhotel e messo in atto severe limitazioni
per quanto riguarda il consumo di carne rossa locale.
Gli americani hanno vietato solo la carne di provenien-
za cinese, mentre gli australiani hanno proibito la carne di
maiale ai propri atleti portandosi tutto il resto da casa. La
Serbia ha basato la sua alimentazione proteica sulla carne di
pollo, in sostituzione delle carni rosse locali. Una eccezione a
questo clima di totale sfducia nei prodotti cinesi, il Sudafri-
ca che non ha invece adottato alcuna precauzione nei con-
fronti dei prodotti locali.
Il Clenbuterolo ovviamente non lunica sostanza do-
pante oggetto di interesse per la WADA, ma certamente
rappresenta un vuoto giuridico (a causa dei tanti, troppi casi
ambigui di atleti che hanno evidenziato una contaminazio-
ne in tracce, troppo poca per costituire
un reale aiuto ma anche eccessiva per
non apparire almeno sospetta) che mi-
naccia di far saltare in aria il gi fragile
castello della ricerca antidoping.
AllAgenzia mondiale anti-
doping stanno lavorando assi-
duamente alla ricerca di nuovi
protocolli scientifci che non
lascino dubbi sulla positivit a
farmaci dopanti. ovvio augu-
rare loro un rapido successo su
questa materia terribilmente
seria per lasciare a una fettina
di carne la possibilit di scon-
fggere la lotta al doping.
Noi a questa lotta ci abbiamo
sempre creduto e con il nostro
lavoro basato sulla massimiz-
zazione dellallenamento, nutrizione e supplementi ci
adoperiamo quotidianamente per sconfggere il doping,
divulgando il meglio dei nostri rispettivi settori. Pi ancora,
il bodybuilding come flosofa di vita merita una maggior at-
tenzione e rispetto, la NBFI (Federazione di Natural Bodybu-
ilding) nata proprio da questi valori di moralit chimica e
rispetto per la salute
degli atleti.
Per uno sport
pulito, sano e ar-
monico, c biso-
gno dellaiuto di
tutti, anche del tuo
che stai leggen-
do queste righe.
Come? Iscriviti alla
NBFI e adoperati
perch la tua pa-
lestra e i tuoi amici
siano doping free.

WWW. NBFI . I T
NATURAL BODYBUILDING 143
DDisponibili presso: SANDRO CICCAREL LLI EDITORE SRL info/ordini: OLYMPIANS Tel. 055/959530 Fax 055/958255 - www.olympian.it e-mail: ordini@oly ympian.it
Bella Forza Advanced LA SOLUZIONE AVANZATA PER: Benessere, Tonicit, Bellezza.
Beauty & Performance Nato per gli atleti ideale per raggiungere e mantenere per sempre la forma sica.
CON GLI INTERVENTI DI: Cinzia Chiarenza (Miss Universo) Diego calzolari (World Champ Muay Thai) Claudio Tozzi (B.I.I.O.

)
La dieta prevede la ciclizzazione dei nutrienti (secondo 7 moduli) e la loro ripartizione giornaliera (Small Frequent Meals)
secondo una precisa pianificazione. I supplementi sono attentamente calibrati secondo le specifiche esigenze individuali.
Lallenamento personalizzato finalizzato al rimodellamento corporeo pensato come tonificazione (o incremento) della
massa magra e alla diminuzione della massa grassa.
304 pagine, costo 29,00 (+ spese postali)
144 NATURAL BODYBUILDING
WWW. NBFI . I T
3 CAMPIONATO
di natural bodybuilding
144 NATURAL BODYBUILDING
WWW. NBFI . I T
WWW. NBFI . I T
NATURAL BODYBUILDING 145
MUSCOLI PERFETTI
PER COMBATTERE
IL DOPING!
QUASI 70 SUPER
ATLETI, DA 20 A
60 ANNI, UNITI
PER LA LOTTA
NATURAL.
Tutta lItalia ha schierato un
grande ESERCITO MUSCOLARE,
che ha dato motivazioni
davvero straordinarie per
migliorare il nostro corpo
in modo naturale!
Prover a ripercorrere gli
eventi, ma dovevate esserci!
Cercher di far rivivere un po
delle splendide emozioni
regalateci e della carica
ricevuta.
Grazie ragazzi!!!
ITALIANO NBFI
e 2 campionato
Ms.FIT BODY
del prof. PASQUALE COZZA
foto Andrea Menichelli - Redditi Marco
WWW. NBFI . I T
NATURAL BODYBUILDING 145
146 NATURAL BODYBUILDING
WWW. NBFI . I T
PREMESSA (soprattutto PER GLI ATLETI)
Lattacco al doping, da parte di voi, FORZE della NATURA, stato
forte, massiccio e compatto! Lho veramente sentito.
Sono sempre stato un idealista, ma una volta di pi non ero solo. Vi
ho percepito fortemente motivati e davvero tanto uniti, in questo e
fra voi. GRAZIE di cuore, per capire i nostri sforzi e anche per la
pazienza nel sopportare tutti i necessari controlli e i tempi tecnici (e
avere ancora il sorriso e la forza per farci, e farvi, applausi!).
Questa la scelta pi onorevole. Questa la strada. Questa
disciplina da veri guerrieri.
Comincio a pensare (dopo 23 anni di settore), che ORA possia-
mo infliggere un duro colpo al pericoloso gonfiore farmaceutico e,
a breve, far veramente rinascere il Natural Bodybuilding! Muscoli
creati saggiamente da seria fatica, senza
esser presi in giro da personalit
chimiche (campioni e prepa-
ratori, di turno, pronti a pren-
derci soldi, per falsi onori e
titoli senza darcene
diritto naturale, ma ruban-
doli ai nostri pari!).
La libert di salire su
un palco per scontrarsi SOLO
con persone VERE, non ha
prezzo!
Si sta davvero bene fra
gente sincera, che lotta contro la
genetica e spinge il ferro, ma sempre
senza trucchi! Con il coraggio di accet-
tare limiti e mostrarsi nudi, ma IMBAT-
TIBILI nellorgoglio.
Cos come siamo noi, veri fratelli del
ferro, non mercenari del doping!
Cos sudare e accettare ha un senso.
Cos vincere o perdere diventa un
particolare.
Cos ognuno di noi vince sempre
la battaglia pi grande! Penso che, ora
dopo tre anni, per noi, questo messag-
gio sia forte e chiaro: SU LE BRACCIA,
GUERRIERI. DOPPI BICIPITI SI
COMINCIA!
INTRODUZIONE
con emozione rinnovata che ho lonore di scrivere il terzo
Redazionale di questa splendida kermesse annuale. Questo
vuole essere pi particolare del solito. Dal momento che la
rivista Natural Bodybuilding & Fitness Italy da qualche nume-
ro viene abbinata a Olympians news-Superfitness, mi sento
in dovere di coinvolgere anche TUTTI gli altri lettori. Cos
ho scritto un approfondimento (tutto nella striscia a latere
delle nostre pagine) dedicato ad alcuni lettori non proprio
Bodybuilder.
Per TUTTI gli altri partiamo subito.
PERCH NBFI
Mi autocito, in parte, dal primo storico evento (non saprei
dirlo meglio):
Fortemente voluto dallinfaticabile Sandro Ciccarelli,
fedele e sincero appassionato di Cultura Fisica, Bodybuil-
ding e discipline affini, coraggioso editore, responsabile di
innovazioni totali nel settore, ora anche Presidente della
NBFI (emanazione italiana della prestigiosa e innovativa
WNBF), la gara stata creata per realizzare un ideale: il
Bodybuilding veramente Naturale!
Questa la mission della NBFI! Ed stata capita bene da tutti
i presenti (compreso il pubblico). Que-
sta stata la mission di TUTTI i
nostri numerosi atleti sul
palco (settanta mi d
tanto ce la stiamo
facendo), che hanno il
valore di preservare la
loro integrit come di
sviluppare il loro corpo.
La posta in gioco
alta: riabilitare la
nostra disciplina difen-
dendo gli atleti da scelte sba-
gliate e promuovendo la salute al massimo
sviluppo!.
CHE LO SHOW ABBIA INIZIO!
Il pubblico gremisce la sala. C
aspettativa e vociare
contenuto. Il teatro
spegne le luci. Il silen-
zio e il buio si fondono
e creano la giusta
pausa nellanimo.
Lo schermo si illumina.
Eugene Sandow, il
padre del moderno
Bodybuilding in Europa e
in Usa, appare. Maestoso.
Granitico, squartato, atletico,
statuario assolutamente invi-
diabile e totalmente naturale! Il
filmato presentato
ingrandito e sgranato
146 NATURAL BODYBUILDING
WWW. NBFI . I T
LEONARDO
CASAGRANDE
nellemozionante black & white depoca. Segue
Eric Broser, quarantenne gigante muscolare del
moderno NBB USA, impegnato in allenamento.
I Pink Floyd scandiscono perfettamente le
dure ripetizioni con note cupe e vibranti.
Anche lui in un drammatico bianco e
nero, che sottolinea nettamente le sue
contrazioni possenti.
Ma ecco apparire coloratissime
immagini, bellissime e moderne, piene di
muscoli e luci! Sono un nuovo mix, a
colori, delle prime due edizioni dei
Campionati Italiani NBFI.
Troneggiano i fantastici protagoni-
sti nostrani e il vincitore assoluto di
entrambe le edizioni, il grande Gerardo
Di Gennaro, atleta dalla linea esemplare e
dai bicipiti e addominali davvero spettaco-
lari, uomo modesto e comunicativo, vero rap-
presentante della Nostra NBFI anche negli
USA! (che, questanno, ho avuto lonore e il
piacere di apprezzare una volta di pi, pas-
sando davvero bei momenti insieme gra-
zie Gerardo!).
Poi il pesante sipario rosso si chiude e
appare il nostro amatissimo presentatore:
Matteo Guida. Questuomo unicona nazionale della rivi-
sta Olympians News. Sapiente, e sempre modesto, mix di
Cultura Fisica (e non solo) e di comunicativa parteno-
pea. un amico, che alla prima edizione mi ha com-
mosso, alla seconda fatto pensare e alla terza scom-
pisciare grande! Non facile il tuo ruolo, e va
sottolineata la difficolt di stare sul palco senza
essere il protagonista assoluto, ma il filo condutto-
re fra il pubblico e gli atleti.
La sua voce introduce gli atleti,
accompagnati dal nostro inno e
capeggiati dalle bellissime (e femmi-
nilissime) rappresentanti donne
della categoria Fit Body NBFI che
spalleggiano un portabandiera
deccezione. In tuta NBFI, il
nostro primo campione: Di
Gennaro, questanno nostro
Special Guest.
Lattesa colmata! Il palco
straripa di super uomini dai
muscoli perfetti sottolineati
dalla forza storica del nostro inno.
Che bello vedere lItalia unita dalla
forza del corpo e dai valori del ferro. Un
sogno che si realizza solo una volta
allanno. Solo sul nostro palco. Questo
non si pu perdere. Sviluppati armonio-
samente e presentati sotto le brillanti
luci della pura disciplina del Natural
non emozionante? Non vi basta?
Allora andiamo avanti
WWW. NBFI . I T
NATURAL BODYBUILDING 147
SU LE BRACCIA, GUERRIERI.
DOPPI BICIPITI
SI COMINCIA!
MATTEO GUIDA
148 NATURAL BODYBUILDING
WWW. NBFI . I T
Quanto tempo occorre per sviluppare un fisico degno di
nota? E per farne uno straordinario?
A questi atleti, di questa giovanissima categoria (fino a 21
anni), non servito tempo (che poco per let che hanno),
ma impegno e capacit applicate con disciplina e costanza,
queste sono tutte caratteristiche non proprie della giovane
et e dei nostri tempi, anche per gli adulti.
Quindi, onore a questi giovanissimi nostri rappresentanti,
che ora vi presento uno per uno:
1 FRANCO COSIMO MALETESTA: imbattibile nella sua categoria.
A questa et un atleta cos simmetrico, equilibrato, massoso, tirato ed elegante
nelle forme davvero raro. Fantastica la tua V-shape, data da vita stretta che
sfociava verso lalto in un gran dorsale ampio e ben strutturato, ben ornato da
deltoidi e gran dentato, che incorniciavano un pettorale scolpito nella roccia,
sopra addominali ottimamente cesellati. Cura un po' di pi il quadricipite (e
labbronzatura) e sei da copertina mondiale!
2 BRUNO VOLPI: atleta elegante e curato, dalle forme allungate, ma
piene. Mostrava uno sviluppo notevole e delineato nellupper body, ma veniva
penalizzato per la poca simmetria IN cosce e gambe. Ma normale Bruno, fra
Natural spesso cos dacci dentro perch meriti davvero.
3 TOMMASO CIMARELLI: bellatleta, completo, possente e solido,
dalle grandi potenzialit, notevole nello sviluppo delle masse, con buona sim-
metria, che deve curare di pi solo la qualit muscolare. Bravo, non mollare,
non manca niente alla massima grandezza del tuo risultato.
JUNIORES under 21
CLASSIFICA CATEGORIA JUNIORES (sotto 21 anni)
1 FRANCO COSIMO MALETESTA n.12 STERNATIA LE
2 BRUNO VOLPI n.27 PIETRALUNGA PG
3 TOMMASO CIMARELLI n.10 ANCONA AN
148 NATURAL BODYBUILDING
WWW. NBFI . I T
2 Bruno VOLPI
3 Tommaso CIMARELLI

F
o
t
o
:


M
i
c
h
a
e
l

N
e
v
e
u
x
1 Franco Cosimo MALETESTA
WWW. NBFI . I T
NATURAL BODYBUILDING 149
Franco Cosimo MALETESTA
WWW. NBFI . I T
NATURAL BODYBUILDING 149
150 NATURAL BODYBUILDING
WWW. NBFI . I T
LE DIMENSIONI NON CONTANO: I GIANT KILLER!
Questa categoria stata una delle pi impegnative e nume-
rose. Ben 20 atleti della migliore specie!!!
Ci avete emozionato (e fatto sudare) veramente parecchio
per classificarvi nelle giuste posizioni.
Ecco, ho cercato di commentarvi TUTTI, con il top pi detta-
gliato (e fino alle posizioni finali):
1 ENZO NARDINO: stratosferico! Massa, simmetria e condizione
assolutamente da podio. Questatleta di San Severo era un osso davvero
duro da battere. La distanza dal secondo non era oggettivamente molto
evidente, ma a questi livelli, cos alti, fatta spesso solo di dettagli e sfu-
mature. Preparatissimo, davvero al top.
2 DAVIDE DONATI: spettacolare atleta di TERRANUOVA BRACCIOLINI!
Sinceramente, per me, non eri dietro a nessuno. Ma la gara per il podio fatta
da sottili differenze che spesso spaccano le giurie, massa, simmetria e condi-
zione erano alle stelle. Presentavi forme e disegni muscolari particolari e accat-
tivanti, con una grinta personale da sottolineare. Non mi resta che rifarti i com-
plimenti, onestamente, qui, in pubblico (perch te li ho gi fatti dietro il palco).
Fantastico.
3 CRISTIAN GUASTELLA: questo notevole posatore di Ragusa
aveva di sicuro uno dei corpi pi statuari dell'intera serata. Nessun punto
carente. La sua notevole forma lo piazza terzo, ad un soffio dai primi, solo
per la qualit muscolare, alta, ma non tanto drammatica quanto quella
MOSCA sotto 68 kg
3 Cristian GUASTELLA 2 Davide DONATI
CLASSIFICA CATEGORIA MOSCA (sotto 68 kg)
1 ENZO NARDINO n.61 SAN SEVERO FG
2 DAVIDE DONATI n.45 TERRANUOVA B.NI AR
3 CRISTIAN GUASTELLA n.38 RAGUSA RG
4 MAURO COPELLINI n.49 ABBIATEGRASSO MI
5 ALESSANDRO PALANDRANI n.58 ANCONA AN
1 Enzo NARDINO
150 NATURAL BODYBUILDING
WWW. NBFI . I T
WWW. NBFI . I T
NATURAL BODYBUILDING 151
Enzo NARDINO
WWW. NBFI . I T
NATURAL BODYBUILDING 151
152 NATURAL BODYBUILDING
WWW. NBFI . I T
dei suoi precedenti concor-
renti. Mitico e con doti da
showman, comunque. Se
riesci a definirti ancora
(perch gi lo sei) e man-
tieni la massa, e le propor-
zioni, che hai ora, non ti
ferma pi nessuno.
4 MAURO COPEL-
LINI: questo atleta di
Abbiategrasso, era colossale
e spettacolare nellupper
body, ma non adeguata-
mente simmetrico con la
sua parte inferiore (e addi-
rittura fra le due cosce). Un
vero peccato. Sei un talento.
Insisti, mi farebbe piacere
rivederti per scalare il
podio.

5 ALESSANDRO
PALANDRANI: eri
densissimo e massoso, con
braccia da urlo, ma penaliz-
zato sopratutto dal round simmetria. Il petto purtroppo non regge il con-
fronto con il resto, davvero tanto pi avanti. Atleta di Ancona, deve tornare
anche lui a dare battaglia per il podio. Se lo merita.
ALTRI PARTECIPANTI,
LUIGI ANTINO n.1: bellatleta di CAMPO-
BASSO, non mostrava punti carenti, linea
davvero piacevole.
EMILIANO MAURIZI n.15: massoso e
granitico, latleta di FERMO era note-
vole, simmetrico e completo.
MASSIMILIANO
BRUGNOLI n.28:
non giovanissimo,
ma in ottima
forma,
latleta di
LODI aveva uno dei migliori toraci sul palco dei Mosca.
ROSARIO GUERCIO n.29: atleta di QUART, era minuto, ma molto dise-
gnato e separato. Ben preparato.
ALBERTO CIABATTI n.30: questo bellissimo atleta di MONTALE, aveva
la parete addominale fra le pi simmetriche della categoria, ma una nota di
merito va anche alla sua V-shape notevole. Cosce da curare.
RICCARDO MARCHI n.31: atleta di BUDRIO, aveva una gran linea,
buone cosce, e un upper body che non presentava carenze. Ottima anche la
qualit, tranne il velo dacqua sulle cosce
VASCO SOMENZI n.34: atleta di SONCINO aveva un tronco super, mas-
soso e tagliato, peccato per le cosce.
ANTONIO FORTUNATO n.42: atleta di CARMAGNOLA sempre elegan-
te e ben preparato. Questanno per il livello era pi alto e certamente il
numero dei partecipanti rendeva la gara pi ostica, anche per lui.
ANDREA AMICI n.48: atleta di CAMERINO presentava una bellissima
muscolatura, ma non simmetricamente perfetta fra la parte alta e bassa del
corpo. Gran peccato
ALBERTO SAID n.50: atleta di MONTESCUDO ha nel cognome un desti-
no. Non si pu dire che non conosci questo Principio per quanto riguarda lo
sviluppo di petto e spalle. Ma non lo hai applicato tanto bene anche sulle
cosce e sulle gambe scherzo (so bene quanto incide la genetica!). Bravo.
MICHELE DI BENEDETTO n.52: atleta diSAN SEVERO ancora acerbo
muscolarmente ma il disegno complessivo non male. Fatti aiutare di
pi dal tuo conterraneo, il vincitore.
GIANLUCA ALPOGGIO n.59: atleta di NERVIANO, era elegante, seria-
mente preparato e davvero muscoloso, simmetrico e piacevole.
DAVIDE LAMBERTI n.65: atleta di FIRENZE, dallottima forma, deve
calcolare meglio i tempi della ricarica. Man mano che posava si tirava e la
sera era ancora meglio (come molti atleti che magari vengono da molto pi
lontano e, quindi, sono anche pi giustificati).
ALESSANDRO TIRANTI n.22: atleta di MACERATA, appariva minuto
e un po acerbo, con alcuni limiti strutturali, ma pu molto migliorare. E
comunque sei stato ai Campionati Italiani!
MOSCA sotto 68 kg
4 Mauro COPELLINI
5 Alessandro PALANDRANI
152 NATURAL BODYBUILDING
WWW. NBFI . I T
DAVIDE
DONATI
WWW. NBFI . I T
NATURAL BODYBUILDING 153
I leggeri sono la prima categoria che strabilia. Perch se
la precedente fantastica sul palco, ma poi, pi da vicino,
ha limiti per la struttura (ovviamente Mosca indica non
tanto grande quanto potrebbe sembrare dalle poltrone),
questa comincia ad essere somaticamente pi importante.
1 LEONARDO CASAGRANDE: stellare! Questatleta gareggia da
tre anni con noi. Ha realizzato sempre il successo meritato e migliora ancora
(anche se la sua forma non facilmente migliorabile) ma quest'anno la
lotta stata durissima, il suo avversario era pazzesco e la sua vittoria stata
dovuta sopratutto alla sua bellissima linea e alle sue cosce. Inoltre le pose di
schiena erano molto forti. Un ultimo punto , forse, stato dato anche dalla
fiducia che riponiamo in atleti che gareggiano con noi da anni, che si sotto-
pongono a pi test e che sappiamo essere portabandiera affidabili e costan-
ti. Grazie Leonardo, modestia e tranquillit sono la tua forza!

2 MASSIMILIANO BURGIO: galattico, assolutamente da spreme-
re i giudici per la posizione giusta. Per quanto mi riguarda, a penalizzarti
lievemente, senza nulla togliere alle qualit del vincitore, ma nemmeno alle
tue, stata l'eccessiva definizione e vascolarit (succedeva anche a Gironda).
In sintesi non hai punti carenti, hai una bellissima linea e massa da vendere,
ma non esagerare nella qualit per i nostri canoni Natural
3 LUCA PIOLANTI: grande. Hai seguito bene il mio consiglio, scritto
lanno scorso (di lavorare sulla qualit) e, senza perdere la tua categoria, sei
salito di un posto. Speravo potessi andare ancora pi su. Ma gli avversari erano
venuti da Marte sar per l'anno prossimo. Te l'ho scritto pi volte e lo ribadi-
sco: hai nel complesso delle formemuscolari fra le migliori dellintera gara!

LEGGERI da 68 a 75 kg
CLASSIFICA CATEGORIA LEGGERI (da 68 a 75 kg)
1 LEONARDO CASAGRANDE n.54 GUBBIO PG
2 MASSIMILIANO BURGIO n.69 TORINO TO
3 LUCA PIOLANTI n.51 MONTESCUDO RN
4 MARCO BASSI n.35 MILANO MI
5 MANUEL BERTELLONI n.56 LUCCA LU
3 Luca PIOLANTI
1 Leonardo CASAGRANDE
2 Massimiliano BURGIO
WWW. NBFI . I T
NATURAL BODYBUILDING 153
154 NATURAL BODYBUILDING
WWW. NBFI . I T
4 MARCO BASSI: massoso, simmetrico ed elegante, questatleta di MILANO non aveva
gruppi muscolari da curare e niente per essere penalizzato. La sua posizione dovuta solo al valo-
re degli avversari e alle sorti tecniche di ogni gara. Potevi vincere per la tua preparazione, ma non
era la serata giusta per la presenza di avversari davvero notevoli.
5 MANUEL BERTELLONI: il titano del palco. Atleta giovanissimo, ma dotato di volumi
da veterano. Con massa e simmetria da top level assoluto. Fantastica la linea e le proporzioni.
Buona la qualit. Ma allora? Purtroppo per questa gara eri carente della massima condizione,
necessaria assurdo dire: troppo poco definito, ma per il livello dei tuoi avversari andata
cos. Davvero un peccato! Torna e sbaraglia! Sei da Mondiale USA.
ALTRI PARTECIPANTI:
FRANCO FALCONE n.6: atleta di OSSANA, si presenta equilibrato e simmetrico, ma deve
ottimizzare la qualit e alcuni punti carenti (addome e petto). Bella la forma generale e le
cosce.
LUCIANO MOSSA n.13: atleta di
AOSTA buono, ma acerbo. Devi esami-
nare bene foto e filmati e confrontarti
onestamente con gli altri. Hai potenziali-
t. Buona la partecipazione, ora dacci
dentro.
MIRKO GIAMMATTEI n.14: atleta di
LUCCA ha una bella linea, ma deve lavorare
di pi (su cosce, petto, braccia e addome).
Presenta anche una qualit muscolare ancora
immatura per un palco di questo livello.
MILO PACIOTTI n.47: atleta di GUBBIO
aveva una bella linea, con torace pieno e denso,
ma perdeva nel resto. Insisti, non credo che tu
possa avere dei limiti grossi che non puoi miglio-
rare.
ANDREA PIGNATTI n.53: i miei complimen-
ti a questatleta di FINALE EMILIA per la linea
eccellente e lapertura notevole di tronco e spalle.
Massoso sopra e anche sotto. Ti manca solo
qualche ritocco alimentare e idrico e, poi,
avversari permettendo, sarai acclamato sul
podio.
FRANCESCO CILLI n.55: elegante e
proporzionato latleta di MONTESILVANO
anche piacevole e simmetrico, pur-
troppo non aveva le masse per com-
petere fra i primi 5, ma non presen-
tava pecche. Bravo.
ANDREA FEBRUO n.60:
atleta di PESCARA aveva unotti-
ma condizione, davvero, ma
scarseggiava nella massa,
soprattutto per il livello dei
concorrenti presenti.
ANTONIO ZAZA
DAULISIO n.64: atleta di ROMA deve impegnarsi parecchio. Buona la coscia,
piacevole la schiena, ma troppi punti carenti (addome, petto, braccia), ma
soprattutto la mancanza di livello alto delle tre caratteristiche che valutiamo:
massa, simmetria e condizione. Sono contento tu abbia avuto coraggio e voglia
di partecipare, ma devo rivederti pi in forma.
4 Marco BASSI
5 Manuel BERTELLONI
LEGGERI da 68 a 75 kg
154 NATURAL BODYBUILDING
WWW. NBFI . I T
MASSIMILIANO
BURGIO
WWW. NBFI . I T
NATURAL BODYBUILDING 155 WWW. NBFI . I T
NATURAL BODYBUILDING 155
Leonardo CASAGRANDE
156 NATURAL BODYBUILDING
WWW. NBFI . I T
Questi ragazzi cominciano ad essere davvero grossi. Ma
il termine popolare male si addice al nostro Mondo Natu-
ral qui conta molto di pi il lavoro complessivo svolto su
TUTTI E TRE gli elementi gi citati di giudizio. La completezza
e la forma, come detto, ma ribadisco: vincono su TUTTO!
Godiamoceli:
1 ALBERTO GUIDI: un meritatissimo primo posto per una nostra new entry
degna di nota. Questo atleta di TORINO presentava uno dei corpi pi equilibrati e cesellati
della serata. Punto di forza la sua forma ed equilibrio generale che, forse cosce poderose
a parte, non presentavano dimensioni mostruose o disegni particolari, ma bellezza e
armonia a lettere cubitali. Complimentoni veramente (anche ai tuoi genitori!).
2 LORENZO
CONTER: atle-
ta di BRESCIA
una nostra ban-
diera (non per
niente era lui che
la portava, profe-
ticamente, nella
prima edizione dei nostri Campionati Italiani). Tre anni fa ha gareggiato nei Leggeri e si
classificato 3. Lanno scorso salito nei Medi, mantenendo il 3 posto (cosa che pu
essere difficile per chi fa un cambio di categoria). Questanno ha scalato classifica! Direi
che sei un Caterpillar. Mi sembri decisamente migliorato, pi pieno e addirittura anche
pi definito Bingo. Mi permetto di porre la tua attenzione sulla postura (hai un
atteggiamento leggermente chiuso in avanti) e sulla tua V-shape (deltoidi e dorsali da
curare) che ti possono penalizzare nella tua giustificata, e spero inarrestabile, ascesa!
3 MAURIZIO ROCCO: quest'ottimo atleta una nostra coerente conoscenza. Si
presenta sempre agguerrito e ben preparato con un upperbody che non lascia davvero a
bocca asciutta. Massoso al punto giusto, con il suo punto di forza nella qualit generale
(in realt "squartato" come si dice in gergo), cade un po' sulla massa delle cosce, belle
ma purtroppo un po vuote e non allaltezza del resto (round Massa e Simmetria non al
top). Sinceramente quest'anno mi sembrato di vedere appena un velo dacqua (solo
alla mattina) rispetto alla tua indiscutibile, ed eccezionale, preparazione qualitativa.
Assolutamente da sempre fra le migliori della gara. Sei di sicuro un grande, ma insisto
MEDI da 75 a 80 kg
CLASSIFICA CATEGORIA MEDI (da 75 a 80 kg)
1 ALBERTO GUIDI n.5 TORINO TO
2 LORENZO CONTER n.68 BRESCIA BS
3 MAURIZIO ROCCO n.26 TERRANUOVA B.NI AR
4 MILO FAINELLO n.43 VERONA VR
5 GABRIELE CALDIRONI n.67 MASSA FISCAGLIA FE
2 Lorenzo CONTER
3 Maurizio ROCCO
1 Alberto GUIDI
156 NATURAL BODYBUILDING
WWW. NBFI . I T
WWW. NBFI . I T
NATURAL BODYBUILDING 157
Alberto GUIDI
WWW. NBFI . I T
NATURAL BODYBUILDING 157
158 NATURAL BODYBUILDING
WWW. NBFI . I T
sul curare i tuoi punti carenti, questanno hai raggiunto il podio, ma perso una posizione
perch la lotta sempre pi dura Ma tu sai che sei qui per lottare!
4 MILO FAINELLO: questo atleta di VERONA (Tecnico FIN, FIPCF e NBFI, laureando
in Scienze Motorie, nonch mio carissimo amico) da sempre con noi. Disciplinato e ferreo,
dotato di unincrollabile volont di partecipare. La vittoria lo aspetta (ma non il suo
scopo prioritario). Nonostante la sua forma elegante e granitica (ha certamente le braccia
pi squartate dellintera serata e molti punti davvero da Top Level, presentati pure con una
routine originalissima su una difficile e divertente base musicale), sia in continuo migliora-
mento, deve combattere un destino avverso sia fuori che sul palco (basterebbero met
delle sue tante difficolt per non far, semplicemente, allenare un atleta motivato, ma nor-
male!). Ma, sono sicuro che sa bene cosa fare, perch lo ha
fatto e lo far ancora e che se, il suo straordi-
nario fisico, dovr affrontare mille batta-
glie e avversit non moller. Perch
lui Milo, ed nato per questo!
P.s. Il Bacio, che hai lanciato a fine
routine, alla tua piccolissima Noemi
(presente a vedere il suo gran pap,
dopo sfortunate vicende di salute), mi
ha stretto il muscolo pi importante (il
cuore).

5GABRIELE CALDIRONI: atle-
ta di MASSA FISCAGLIA, era in grado di
reggere confronti per la linea e la simme-
tria con moltissimi vincitori, anche di altre
categorie. Bello, elegante e proporzionato,
poteva essere addirittura sul podio e rappresentare senzaltro un esempio di atleta Natural. Tuttavia la sua con-
dizione (soprattutto intesa come Qualit Muscolare e poi Posing) era davvero poco evidente (quasi da fuori
Gara!). Permettimi Gabriele, lavora tanto su quella (e basta) per le prossime competizioni, davvero sei un ottimo
concorrente ed un peccato che perdi solo per questo No?
ALTRI PARTECIPANTI:
NICOLA PANNILUNGHI n.32:
questatleta di SANSEPOLCRO aveva una
bella linea, senza carenze notevoli, con
buone cosce muscolose e proporzionate.
Era ben evidente anche la parte supe-
riore, sopratutto per le masse, partico-
larmente sulla spalle e sul petto, ma
peccava un po di qualit e sullad-
dome. Sei dotato, vai cos.
IVANO CAPPELLETTI n.66:
atleta della provincia di COMO
elegante e longilineo, discreta-
mente simmetrico e prepara-
to, ma non allaltezza del
livello pi alto del palco di
questa serata. Complimenti,
comunque, anche perch
non mi sembri proprio un
ragazzino quindi insisti !
4 Milo FAINELLO
5 Gabriele CALDIRONI
MEDI da 75 a 80 kg
158 NATURAL BODYBUILDING
WWW. NBFI . I T
LORENZO
CONTER
WWW. NBFI . I T
NATURAL BODYBUILDING 159
Ci siamo. Questo il nostro bacino pi grande in termini di
masse generali. La categoria numerosa anche perch doppia,
raccoglie anche i pesi massimi (che non erano tanto numerosi
da costituirne una solo per loro).
Guardiamoceli senza paura, sono davvero natural.
1 FRANCESCO PALEARI: quest'atleta il mio preferito fra le new entry.
Appena apparso in scena ha dominato sui suoi giganteschi e preparatissimi com-
pagni di categoria. Ipergalattico. Squadrato, massoso, tirato e simmetrico, anche
esteticamente piacevole, non era proprio battibile. Avviso i lettori che in foto non
rende nemmeno la met (misteri della fotogenia). Lo sguardo sereno e sicuro
(forse quasi al limite del troppo sicuro) lasciava intravedere il pensiero e la cer-
tezza della vittoria. Indiscutibilmente un grande campione, con canoni estetici e
strutturali davvero al limite dellicona Natural che noi privilegiamo.

2 CHRISTIAN ANDREATTA: questo gigante muscolare il dinosauro
della nostra Federazione. Presente e sempre sul podio di ogni nostro Campionato
con prestazioni deccellenza (in ordine 2, 1 e 2) un vero Golem, Titano della
NBFI! Non ha punti carenti, eccelle in tutto tranne che nella forma estetica (molto
migliorata dal primo anno) e nella presenza scenica ( due anni che te lo consi-
glio: sorridi) giocatelo il palco, divertiti, osa sei un campione (puoi farlo,
con seriet, ma anche con un pizzico destro, no?). Ma, forse, per Te il NBB una
cosa seria (e seriosa) e lo anche per TUTTI noi (anche se sorridiamo o ridiamo) quindi, con questi piazzamenti!, continua cos.
3 FRANCESCO DI STEFANO: bellatleta, linea eccellente, bella presenza muscolare, meritevole in parecchie zone. Ad esempio con cosce davvero ben
tornite (veramente in
3D), sviluppate e com-
plete in ogni settore,
quasi da qualsiasi ango-
lazione. Direi ottima la
simmetria e molto
buona la condizione, un
po penalizzato nel
round massa da braccia
(lunghe da riempire) e
petto (ancora da ispes-
sire). Ci aspettiamo
grandi cose e molte le
hai gi fatte benissimo.
Comunque sei al top!
4 FRANCESCO
PIGNATTI: questo
massoso atleta non rie-
sce a schiodarsi dal 4
posto. Eppure notevo-
le. Ha volumi che non
sono nella norma, con
spessori davvero notevoli
e anche la linea non
MEDIO MASSIMI
da 80 a 86 kg
CLASSIFICA CATEGORIA MEDIOMASSIMI (da 80 a 86 kg)
1 FRANCESCO PALEARI n.9 TARANTO TA
2 CHRISTIAN ANDREATTA n.72 PIAZZE DI BEDOLLO TN
3 FRANCESCO DI STEFANO n.63 FIRENZE FI
4 FRANCESCO PIGNATTI n.57 FINALE EMILIA MO
5 ANDREA VASELLINI n.37 MILANO MI
2 Christian ANDREATTA
3 Francesco DI STEFANO
1 Francesco PALEARI
WWW. NBFI . I T
NATURAL BODYBUILDING 159
160 NATURAL BODYBUILDING
WWW. NBFI . I T
male. Vediamo di provare a capire perch non sali la classifica. Un consiglio: migliora la presentazione
(pose e qualit, soprattutto delle cosce: Round Condizione). Non c' due senza tre. Torna e distruggi!

5 ANDREA VASELLINI: ti ho fatto molti complimenti lanno scorso che ripeto, ovviamente,
anche questanno. Forma dei muscoli, aspetto generale, massa e simmetria ad un notevole livello.
Forse, come ti dicevo, puoi provare a lavorare di pi sulla qualit (il tuo preparatore la sa lunga su
questo) e sui tuoi pochissimi punti carenti in massa (tricipiti e polpacci?). Ma il punto un
altro. Gareggi nella categoria dei giganti. Per alcuni aspetti la pi dura. Chi riesce a costruire muscoli
per questa altezza e questa quantit, davvero un essere speciale. Capisci? Pur essendo migliorato,
non hai fatto quel balzo che da un giovane, COME TE, mi aspettavo. Qui, se rimani uguale o migliori
poco, perdi subito 2 posizioni. Ti avevo scritto: stupiscimi ricordi? Ora posso immaginare che un
ragazzone, come sei, in questepoca, sia gi raro che si dedichi ancora di pi alla difficile arte del
NBB ma voglio sperarlo. SEI IL NUOVO CHE AVANZA. NON FERMARTI. E voglio dirtelo ancora, anzi,
voglio urlartelo: ORA DEVI STUPIRMI!

ALTRI PARTECIPANTI:
WALTER ROSAT n.39: latleta di una delle zone pi belle dItalia (CLES), era perfetto come la
Natura dalle sue parti. Massa, simmetria e condizione ad un livello non criticabile. Bellissime le
forme dei tuoi massosi ed eleganti muscoli con una nota particolare alla simmetria notevole dei tuoi
addominali. La tua posizione non una tua colpa o carenza, solo dovuta a sottili differenze con i
tuoi avversari, che, stavolta per un soffio, hanno avuto la meglio. Occhio a curare alcune pose
(soprattutto di schiena). Consiglio: lanno prossimo, aspettali al varco. Potresti sorprenderli (come se
il tuo famoso lago tornasse rosso!).
VALERIO VESCOVO n.40: ho avuto il piacere di conoscerti (in un luogo non cos piacevole), ed
ho apprezzato il tuo comportamento, insieme a quello di altri atleti (che dovevano rifare la raccolta
per il test delle urine). Sul palco ho potuto apprezzare anche la tua preparazione e lottima forma
che presentavi. Nonostante meriti i miei complimenti per lottimo lavoro fatto, hai certamente gi
capito che il livello era davvero elevato e difficile da raggiungere. Ma non sei affatto lontano
insisti, perch sei gi arrivato a poca distanza dal top.
CORRADO BONOMO n.41: Ho un debole per questo roccioso e squadrato atleta, dato dal
fatto che siamo quasi coetanei e che mi ricorda due miei eroi cinematografici (in antitesi, Stallone e
Tot). Ma questanno non era nella sua condizione migliore, ma so che ha avuto poco tempo per
prepararsi e che torner a stupirci. Ci conto.
PAOLO DI SIMINE n.44: ti parlo diretto. Buono il tronco e
fantastica la massa delle cosce. Ma la penalizzazione nel
round Simmetria. Sei lunico Natural ad avere la parte inferio-
re troppo grossa per quella superiore ed inoltre, davvero
NON in condizione da gara devi lavorare parecchio su questo
punto (e sullequilibrio delle forme in generale). Notevole la pos-
sanza della struttura, ma il NBB non solo questo. Ora model-
lala, scolpiscila e abbelliscila per i canoni necessari alla Sta-
tua Natural che vogliamo sul palco.
MASSIMILIANO PICARIELLO n.46: uno dei nostri
atleti migliori, un 1 ed un 2 posto ai precedenti cam-
pionati (e anche uno dei miei preferiti) questanno ha
fatto il pregara, ma non si presentato allo Show
serale. Mi spiace. Non eri nella tua solita forma, vero,
ma avresti fatto un ottimo spettacolo lo stesso. Comun-
que ti capisco e ti rispetto davvero molto per questo (un
campione non si pu accontentare). Ti aspettiamo anche
lanno prossimo e davvero ti vogliamo rivedere al tuo TOP di sempre nella sfida finale.
ANTONIO PAGLIUCA n.62: bellatleta, longilineo ed elegante, con braccia fantastiche e voluminose, che circon-
dano un petto pieno e degli ottimi addominali. Peccato per alcune zone un po' carenti che minavano il Round Massa e
pure quello della Simmetria Ma credo che CAVA DE TIRRENI possa apprezzare il tuo ritorno.
MARCELLO VACCARO n.70: apprezzo la voglia di gareggiare, per una forma quasi discreta; buono il petto, ma sei
ancora lontano dalla media dei partecipanti. Hai molto da lavorare su tutti i tre i nostri parametri di giudizio. Hai una forte
penalizzazione nella struttura (larghezza biacromiale e bacino), ma non puoi farci niente. Ma per il resto daccene!
MEDIOMASSIMI da 80 a 86 kg
4 Francesco PIGNATTI
5 Andrea VASELLINI
avu pppppoco
160 NATURAL BODYBUILDING
WWW. NBFI . I T
CHRISTIAN
ANDREATTA
WWW. NBFI . I T
NATURAL BODYBUILDING 161
Francesco PALEARI
WWW. NBFI . I T
NATURAL BODYBUILDING 161
162 NATURAL BODYBUILDING
WWW. NBFI . I T
Fantastici! Sono arrivati i LEONI DEL TEMPO come li ha definiti
(ma non ce nera bisogno, erano gi definiti abbastanza) il nostro
super presentatore Matteo Guida. Mamma come li invidio. Sono a
2 anni da loro e, una parte di me, vorrebbe avere il tempo per
(ma ora che son giudice non posso pi. Comunque non si sa mai
magari a 55) unesibizione!
1 GIOVANNI PELLERITI: quest'uomo un GIGANTE di simpatia e genialit.
La sua piccola struttura, brevilinea, scoppiava di muscoli (soprattutto le braccia),
come lui di simpatia, ma era anche molto in condizione da gara. Schiena con pelle a
carta velina, vena enorme sul bicipite, visibile fino al deltoide, tutto con pochissima
acqua addosso (davvero estremamente tirato). Eccellente. Tuttavia, senza nulla toglie-
re al suo fisico stratosferico e granitico, ci che pi meritava era la sua routine. Se era
originale, come credo, fattelo dire: SEI UN GENIO (paragonabile a Chaplin o Keaton).
Se ti sei ispirato, beh, sei un MIMO e un attore pazzesco! Spero vada su YouTube, letto-
ri, cercatela. Vale tutta la serata!
Vinci il premio: BEST ACTOR & SHOWMAN NBFI (a parimerito con Guida!).
2 NICOLINO GARAU: alla faccia del Nicolino, sei come Giovannino (Little
John) di Sherwood! Questo colossale atleta aveva massa e qualit da vendere (addo-
me da urlo). Peccato per la simmetria. Quella s, era un po carente. Ma se avessi avuto
il resto (arti superiori, ma sopratutto inferiori) come il tronco, beh, rischiavi il podio,
ma degli assoluti! Comunque, anche per questo i miei pi grandi complimenti.
Vinci il premio: IL PI GROSSO DELLA FORESTA DI SHERWOOD NBFI!
3 MARINO MACCHIO: Questo era l'atleta pi "vecchio" sul palco. Ma alla faccia del vecchio Sei il mio mito assoluto. Obiettivo per TUTTI noi. Spalle
larghe e V-shape
da strapparsi i
capelli. Peccavi un
po' di "qualit" ma
che cavolo, a 61
anni sembravi
coetaneo degli
altri e avevate tutti
un fisico da tren-
tenne ben pale-
strato. Compli-
menti a TUTTI. Ma
tu, vinci il premio:
HIGHLANDER NBFI!
OVER 50 sopra 50 anni
CLASSIFICA CATEGORIA OVER 50 (sopra 50 anni)

1 GIOVANNI PELLERITI n.19 VALPERGA TO
2 NICOLINO GARAU n.11 NARCAO CI
3 MARINO MACCHIO n.8 S.GIOVANNI V.NO AR
2 Nicolino GARAU 3 Marino MACCHIO
1 Giovanni PELLERITI
162 NATURAL BODYBUILDING
WWW. NBFI . I T
WWW. NBFI . I T
NATURAL BODYBUILDING 163
Giovanni PELLERITI
WWW. NBFI . I T
NATURAL BODYBUILDING 163
164 NATURAL BODYBUILDING
WWW. NBFI . I T
Beh, dopo tutti questi ragazzoni, un break femminile di
classe, solleva lo spirito del pubblico maschile e stimola lamor
proprio di quello femminile che finalmente possono ispirarsi,
senza continuare a credere che il Bodybuilding Natural femmi-
nile, sia poco femminile. Ho mai detto femminile? S, perch
scherzosamente, credo che sia ancora il caso di calcare la mano
sul termine femminile!
Purtroppo le nostre donne sono ancora poche, ma la batta-
glia qui, non solo contro il Doping, ma contro altre forme di
ignoranza italian popular, credenze e luoghi comuni, duri a
morire (ma quando sono nati?), eppure le statue femminili piac-
ciono ed esistono da millenni Mah!??
e noi, in pi, le abbiamo VIVENTI !
Eccole, le nostre donne (davvero molto):
1 ANNALISA GHIROTTI: latleta (docente, Architetto, Personal Trai-
ner) alla sua seconda esperienza assoluta ed alla sua prima vittoria Com-
plimenti campionessa! Posso, quindi, confessare, una volta in pi, la mia amici-
zia e stima e assumermi anche la responsabilit di farle i meritati complimenti
per iscritto (di persona, questanno, non abbiamo avuto tanto tempo). Il suo
noto preparatore ha compiuto ancora i suoi prodigi, ma scusa, Luigi, se scherzo:
Con una tosta come lei, il tuo difficile compito stato troppo facilitato o no?.
Annalisa ha una linea straordinariamente femminile ed dotata di una sinuosit e
flessibilit delle movenze, assolutamente fuori dal comune. Quest'anno curate poi,
pi dello scorso, con una coreografia della routine libera, originale, divertente,
ammiccante e sexy al punto giusto. Muscoli, equilibrio, grazia, eleganza tanta da
far fatica a distogliere lo sguardo. Se aggiungiamo una qualit muscolare e una
simmetria, curata alla perfezione, su muscoli lunghi, affusolati, piacevoli, ma ben
squadrati e rilevati da allenamenti veri, duri e mirati beh, la definirei: ipnotica.
Quando lascia il palco, ogni sguardo la segue fino alle quinte (e, dopo, non si pu
non avvertire un senso di "vuoto")! Sinceramente, il mix che offri davvero
entusiasmante. Se ti disegnassi non potrei fare di meglio. Splendida. Torna ancora
e lotta per il NBB Femminile con noi, sei una vincente!
2 KETA DARCANGELO: questa ragazza aveva unenergia veramente parti-
colare. Oserei dire: magica. La presenza scenica era decisamente cinematografica.
Non ti conosco, ma permettimi di darti del tu. Sembravi uscita da un film fantasy
neoclassico, avevi uno stile regale da Regina di Atlantide(ottima anche la scelta
del costume). Le forme equilibrate e modellate dal lavoro con i pesi, avevano conno-
tazioni straordinariamente estetiche e sensuali. Mi hai colpito parecchio anche per la
corretta presenza sul palco che era davvero di gran classe. Equilibrio e forme toniche,
eleganti e perfette. Davvero ben curata e molto dotata. Ottima posatrice, sei stata
ad un soffio dalla vittoria (e con una tale avversaria questo la dice lunga).
Lavora un po' di pi sulla qualit e sulla schiena e minaccerai pericolosamente
la mia Campionessa preferita ma attenta, lei non riposer sugli allori! Noi tutti ti
aspettiamo lanno prossimo, per stimolare ancora il miglioramento del NBB femmi-
nile. Sono sicuro che tu abbia ispirato molte donne presenti e DEVI continuare a
Ms. FIT BODY
CLASSIFICA CATEGORIA MS. FIT BODY

1 ANNALISA GHIROTTI n.7 CESENA FC
2 KETA D'ARCANGELO n.2 MONTESILVANO PE
3 LAURA FRANCESCHINI n.4 SESTRI LEVANTE GE
4 LAURA FACCHINI n.3 GABICCE MARE PU
2 Keta D'ARCANGELO
1 Annalisa GHIROTTI
164 NATURAL BODYBUILDING
WWW. NBFI . I T
WWW. NBFI . I T
NATURAL BODYBUILDING 165
Annalisa GHIROTTI
WWW. NBFI . I T
NATURAL BODYBUILDING 165
166 NATURAL BODYBUILDING
WWW. NBFI . I T
farlo con noi, in modo
naturale, cos come ti
viene, senza forzature
e con la classe che ti
propria.
3 LAURA
FRANCESCHINI:
la tua ottima presenza
sul palco, la padro-
nanza delle tue pose,
la naturalezza e sim-
patia con cui presen-
tavi il lavoro, serio,
svolto da anni, era
evidente. Complimenti
anche per la sensuali-
t ed eleganza che hai
espresso con i passi di
danza (un connubio
sempre vincente su
una donna che fa
Bodybuilding!). La tua
V-shape era stratosfe-
rica da dietro (com-
plessivamente il tuo
back era quasi da prima in classifica!). Ma la tua esperienza, penso, ti abbia fatto notare che, rispetto alle due concorrenti prima di te, eri un po carente della
"qualit" che entrambe avevano molto pi curato nel complesso, ma soprattutto davanti. Un particolare davvero rilevante sul tuo corpo notevole (ben sviluppato
e anche simmetrico), soprattutto per risultare pericolosa per loro. Un tuo punto davvero debole sono gli addominali. Sarei davvero curioso di vedere cosa succede
se li migliori e ti tiri ancora un po' potresti essere davvero molto pericolosa e la gara, next year, sarebbe decisamente ancora pi infuocata!!! Hai tutto il mio
appoggio su questa via, naturalmente.
4 LAURA FACCHINI: Laura
devessere un nome che va forte
nella nostra disciplina! Questa
splendida e giovanissima ragazza
di GABICCE MARE, davvero stupiva.
Stupiva perch nel nostro molle
mondo moderno una ragazza
cos, giovane e bella, che capisce il
valore del NBB una speranza.
Stupiva la sua composta presenza
che, per, emanava un piacevole
mix di timidezza e sicurezza (lan-
no prossimo aumenterai la secon-
da e il NBB laumenter anche
nella tua vita fidati). Stupiva la
tua schiena, davvero ben lavorata
e proporzionata. Brava! Consiglio
finale: cura di pi la qualit
muscolare e diverrai gradual-
mente unavversaria sempre pi
dura da battere. Sei una vera pro-
messa. Non mollare. Nel comples-
so, da subito per me, sei assoluta-
mente approvata come nostra
Icona di Giovanissima ragazza
NBFI! La nostra pi giovane e bella
promessa, naturalmente.
3 Laura FRANCESCHINI 4 Laura FACCHINI
Ms. FIT BODY
166 NATURAL BODYBUILDING
WWW. NBFI . I T
WWW. NBFI . I T
NATURAL BODYBUILDING 167 WWW. NBFI . I T
NATURAL BODYBUILDING 167
SPLENDIDE RAGAZZE! IL GRUPPO DELLE ATLETE CON MELISSA KELLEY
168 NATURAL BODYBUILDING
WWW. NBFI . I T
Ospite d'onore
Melissa
Kelley
168 NATURAL BODYBUILDING
WWW. NBFI . I T
Melissa Kelley Prima classificata
categoria basse figure 2009 WNBF
Pro American Championships.
Melissa stata l'ospite
femminile della gara e
si presentata in
ottima forma,
esibendosi in una
routine energica e
atletica. Nella foto in
basso, riceve una targa
ricordo dal presidente
NBFI Sandro Ciccarelli.
WWW. NBFI . I T
NATURAL BODYBUILDING 169
Ospite d'onore
Gerardo Di
Gennaro
WWW. NBFI . I T
NATURAL BODYBUILDING 169
Il nostro Gerardo Di Gennaro,
Campione italiano assoluto NBFI
negli anni 2009 e 2010, sesto
classificato ai mondiali WNBF Pro
di New York nel 2010.
Gennaro stato
l'ospite maschile
della gara e si
presentato in forma,
nonostante i
notevoli impegni
lavorativi. Nella foto
in basso, riceve una
targa ricordo dal
presidente NBFI
Sandro Ciccarelli.
170 NATURAL BODYBUILDING
WWW. NBFI . I T
E siamo arrivati alla fine... o quasi.
Gli atleti arrivati qui, non sono pi tali. SONO TUTTI CAMPIONI,
vincitori della loro categoria.
NIENTE PI COMMENTI. APPREZZATE LE FOTO e sappiate che
stata durissima per noi Giudici. Ci siamo consultati al capello
spaccato in 18 minuziosamente. Abbiamo chiesto aiuto anche
al nostro Presidente. La differenza stata minima. Fra i primi due,
solo le pose di schiena permettevano una minima scelta giustifi-
cata che non fosse lexequo. Alla fine stata premiata anche la
fiducia sullatleta pi noto, che per tre anni si sottoposto ai
nostri controlli, ha lottato al nostro fianco e meritava di vincere
anche solo per questo.
CLASSIFICA ASSOLUTO
1 LEONARDO CASAGRANDE n.54 GUBBIO PG
2 FRANCESCO PALEARI n.9 TARANTO TA
3 ENZO NARDINO n.61 SAN SEVERO FG
4 ALBERTO GUIDI n.5 TORINO TO
ASSOLUTO
170 NATURAL BODYBUILDING
WWW. NBFI . I T
1
Leonardo CASAGRANDE
WWW. NBFI . I T
NATURAL BODYBUILDING 171
A dire il vero,
Leonardo qui
non ha trovato
avversari
2 OLIVER
BAUER: pi alto
e possente dei suoi
compagni, anche ben
condizionato, ma
penalizzato dal
Round Simmetria.
Proveniente
da HEILBROON,
GERMANIA.
3 FABIO ORFEO: simmetrico, preparato, ma non
di grandi volumi, molto piacevole. Proveniente
da RIAZZINO, SVIZZERA.
2 Oliver BAUER
3 Fabio ORFEO
1 Leonardo CASAGRANDE
WWW. NBFI . I T
NATURAL BODYBUILDING 171
CLASSIFICA SELEZIONE CAMPIONATO MONDIALE WNBF
1 LEONARDO CASAGRANDE n.54 GUBBIO ITALIA
2 OLIVER BAUER n.18 HEILBROON GERMANIA
3 FABIO ORFEO n.16 RIAZZINO SVIZZERA
SELEZIONE CAMPIONATO
MONDIALE WNBF
172 NATURAL BODYBUILDING
WWW. NBFI . I T
CRITERI DI GIUDIZIO, LAVORO DEI GIUDICI
Pu nascere la domanda: come ci organizziamo per giudi-
care? La decennale esperienza di palco di molti di noi o gli
studi o la passione non sono una garanzia assoluta di capa-
cit di giudizio corretto. Dopo il corso che ci ha qualificato
e uniformato, sotto la guida del Presidente tedesco GNBF,
Berend Breitenstein, ben tre anni fa, noi giudici (Docenti,
Esperti e Agonisti di settore)
facciamo sempre una riunio-
ne annuale Pre Gara (il giorno
prima). Questa per aggiorna-
re, revisionare e controllare i
criteri NBFI e le direttive
internazionali.
Comunque, anche se sta-
biliamo criteri generali a prio-
ri, quando votiamo, non sem-
pre possiamo confrontarci, in diretta, su tutti gli atleti e con tutti i giudici, quindi la libert
individuale sempre garantita e cos le sorprese... anche se il Capo Giuria o il nostro Presiden-
te, sono sempre pronti e disponibili a supervisionare e controllare il nostro operato.
S. Voi che state sfogliando e guardando le foto, ma che non
avete mai letto di una gara cos grande (questi sono Campio-
nati Italiani!) e mai provato lemozione di vederla (dovete
venire a vedere cosa pu fare lallenamento con i pesi e una-
vanzata alimentazione, senza alcun uso di sostanze illegali e
dannose).
Questo specchietto per voi, e per tutti quelli che non
hanno mai capito, bene, questo tipo di gara. Quelli che non
sanno che , da una parte, un indiscutibile evento particolare,
ma che, dallaltra, ha diverse valenze di carattere generale e
universale. Quelli che farebbero molte e diverse domande,
adesso avranno molte risposte.
Cercher, come posso, di dare il senso pi profondo, del
suo perch, anche a tutti loro. E, magari, lanno prossimo
sarete l, anche voi (con loro), a capire i costi e le fatiche di
questi atleti, e a tifare, tutti insieme questi uomini straordina-
ri, questi esempi di dove pu arrivare il limite umano nella
costruzione del proprio corpo.
POI POTETE ENTRARE NEL
VIVO CON GLI APPASSIONATI
E LEGGERE IL RESTO.
Per i neofiti: tanti perch... una sola
risposta!
In realt, pochi ci capiscono davvero fino in fondo (anche SE
le palestre si stanno riempiendo sempre pi). In molti
fanno domande, per noi banali. Proviamo, allora, a vederne
qualcuna.
> Perch mangiare non per il gusto, ma misurando, pesan-
do e scegliendo anche lacqua?
> Perch evitare dispersioni inutili di energia (tipo le lun-
ghe passeggiate per le vetrine del centro), ma mettercela
tutta in sala pesi per allenarsi tanto duramente?
> Perch restare disidratati, affamati, concentrati posando
per ore?
> Perch mostrare muscoli straordinari che nessun atleta
Spieghiamo
il N.B.B. (solo PER I LETTORI neofiti)
L
Gabriele Tampellini,
presidente di giuria
I giudici: (da sx) Augusto Priami, Roberto Del Gaudio, Sauro Ciccarelli, Pasquale Cozza, Luca Alfonsi, Andrea Bonciani, Carlo Buzzichelli, Marco Pesciolini
Il giudice Jim Charlie
con Marco Pesciolini
WWW. NBFI . I T
NATURAL BODYBUILDING 173
possiede e non fare nulla (niente prove di forza, nemme-
no sollevare o spezzare o rompere, neanche correre o saltare
o lanciare)?
> Perch salire su un palco, solo con un costume, davanti a
centinaia di persone?
> Perch trasformare il proprio corpo in una muscolosa
statua vivente?
In conclusione: perch essere tanto diversi dagli altri?
Forse per essere unici?
Le ragioni sono tante e profonde (alcune, addirittura,
insite nel nostro DNA). Ve ne voglio presentare alcune.
Alla fine non sarete esperti, ma capirete meglio questi Super-
man e, magari, ne sarete attratti
Proviamo ad aprire la mente
per cambiare in meglio il nostro corpo!
Ecco un classico luogo comune, sintetizzato in questa frase
frequente: Io sto bene cos. Perch dovrei cambiare?. Perch
succeder comunque ma non so SE ti piacer
In questo mondo veloce, fatto di spot, user slogan per
dire delle cose. Se fossi Bob Dylan, direi: Perch niente pi
certo del cambiamento. Se fossi Paris Hilton, direi: Meglio
cambiare no? Se fossi un filosofo delle pubblicit, unirei i due
Spot e concluderei: Se cambiare certo e meglio, lo far
scegliendo COME!.
Personalmente uso prevalentemente i pesi (con un po di
Kettlebell e di LYWC, Kung Fu). Lo scopo sopravvivere alla
vecchiaia e alla debolezza dei tempi.
La risposta ai tanti perch una. Semplice. Breve. Logica.
PER SFIDARMI AD ESSERE IL MEGLIO DI ME STESSO.
Accetta la sfida.
Noi ti stimoliamo e te ne diamo
la possibilit.
Se le foto che vedi ti hanno stimolato, da domani prova ad
allenarti DAVVERO (non solo parlottando in palestra). Fallo
in modo positivo e propositivo (non pensare: Tanto per stare
in forma ma pensa: Per raggiungere il MEGLIO della mia
Forma!).
Prova a mangiare con un SENSO (non intendo il
gusto o lolfatto ma un altro senso quello logico!).
Prova ad usare regolarmente inte-
gratori veri, studiati e selezionati
(non temerli o non farti attrarre
solo da quelli con il miglior
packaging).
Prova a CREDERCI e ad
informarti COME si fa
veramente.
Scegli persone compe-
tenti. Naturali. Affidabili. Cer-
cale. Sono poche, ma ci sono.
RISPETTO GENERALE E
RINGRAZIAMENTI FINALI
Dopo tre anni voglio ringraziare atleti e
preparatori, per come si comportano
con noi, la correttezza nel rispettare il
giudizio e nelluniformarsi tanto corret-
tamente con i criteri
per guidare la prepa-
razione. Il rispetto
per latleta per noi
sacro, ma anche i
Giudici sentono
questo rispetto e
vi ringraziano.
ente inte
ionati
rre
r
Il Cinema teatro
Salsiani, location
della gara
Il pregara...
Ultimi ritocchi prima di salire sul palco...
l'operazione di "mallatura" una delle fasi
pi delicate e importanti della gara.
174 NATURAL BODYBUILDING
WWW. NBFI . I T
E fallo adesso! Quante vite pensi di avere? Lo dico perch
la Nostra NBFI si impegna tanto anche in questo. Con corsi
specifici (di diverso livello), tutti molto approfonditi e con
decine di docenti, altamente qualificati (provenienti, come i
corsisti, da tutta Italia), forma, annualmente, istruttori, allena-
tori e Personal Trainer, veramente appassionati e tanto com-
petenti quanto Naturali!
Molti di loro (docenti, ma anche qualche Personal NBFI)
scrivono per questa rivista ed alcuni erano l, anche fra i giu-
dici, gli organizzatori (o il pubblico). Stiamo cercando di
costruire, da anni, un gruppo saldo e fedele alla missione. E il
nostro sodalizio (pi che decennale per alcuni, e minimo
quinquennale per altri) ne la prova. Questa non pubblicit
vana o interessata. Ma lessenza della nostra Missione Fede-
rale: la lotta al Doping che diffuso dallignoranza!
Se il pubblico, quindi il lettore, legge questo, poi viene
alle gare e vede pu liberarsi dai luoghi comuni, radicati
nellignoranza, che racconta favole per minare le volont e
sviluppare lo spaccio illegale del Doping (in quello che, una
volta, era la nostra sana comunit del muscolo e che, adesso,
deve tornare tale).
Ora che seguite il meccanismo, non pi difficile da
capire se continuerete a leggere.
Perch il NBB cos
diverso da altri
sport?
Intanto PERCH, il Natural
Bodybuilding, molto pi
una DISCIPLINA, che non uno
SPORT (se vi sfugge vedere
la differenza su un vocabola-
rio). Poi perch, per valutarla bene, dobbiamo uscire dalla
classica ottica sportiva-prestazionale (misuro, vedo, crono-
metro, peso poi gioisco!) ed entrare in quella artistica pre-
stazionale che, in gara, si occupa non tanto di quello che fa,
ma MOLTO di quello che si VEDE del corpo del protagoni-
sta (vedere nellepoca del 3D non poco e, davvero, lo
spettacolo tutto in 3D).
Cosa si cerca nella gara
Il giudice, in modo freddo e tecnico, e il pubblico, in modo
istintivo e passionale, viene coinvolto e stimolato dal risultato
finale: la modifica creata dal nostro corpo (guardo lopera
darte, vedo TUTTO il lavoro che stato fatto, lo valuto e mi
emoziono!).
importante sottolineare DAL e non SUL nostro corpo.
Perch il corpo pu essere cambiato da stimoli esterni
(allenamento e alimentazione) solo se prima cambia dallin-
terno (mente e metabolismo)! E dopo, tutto questo, pu
passare allesterno (muscoli e grasso) in funzione di quello
che abbiamo (genetica) o cerchiamo, provando (ricerca) e
studiando il settore (cultura fisica).
Ma solo accettando le regole della sfida senza barare
(restando naturali) che, alla fine, possiamo salire su questo
palco (Natural Bodybuilding Federation Italy).
Veloce sguardo alle regole
I round che gli atleti affrontano per il punteggio sono tre:
Simmetria, Massa e Condizione.
Sinteticamente:
1) Simmetria = sviluppo proporzionato a 360 del
corpo in ogni zona, e fra queste e le altre (lato sini-
stro e destro, alto e basso, davanti e dietro);
Ringraziamo gli
sponsor, che per-
mettono tutto
questo, con la loro
costante presenza
e, questanno,
hanno pensato
bene di creare
un momento di
attenzione e
informazione
sui loro prodotti
(per me molto
pi gradito delle
solite pubblicit).
capire s
Pe
d
u
SP
la
WWW. NBFI . I T
NATURAL BODYBUILDING 175
2) Massa o Muscolarit = sviluppo massimo possibi-
le senza grasso e senza perdere proporzioni esteti-
che e forma atletica di tutto il corpo (Superman
vince contro Hulk).
3) Condizione = complesso mix fra forma, definizio-
ne e funzionalit che latleta mostra in equilibrio
insieme al resto secondo i canoni stabiliti dal con-
cetto di emblema del Natural (eleganza, forza,
equilibrio pi un vero guerriero che non un
pupazzone!).
Perch diverso dallo sport
Perch lo Sport usare luomo come mezzo per un fine, la
Prestazione. Luomo dello sport cambia la propria struttura e
si allena per FARE qualcosa.
Se sviluppare gambe immense e alleggerire il tronco va
bene per il pattinaggio, ecco che luomo si inchiner alla
richiesta prestazionale sportiva (ma non ci si preoccupa per
questo, o per le NOTE asimmetrie create dal Tennis o dal Cicli-
smo o dal Getto del Peso o dalla Boxe o dal Calcio o dal Canot-
taggio continuo??? Ma, per fortuna, ora, sono tutte conte-
nute dallequilibrio dato dalluso dei pesi nella preparazione
atletica e gi Noi siamo ancora QUA!)!
Luomo stato usato ma nessuno grida allo scandalo
(o ci ringrazia) anzi.
Ora, attenzione, non sto esprimendo un giudizio, sia chia-
ro che non sono CONTRO lo Sport (sono anche un professore
di Educazione Fisica non potrei). Qui non parlo di benefici
(o dei deterioramenti), legati alla modificata morfologia.
solo un dato di fatto.
Sport = strumentalizzazione delluomo per un record. Ed ogni
Sport strumentalizza in modo assolutamente specifico.
Qui, la nostra disciplina, usa come mezzo varie cose
(pesi, dieta, integratori, allenamenti aerobici) per arrivare
a trasformare luomo nel suo aspetto! Questa fondamen-
talmente la nostra diversit dallo Sport lo scopo finale
siamo Noi (perch sono IO la prestazione).
Non essendoci strumentalizzazione finalizzata a, ma
benefici fisici e funzionali generali, il NBB diven-
tato la BASE vera di TUTTI gli Sport! Che poi
questa modifica strutturale piaccia o sia
giusta o sempre corretta o funzionale, non
largomento di questa parte (ma non vi
dubbio che, se ben fatta, non d mai
problemi anzi!!!).
Certo , che ci che viene crea-
to nel nostro ambiente (e nello
sport) dallaggiunta di Doping,
non solo mostruoso da vedere,
ma scorretto e nocivo, quindi
assolutamente da combattere!
Allora siamo
lantisport e contro
lo sport?
Ma che sciocchezze! Cosa vuol dire? Se
mangio una pera (frutta fresca) vuol dire
che odio le mandorle (frutta secca)?
Mi sembra un non sense, frutto
solo di una manovra politicizzata. Perch
pu far comodo vederci diversi dagli
altri sportivi separati, strani, ano-
mali (magari per distrarre da loro e
accollare a noi completamente lo
scandalo del doping).
XXXXXX
OLYMPIANSTORE.IT
Che poi
a o sia
, non
n vi
mai
Se
dire
tto
rch
li
176 NATURAL BODYBUILDING
WWW. NBFI . I T
Poi, qualcuno predilige il NBB allo Sport! Scandaloso? Non
cos tanto se si pensa che lo SPORT stupendo, ma traumatico
per definizione e limitato nel tempo, con poche eccezioni, per
la quasi totalit delle proprie manifestazioni agonistiche di
buon livello (spesso a 25 anni si gi vecchi sono un ex
sportivo lo so BENE!).
Altri dicono che lo sport fatto in un'et dove facile
farlo ad orari stabiliti e regolari (poi la vita decide sulla tua
libert e la palestra sempre aperta e se ne frega anche del
clima). Altri, ancora, dicono che molto del moderno sport
corrotto (fra direttori di gara, allenatori, presi-
denti per scommesse e altro, dura dire di no,
per difenderlo). Ma non voglio polemizzare. Di
certo non siamo Noi contro gli altri, ma CON
gli altri. Infatti faccio ancora sport per
hobby (che gioco di parole assurdo).
Ma c anche dellaltro (lo sport ci
usa per migliorarsi quindi???). Molto
altro (i medici ci usano per riabilitare
quindi???). Siamo il rifugio di tutti, anche
degli ex sportivi (contro il logorio della
vita moderna e la troppa pace del diva-
no di casa allora?). Vedete che siamo
CON lo Sport?
Ancora contro di noi
Ma i detrattori, invece, dicono che:
a) i muscoli non piacciono e sono per gli
ignoranti!
b) che i nostri atleti sono inutili narcisisti;
c) che sono tutti dopati;
d) che usano integratori dannosi;
e) e che non ha senso tutto questo ad una certa et.
Non voglio essere polemico. Ma informare. E, credetemi, non
sar di parte. Sono un docente, uno sportivo e anche un giu-
dice, ma, da anni, non un atleta agonista questo mi rende
multiangolare ed equilibrato ( spero).
Sar lapidario. Mi rifar a Socrate (un famoso vecchio
ignorante) che disse: una vergogna invecchiare senza vedere
la forza e la bellezza di cui il nostro corpo capace!.
Potrebbe bastare. Ma vado oltre. E rispondo in ordine.
A) I muscoli devono piacere a chi li sviluppa e ai suoi
simili (come i tattoo, il piercing e mille altre cose che cambia-
no laspetto viva la libert). Vi assicuro che c chi impazzi-
sce per loro veramente. Ma, stavolta, paragonati alle altre
scelte, i muscoli cambiano tanto anche la funzione (forza,
velocit, potenza e di conseguenza salute e longevit) del
corpo e non solo lestetica!
B) Il primo punto scritto risponde gi alla presunta inuti-
lit. Un muscolo non pu mai essere inutile (lallenamento
specifico lo rende pi adatto ad una prestazione o ad unaltra.
Chi critica gli sprinters perch si fermano dopo solo 100 m o
i nuotatori perch non sciano bene o i WeightLifter perch
non si arrampicano?). Questo ci renderebbe narcisi o vanesi?
Solo Noi? In questepoca, (di creme e silicone) quanto mai
smodata chirurgicamente ed esteticamente appariscente (da
Look Maniac), poi folle .
Allora, sollevate un peso con uniniezione di botulino o
FATE qualsiasi altra cosa, se potete (tipo corrugare la fronte
o unespressione furba Oppure migliorate la forza del petto
con la chirurgia estetica). Allora chi pi VANESIO? (da
VANO = INUTILE!).
C) Questa una Gara Natural, vuol dire SENZA Doping!
Noi facciamo ben due test per garantirlo: poligrafo (macchina
della verit) e urine! Perch, allora, il Bodybuilding stato
tacciato da sempre di questo? Perch questa la sua piaga (s,
Voglio ringraziare colui che
dietro le quinte si interfaccia con tutti
gli atleti, tutti i tecnici (audio, luci, com-
puter), il presentatore, noi e il palco.
Un lavoraccio organizzato al minuto
dal grande (in tutti i sensi quasi 2 m)
Kristian Montevecchi (Docente,
Tecnico e PT IART e NBFI II livello,
Articolista Olympian's e molto altro
ancora), infaticabile e precisissimo...
una colonna portante!
176 NATURA
dent
per
cert
gli a
ho
M
ign
d
e) e che
Lo stress pre-gara...
completamente
esauriti!!!
Kristian con Melissa
Sara, splendida
valletta della
manifestazione
WWW. NBFI . I T
NATURAL BODYBUILDING 177
lo so, che siamo in buona, e sportiva, compagnia, ma adesso
non ho voglia di scaricare il barile, ma di pulirlo!). Noi siamo
fra i pochi che controllano DAVVERO i propri atleti! Facile
risultare pulito senza controlli
Noi, SIAMO NATI PER QUESTO (Natural Bodybuilding &
Fitness Italy, lo dice forte e chiaro!), perch non sempre sod-
disfatti del lavoro, difficile, svolto da altri seri colleghi. Anche
il nostro perfettibile, ma ce la mettiamo tutta, anche come
CRITERI di valutazione dei vincitori (ad esempio privilegiamo
la linea alla massa mostruosa o il tiratissimo al culturista diu-
reticizzato).
D) Gli integratori sono nutrienti naturali che potenziano
la salute e la prestazione! Non avrebbe alcun senso il contra-
rio. Ora, infatti, li vendono ovunque, per ogni cosa e proprio
per TUTTI (su, non fate finta, ancora, di NON saperlo che vi
riempite di Antiaging, Guaran e Ginseng e date vitamine ai
figli e ai nonni).
E) Il senso alto, atavico, la rinascita universale
dellUomo. Esagero? Chi stato rappresentato dallarte, nei
secoli, quando QUESTA cercava di stupire con lestrema perfe-
zione della bellezza umana (forma)? Qualera il fisico dei
migliori guerrieri di ogni tempo (funzione)? E delle migliori
guardie del corpo moderne (protezione)? E che fisico hanno i
Super Eroi (ideale)? E i giocattoli dei bambini (fantasia)?
Da sempre gli uomini che vi danno sicurezza, senso della
disciplina, rettitudine, forza morale come sono fatti??? Asso-
migliano ad uomini comuni (o ai politici) o ai Bodybuilder Natu-
rali? I Romani dicevano: Ci che vedi ci che sei quindi
Noi abbiamo il fisico dellEroe... vuol dire qualcosa (certo,
c a chi non piace e tifa Woody Allen perch fa ridere)!
Vado al punto
Forse non ho esagerato. Se fanno leva sui bambini, che sono
puri e semplici, non ancora tanto condizionati da mode o
altro forse il valore ATAVICO, profondo e pi alto di quello
che perdiamo non praticandolo o considerandolo!
Let, per avanza. E allora? Invecchiando si diventa
saggi. Per farlo bisogna, per, essere longevi. Per essere longe-
vi e migliorare la qualit della vita cosa facciamo? Fumiamo,
mangiamo ci che piace, oziamo, ci occupiamo del futile e
delle mode? O ci occupiamo di Noi? E COME ? Beh, il modo
migliore certamente aumentare il sapere (ma i miei colleghi
professori non sono poi tutti cos in forma il sapere deve
essere indirizzato bene). La vera Cultura che non sterile gin-
nastica nozionistica e mnemonica RICERCA, APPROFON-
DIMENTO, SCELTA! Lavoro facile per molti o difficile per pochi?
Finale: ecco spiegato perch non siamo molti. E perch il
nome che vogliono far dimenticare della nostra disciplina era
CULTURA FISICA!
Adesso tutti sapete perch la facciamo. Quanti ORA
hanno voglia di venire a vedere, leggere e capire fino in
fondo la gara pi importante di Bodybuilding Naturale
in Italia? Troverete motivazioni naturali per vivere bene e
a lungo in ottima forma.
Per finire tutti i tecnici,
lamico Jim Charlie, from
USA, responsabile
internazionale del
poligrafo e, ultimi, una
coppia straordinaria:
Sandro e Sauro Cicca-
relli, Presidente NBFI,
Editore e organizzato-
re assoluto dell'evento
e il suo degno
figlio (che anche
il miglior collega
Giudice che si
possa avere).
I ragazzi (non ci sono tutti...) del servizio
d'ordine, bravissimi, con il gruppo di atlete.
Jim Charlie
Sandro Ciccarelli con Gabriello Castellacci
I trofei e le coppe per le premiazioni
Uno speciale ringraziamento anche a Sara
Banchetti, che da maggio in poi ha tenuto
il resoconto delle vostre iscrizioni, svolgendo
un notevole e preciso compito di segreteria.
Prof.Pasquale Cozza, 110 e lode Istituto Superiore
di Educazione Fisica di Bologna (1987) - Allenatore
Regionale Centri Avviamento allo Sport di: Pesistica,
Atletica Leggera, Boxe, Minibasket (1983-85) -
Tecnico e Allenatore di Pesistica e Cultura Fisica
FIPCF (1989) - Docente Educazione Fisica (dal 1988)
Scuole Superiori, Docente Federale Regionale
(1990) e Nazionale FIPCF (2004), Docente Nazionale
e Giudice NBFI, Docente Universit Scienze Motorie Master Alta Specia-
lizzazione, Certicazioni Internazionali e Nazionali: MDNCC, CSSS I & II
level, CCHIP, MAPS, ELYWCIMA UI. Socio e Fondatore DMSA, gi Relatore
DEFAV. Ha Collaborato con Enti e Associazioni Sportive oltrech Atleti
Nazionali ed articolista di prestigiose riviste di settore.
WWW. NBFI . I T WWW. NBFI . I T
178 NATURAL BODYBUILDING
"First place
and winner of
the lightweights
is Mr. Leonardo
Casagrande from
Gubbio, Italy".
Copyrighted 2012 by Sandro Ciccarelli Editore
Sabato 12 Novembre 2011, ore 18.30, teatro dellHigh School Martin Lu-
ther King Jr. di MANHATTAN.
I
sei atleti fnalisti della categoria lightweight sono in linea sul palco dopo le pose
obbligatorie e la routine individuale in attesa di conoscere il verdetto fnale della
giuria. Tra loro ci sono i due portacolori della NBFI: Leonardo Casagrande ed Enzo
Nardino. Comunque vada, mi dico cabalisticamente, sar un successo!
Il chairman Jack LaMenna apre la busta ed inizia a chiamare i nomi dei concorrenti a
partire dal sesto classifcato. Sixth place Mr. Ivor Brown, from Brooklyn, USA.
E vai, fuori uno! Mentre il nostro Gabriele Tampellini, chiamato sul palco dal presidente
Charles Carollo in qualit di delegato della NBFI per premiare la categoria consegna la
medaglia al concorrente eliminato, noi dalla prima fla dellauditorium applaudiamo lo
scampato pericolo.
Fifth place, Mr. Shawn Blassie from Montana. Un forte calore mi risale lun-
go tutto il corpo fno ad inondarmi il viso. Applaudiamo ancora, un po per scaramanzia,
un po per scaricare la tensione.
Fourth place Mr Ulysses Fowler, from Fitchburg, Massachussets suspen-
ce in totale apnea, lo stomaco si chiude. E qui comincio davvero ad esultare a braccia al-
zate con un gesto liberatorio! Due italiani nei primi tre! Fantastico! Chi lavrebbe mai det-
to prima di partire? Il miglior risultato di sempre! Cosa potevamo aspettarci di meglio?
Il chairman prosegue: Third place Mr. Enzo Nardino from San Severo,
Italy!. Lapplauso parte automatico assieme ad un tifo da stadio in puro Italian style.
Enzo riceve la sua meritatissima medaglia dallamico ed accompagnatore Massimo
Sardella. Ringrazia il pubblico che lo applaude calorosamente. un grande! Lo
guardiamo con ammirazione mentre saluta e ringrazia il pubblico. Meritava il
secondo posto!, commentiamo dal parterre.
WWW. NBFI . I T
NATURAL BODYBUILDING 179
In diretta dal parterre
di Kristian Montevecchi
CRONACA DI UN
TRIONFO
Third place
Mr. Enzo Nardino
from San Severo,
Italy!
F
o
t
o
:


N
o
r
b
e
r
t
o

T
o
r
r
i
e
n
t
e
180 NATURAL BODYBUILDING
WWW. NBFI . I T
Copyrighted 2011 by Chelo Publishing, Inc.
Ma non c tempo per rilassarsi e fare altre considerazioni. Leonardo an-
cora l, sul palco. Siamo allepilogo fnale: o vince o secondo. Che emozione
incontenibile. Non riesco pi a stare seduto al mio posto. Travolto dalla frene-
sia mi catapulto a bordo palco per assistere allultimo verdetto.
Leonardo al centro, di fanco al suo avversario, in posa frontale ri-
lassata, con il suo fantastico V-Shape e quelle cosce gonfe e striate che
sembrano scolpite da Michelangelo. And now for the second pla-
ce. Dicono che essere scaramantici porti sfortuna. Nonostante ci in-
crocio le dita di una mano, metto laltra in tasca e chiudo gli occhi. Se-
cond place Mr. Anthony Langevin, from Hamilton, New Jersey.
lapoteosi! Leonardo si porta le mani al viso e guarda il cielo. Ha vinto!
campione del mondo!
Dalla felicit non riesco ad assistere alla premiazione del secondo classi-
fcato. Non importa. Lemozione incontenibile. Esultiamo e ci abbracciamo.
Giordana, amica del cuore, supporter e strepitosa assistente di Leonardo in
tutte le fasi della sua preparazione ha le lacrime agli occhi!
Quando Jack LaMenna
proclama uf cialmente First
place and winner of the
lightweights is Mr. Leonardo
Casagrande from Gubbio,
Italy esplodiamo con un boato
e ci tratteniamo a stento dal salire
sul palco per una pacifca invasio-
ne con la bandiera, mentre dietro
di noi il pubblico dellauditorium
saluta il vincitore con un fragoro-
so applauso e con una meritatis-
sima standing ovation.
RAGAZZI, CHE SERATA
MEMORABILE!
WWW. NBFI . I T
pro
pla
ligh
Cas
Ital
e ci
sul
ne
di
sal
so
sim
RA
M
F
o
t
o
:


N
o
r
b
e
r
t
o

T
o
r
r
i
e
n
t
e
V
clunc
Crcal|nc
Crcal|na c|lrala lcgu--a
c
1r|ncl|lgl|c|na
lcla--|c
Cu-lc Crangc
Incrgq Cnc wcllnc-- : C-ncccul|cal ulr|l|cn www.nrgcnc.|l |nlcnrgcnc.|l
TEL. 041.2372926 FAX 041.5086626
FORMULA ESCLUSIVA
EFFICACIA GARANTITA
Incrgq Cnc - 1hc cw wcllnc-- ulr|l|cn Ccnanq
l| lcwcr l| Vclunc l| lrcnglh lcw Cncc|-lc|nc
182 NATURAL BODYBUILDING
WWW. NBFI . I T
Copyrighted 2012 Sandro Ciccarelli Editore
I FANTA
...alla conquista
di New York
di Gabriele Tampellini
WWW. NBFI . I T
NATURAL BODYBUILDING 183
STICI
Cronaca di quattro supereroi partiti da diverse zone
dItalia, con molta umilt e tante speranze, ma animati da
un comune obiettivo: conquistare il palco internazionale WNBF
ai mondiali di New York... e 2 di loro ce lhanno fatta!
184 NATURAL BODYBUILDING
WWW. NBFI . I T
HISTORIA MAGISTRA VITAE...
la storia maestra di vita.
Come non pensare al passato, quando, allinizio del secolo,
molte persone lasciavano il proprio paese, i propri cari e si imbar-
cavano alla volta degli Stati Uniti dAmerica alla ricerca di fortuna
e di una nuova vita, armati solo di un bagaglio e di tante speranze?
Oppure come non ricordare i pionieri che dalla costa Est degli Sta-
ti Uniti si mossero alla ricerca di oro e fortuna verso la costa Ovest
(nellarea geografca in cui oggi situato il Golden State, cio lo sta-
to della California) attraverso lignoto e mille peripezie per cercare
qualcosa di meglio, forse semplicemente per avere unopportunit
di evolvere e di migliorare.
Ed anche per questo ruolo di paese delle opportunit, conso-
lidato nellimmaginario collettivo, che gli USA, attualmente prima
potenza mondiale, sono noti e famosi.
A torto o a ragione, tra pareri positivi e negativi nonch tra
mille contraddizioni, gli Stati Uniti ancora oggi sono considerati da
molti unoasi dove realizzare sogni, dove ricevere opportunit.
Dove non conta chi sei e da dove vieni, essendo un paese fondato
e cresciuto sullimmigrazione, sulle multi etnie e attualmente sostenuto
anche dalla capacit di adattamento e di integrazione delle persone.
Se si ha in mente qualcosa di buono da realizzare, se ci si di-
stingue e se si in grado di fare la diferenza, lAmerica in grado di
ofrire, senza riserve, unopportunit per realizzarsi e per emergere.
Mai cosa stata pi vera per la NBFI.
Notoriamente sono i cervelli a fuggire dal nostro paese per cer-
care migliori condizioni e per poter ricevere maggiore considerazio-
ne, sia da un punto di vista professionale che economico.
Qualche volta a fuggire, insieme ai cervelli, troviamo anche ec-
cellenti fsici natural... o per meglio dire, non per fuggire necessaria-
mente da qualcosa, ma per realizzare qualcosa di grande nellam-
bito del natural bodybuilding!
Ma partiamo dal principio.
Era l8 di Ottobre 2011 e ormai era passato un anno dallul-
tima edizione del Campionato Italiano NBFI vinta per ben due
volte dal nostro beniamino e campione assoluto Gerardo Di
Gennaro (Dino per gli amici).
Proprio lanno scorso, nel 2010, dopo aver riconfermato il ti-
tolo assoluto, Dino decide di afrontare la dura prova per la scalata
al titolo mondiale WNBF a New York. Insieme allamico Andrea ed
al sottoscritto parte alla volta degli Stati Uniti una piccola rappre-
sentanza della NBFI. Lesperienza stata elettrizzante.
Vuoi perch fosse la prima volta, vuoi per il livello strato-
sferico e lambiente ultra
motivante (chi stato negli
USA sa di cosa parlo) in cui
ci siamo trovati a muoverci,
il mondiale WNBF 2010
stata unavventura che ha
lasciato un segno indelebi-
le nelle nostre menti e nei
nostri cuori ed ha segnato il
passo facendo nascere in molti atleti il desiderio di realizzare il
sogno americano.
Credo che il notevole incremento di atleti presenti questan-
no al nostro Campionato italiano (circa 65 rispetto ai 33 della
scorsa edizione) sia dipeso, oltre che dal desiderio di esprimersi
come atleti natural nella nostra Federazione, anche dal deside-
rio scaturito in loro dopo aver visto e letto lesperienza del no-
stro pro Di Gennaro, di realizzare concretamente lopportunit
di evolvere e di mettersi alla prova su un palco internazionale, al
Campionato europeo oppure direttamente a quello mondiale.
Nel 2010 quindi siamo partiti in tre e tornati a casa con une-
sperienza indimenticabile ed un ottimo sesto posto (anche se
un po penalizzante, a mio modesto parere).
Questanno la NBFI si trovata ad eleggere un nuovo cam-
pione assoluto.
Dino infatti nel 2010 diventato professionista WNBF e non
avrebbe pi partecipato al campionato italiano, ma si sarebbe
presentato direttamente alleuropeo oppure nuovamente al mon-
diale. Ma motivi di lavoro gli hanno impedito di potersi preparare
adeguatamente ad una gara di cos alto livello ed ha deciso di pro-
crastinare la sua partecipazione ai mondiali dellanno successivo.
Si posto quindi un dilemma ed una necessit per la NBFI,
vale a dire eleggere un nuovo campione assoluto.
Il ruolo dellassoluto molto importante
perch determina un canone di riferimento
per gli altri atleti e diventa cos una sorta di
bandiera della federazione.
In grande dif colt, visto lelevatissimo
livello dei vincitori di ogni categoria nel cam-
pionato italiano, ma certi infne di fare una
scelta corretta, la giuria ha decretato come vin-
citore Leonardo Casagrande e gli ha conferito
questo ruolo insigne.
Degno successore di Di Gennaro non solo
per qualit fsiche ma anche per qualit morali
quali umilt, discrezione e pacatezza, unite ad
una determinazione senza uguali. Tali valori
hanno fatto di questatleta il protagonista non
solo del nostro modesto palco italiano, ma an-
che di quello internazionale. Avete capito bene.
Reggetevi forte!
Questanno come da regolamento WNBF stata legittimata
la partecipazione al campionato Europeo e a quello Mondiale di
tutti i primi classifcati per ogni categoria di peso.
Il campionato europeo (novit WNBF nata nel 2010 e realiz-
zata a Brunsbuttel, in Germania, dal presidente GNBF Berend
Breitenstein) tuttavia si trovato ad essere eccessivamente a
ridosso del campionato italiano (dopo una settimana esatta) e
per gli atleti NBFI non si rivelata unopzione percorribile.
Con un mix di sorpresa ed incredulit mi sono trovato ad
accompagnare al campionato mondiale di New York ben 4 atleti!
I primi di ogni categoria, ad eccezione del vincitore dei pesi
medi, hanno deciso di prendervi parte.
Gli atleti in questione sono:
LEONARDO CASAGRANDE
primo classifcato categoria Leggeri e campione
assoluto NBFI 2011
ENZO NARDINO
primo classifcato categoria Mosca
FRANCESCO PALEARI
primo classifcato pesi Medio massimi
ANNALISA GHIROTTI
prima classifcata categoria Fit-body
In veste di rappresentante uf ciale della federazione stato
delegato ancora una volta il sottoscritto, in compagnia stavolta
dellamico e collega Kristian Montevecchi, che oltre ad aver ac-
compagnato e sostenuto la sua compagna Annalisa Ghirotti, ha
svolto un ottimo lavoro di af ancamento nel mio ruolo uf ciale,
dividendo con me il compito di stare accanto agli atleti nei gior-
GERARDO DI GENNARO, SHAUN CLARIDA E JIM CORDOVA
LEONARDO CASAGRANDE,
VINCITORE ASSOLUTO DEL 3
CAMPIONATO ITALIANO NBFI
DI NATURAL BODYBUILDING
F
o
t
o
:


N
o
r
b
e
r
t
o

T
o
r
r
i
e
n
t
e
F
o
t
o
:


O
l
y
m
p
i
a
n

s
WWW. NBFI . I T
NATURAL BODYBUILDING 185
ni pre gara e durante il campionato e di prendere inoltre parte al
meeting uf ciale dei rappresentanti WNBF. Colgo loccasione per
ringraziarlo oltre che per lottimo lavoro svolto, anche per aver
alleggerito, insieme ad Annalisa, la mia trasferta in aereo, mezzo
per me notoriamente ostico!
Io, Annalisa e Kristian siamo partiti la mattina di marted 8
Novembre da Milano.
Siamo arrivati a New York alle 14 circa, ora locale.
Il loro albergo era situato sulla West Side di Manhattan e nel-
la stessa struttura li avrebbero raggiunti Leonardo Casagrande in
compagnia dellamica Giordana Cipolletta, anche lei indiscussa
protagonista di questa emozionante trasferta. Ha infatti aiutato
e sostenuto Leonardo ed Annalisa nella delicata fase pre contest
dallarrivo fno al termine della competizione (ed anche dopo in
realt). Da parte mia alloggiavo nella East Side, dove mercoled sa-
rebbe giunto anche Francesco Paleari, mentre Enzo Nardino ed il
suo seguito (Massimo Sardella, Massimo Caputo ed il pap Renato
Nardino) erano alloggiati nella parte sud, nella lower Manhattan.
Io quindi ho fatto da riferimento in parte a Francesco Paleari
ed in parte a Enzo Nardino, arrivato anche lui di marted, men-
tre Kristian, insieme a Giordana, stato punto di riferimento per
Annalisa Ghirotti e Leonardo Casagrande.
Mercoled mattina mi sono trovato con Enzo Nardino accom-
pagnato da un piccolo staf, il Team Hobby Sport cos composto:
Renato Nardino: pap di Enzo armato di macchina fotografca
professionale con la quale ha scattato moltissime foto den-
tro e fuori lo show.
Massimo Sardella: estroverso e simpaticissimo accompagna-
tore di Enzo, ex campione italiano e grande appassionato di
natural bodybuilding, ha animato il backstage e incoraggiato
i nostri atleti da bordo palco durante le votazioni preliminari
e durante lo show serale.
Massimo Caputo: pi simile ad un neo bodybuilder california-
no che ad un ragazzo del sud Italia di soli 16 anni. Sullonda
della sua vacanza studio in California e conoscendo gi un po
gli States e la lingua locale ha infatti deciso di accompagnare
Enzo che si trovava ad essere invece alla sua prima trasferta
negli USA. Alto, biondo e gi fsicato, potrebbe certamen-
WWW. NBFI . I T
F
o
t
o
:


N
o
r
b
e
r
t
o

T
o
r
r
i
e
n
t
e
186 NATURAL BODYBUILDING
te essere, se lo vorr, una futura promessa per la categoria
Juniores della NBFI. Ti aspettiamo il prossimo Ottobre sul
nostro palco!
Mi sono cos incontrato mercoled 9 alla mattina con Enzo
ed il suo picolo seguito davanti allhotel Pennsylvania. La prima
tappa stata in un piccolo negozietto locale (un Deli dove ven-
dono alimentari e fanno un po di gastronomia) per fare scorta
di petto di pollo ai ferri da portarsi appresso per il resto dei pasti
della giornata.
Uno degli aspetti pi pratici di Manhattan che si pu re-
perire cibo preparato ad hoc praticamente ad ogni ora che pos-
sa tornar utile! E cos ho trascorso la giornata con loro facendo
scoprire un po di quel nuovo ed entusiasmante ambiente in cui si
sarebbero ritrovati a stare per i prossimi giorni. Dopo aver passeg-
giato sulla Madison Avenue abbiamo raggiunto Kristian, Annalisa,
Leonardo e Giordana. Dopo un breve saluto, Annalisa e Leonardo
con i rispettivi accompagnatori si sono ritirati in albergo a riposare.
Annalisa poi, seguendo alla lettera le indicazioni del suo
noto e brillante preparatore, ha passato i giorni antecedenti alla
competizione praticamente sempre sdraiata e con le gambe sol-
levate (anche in aereo, che ci crediate o no!), per evitare laccu-
mulo di liquidi negli arti inferiori.
Enzo invece, lungi dal porsi questo problema, ha percorso
con me e gli altri diversi km, anzi miglia, visitando un bel pezzo
del ponte di Brooklyn e dei posti limitrof.
Intorno alle 17 siamo rientrati in albergo, dato che a lui spet-
tava lultimo workout prima della gara.
Abbiamo trovato una palestra con-
venzionata e anche io, insieme a Massimo
Sardella e a Massimo Caputo, ne abbiamo
approfttato per fare un allenamento leg-
gero. La palestra era piuttosto spartana,
sotterranea, ma ben attrezzata. E ovvia-
mente abbiamo fatto anche qualche foto
goliardica!
Enzo ha fatto un allenamento a cir-
cuito, per scaricare bene le scorte di gli-
cogeno e prepararsi cos alla ricarica di
carboidrati prima della gara. Come po-
tete vedere dalla foto era in forma stre-
pitosa. Volumi, defnizione, vascolarit...
non mancava nulla e tutto ad un livello
molto alto. Ad ogni posa e ad ogni giro
di circuito sembrava si gonfasse con un
compressore, ad ogni posa il muscolo sembrava acquisire volume
e qualit. Nelle pose laterali di petto e di tricipite (a mio parere i
suoi cavalli di battaglia) poi era evidentissimo questo fenomeno.
Da quel momento ho capito che anche atleti americani
del calibro di Jim Cordova e Shaun Clarida (the Giant Killer), che
questanno non hanno partecipato, avrebbero comunque avuto
parecchio flo da torcere!
Il grande Leonardo Casagrande e Annalisa invece hanno op-
tato di rimanere nella west side ad allenarsi in un prestigioso ed
ultra moderno centro della Reebok, che una volta saputo il mo-
tivo della loro presenza a New York, ha regalato loro lingresso. Ci
siamo salutati e ci siamo dati appuntamenti davanti al Pennsyl-
vania il mattino dopo alle 9:30.
Francesco Paleari arrivato il mercoled e Gioved mat-
tina si presentato puntuale allappuntamento. Entro le 10
dovevamo infatti essere tutti presenti allhotel New Yor-
ker per efettuare i test al poligrafo. Hanno efettuato i test in
sequenza Francesco Paleari, Annalisa Ghirotti, Leonardo Casa-
grande ed Enzo Nardino. Ho tradotto per loro i test e tutti hanno
superato la prova senza dif colt (e avrei voluto ben vedere!)
Gioved pomeriggio ho accompagnato Francesco a fare un
po di compere in un negozio di alimentari vicino a dove aveva
af ttato lappartamento, poi nel pomeriggio siamo andati ad al-
lenarci in una New York Sport Club dove abbiamo completato un
allenamento leggero e fatto qualche foto.
Vorrei spendere solo due parole su Francesco Paleari e ap-
profttare oltretutto per ringraziarlo di avermi ospitato nelle 2
sere cruciali per levento, cio il venerd e il sabato.
Non solo, ma mettendo a disposizione il suo inseparabile I-
Phone, ha scattato un sacco di foto e ha tenuto costantemente
aggiornata la pagina NBFI su facebook, praticamente in tempo
reale, corredandola sempre di foto per tutti coloro che con curio-
sit e motivazione ci seguivano dallItalia. Lultimo aggiorna-
mento siamo andati a farlo insieme allAp-
ple store sulla Madison Avenue proprio tra
il pre gara e lo show serale!
Se dovessi descrivere Francesco con un
solo aggettivo, lo defnirei come una per-
sona estremamente coraggiosa. Appuntato
della guardia di fnanza di Taranto, partito
il mercoled da solo (il suo coach non ha po-
tuto seguirlo per le lunghe tempistiche buro-
cratiche relative al rinnovo del passaporto),
lasciando a casa due splendide bimbe, An-
gelica di 4 anni e la piccola Fabiana, di soli
2 anni e mezzo, e una moglie (evidentemente
molto comprensiva) in attesa di un maschietto,
Cristian, che al momento della pubblicazione
di questo articolo star gi indossando i regali
di pap. Parlava con loro pi volte al giorno
tramite skype e le tranquillizzava che tutto
andava bene e che sarebbe tornato presto
con dei bei regali. Per essere la prima volta
negli Stati Uniti, si mosso con una disin-
voltura e con una velocit di adattamento
che aveva dellincredibile. Pensavo fosse
gi stato in America diverse volte.
Ha afrontato una categoria tra le pi
dure della competizione, i pesi Medi: forse le foto non rendo-
no giustizia, ma vi assicuro che il line up sembrava composto da
X-Men. Il livello qualitativo di Francesco era altissimo, migliorato
notevolmente nella separazione di gambe e dorso, suoi punti
deboli, rispetto al precedente campionato italiano.
Ed ha avuto solo 2 giorni (gioved e venerd) per smaltire
fuso orario e viaggio prima del mondiale. Sabato sera, dopo aver
sportivamente accettato un verdetto senzaltro troppo duro,
venuto insieme a noi in un Mac Donalds vicino per rilassarsi un
po. Domenica siamo andati a fare compere per la sua famiglia e
nel primo pomeriggio ripartito alla volta di Taranto. Un viaggio
intercontinentale per stare solo 3 giorni pieni, di cui uno, il Saba-
to, durato dalle 6 di mattina alle 2 di notte.
Per disputare il mondiale.
Come pu tutto ci non essere parafrasato in ferrea volont,
grande determinazione e coraggio?
WWW. NBFI . I T
NATURAL BODYBUILDING 187
RENATO NARDINO, GABRIELE TAMPELLINI,
ENZO NARDINO E MASSIMO CAPUTO
MASSIMO SARDELLA E ENZO NARDINO
FRANCESCO PALEARI AL POLIGRAFO
G
ABRIELE E FRANCESCO
ve
S
a
g
s
m
g
c
c
c
t
188 NATURAL BODYBUILDING
WWW. NBFI . I T
Per noi hai vinto comunque, e lanno prossimo sono certo che
dimostrerai il tuo valore da vero guerriero anche agli altri atleti!
Venerd pomeriggio io e Kristian Montevecchi eravamo con-
vocati al meeting dei rappresentanti delle variefliali WNBF del
resto del mondo.
Dopo aver trascorso la mattinata in relax passeggiando lun-
go la Lexington Avenue mi sono accordato con Kristian per tro-
varci, intorno alle 16, al New Yorker Hotel, dove Annalisa avrebbe
dovuto efettuare la mallatura spray, servizio messo a disposizio-
ne per atleti e atlete che ne avessero avuto necessit.
Purtroppo a causa di una manifestazione (come magari
avrete seguito dai TG in Italia, la situazione a New York era
piuttosto tesa per via degli Indignados) il traffico intorno
rimasto bloccato per diverse ore e Annalisa e Kristian sono ar-
rivati con oltre unora di ritardo allappuntamento.
Stress e fatica che non avrebbero certo giovato alla nostra
Annalisa proprio nel delicato giorno prima della competizione.
Lappuntamento al meeting
era fssato per le 17,30 ed essendo
il traf co completamente fermo io
e Kristian abbiamo percorso molto
velocemente a piedi i 20 isolati che
ci separavano dal luogo prestabili-
to: il Sunset Lounge situato nello
Shef eld Building, sull8th Avenue.
Il posto era veramente sugge-
stivo. Al 57 piano si vedeva pratica-
mente tutta la West Side illuminata
e le strade completamente intasate
di automobili per miglia e miglia.
Al meeting, oltre ai vari rappresentanti federali era presente
tutto lo staf della WNBF: il presidente Cheh Low, Charles Carollo,
il fotografo uf cale Norbert Torriente e collaboratori e articolisti
del calibro del dott. Joe Klemczewski, guru di strategie alimen-
tari e preparatore di atleti natural di altissimo livello, del calibro
di Melissa Kelley.
Facendo due chiacchiere informali prima di cena, il rappre-
sentante della WNBF delle Barbados ci ha consegnato una locan-
dina che pubblicizzava il futuro campionato per professionisti e
amatori che si terr nel 2012 appunto alle Barbados. Per chi fosse
interessato a parteciparvi per una gara/vacanza ce lo faccia sape-
re, lo accompagner volentieri!
Il meeting ha avuto inizio intorno alle 18,30 e Charles Ca-
rollo, dopo averci fatto accomodare e aver preso la parola ci ha
invitato, uno ad uno ad alzarci e a fare una piccola presentazione
nostra e della federazione di cui eravamo in rappresentanza. Ca-
rollo ha proseguito afermando che la federazione solida, che
gli iscritti sono numerosi, che i paesi af liati sono in aumento,
ha rimarcato la solidit e la storicit della WNBF ed ha afermato
che la scelta di un formato elettronico per la rivista NB&F USA sia
un passo verso il futuro e verso una generazione di persone che
fa sempre pi af damento sul supporto digitale che non sulla
lettura su testi cartacei.
Dopo queste considerazioni, Carollo ha consegnato a ciascun
rappresentate WNBF una medaglia, come riconoscimento del
contributo alla crescita della federazione, in continua espansione.
Parlando a nome della NBFI, tra il 2010 e il 2011 in Italia ab-
biamo dato prova di essere ben capaci, e abbiamo attivamente
contribuito, allargando la cerchia degli atleti italiani e portando
negli USA professionisti di altissimo livello.
Ma possiamo fare anche meglio, e di pi. Siamo nati da poco
e abbiamo ampio margine di miglioramento sotto tanti aspetti, ne
sono fermamente convito. Abbiamo certamente causato qualche
disagio di cui ci scusiamo, ma cerchiamo di imparare dai nostri er-
rori e vi chiediamo fducia, seri atleti natural, non vi deluderemo!
La serata proseguita in modo informale e io e Kristian ne
abbiamo approfttato per confrontarci con alcuni colleghi sedu-
ti al nostro tavolo: Francois Gay, della SNBF, Berend Breitenstein
della GNBF e neo fondatore del campionato europeo, Deanne
Murphy della WNBF Australia (portavano solo 24 atleti!) e abbia-
mo scambiato due parole anche con il simpatico e afabile Cheh
Low, presidente della WNBF. Siamo rientrati presto, il mattino
dopo era il grande giorno e avevamo bisogno di forze! Dove-
vamo svegliarci presto, perch lappuntamento era per le 8 alla
Martin Luther King High School .
Per evitare a mia cognata una levataccia alle 6 di Sabato
mattina ho pernottato da Francesco Paleari e ho avuto modo di
osservare in diretta lefetto della sua ricarica del Venerd. Sabato
mattina era impressionante, ma il meglio doveva ancora arrivare.
Mi ha spiegato che, quando ricarica, in realt talmente reattivo
dalla dieta precedente che pu mangiare praticamente ci che
vuole, senza correre il rischio di appannarsi di acqua.
E ve lo confermo.
Lungo il tragitto che ci avrebbe portato al luogo della gara
abbiamo fatto tappa in uno Starbucks Cofee e oltre al caf si
mangiato un enorme muf n ai mirtilli (a dire il vero anche io,
sono pur sempre il consigliere atleti e dovevo immedesimarmi
con loro fno in fondo!
In efetti, anche il grande Leonardo Casagrande ha ricaricato
senza complimenti, a partire gi dal gioved: quando la mattina
dei test al poligrafo lho visto rimpinzarsi di miele sono rimasto
perplesso... il miele ha un indice glicemico altissimo e dal giove-
d al sabato temevo si potesse coprire un po. Quando lho visto
spogliato, nel backstage, ho capito che i miei timori erano total-
mente infondati.
Il posto dove si sarebbe svolta la competizione era lo stesso
dellanno precedente. Sullo sfondo del palco erano state appese
e posizionate le bandiere dei vari paesi af liati alla WNBF. Molto
emozionante!
Gli spazi in cui muoversi nel backstage erano comunque pi
angusti dello scorso anno un unico grande spogliatoio per
tutti: uomini e donne, pro e amatori. Erano circa 230 atleti, fate
voi i conti... caos ovunque dalla mattina alla sera, tracce di mallo
anche nelle scanalature tra le mattonelle.
E la cosa strana che pur trattandosi di un campionato del
mondo non cera nelle strade limitrofe o anche direttamente fuo-
ri dalla scuola, UN SOLO MANIFESTO che pubblicizzasse levento,
o che dicesse che allinterno si stesse svolgendo un campionato
del mondo!
Chi venuto a Figline Valdarno, ha certamente trovato molti
pi cartelloni e messaggi che pubblicizzavano il nostro evento.
Molti pi che a Manhattan...
Come organizzazione, la NBFI non ha avuto veramente nul-
la da invidiare, considerando che si trattava di un campionato
mondiale... e non dico ci per mero patriottismo!
Ma torniamo nel backstage.
Annalisa si stava preparando per il pregara e ad un certo mo-
mento vedo Kristian pallido e agitato che mi guarda con gli occhi
sbarrati e mi dice: La ricarica non ha preso!! Annalisa ancora
vuota! E ora che facciamo? Scrivo al suo preparatore...
A me, onestamente, non sembrava afatto male, tiratissima,
gambe segnate e dorsali bene in evidenza, ma in efetti il giorno
prima, come accennato precedentemente, alcune cose non erano
andate come avrebbero dovuto. Gi la preparazione ad una com-
petizione di questo livello richiede una cura maniacale negli ultimi
dettagli prima della gara e una persona precisa e motivata come
GABRIELE E KRISTIAN
WWW. NBFI . I T WWW WW WW WW WWWWWW. NB NBFI . I T
F
o
t
o
:


N
o
r
b
e
r
t
o

T
o
r
r
i
e
n
t
e
NATURAL BODYBUILDING 189
190 NATURAL BODYBUILDING
WWW. NBFI . I T
Annalisa non lascia nessun dettaglio al caso. Per raggiungere il top della condizione in competi-
zioni di livello cos alto, infatti, niente pu essere lasciato al caso, e anche il pi piccolo dettaglio
pu determinare una diferenza sostanziale anche nel piazzamento.
Tra laltro, Annalisa ha afrontato la competizione presenziando in due diverse categorie:
la PRO MS EXERCISE FIGURE TALL e la PRO MS FIT BODY.
Dopo aver seguito le operazioni di riscaldamento nel backstage, mi sono seduto in platea
per vedere linizio del pregara, cominciato proprio con le PRO MS EXERCISE FIGURE SHORT, in
cui avrebbe preso parte anche Melissa Kelley, atleta di altissimo livello e ospite al campionato
italiano NBFI. Questa gara sarebbe stata per lei lultima, infatti aveva deciso di smettere di ga-
reggiare gi lanno precedente. Ma la tentazione stata troppo forte e ha deciso di prendere
parte ai mondiali anche questanno!
Tra laltro, Annalisa era nella categoria successiva e mentre le atlete venivano chiamate,
Kristian mi ha raggiunto in platea.
Era preoccupato del fatto che Annalisa apparisse troppo vuota rispetto alle previsioni.
Quando la nostra fgure si posizionata con le altre in realt abbiamo dovuto ricrederci.
Appariva in formissima e reggeva tranquillamente il confronto con le altre concorrenti, senza
punti carenti di sorta. Le pose di schiena poi erano il suo punto forte, ricche di dettagli e se-
parazioni evidentissime.
A dire la verit nella stessa categoria di Annalisa cerano atlete ben pi voluminose e fsi-
cate, ma dal mio punto di vista deviavano, non poco, da quelli che avrebbero dovuto essere
dei paramentri di riferimento per le fgure. Avrebbero fatto un fgurone nella categoria wo-
men bodybuilding lightweights.
In cuor mio pensavo che Annalisa sarebbe rientrata tra le prime sei, al massimo tra le
prime 8. Invece, inspiegabilmente, stata relegata al dodicesimo posto (su 15).
Anche nella prova serale in abito da sera ha fatto un fgurone. Tantissimi i complimenti da
parte delle altre atlete, molte delle quali in abiti da sera... non esattamente raf nati, per tagli
e colori... ma i gusti in fatto di fashion negli USA sono nettamente diversi dai nostri. Di questa
cosa ho parlato anche con Melissa e la sua amica Brenda, ex concorrente di fgure amateur. I
criteri di valutazione per le fgure sono troppo diferenti rispetto a quelli che dovrebbe essere
i parametri di riferimento. Per questo ha smesso di gareggiare.
Unatleta fgure, infatti, non ricerca una muscolosit troppo pronunciata, ma femminilit
e bellezza. Invece le atlete che dovrebbero, a rigor di logica, venire penalizzate dalla loro
condizione un po troppo hard si sono piazzate in testa alla classifca. Cos Annalisa, lunica
donna del gruppo dei Fantastici 4, ha rispecchiato perfettamente il ruolo diventando davvero
la donna invisibile.
Ma solo agli occhi della giuria, non certo ai nostri!
Il piazzamento nella categoria ft body non ha sortito un esito pi incoraggiante, con un
quindicesimo posto su 18 concorrenti. Tuttavia resto convinto che, oltre al fatto di meritare un
piazzamento senzaltro migliore, per Annalisa questo sia stato un ottimo banco di prova per
lanno venturo. Se apparir sul palco di sabato come lho vista il luned, dopo essersi messa
tranquilla e aver ricaricato fsicamente e mentalmente, di certo non passer pi inosservata!
Dopo la categoria ft body stato il turno della categoria PRO MEN LIGHTWEIGHTS, dove
hanno gareggiato i nostri Leonardo Casagrande ed Enzo Nardino. Pur non partecipando,
come detto in precedenza, atleti del calibro di Brian Withacre, Jim Cordova o Shaun Clarida, la
categoria era molto agguerrita... dai nostri atleti stavolta!
Non cerano atleti in tutto il line up che avrebbero potuto mettere in seria dif colt Leo-
nardo o Enzo.
La loro condizione era stratosferica e si staccavano in modo abbastanza netto dal gruppo.
Dopo il round della simmetria sono stati posizionati al centro del palco e non sono pi stati
spostati. Lunico piccolo neo stato nel fatto che non comprendevano bene le pose chiamate
dalla giuria e soprattutto quando erano girati di schiena suggerire era molto arduo! Ma gli
amici di Enzo, posizionati insieme a me proprio sotto al palco, si sono dati un gran da fare per
sopperire a questo inconveniente.
Terminato il loro pregara ho chiesto immediatamente alla headjudge americana se ci
avrebbe comportato delle penalit, ma molto gentilmente mi ha risposto di no. In ogni caso,
cari atleti, sappiate che lanno prossimo tutte le sere fno al giorno prima della gara sarete
obbligati a praticare una mezzoretta di pose chiamate in inglese dal sottoscritto! Le hanno
imparate anche gli atleti nipponici, potete, e dovete, farlo anche voi!
Terminato il pregara, andando verso il backstage sono stato letteralmente sommerso di
complimenti e di domande da parte degli atleti e dagli spettatori. Mi hanno chiesto informa-
zioni sulla loro dieta, sul tipo di mallo che hanno utilizzato e fatto i complimenti. La stessa Me-
LEONARDO CASAGRANDE
ANNALISA GHIROTTI
F
o
t
o
:


J
o
r
d
a
n

S
a
m
u
e
l

P
H
h
o
t
o
h
r
a
p
h
y
F
o
t
o
:


J
o
r
d
a
n

S
a
m
u
e
l

P
H
h
o
t
o
h
r
a
p
h
y
WWW. NBFI . I T
NATURAL BODYBUILDING 191
lissa Kelley mi ha detto che secondo lei sarebbero rientrati facilmente tra i primi tre. In realt
anche secondo me, ma per scaramanzia non ho detto nulla. Era assolutamente evidente che
i primi due erano loro. Il secondo classifcato della loro categoria, Anthony Langevin, ottimo
atleta, non era tuttavia al livello di Enzo.
Enzo richiama molto Jim Cordova (atleta a cui si ispira) sia nel fsico che nel modo di
posare. Da rilassato molto qualitativo, ma quando inizia a contrarre la muscolatura esplode
letteralmente: prende volume, si vascolarizza, compaiono striature e dettagli evidenti ovun-
que, sembra che raddoppi di dimensione ad ogni mossa, specialmente in quelle di lato e in
quelle di tre quarti. Sicuro di s domina il palco come se fosse il protagonista della scena,
passaggi di posa spettacolari e puliti.
Ottimo risultato comunque!
Il vero protagonista della scena tuttavia stato il nostro campione assoluto NBFI Leonardo
Casagrande. Tranquillo ragazzo di Gubbio, venuto negli USA per la prima volta e accompagna-
to dallamica di infanzia Giordana Cipolletta, soprannominata scherzosamente la mallatrice
WNBF. Anche lei merita una piccola menzione e molti ringraziamenti per la sua disponibilit,
collaborazione, gentilezza e simpatia! Gran parte delle foto di gruppo, in cui compare tutto lo
staf NBFI le ha scattate lei. Ha fatto moltissime foto al nostro campione nel backstage.
E stata molto vicino a Leonardo nei giorni antecedenti alla gara e si preoccupata di
mallarlo prima della competizione e di dare le ultime rifniture prima dello show serale. Ha
aiutato anche Annalisa nelle operazioni di mallatura, fatto con lei le prove di trucco e accon-
ciatura il venerd e dato aiuto e supporto anche agli altri ragazzi.
Prima che chiamassero i 5 fnalisti, Charles Carollo mi ha chiesto se avessi atleti in questa
categoria. Ho risposto di s e cos mi ha incaricato di premiarli. Gentilmente ha acconsentito an-
che alla richiesta di Massimo, uno degli accompagnatori di Enzo di partecipare alle premiazioni.
Cos quando hanno cominciato a premiare dal quinto al primo, ho temuto un po quando
hanno chiamato Enzo al terzo posto. Temevo una votazione politica e invece latleta ameri-
cano si classifcato secondo e io ho avuto lemozione fortissima di premiare Leonardo quan-
do stato proclamato vincitore!
Dopo averlo giudicato vincitore di categoria e vincitore assoluto al campionato italiano
nel ruolo a me af datomi di capogiuria, vederlo classifcato e giudicato vincitore di categoria
al campionato mondiale stata una soddisfazione ed una gratifcazione immensa.
come se, insieme a lui, avessi vinto anche io, lui come atleta e assoluto protagonista
della scena, io come consigliere e politico della federazione.
Avevo avuto granitica conferma che il nostro operato (il mio e quello ovviamente di tutti
giudici NBFI che rappresentavo) era stato riconosciuto e ritenuto corretto su scala mondiale.
Vi assicuro non di poco conto, almeno per me.
Ma torniamo al nostro Leonardo.
Condizione ottima, simmetrico e proporzionato, ancora pi asciutto rispetto al campio-
nato italiano e ovviamente gambe da freak, suo inarrivabile marchio di fabbrica (e dovevate
vederle di luned, dopo un paio di giorni carb free...) che hanno ipnotizzato la giuria, gli spet-
tatori e lo hanno portato sul tetto del mondo.
Grazie Leonardo, per merito tuo tutti noi siamo nella storia del natural bodybuilding. Per
sempre.
Tutto ci appare ancor pi straordinario se si pensa che la
NBFI esiste solo da tre anni e mezzo e che la tua stata la prima
partecipazione ad un campionato mondiale.
Complimenti anche al tuo coach, che ha svolto un lavoro
straordinario e grazie ancora anche alla carissima Giordana, in-
sieme a te protagonista di questa incredibile avventura e grande
supporter di tutto il gruppo.
Io come vi ho detto ero sul palco, incaricato a premiare i f-
nalisti e con essi il NOSTRO VINCITORE. Ma potete comprendere meglio quello che abbiamo
vissuto dalla cronaca di Kristian Montevecchi che avete letto allinizio dellarticolo: le sensa-
zioni provate, le emozioni e tutto quello che successo a lui e allo staf NBFI... davanti al set!
La ben dettagliata descrizione fatta da Kristian rende perfettamente lidea...
La successiva categoria PRO MEN MIDDLEWEIGHTS ha avuto come nostro eccellente rap-
presentante Francesco Paleari. Preparatissimo, ho avuto modo di verifcare la sua condizione
nei 2 giorni precedenti alla gara ed era veramente ottima. Miglioratissimo sul dorso, ricco di
dettagli e pi asciutto mentre le gambe, oltre al volume, erano molto pi separate e vascola-
rizzate rispetto al campionato italiano.
FRANCESCO PALEARI
ENZO NARDINO
F
o
t
o
:


J
o
r
d
a
n

S
a
m
u
e
l

P
H
h
o
t
o
h
r
a
p
h
y
F
o
t
o
:


J
o
r
d
a
n

S
a
m
u
e
l

P
H
h
o
t
o
h
r
a
p
h
y
Foto: Olympians
Petto, addome e braccia ulteriormente migliorate, dalle foto
fanno impressione. Anche in questo caso complimenti al coach,
in poco meno di un mese riuscito a far migliorare il suo atleta
considerevolmente in vista di una gara e di una categoria molto
dif cili. Forse le foto non rendono giustizia, ma i primi 4 classi-
fcati sembravano davvero usciti da un fumetto della Marvel
Comics. Rapporto vita-spalle, volumi e defnizione da super eroi.
Tuttavia, a mio parere, peccavano un po nella condizione (sotti-
gliezza della pelle, vascolarizzazione e mallatura).
Nessuno brillava per qualit estrema e vascolarizzazione, a
parte Francesco. vero che non aveva i volumi dei primi, per
se vero che a parit di punteggio vince il pi simmetrico e il
round della condizione mira a valorizzare la qualit della pelle,
il tiraggio ed anche la mallatura, faccio fatica a capire il decimo
posto (su una categoria di 14 atleti) di Francesco...
Alcuni atleti, classifcati prima di lui, avevano addirittura il
mallo che colava con il sudore e nascondeva non poco laddome
rendendo il complesso non molto bello a vedersi, con goccioloni
neri che solcavano tutto il corpo. Il secondo classifcato di questa
categoria, Greg Rando, un ottimo atleta completamente cieco.
Era in condizione ottima e pur necessitando di unaccompagna-
trice per muoversi sul palco, ha posato benissimo. Ottimo esem-
pio di uomo oltre che di atleta, i nostri pi sinceri complimenti!
Comunque a ben vedere penso di aver capito che i parame-
tri americani, anche se il regolamento WNBF, in teoria, premia
lassoluta simmetria, qualit e condizione, in realt tendono a
preferire la massa.
Gli Stati Uniti sono grandi, hanno grandi strade, grandi co-
struzioni, grandi formati per gli alimenti (acqua e latte si vendo-
no al gallone, circa 3,8 litri) e sono pi portati a guardare le cose
pi grandi... le fgure pi muscolose anche se un po fuori scala,
latleta pi voluminoso anche se un po meno qualitativo di Fran-
cesco e... le gambe di Leonardo!
Scherzi a parte, Leonardo era veramente completo, compatto
e simmetrico ovunque, ma ritengo che il suo look un po freak del-
le gambe abbia catturato lattenzione della giuria! Meglio per noi!
E proprio su questa falsariga mi permetto di dare un sugge-
rimento a Francesco, ovviamente da valutare attentamente con
il suo coach. Pu sembrare folle, ma non privo di fondamento.
Noi italiani non siamo fatti per la grande distribuzione e per le
cose grandi. Sappiamo fare cose eccezionali, di nicchia e siamo
insuperabili in tutto il mondo. Abbiamo i migliori scienziati (che
per campare devono andare a lavorare allestero ma vabb...) ab-
biamo le migliori automobili, i migliori stilisti, i migliori cuochi
e in questo caso... i migliori atleti, ma da un punto di vista della
qualit.
E su quello dobbiamo puntare.
Puntare al gioco della massa e dei Kg contro gli Stati Uniti
per me deleterio. Loro ne hanno di pi. Vuoi per genetica de-
terminata da mix di razze che hanno selezionato la muscolosit
ed i caratteri strutturali migliori e pi forti, lalimentazione, anzi
iper-alimentazione (avete visto le dosi nei supermarket e al risto-
rante?), integratori con RDA spaziali...
Noi siamo forti sulla qualit.
Ci che mi domandavo come verrebbe considerato un
iper qualitativo come Francesco nei pesi massimi. La categoria
medi una via di mezzo, un po ambigua, la massima espressione
fsica la si trova, a mio parere, nei leggeri o nei massimi. Se Fran-
cesco rientrasse nei massimi, anche per poco, non passerebbe
inosservato perch sarebbe senzaltro lunico ad avere qualit
e svenature di rilievo. E non dovrebbe sofrire per rientrare nei
medi. Sicuramente nessun massimo si presenterebbe asciutto e
vascolarizzato come te, Francesco.
Non passeresti inosservato, come magari successo nei medi.
Se vero che simmetria e condizione totalizzano un punteggio
pi alto della solita muscolosit, potresti avere pi chance nei
massimi, perch proporresti qualcosa di unico e non verresti pe-
nalizzato. Ma a te, e al tuo coach, la scelta per lanno venturo.
Lo spazio tra il pregara e lo show serale stato riempito da
foto nel backstage e dalla preparazione per lapertura dello show
pomeridiano. A tutti i rappresentanti uf ciali delle varie federa-
zioni stata assegnata una bandiera contrassegnante la nazione
di provenienza e ci hanno fatto accomodare, insieme a tutti gli
atleti, dietro al sipario.
Verso le 17, dopo un breve discorso introduttivo tenuto da
Fred DiMenna, il sipario si aperto, mostrando al pubblico in sala
tutte le nazioni partecipanti, con atleti e rappresentanti forniti
di bandiera.
Al termine dello show, intorno alle 22,30, ho salutato Charles
Carollo e Cheh Low e mi sono avviato con i ragazzi verso luscita.
Tutti stanchi e provati, ma emozionati e felici per aver portato
a casa un titolo mondiale (ancora mi emoziona scriverlo!)e un
terzo posto, abbiamo fatto tappa in un Mac Donalds vicino, per
proseguire i festeggiamenti e per far prendere agli atleti una pic-
cola pausa dalla dieta pre agonistica!
Dopo aver aggiornato la pagina di fbook e fatto due paro-
le sulla gara, io e Francesco siamo andati a dormire che erano
192 NATURAL BODYBUILDING
WWW. NBFI . I T
WWW. NBFI . I T
NATURAL BODYBUILDING 193
LA NOSTRA DELEGAZIONE CON CHEH LOW, FONDATORE E PRESIDENTE DELLA WNBF
INCONTRO DI 3 FEDERAZIONI NAZIONALI: BREITENSTEIN (GERMANIA), TAMPELLINI (ITALIA) E BARBADOS
194 NATURAL BODYBUILDING
WWW. NBFI . I T
quasi le due. Il giorno dopo ci siamo al-
zati di buonora, ladrenalina era ancora
in circolo e dopo il solito muf n da
Starbucks siamo andati a fare un po di
compere per la sua famiglia che atten-
deva impaziente il suo rientro. Verso le
due partito alla volta del New Jersey,
lo attendeva infatti limbarco allaero-
porto di Newark verso le 19.
Enzo Nardino, suo pap e i suoi due
amici si sarebbero imbarcati dal JFK intorno
alle 22. Per loro lesperienza americana era giunta
al termine, mentre io, una volta tornato a casa della
mia gentile cognata, ho ripristinato i contatti con Leonardo,
Annalisa, Giordana e Kristian alloggiati nella West Side.
Luned mattina ci siamo trovati davanti al New Yorker Hotel
ed abbiamo trascorso la mattinata ed una buona parte del po-
meriggio passeggiando per la lower Manhattan, cio nella parte
sud, sulla Fifth Avenue, approfttandone per gli ultimi acquisti
prima della partenza.
Mentre Annalisa provava un vestito, io e Kristian abbiamo
avuto riprova che la sua fsionomia era veramente cambiata ra-
dicalmente dal Sabato: muscolatura piena, vene sulladdome e
quasi comparivano striature sulla parte alta della schiena e sul
trapezio, tanto era tirata e sottile la pelle.
Pi tardi abbiamo raggiunto Leonardo e Giordana a Times
Square, dove abbiamo scattato le ultime foto, in un ambiente che
tra luci, grattacieli e persone rendeva latmosfera quasi surreale.
Intorno alle 19 ci siamo mossi per raggiungere mia cognata
Magali e festeggiare tutti insieme lultima sera di permanenza
in un noto ristorante Giapponese situato sulla 2th Avenue, dove
con poco pi di venti dollari abbiamo potuto ordinare dellottimo
sushi a volont, senza limitazioni. Che belle le formule all you can
eat... Beh, ho ragione di credere che per quella sera i gestori abbia-
no chiuso la giornata in perdita!
Per il marted il nostro programma prevedeva la colazione in
una famosa pasticceria sempre sulla 2th Avenue (dove tra torta
di mele e muf n elaboratissimi, abbiamo dato fondo alla nostra
golosit) e due passi in Central Park.
Alle 3 pm infatti dovevamo trovarci in albergo per prendere
il taxi e iniziare a dirigerci verso il JFK dove avremmo dovuto im-
barcarci per lItalia intorno alle 19. In realt poi, per alcuni disguidi,
ci siamo imbarcati alle 2 di notte e siamo arrivati alle nostre case
mercoled sera, anzich di mattina, come avevamo preventivato.
Inutile dire che il rientro al lavoro gioved mattina stato a
dir poco drammatico, ma ladrenalina, limpazienza di visionare
le foto e di scambiarci messaggi ed impressioni ci ha aiutato a
superare la stanchezza del Jet Lag.
Facendo un bilancio di tre anni
di attivit della NBFI possiamo ri-
tenerci ampiamente soddisfatti:
abbiamo costituito un gruppo di
persone appassionate, allineate negli
ideali e negli obiettivi, af atate e unite.
Abbiamo selezionato atleti di altissimo
livello, di cui uno ha vinto il titolo mondiale
WNBF di categoria e un altro ha conquistato un
ottimo terzo posto.
Da parte nostra cercheremo di fare sempre meglio per ren-
dere merito a coloro che veramente si impegnano nella nostra
disciplina e cercano di essere un esempio per tutti, che desidera-
no essere dei riferimenti reali e concreti per le altre persone e per
tutti gli appassionati, che a loro volta possano cos identifcare
nei nostri atleti e nei grandi risultati da essi conseguiti non solo
un grandioso risultato ottenuto attraverso un approccio sano e
realistico allallenamento ed al settore agonistico, ma la conse-
guenza logica di un approccio sano e vincente nei confronti della
vita, a 360 gradi.
Dino, lanno prossimo vogliamo anche TE a New York, per far
sentire ancora pi forte la nostra voce!
To be continued....
Gabriele Tampellini
Gabriele Tampellini, Laureato in Scienze delle Attivit Moto-
rie e Sportive presso lUniversit degli studi di Verona nel 2002.
Ha conseguito inoltre la certifcazione MDNCC con il Dott.
Mauro Di Pasquale, la certifcazione CSSS con Rehan Jalhali,
il CIHP con Nelson Ayotte. Nel
2008 diplomato come maestro
di pesistica e cultura fsica FIPCF-
CONI (III livello) presso la Scuola
dello Sport di Roma. Inoltre do-
cente federale e giudice federale
della NBFI, e docente FIPCF -FIPE
per il comitato regionale veneto.
Collabora attualmente con
il centro Millennium Sport e
Fitness di Brescia in qualit di
personal trainer e consulente
ftness a tempo pieno.
q asi le d e Il giorno dopo ci siamo al
ue
orno
giunta
a casa della
tti L d
d
t
ab
pe
idea
Abbiam
livello, di
WNBF di cate
tti t t
Natural Medicine
Leggere attentamente letichetta. Seguire sempre le
indicazioni per luso. Non superare la dose quotidiana
consigliata. Lallenamento coi pesi costante e una corretta
alimentazione sono essenziali per ottenere i risultati
desiderati nel bodybuilding. In caso di uso prolungato (oltre
le 6-8 settimane) necessario il parere del medico. Non
usare comunque il prodotto in caso di patologia epatica o
renale, in gravidanza e al di sotto dei 14 anni se non dopo
aver consultato il parere del medico. Tenere fuori dalla
portata dei bambini al di sotto dei tre anni di et.
IMPORTATI E DISTRIBUITI DA NATURE FOOD
Chiama per conoscere il punto vendita a te pi vicino!
Negozi - Palestre - Parafarmacie - Erboristerie - Farmacie
Richiedete senza impegno il listino riservato
Tel.0524.575599 naturefood@integratoriamericani.it
Post-Workout Formula. GUARANTEED.
THE MOST POWERFUL