Sei sulla pagina 1di 14

BIOTECNOLOGIE MODERNE

1. Cosa sono le biotecnologie Si possono definire le biotecnologie come ogni tecnologia che utilizza organismi viventi (quali batteri, lieviti, cellule vegetali, cellule animali di organismi semplici o complessi) o loro componenti sub-cellulari purificati (organelli ed enzimi) al fine di ottenere quantit commerciali di prodotti utili, oppure per migliorare le caratteristiche di piante e animali o, ancora, per sviluppare microrganismi utili per specifici usi. Una definizione cos generale includerebbe ovviamente anche tecnologie produttive utilizzate da millenni, quali lagricoltura, la zootecnia, lo sfruttamento delle attivit fermentative dei microrganismi (ad esempio nella produzione di bevande alcoliche, pane e formaggi). Pertanto queste ultime vengono distinte indicandole come biotecnologie tradizionali, per differenziarle da quelle moderne, definite biotecnologie innovative o avanzate. 1.1 Le biotecnologie tradizionali Se intendiamo le biotecnologie nel senso pi lato del termine e cio lutilizzazione di organismi viventi (soprattutto microrganismi), o parti di essi, per produrre sostanze utili alluomo, chiaro che biotecnologia si propone come una parola nuova che descrive una disciplina antica, che risale ai tempi preistorici con la preparazione di bevande e cibi fermentati: in effetti, gi migliaia di anni fa luomo ha iniziato a produrre birra, vino e pane e a trasformare il latte in yogurt e formaggio. Gli antichi Sumeri e Babilonesi producevano birra sin dal 6000 a.C. e gli Egizi cuocevano pani lievitati sin dal 4000 a.C. La birra, in particolare, considerata la bevanda degli dei e degli eroi, stata la pi diffusa in tutti i continenti fin dai tempi pi antichi. I nostri antenati non conoscevano per i meccanismi alla base della trasformazione di prodotti naturali in cibi e bevande (lievitazione, fermentazione, ) e cio che vi fossero coinvolti specifici organismi viventi: necessario infatti attendere qualche millennio prima che Anton van Leeuwenhoek (1632-1723), grazie alla costruzione del primo microscopio, riesca a osservare per primo il mondo microbico e ad ipotizzare che i microrganismi siano alla base di molti processi che avvengono nella produzione di cibi e bevande fermentate. E per Louis Pasteur che, verso la met del secolo scorso, tra il 1857 e il 1876, comprende e descrive eventi usuali, ma misteriosi, quali appunto la preparazione della birra, dimostrando che un organismo unicellulare, il lievito Saccharomyces, a causare la fermentazione. Pasteur individua anche i batteri responsabili della fermentazione lattica e di quella butirrica. Studia inoltre i microbi responsabili della produzione dellaceto nonch quelli responsabili delle alterazioni del vino e della birra. 1.2 Le biotecnologie moderne Con gli studi di Pasteur che, a ragione, pu essere considerato il padre della biotecnologia, vengono cos poste le premesse per i processi fermentativi sfruttati dallattuale bioindustria, che fa uso di colture pure di microrganismi per la produzione di alimenti, bevande e altri prodotti utili. La prima differenza tra le biotecnologie tradizionali e quelle attuali dunque la conoscenza dei meccanismi biologici alla base dei processi osservati. La discriminante, che consente per di parlare a pieno titolo di biotecnologie innovative, rappresentata dalla tecnologia del DNA ricombinante (ingegneria genetica). Pi precisamente, verso la fine degli anni Settanta, si verificano alcune aperture culturali e metodologiche di grande rilievo per cui diventa possibile ai ricercatori operare a livello del DNA e quindi modificare miratamene il genoma di cellule microbiche, in modo da mutarne le caratteristiche produttive e/o funzionali.

2. Lingegneria genetica e i suoi strumenti

Vediamo ora come possiamo sfruttare convenientemente i meccanismi naturali di funzionamento del DNA per scopi utili alluomo, cominciamo cio ad addentrarci nel campo dellingegneria genetica. Con questo termine si intende linsieme delle procedure che portano a modificare il DNA selvatico di un organismo. Per prima cosa vediamo di quali strumenti molecolari si servono i biotecnologi per operare sul DNA degli organismi: si tratta di molecole naturali oppure di prodotti di sintesi, fabbricati per copiando quelli naturali.

2.1 Gli enzimi di restrizione Gli enzimi di restrizione sono proteine naturali che molti batteri possiedono per difendersi dalle infezioni virali. I virus infatti agiscono iniettando il loro genoma nella cellula e inducendola a produrre le proteine virali anzich le proprie e moltissime copie del genoma virale fino a scoppiare. Gli enzimi di restrizione sono delle vere e proprie forbici chimiche capaci di tagliare un filamento di DNA in particolari zone dette siti di restrizione. Si tratta di sequenze nucleotidiche palindrome, cio identiche nei due sensi sui due filamenti complementari.

Il taglio consiste nellidrolisi del legame fosfodiestere tra due nucleotidi adiacenti in modo verticale (blunt end) oppure aframmenti di DNA di diversa origine ponti idrogeno tra le forma di elle (sticky end) che provoca anche la rottura dei basi complementari.
GAATTC CTTAAG GAATTC CTTAAG

e la Ligasi permettono di legare tra loro

G AATTC CTTAA G

G AATTC CTTAA G

GAATTC CTTAAG

Le terminazioni appiccicose (sticky) sono brevi ricombinante nucleotidi che possono Il risultato il DNA sequenze libere di riappaiarsi se trovano una sticky end complementare su un altro filamento.

2.2 Il DNA ricombinante

Questa possibilit viene sfruttata dai biotecnlogi per creare il DNA ricombinante, cio una molecola ibrida ottenuta tagliando con lo stesso enzima di restrizione due DNA di diversa specie e mettendoli poi a contatto in provetta: le sticky end complementari si riaggregano anche se i due DNA non appartengono al filamento originale. Grazie a questa tecnica sono stati inseriti geni estranei allinterno dei plasmdi, piccoli anelli di DNA batterico, costituiti da poche decine di geni e quindi poche centinaia di coppie nucleotidiche. Tali molecole sono presenti in natura nei batteri ed ospitano geni codificanti per enzimi digestivi (fattori nutrizionali) o per enzimi che permettono la resistenza a certi antibiotici (fattori di resistenza). Al loro interno i geni sono organizzati in operoni.

2.3 Il trasferimento di geni Grazie al processo di coniugazione, i batteri portatori di plasmidi possono trasmetterne una copia a batteri che ne sono privi: questo meccanismo fa dei plasmidi di veri e propri vettori genetici. Il plasmide, o meglio uno dei suoi due filamenti, passa da un batterio allaltro attraverso un pilo cio un tunnel citoplasmatico; man mano che entra nel secondo batterio viene duplicato e ricostituito mentre lo stesso avviene nel batterio donatore. Alla fine del processo, il batterio ricevente avr acquisito le stesse propriet del primo. Si tratta di un meccanismo fonte di variabilit genetica nei batteri che altrimenti ne sarebbero privi a causa della loro riproduzione di tipo asessuato.

Anche i virus, per il loro naturale comportamento, sono sfruttati dai biotecnologi per veicolare geni estranei allinterno delle cellule infettate artificialmente. Il DNA estraneo andr ad inserirsi nel genoma della cellula ospite e potr cos essere espresso se la sua allocazione avverr con successo nel punto desiderato ( fase iniziale di un ciclo lisogeno).

3. Le principali applicazioni dellingegneria genetica Vediamo ora quali sono le procedure in cui enzimi di restrizione e vettori genetici possono essere usati dai biotecnologi e per quali fini tali procedure vengono applicate. 4.1 Gli OGM La sigla OGM sta per Organismi Geneticamente Modificati: si tratta di esseri viventi nel cui genoma stato inserito un tratto di DNA estraneo che possa conferire allorganismo una caratteristica nuova utile per luomo. Se parliamo di batteri preferibile per usare la sigla MGM cio Microrganismi geneticamente modificati. Ad esempio in un ceppo di Escherichia coli pu essere inserito il gene umano che codifica per linsulina oppure quello per la somatotropina (ormone della crescita). Esprimendosi insieme ai geni del batterio una volta inserita in un operone, tale sequenza produce in grande quantit e a basso costo un ormone indispensabile ai pazienti diabetici oppure a quelli con problemi di accrescimento. Un plasmide contenente 4 geni artificiali ha conferito al batterio Alcanivorax borkumensis la capacit di digerire, con una velocit 50 volte superiore, gli alcani che contaminano le acque marine , Questo batterio mangia-petrolio diventato un importante strumento per la decontaminazione ( bioremediation). Con la stessa tecnica di trasformazione batterica, oltre agli ormoni si possono produrre proteine adatte alla preparazione di vaccini, enzimi di cui il paziente sia carente come nel caso del fattore VIII della coagulazione in tipo di emofilia. Nellambito del mondo vegetale, lintroduzione di geni estranei viene realizzata attraverso due tecniche alternative: una nota come metodo del cannone e consiste nel far aderire a microsferule doro il DNA che si vuole introdurre, poi si spara ad altissima velocit queste sferule sulle foglie, il DNA cos veicolato allinterno delle cellule che vengono poste in coltura e lasciate moltiplicare . Esse formeranno plantulae dal DNA modificato. Il secondo metodo, di gran lunga il pi diffuso, detto metodo dellAgrobacterium tumefaciens e consiste nel permettere ad un batterio che

infetta normalmente le piante di entrare nelle cellule dopo aver subito una ricombinazione del proprio plasmide con un gene estraneo. Il plasmide sar veicolato nella cellula della pianta o nel DNA del cloroplasto e l potr esprimersi. Le piante vengono rese OGM per conferire loro particolari propriet, soprattutto la resistenza alle larve di parassiti naturali: in tal modo si riduce significativamente la necessit di usare pesticidi.

Anche alcuni animali possono essere modificati geneticamente ma la tecnica molto pi complessa. Consiste nellintrodurre il segmento di DNA estraneo nei pronuclei di un ovulo fecondato prima che avvenga la loro fusione e si formi un vero e proprio zigote. Il gene andr ad inserirsi nel DNA dellospite e verr replicato in tutte le cellule figlie che costituiranno lembrione prima e lorganismo completo poi. Luso che stato fatto a livello sperimentale degli animali OGM vario: cavie con particolari caratteristiche Gene inserito in uno dei pronuclei per studiare malattie umane, di ovuli fertilizzati produzione di farmaci nel latte delle capre o delle mucche OGM, creazione di animali da allevamento Impianto nella femmina capaci di una crescita pi rapida o resistenti a certe malattie, maiali con organi Dal 10 al 30% dei neonati portatore umanizzati da trapiantare del gene estraneo per ridurre i rischi di rigetto; in generale il processo molto costoso e dunque ne stato fatto un uso solo scientifico e molto limitato; il patrimonio genetico speciale di questi animali ne ha reso utile la clonazione proprio perch costa molto produrli.

Animali transgenici

4.2 La terapia genica E possibile modificare geneticamente soltanto le cellule somatiche di un individuo a fini esclusivamente terapeutici, perch le modifiche apportate non possono in alcun caso essere trasferite alla prole, quindi non possono riguardare i gameti. Le cellule malate, contenenti un gene difettoso, vengono estratte dal corpo, coltivate, modificate geneticamente di solito mediante lintroduzione di un virus vettore del gene sano e poi reimpiantate . La procedura funziona al momento solo in cellule di midollo osseo o di cute che sembrano pi facili da coltivare. Nel 1990, ad un bambino americano affetto da SCID ( immunodeficienza combinata severa) mancava , nei linfociti, un enzima detto adenosina-deaminasi indispensabile per il loro funzionamento. Il gene per la A-deaminasi ha una mutazione e il bambino poteva sperare in una guarigione solo se si fosse corretto il difetto genetico, in quanto le cellule trattate avrebbero potuto liberamente moltiplicarsi nellorganismo e creare una popolazione di linfociti funzionanti. Il genoma di un retrovirus che presenta affinit per i linfociti fu attenuato e modificato con laggiunta della sequenza genica codificante per la A-deaminasi; fu incubato con linfociti malati del bambino e poi le cellule furono reiniettate nel bambino. Il gene si inser nel DNA dei linfociti ed inizi a produrre lenzima mancante; la terapia ebbe successo ed apr la strada ad un nuovo campo di ricerca e di applicazione.

4.2 La clonazione Per clonare un animale si usa la seguente procedura: si preleva il nucleo da una cellula adulta e lo si inserisce nel citoplasma di un ovulo enucleato della stessa specie prelevato da una femmina donatrice . Si lascia moltiplicare in provetta fino allo stadio di poche cellule (morula) e poi si impianta nellutero di un animale ospite per la gestazione. In tal modo stata creata la famosa Dolly, seguita poi da molti altri vitelli, maialini, rane ecc. La tecnica di clonazione molto probabilmente potr essere applicata alle cellule umane ma lo scopo non sarebbe certo quello di creare tante copie di un individuo (cosa che al momento non sarebbe di alcun interesse pratico per gli scienziati) bens quello di creare cellule staminali di tipo embrionale recanti il patrimonio genetico del paziente donatore al fine di produrre organi o almeno tessuti per un trapianto autologo in malattie gravemente invalidanti come linfarto del miocardio, il morbo di Parkinson, le lesioni spinali.

3.3 Le cellule staminali Le cellule staminali sono infatti cellule indifferenziate in cui i geni non sono stati ancora silenziati dal processo che le porta a specializzarsi. Le cellule della blastocisti , terzo stadio dello sviluppo embrionale, sono infatti totipotenti cio possono originare qualunque altro tipo di cellula e dare origine addirittura ad un organismo completo; alla terza divisione cellulare gi alcuni geni non si esprimono pi e ne derivano tre gruppi di staminali pluripotenti, cio capaci di formare uno dei tre foglietti embrionali ma non un embrione completo; alla quarta serie di divisioni da ogni foglietto si creano staminali multipotenti capaci di differenziarsi in cellule di alcuni organi ma non di altri ; da

queste si differenziano poi, per silenziamento selettivo di altri gruppi di geni, cellule unipotenti, capaci di originare un solo tipo di cellula. Una coltura di cellule staminali sarebbe in grado dunque di rigenerare nel corpo del paziente un tessuto danneggiato ripristinandone le funzioni. Ci stato realizzato in vitro per alcune linee cellulari come ad esempio quelle della pelle, importantissime per trapiantare tessuto sano autologo nei grandi ustionati, ma ancora sono in fase sperimentale altre applicazioni: quella per rigenerare i neuroni umani danneggiati dal morbo di Parkinson terminer entro 5 anni, quella per ricostituire il midollo spinale lesionato stata sperimentata nel topo con risultati promettenti ed attualmente ancora proibita la sperimentazione sulluomo nei paesi occidentali, ma gi in fase avanzata di applicazione in Thailandia , dove non esistono leggi a regolamentare o bloccare la ricerca sulle staminali. Questo campo di applicazione biotecnologica ha incontrato difficolt di tipo etico in quanto queste cellule vengono ricavate dagli embrioni che sono considerati soggetti di diritto e persone a tutti gli effetti. Discuter pi avanti la mia tesi in proposito. Le staminali adulte esistono nellorganismo ma sono scarse, difficili da selezionare e per loro natura meno plastiche delle staminali embrionali. Al momento non esiste un protocollo sicuro che garantisca la possibilit di riportare allo stato di cellula totipotente qualunque cellula adulta; recentissimi studi riferiscono di un tentativo portato a termine con successo su cellule cardiache ma nulla ancora ufficializzato. 3.4 Lanalisi del DNA : le differenze genetiche Lanalisi del DNA quella procedura che ci consente di individuare le caratteristiche uniche di una specie o di un individuo che sono codificate nel suo DNA. La procedura fondamentale che precede lanalisi il sequenziamento, cio il metodo utilizzato per arrivare a conoscere lesatta sequenza nucleotidica dei singoli geni di una specie. Oggi questa procedura automatizzata e molto veloce, per cui i genetisti conoscono ormai la sequenza completa del DNA di moltissime specie, uomo compreso. Il progetto genoma si concluso nel 2004, in anticipo rispetto a quanto previsto grazie alla collaborazione di molti laboratori di biologia molecolare in tutto il mondo. Qualunque analisi non pu prescindere dalla conoscenza della sequenza nucleotidica dei geni da esaminare, cosa che dunque non loggetto dei test sul DNA ma loro indispensabile premessa; lobiettivo di tali analisi diverso, cio riconoscere le piccole differenze individuali o di specie

Geni a confronto: cyt B di pollo e di mucca


( primi 250 nucleotidi)

nella sequenza nucleotidica di base di un determinato gene.

..produce frammenti diversi

Nellimmagine sopra si vedono i primi 250 nucleotidi (sequenza reale) del gene del citocromo B di pollo e di mucca. Questo gene allocato nel DNA mitocondriale e codifica per quel cit. b coinvolto nella catena di trasporto degli elettroni, fase finale della respirazione cellulare. La sequenza genica pu essere rintracciata mediante un apposito database biologico reso disponibile dagli USA nel sito del NCBI; le sequenze ottenute possono poi essere comparate da un software specifico, questo CLUSTALW. Gli asterischi mettono in evidenza le parti comuni ad entrambi i geni. Cosa accade se sequenze simili ma non identiche vengono sottoposte a taglio con enzimi di restrizione? Si troveranno sul gene le cosiddette RFLP, cio dei polimorfismi nella lunghezza dei frammenti di restrizione. Infatti lo stesso sito di restrizione sar presente in entrambi i geni ma messo in punti diversi. Se sottoponiamo due DNA diversi al taglio con lo stesso enzima di restrizione, esso produrr frammenti di lunghezza diversa in quanto i siti di restrizione si trovano in differenti posizioni sulle due catene. Ora bisogna separare e mettere in evidenza questi frammenti, attraverso una procedura detta elettroforesi. Un supporto di gel-agarosio contiene dei pozzetti nei quali viene inserito il DNA frammentato; il gel viene appoggiato in un bagno di soluzione elettrolitica tampone a cui viene applicata una differenza di potenziale; poich il DNA in soluzione presenta cariche negative dovute ai gruppi fosfato, i frammenti vengono attratti verso il polo positivo della camera

che possono essere separati per elettroforesi

elettroforetica. Si assiste dunque ad una migrazione dei frammenti lungo il gel che chiamiamo corsa elettroforetica. I frammenti pi lunghi e pesanti si muovono pi lentamente di quelli corti e leggeri, quindi si avr, a fine corsa, una separazione dei frammenti in base alla lunghezza e quindi al peso. I pi leggeri sono quelli in basso, verso il polo +

Corsa del DNA su gel di agarosio

Terminata la corsa i frammenti risulteranno ancora invisibili a occhio nudo. Per evidenziarne la posizione sul gel vanno trattati con etidio bromuro, una sostanza che si insinua nella doppia elica e che reagisce agli UV rimandando una luminescenza arancione. Tenendo il gel a bagno in bromuro di etidio e poi illuminandolo con luce UV si vedranno le bande arancioni corrispondenti ai frammenti di DNA. Se si analizzano pi campioni di DNA da specie diverse, ciascuno in un pozzetto, potremo apprezzare le differenze di specie osservando la diversa disposizione delle bande sul gel.

3.5 Applicazioni dellanalisi del DNA Vediamo qualche applicazione del DNA fingerprinting tra quelle pi note: IDENTIFICAZIONE DI SPECIE (per frodi alimentari oppure in diagnostica fitopatologica)
BANDE PRODOTTE DALL'ENZIMA DI RESTRIZIONE Hae III SUINO BOVINO POLLO TACCHINO ____________________________________________________________________ ____ 285 bp ____ 159 bp ____ 153 bp ____ 132 bp ____ 126 bp ____ 126 bp ____ 103 bp ____ 74 b ____ 74 bp ____ 74 bp ____ 74 bp ____ 56 bp ________________________ ____________________________________________ BANDE PRODOTTE DALL'ENZIMA DI RESTRIZIONE Alu I SUINO BOVINO POLLO TACCHINO ____________________________________________________________________ ____ 359 bp ____ 359 bp ____ 244 bp ____ 190 bp ____ 169 bp ____ 115 bp ____________________________________________________________________

Un esempio pratico laccertamento della provenienza di una carne per prevenire o accertare eventuali frodi alimentari. Qui vediamo come si presentano le bande del cit b di quattro animali diversi se trattato con due enzimi di restrizione. Spesso infatti un solo enzima non d risultati: vedete come Alu non consente di differenziare pollo da tacchino; il trattamento con HaeIII risolutivo.

DIAGNOSI DI PREDISPOSIZIONE A MALATTIE (la presenza di oncogeni anche se non ancora attivi o di particolari sequenze comuni in tutti i casi di alcune patologie pu essere rilevata ) PROCEDURE FORENSI (accertamento di paternit o parentela, identificazione di una vittima o di un colpevole) Un ultimo esempio: qui vediamo il DNA di due fratelli gemelli (notate la coincidenza assoluta delle bande) confrontato con quello dei genitori: le bande dei figli coincidono o con quelle paterne o con quelle materne. Negli esseri umani ci sono molti geni e alcuni presentano maggiore variabilit di altri; in medicina forense bisogna effettuare il fingerprinting su 8 loci genici contemporaneamente per avere la certezza dellidentificazione. La probabilit di coincidenza contemporanea di tutti e 8 i loci inferiore a 1 su 6 miliardi, quanti sono gli esseri umani stimati sulla Terra Questo conferisce allidentificazione una certezza quasi assoluta: infatti lunica possibilit di errore lesistenza di un gemello monovulare.

Ge

3.6 Isolamento e amplificazione di geni: la tecnica PCR Cerchiamo ora di capire quale parte del DNA di un individuo opportuno sottoporre ad analisi e come poter disporre di un quantitativo di campione sufficiente per effettuarla. Quali geni analizzare? Ogni volta che desideriamo sottoporre ad analisi il DNA estratto da un vivente, noi abbiamo a disposizione lintero il 99% dei genoma dellindividuo; se pensiamo che un essere umano condivide con uno scimpanz il 99% dei geni, geni con gli comprendiamo come sia importante non la porzione di DNA che abbiamo in comune, ma quella piccola scimpanz porzione che ci differenzia come specie (e, nellambito della nostra specie, quelle piccole porzioni che ci differenziano come individui). Dobbiamo perci ricorrere ad un metodo che ci permetta di isolare ed analizzare solo qualche gene, tra i tanti presenti nel campione. Il metodo pi efficace, preciso e veloce per selezionare ed amplificare un gene la tecnica detta PCR, cio Reazione a Catena della Polimerasi, inventata nel 1989 da un allora giovane ricercatore americano, Kary Mullis, che letteralmente mise il turbo alla ricerca genetica e che gli valse il Nobel.
Condividiamo

I primers

Si tratta di avviare artificialmente la duplicazione del DNA in un punto ben preciso del genoma, selezionato grazie ai cosiddetti PRIMERS, cio brevi sequenze di ribonucleotidi, da 10 a 20, indispensabili normalmente a qualunque DNA-polimerasi per cominciare a copiare. Ce ne devono essere due per ogni segmento della doppia elica e vengono indicati con le sigle FW e RW cio avanti (forward) e indietro (rewind) . La loro specificit molto alta, nel senso che ogni gene ha una sequenza iniziale

di nucleotidi che la stessa solo per i primi tre, poi cambia da gene a gene. Conoscendo i primi venti nucleotidi di ogni gene si possono sintetizzare in un laboratorio chimico i primers artificiali e si pu utilizzarli per una duplicazione artificiale.

La mastermix
Il DNA del campione, una volta estratto e purificato, viene miscelato con le molecole necessarie ad una normale duplicazione, cio i deossiribonucleotidi, una speciale polimerasi estratta dal batterio Termophilus aquaticus detta Taqpolimerasi capace di resistere ad alte temperature, i primers specifici per la sequenza da isolare e amplificare.

Deossiribonucleotidi Taq- polimerasi Primers DNA campione

La reazione a catena prevede una prima fase di apertura della doppia elica o FASE di DENATURAZIONE che si ottiene portando la miscela a 95C. In seguito quando la temperature Scende a 65C si ha la FASE di ANNEALING, cio appaiamento dei primers alle sequenze complementari che si trovano allinizio del gene da amplificare. La temperatura viene di nuovo aumentata a 72C, valore ottimale per la funzionalit della taq-pol la quale comincia a copiare; la FASE di ESTENSIONE , che permette di raddoppiare le molecole del gene inizialmente presenti. Ogni ciclo di denaturazione+annealing+estensione viene ripetuto decine di volte da una apparecchiatura apposita detta termociclatore. Nel giro di 2 ore vengono prodotte oltre un milione di copie del gene selezionato dai primers, quantit sufficiente per effettuare le successive analisi.

3.7 Il sequenziamento Il sequenziamento la procedura utilizzata per scoprire la sequenza nucleotidica di un tratto di DNA. Si serve della tecnica PCR e di un particolare tipo di nucleotidi miscelati a quelli normali: sono detti didesossiribonucleotidi ( DdNTP), a causa della mancanza di un ulteriore atomo di ossigeno rispetto ai desossiribonucleotidi normalmente utilizzati per duplicare il DNA. Questa loro caratteristica, ottenuta artificialmente, impedisce la prosecuzione della duplicazione qualora il DdNTP si leghi ad una base complementare. Poich durante la PCR i nucleotidi si appaiano casualmente, capiter che ogni tanto un DdNTP si leghi al filamento in duplicazione interrompendo la reazione e formando un frammento incompleto. Se, ad esempio, un filamento di DNA possiede una Timina in posizione 2,3,8,9, 19 e 20 in una lunghezza totale di 23 nucleotidi allora in presenza dei DdNTP-A si former una miscela di frammenti interrotti rispettivamente lunghi 2,3,8,9, 19 e 20 nucleotidi. Questi avranno diverso peso molecolare e quindi, sottoposti ad elettroforesi, si separeranno creando 6 bande . Con laiuto di un tracciante per i pesi molecolari potremo individuarne la lunghezza e capire quindi in quali posizioni si trovavano i nucleotidi T nel DNA di partenza. Loperazione viene ripetuta per le altre basi azotate e, integrando la lettura dei tracciati elettroforetica, si arriva a decodificare la sequenza nucleotidica completa. Esempio:
Eppendorf 1 DdNTP-T 21pb-A 16pb-A 11pb-A 10pb-A 1pb-A Eppendorf 2 DdNTP-A 20pb-T 19pb-T 9pb-T 8pb-T 2pb-T Eppendorf 3 DdNTP-C 23pb-G 15pb-G 14pb-G 5pb-G 4pb-G Eppendorf 4 DdNTP-G 22pb-C 18pb-C 17pb-C 12pb-C 13pb-C 7pb-C 6pb-C

Migrazione elettroforetica : Eppendorf 1 DdNTP-T A Eppendorf 2 DdNTP-A T Eppendorf 3 DdNTP-C G --Eppendorf 4 DdNTP-G C ------------------------------------------

--A T G C La lettura del tracciato elettroforetico si fa in ordine crescente nella posizione delle bande: il risultato nel nostro esempio sar : ATTGGCCTTAACCGGACCTTACG

Paia di basi 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1

Di solito la tecnica buona per segmenti di 600-700 pb; frammenti si possono sequenziale interi genomi.

sovrapponendo le letture di molti

3.8 La tecnica delle sonde molecolari ( Southern blotting) Per isolare una certa sequenza nucleotidica in un campione di DNA, ovvero per evidenziarne la presenza, si possono utilizzare dei frammenti di DNA o di RNA complementari alla sequenza cercata detti sonde ( DNA probes); la metodologia consiste nel - tagliare il DNA in esame ( si usa il DNA intero estratto dalle cellule) con un enzima di restrizione ottenendo cos numerosi frammenti - sottoporli ad elettroforesi su gel di agarosio - immergere il gel in una soluzione alcalina ( NaOH diluito) per circa 15 minuti per denaturare il DNA ed ottenere filamenti singoli - coprire il gel con un foglio di nitrocellulosa e una pila di fogli assorbenti; per capillarit il liquido risalir nel foglio trascinando con s i filamenti di DNA che occuperanno quindi esattamente la stessa posizione che avevano nel gel - immergere poi il foglio con il DNA in una soluzione contenente la sonda marcata (di solito resa radioattiva con P32 sia terminalmente che in continuo) ed attendere che la sequenza cercata ibridizzi con la sonda - effettuare un lavaggio per sciacquare via le sonde non ibridate - sottoporre il foglio ad autoradiografia: la lastra impressionata porter le impronte delle bande marcate Questa tecnica pu anche essere applicata alla ricerca di particolari RNA fra tutti quelli espressi da una cellula; in questo caso chiamata Northern blotting ed alla base della tecnica dei microarray. Gli utilizzi del Southern blotting sono molteplici: analisi forensi ( richiede per molto DNA), diagnosi genetiche, riconoscimento di particolari infestanti in patologia agraria o di OGM negli alimenti. 4. Rischi e paure : obiezioni alle biotecnologie moderne Propagazione di DNA ibrido La possibilit di propagare del DNA ibrido, contenente cio combinazioni di geni provenienti da specie molto diverse, ha fatto nascere la paura che microrganismi portatori di nuove e insolite caratteristiche possano sfuggire inavvertitamente dal laboratorio e rappresentare un pericolo per le popolazioni umane, animali o vegetali. Parimenti, il rilascio deliberato di microrganismi ingegnerizzati nellambiente sia per applicazioni agricole, sia per opere di disinquinamento ambientale (bioremediation) ha fatto sorgere preoccupazioni circa il controllo di una loro replicazione e diffusione indesiderata nellambiente. In particolare ci si preoccupa di alcuni possibili eventi: 1. la possibile propagazione dei transgenici e cio dei nuovi caratteri ad altri organismi, con alterazione degli equilibri ambientali , prevalenza e diffusione della specie OGM sulle variet naturali con perdita della biodiversit. 2. La diffusione eccessiva di monocolture ingegnerizzate che creerebbe una dipendenza economica dei contadini dalle ditte produttrici delle sementi le quali detengono i diritti derivanti dalla creazione di un prodotto che in natura non esiste. 3. Leventuale pericolosit di alimenti di origine vegetale (cereali, ortaggi, frutti) e animale (carne, latte, uova) ottenuti rispettivamente da piante o animali transgenici. Per limitare , se non completamente eliminare questi rischi, ricercatori hanno sviluppato sia idonei sistemi diagnostici per il monitoraggio dei microrganismi e degli organismi geneticamente modificati (GMO/GEM) sia nuovi sistemi per tenere sottocontrollo la replicazione/diffusione nellambiente dei GMO e norme a cui ogni laboratorio deve attenersi per eliminare i rischi paventati: a) accurata sterilizzazione disinfezione degli strumenti e del personale b) naturale indebolimento dei ceppi batterici ingegnerizzati

c) inserimento di geni suicidi in appositi operoni che restano repressi solo nelle colture di laboratorio ma si attiverebbero appena il batterio dovesse sfuggire nellambiente d) inserimento di geni marcatori (ad esempio il gene LUX per la bioluminescenza) che consentono unimmediata identificazione della loro presenza nellambiente) e) creazione di sonde molecolari capaci di diagnosticare leventuale presenza di DNA contaminante in un ambiente naturale o in un organismo normale. f) il timore di una trasformazione indesiderata dall OGM a batteri naturali (ad esempio molto temuta la trasmissione dellantibiotico-resistenza) stato del tutto smentito dalle numerose prove sperimentali: in molte ricerche pubblicate negli ultimi dieci anni mai si verificato un simile evento in quanto il DNA passato attraverso il tratto digerente di un animale o delluomo viene completamente distrutto e non mai stato trasmesso ai batteri intestinali. g) La presenza di proteine ricombinanti in un alimento non pu avere effetti biologici sulluomo se le sue cellule non possiedono il corrispondente recettore che ne permetta lingresso: spesso si tratta di proteine espresse nellOGM che non hanno alcuna corrispondenza con le proteine umane dunque verrebbero esclusivamente digerite senza neppure passare la barriera di membrana delle cellule intestinali. h) La presenza di unetichetta che informa il consumatore salvaguarda il diritto di scegliere ed orienta automaticamente il mercato e i produttori verso la coltivazione naturale o quella ingegnerizzata.

Manipolazione di DNA umano Alcune delle questioni bioetiche attualmente pi dibattute, che possono avere attinenza con gli argomenti da noi trattati, riguardano luso delle staminali embrionali e la diagnosi genetica preimpianto, gli esperimenti di clonazione effettuati sulla specie umana. Esporre le proprie opinioni, dubbi e discuterne in classe.